Metabolically engineered cells for the production of pinosylvin
09725743 · 2017-08-08
Assignee
Inventors
- Michael Katz (Malmo, SE)
- Jochen Forster (Copenhagen, DK)
- Helga David (Copenhagen, DK)
- Hans Peter Schmidt (Holte, DK)
- Malin Sendelius (Lund, SE)
- Sara Peterson Bjorn (Lyngby, DK)
- Thomas Thomasen Durhuus (Copenhagen, DK)
Cpc classification
C12N9/1029
CHEMISTRY; METALLURGY
International classification
C12N9/00
CHEMISTRY; METALLURGY
Abstract
A genetically engineered micro-organism having an operative metabolic pathway producing cinnamoyl-CoA and producing pinosylvin therefrom by the action of a stilbene synthase is used for pinosylvin production. Said cinnamic acid may be formed from L-phenylalanine by a L-phenylalanine ammonia lyase (PAL) which is one accepting phenylalanine as a substrate and producing cinammic acid therefrom, preferably such that if the PAL also accepts tyrosine as a substrate and forms coumaric acid therefrom, the ratio Km(phenylalanine)/Km(tyrosine) for said PAL is less than 1:1 and if said micro-organism produces a cinammate-4 -hydroxylase enzyme (C4H), the ratio K.sub.cat(PAL)/K.sub.cat(C4H) is at least 2:1.
Claims
1. A recombinant microorganism comprising an operative metabolic pathway for producing pinosylvin, wherein said recombinant microorganism comprises: a) a L-phenylalanine ammonia lyase (PAL) from Arabidopsis thaliana, for converting L-phenylalanine to cinnamic acid; b) a 4-coumarate-CoA ligase from Arabidopsis thaliana, for converting cinnamic acid to cinnamoyl-CoA; and c) a stilbene synthase from Vitis vinifera, for converting cinnamoyl-CoA to pinosylvin, wherein said microorganism is Saccharomyces cerevisiae and produces at least 1.5 mg/g pinosylvin on a dry weight basis.
2. The recombinant microorganism of claim 1, comprising: a) one or more copies of a heterologous nucleotide sequence encoding said L-phenylalanine ammonia lyase operatively linked with an expression signal not natively linked with the said L-phenylalanine ammonia lyase, b) one or more copies of a heterologous nucleotide sequence encoding said 4-coumarate CoA-ligase operatively linked with an expression signal not natively linked with said 4-coumarate CoA-ligase, and c) one or more copies of a heterologous nucleotide sequence encoding said stilbene synthase operatively linked with an expression signal not natively linked with said stilbene synthase.
3. A method for producing pinosylvin comprising culturing said recombinant microorganism of claim 1 under conditions to produce said pinosylvin.
4. The recombinant microorganism of claim 1, wherein said L-phenylalanine ammonia lyase is expressed in said recombinant microorganism from a nucleotide sequence encoding the amino acid sequence of SEQ ID NO: 2.
5. The recombinant microorganism of claim 1, wherein said 4-coumarate-CoA ligase is expressed in said recombinant microorganism from a nucleotide sequence encoding the amino acid sequence of SEQ ID NO: 4.
6. The recombinant microorganism of claim 1, wherein said stilbene synthase is expressed in said recombinant microorganism from a nucleotide sequence encoding the amino acid sequence of SEQ ID NO: 10.
7. The recombinant micro-organism of claim 2, wherein said expression signal not natively linked with said L-phenylalanine ammonia lyase, said 4-coumarate CoA-ligase or said stilbene synthase is a constitutive promoter.
8. The recombinant microorganism of claim 1, wherein said recombinant microorganism produces pinosylvin directly from glucose, without addition of cinnamic acid, cinnamoyl-CoA or any other downstream cinnamic acid derivative.
9. The recombinant microorganism of claim 1, wherein said recombinant microorganism produces at least 1.8 mg/g pinosylvin on a dry weight basis
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1) To assist in the ready understanding of the above description of the invention reference has been made to the accompanying drawings in which:
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10) The invention will be further described and illustrated by the following non-limiting examples.
EXAMPLES
Example 1
(11) Isolation of Genes Encoding PAL, 4CL, RES and VST1
(12) Phenylalanine ammonia lyase (PAL2) (Cochrane et al., 2004; SEQ ID NO: 1, 2), 4-coumarate:CoenzymeA ligase (4CL1) (Hamberger and Hahlbrock 2004; Ehlting et al., 1999; SEQ ID NO: 3, 4) were isolated via PCR from A. thaliana cDNA (BioCat, Heidelberg, Germany) using the primers in table 1. PAL2 and 4CL1 were chosen amongst several A. thaliana homologues due to favourable kinetic parameters towards cinnamic acid and cinnamoyl-CoA, respectively (Cochrane et al., 2004; Hamberger and Hahlbrock 2004; Ehlting et al., 1999).
(13) The coding sequence of resveratrol synthase (RES) from Rhubarb, Rheum tataricum (Samappito et al., 2003; SEQ ID NO: 5, 6) was codon optimized for expression in S. cerevisiae using an online service backtranslation tool, yielding sequence SEQ ID NO: 7, 8. Oligos for the synthetic gene assembly were constructed at MWG Biotech and the synthetic gene was assembled by PCR using a slightly modified method protocol of from Martin et al. (2003) described below.
(14) TABLE-US-00001 TABLE 1 Primers and restriction sites for the amplification of genes Primer for amplification of gene* Restriction Restriction (Restriction sites are underlined) Gene site: primer site: vector 5′-CGGAATTCTCATGGATCAAATCGAAGCAATGTT PAL2 EcoR1 EcoR1 5′-CGACTAGTTTAGCAAATCGGAATCGGAGC PAL2 Spe1 Spe1 5′-GCTCTAGACCT ATGGCGCCACAAGAACAAGCAGTTT 4CL1 Xba1 Spe1 5′-GCGGATCCCCT TCACAATCCATTTGCTAGTTT TGCC 4CL1 BamH1 BglII 5′-CC GGATCCAAATGGCCCCAGAAGAGAGCAGG RES BamH1 BamH1 5′-CG CTCGAGTTAAGTGATCAATGGAACCGAAGACAG RES Xho1 Xho1 *SEQ ID Nos 11-16
(15) Primers from MWG for the assembly of the synthetic gene were dissolved in milliQ-water to a concentration of 100 pmole/μl. An aliquot of 5 μl of each primer was combined in a totalmix and then diluted 10-fold with milliQ water. The gene was assembled via PCR using 5 μl diluted totalmix per 50 μl as template for fusion DNA polymerase (Finnzymes). The PCR programme was as follows: Initial 98° C. for 30 s., and then 30 cycles with 98° C. for 10 s., 40° C. for 1 min. and 72° C. at 1 min./1000 basepairs, and a final 72° C. for 5 min. From the resulting PCR reaction, 20 μl was purified on 1% agarose gel. The result was a PCR smear and the regions around the wanted size were cut out from agarose gel and purified using the QiaQuick Gel Extraction Kit (Qiagen). A final PCR with the outer primers in table 1 rendered the required RES gene. Point mutations were corrected using the Quickchange site directed mutagenesis II kit (Stratagene, La Jolla, Calif.).
(16) The VST1 gene encoding Vitis vinifera (grapevine) resveratrol synthase (Hain et al., 1993) was synthesized by GenScript Corporation (Piscataway, N.J.). The amino acid sequence (SEQ ID NO: 10) was used as template to generate a synthetic gene codon optimized for expression in S. cerevisiae (SEQ ID NO: 9). The synthetic VST1 gene was delivered inserted in E. coli pUC57 vector flanked by BamH1 and Xho1 restriction sites. The synthetic gene was purified from the pUC57 vector by BamH1/Xho1 restriction and purified from agarose gel using the QiaQuick Gel Extraction Kit (Qiagen).
Example 2
(17) Construction of a Yeast Vector for Expression of PAL2
(18) The gene encoding PAL2, isolated as described in example 1, was reamplified by PCR using forward- and reverse primers, with 5′ overhangs containing EcoR1 and Spe1 restriction sites (table 1). The amplified PAL2 PCR product was digested with EcoR1/Spe1 and ligated into EcoR1/Spe1 digested pESC-URA vector (Stratagene), resulting in vector pESC-URA-PAL2. The sequence of the gene was verified by sequencing of two different clones.
Example 3
(19) Construction of a Yeast Vector for Expression of 4CL1
(20) The gene encoding 4CL1 was isolated as described in example 1. The amplified 4CL1 PCR-product was digested with Xba1/BamH1 and ligated into Spe1/BglII digested pESC-TRP vector (Stratagene), resulting in vector pESC-TRP-4CL1. Two different clones of pESC-TRP-4CL1 were sequenced to verify the sequence of the cloned gene.
Example 4
(21) Construction of a Yeast Vector for Expression of 4CL1 and RES
(22) The gene encoding RES was isolated as described in example 1. The amplified synthetic RES gene was digested with BamH1/Xho1 and ligated into BamH1/Xho1 digested pESC-TRP-4CL1 (example 3). The resulting plasmid, pESC-TRP-4CL1-RES, contained the genes encoding 4CL1 and RES under the control of the divergent GAL1/GAL10 promoter. The sequence of the gene encoding VST1 was verified by sequencing of two different clones of pESC-TRP-4CL1-VST1.
Example 5
(23) Construction of a Yeast Vector for Expression of 4CL1 and VST1
(24) The gene encoding VST1 was isolated as described in example 1. The purified and digested VST1 gene was ligated into BamH1/Xho1 digested pESC-TRP-4CL1 (example 3). The resulting plasmid, pESC-TRP-4CL1-VST1, contained the genes encoding 4CL1 and VST1 under the control of the divergent GAL1/GAL10 promoter. The sequence of the gene encoding VST1 was verified by sequencing of two different clones of pESC-TRP-4CL1-VST1.
Example 6
(25) Expression of the Pathway to Pinosylvin in the Yeast S. cerevisiae Using PAL2, 4CL1 and RES
(26) Yeast strains containing the appropriate genetic markers were transformed with the vectors described in examples 2, 3 and 4, separately or in combination. The transformation of the yeast cell was conducted in accordance with methods known in the art by using competent cells, an alternative being for instance, electroporation (see, e.g., Sambrook et al., 1989). Transformants were selected on medium lacking uracil and/or tryptophan and streak purified on the same medium.
(27) S. cerevisiae strain FS01267 (MATa trp1 ura3) was co-transformed with pESC-URA-PAL2 (example 2) and pESC-TRP-4CL1-RES (example 4), and the transformed strain was named FSSC-PAL24CL1RES.
Example 7
(28) Expression of the Pathway to Pinosylvin in the Yeast S. cerevisiae Using PAL2, 4CL1 and VST1
(29) Yeast strains containing the appropriate genetic markers were transformed with the vectors described in examples 2, 3 and 5, separately or in combination. The transformation of the yeast cell was conducted in accordance with methods known in the art, for instance, by using competent cells or by electroporation (see, e.g., Sambrook et al., 1989). Transformants were selected on medium lacking uracil and/or tryptophan and streak purified on the same medium.
(30) S. cerevisiae strain FS01267 (MATa trp1 ura3) was co-transformed with pESC-URA-PAL2 (example 2) and pESC-TRP-4CL1-VST1 (example 5), and the transformed strain was named FSSC-PAL24CL1VST1.
Example 8
(31) Fermentation with Recombinant Yeast Strains in Shake Flasks
(32) The recombinant yeast strains were inoculated from agar plates with a sterile inoculation loop and grown in 100 ml defined mineral medium (Verduyn et al., 1992) that contained vitamins, trace elements, 5 g/l glucose 95 g/l galactose. The 500 ml stoppered shake flasks were incubated for three days at 30° C. and 160 rpm.
Example 9
(33) a) Extraction of Pinosylvin
(34) Cells were harvested by centrifugation 5000 g for 5 minutes. An aliquot of 50 ml of supernatant was extracted once with 20 ml ethyl acetate. The ethyl acetate was freeze dried and the dry product redissolved in 0.7 ml methanol and filtered into HPLC vials.
(35) The cell pellet from 100 ml medium was dissolved in 2 ml water and divided into 3 fastprep tubes and broken with glass beads. The crude extracts from the three tubes were pooled into 10 ml 100% methanol in a 50 ml sartorius tube and extracted on a rotary chamber for 48 hours in a dark cold room at 4° C. After 48 hours the cell debris was removed via centrifugation for 5 min. at 5000 g and the methanol was removed by freeze-drying overnight. The dry residue was redissolved in 0.7 ml methanol and filtered into HPLC vials.
(36) b) Analysis of Pinosylvin
(37) HPLC
(38) For quantitative analysis of cinnamic acid, coumaric acid, and pinosylvin, samples were subjected to separation by high-performance liquid chromatography (HPLC) Agilent Series 1100 system (Hewlett Packard) prior to uv-diode-array detection at λ=306 nm. A Phenomenex (Torrance, Calif., USA) Luna 3 micrometer C18 (100×2.00 mm) column was used at 40° C. As mobile phase a gradient of acetonitrile and milliq water (both containing 50 ppm trifluoroacetic acid) was used at a flow of 0.4 ml/min. The gradient profile was linear from 15 acetonitrile to 100% acetonitrile over 20 min. The elution time was approximately 8.8-8.9 minutes for trans-pinosylvin. Pure pinosylvin standard (>95% pure) was purchased from ArboNova (Turku, Finland).
(39) LC-MS
(40) Samples and standards were analyzed by negative electrospray LC-MS on a Waters (Micromass, Manchester, UK) LCT™ time-of-flight mass spectrometer with a Lockspray™ reference probe coupled to an Agilent 1100 HPLC system (Agilent Technologies Walbron, Germany). The separations were done on a 50 mm×2 mm ID Luna C-18 (II) column (Phenomenex, USA) fitted with a 4 mm×2 mm ID SecurityGuard™ pre-column (Phenomenex, USA) using a water-acetonitrile gradient at 0.3 ml/minute. Both eluents contained 20 mM formic acid. The solvent composition was changed from 15% acetonitrile at injection to 100% acetonitrile in 20 minutes, which was maintained for 5 minutes before the gradient was returned to starting conditions. A 3 μl sample was injected in all cases and the column was maintained at 40° C. All chemicals were of HPLC grade and dissolved into Milli-Q™ water.
(41) UV spectra were collected from 200-700 nm at 2 spectra per second with a resolution of 4 nm.
(42) The mass spectrometer was tuned for maximum sensitivity in negative electrospray mode to a resolution better than 5500 FWH on a solution of leucine enkphaline (0.5 μg/ml in 50% acetonitril with 0.5% formic acid). Said solution was also used as mass reference in the Lockspray™ in negative ESI at 15 μl/minute. The instrument was calibrated in negative ESI on a carboxylated-PEG mixture in 50% acetonitril. In both cases the calibration had a residual error less than 2 mDa on at least 25 calibration ions. The run conditions were selected for minimal in-source fragmentation.
(43) Mass spectra were collected from 100 to 900 Da/e at a rate of 0.4 seconds per spectrum with 0.1 second interscan time. A reference spectrum was collected from the Lockmass™ probe every 3.sup.rd seconds and 10 reference spectra were averaged for internal mass correction.
(44) Narrow ion traces were extracted using +/−25 mDa around the protonated or deprotonated mass of the expected metabolites.
(45) Results
(46) Strains FSSC-PAL24CL1RES and FSSC-PAL24CL1VST1, were cultivated on 100 g/l galactose as described in example 8, and analyzed for their content of pinosylvin. Additionally, a control strain FSSC-control was included that contained the empty vectors only. The HPLC-analysis showed that strains FSSC-PAL24CL1VST1 and FSSC-PAL24CL1RES contained a component with a retention time of 8.8-9.0 min. that was identical to trans-pinosylvin (
(47) The results, therefore, demonstrated the presence of an active phenyl-propanoid pathway in S. cerevisiae that led to in vivo production of trans-pinosylvin. The production of pinosylvin can most likely be improved by cultivating the strains under well-defined growth conditions in batch- and continuous cultures, and/or optimizing the expression/activities of the individual enzymes
Example 10
(48) a) Construction of a Bacterial Vector for Expression of PAL2 in Escherichia coli
(49) The plasmids that were used in the following examples contained one or more marker genes to allow the microorganism that harbour them to be selected from those which do not. The selection system is based upon dominant markers, e.g. resistance against ampicillin and kanamycin. In addition, the plasmids contained promoter- and terminator sequences that allowed the expression of the recombinant genes. Furthermore, the plasmids contained suitable unique restriction sites to facilitate the cloning of DNA fragments and subsequent identification of recombinants. In this example the plasmids contained either the ampicillin resistance gene, designated as pET16b (Novagen), or the kanamycin resistance gene, designated as pET26b (Novagen).
(50) The gene encoding PAL2, isolated as described in example 1, was reamplified by PCR from the plasmid pESC-URA-PAL2 (example 2), using forward- and reverse primers, with 5′ overhangs containing suitable restriction sites. The introduction of said restriction sites at the 5′ and 3′ ends of the gene allowed ligation of the restricted PCR product into a digested pET16B vector that contained the T7 promoter. The resulting plasmid, pET16B-PAL2, contained the gene encoding PAL2 under the control of the T7 promoter.
(51) b) Construction of a Bacterial Vector for Expression of 4CL1 and VST1 in Escherichia coli
(52) The gene encoding 4CL1, isolated as described in example 1, was reamplified by PCR from the plasmid pESC-URA-4CL1-VST1 (example 5), using forward- and reverse primers, with 5′ overhangs containing suitable restriction sites. The introduction of said restriction sites at the 5′ and 3′ ends of the gene allowed ligation of the restricted PCR product into a digested pET26B vector. The resulting plasmid, pET26B-4CL1, contained the gene encoding for 4CL1 under the control of the T7 promoter from Lactobacillus lactis.
(53) The gene encoding VST1, isolated as described in example 1, was reamplified by PCR from the plasmid pESC-URA-4CL1-VST1 (example 5) using forward- and reverse primers, with 5′ overhangs containing suitable restriction sites. The introduction of said restriction sites at the 5′ and 3′ ends of the gene allowed ligation of the restricted PCR product into a digested pET16B vector. The resulting plasmid, pET16B-VST1, contained the gene encoding VST1 under the control of the T7 promoter. The T7 promoter and the gene encoding VST1 were reamplified as one fragment by PCR from the plasmid pET16B-VST1 using forward and reverse primers, with 5′ overhangs containing suitable restriction sites. The introduction of said restriction sites at the 5′ and 3′ ends of the DNA fragment allowed ligation of the restricted PCR product into the digested plasmid pET26B-4CL1. The resulting plasmid, pET26B-4CL1-VST1, contained the genes encoding 4CL1 and VST1, each under the control of their individual T7 promoter. The sequence of the genes encoding 4CL1 and VST1 was verified by sequencing of two different clones of pET26B-4CL1-VST1.
(54) c) Expression of the Pathway to Pinosylvin in Escherichia coli
(55) Escherichia coli strains were transformed with the vectors described in (a) and (b), separately or in combination. The transformation of the bacterial cell was conducted in accordance with methods known in the art by using competent cells, an alternative being for instance, electroporation (see, e.g., Sambrook et al., 1989). Transformants were selected on medium containing the antibiotics ampicillin and kanamycin and streak purified on the same medium.
(56) Escherichia coli strain BL21 (DE3) was transformed separately with the vector pET16B-PAL2 (a), yielding the strain FSEC-PAL2; and with pET26B-4CL1-VST1 (b), yielding strain FSEC-4CL1VST1. In addition, Escherichia coli strain BL21 (DE3) was co-transformed with pET16B-PAL2 (a) and pET26B-4CL1-VST1 (n), and the transformed strain was named FSEC-PAL24CL1VST1.
(57) d) Fermentation with Recombinant Escherichia coli Strains in Fermentors
(58) The recombinant yeast strains can be grown in fermentors operated as batch, fed-batch or chemostat cultures. In this instance fermentation was in shake flasks.
(59) Pre-cultures of Escherichia coli BL21 (DE3) were grown in glass tubes at 160 rpm and 37° C. in 7 ml of LB medium containing 100 μg/ml ampicillin and 60 μg/ml kanamycin. Exponentially growing precultures were used for inoculation of 500 ml baffled shake flasks that contains 200 ml LB medium supplemented with 50 g/l glucose, 5 g/l K.sub.2HPO.sub.4, 80 μg/ml ampicillin and 50 μg/ml kanamycin, which are incubated at 160 rpm and 37° C. After 5 hours, isopropyl β-thiogalactopyranoside (IPTG) was added at a final concentration of 1 mM, as an inducer of the T7 promoter that is in front of each of the three genes PAL2, 4CL1 and VST1. After an incubation period of 48 hours at 37° C., the cells were harvested and subjected to extraction procedures and analysed for the presence of produced pinosylvin.
(60) e) Extraction and Analysis of Pinosylvin in Escherichia coli
(61) Extraction and analysis were performed using the methods as described in example 9. Results of HPLC conducted on the extracted materials from the fermentation using the engineered strain described and a control strain containing empty plasmids are shown in
Example 11
(62) a) Construction of a Bacterial Vector for Expression of PAL2 in Lactococcus lactis
(63) The plasmid pSH71 and derivatives thereof, which is used in the following examples, is a bifunctional shuttle vector with multiple origins of replication from Escherichia coli and Lactococcus lactis. With that, the host range specificity traverses Escherichia coli and other species of lactic acid bacteria. Though transformations in Lactococcus lactis usually proceed without problems, putative difficult transformations in other species of lactic acid bacteria can, therefore, be overcome by using Escherichia coli as an intermediate host for the construction of recombinant plasmids. The plasmid contains one or more marker genes to allow the microorganism that harbour them to be selected from those which do not. The selection system that is used for Lactococcus lactis is based upon dominant markers, e.g. resistance against erythromycin and chloramphenicol, but systems based upon genes involved in carbohydrate metabolism, peptidases and food grade markers, have also been described. In addition, the plasmid contains promoter- and terminator sequences that allow the expression of the recombinant genes. Suitable promoters are taken from genes of Lactococcus lactis e.g. lacA. Furthermore, the plasmid contains suitable unique restriction sites to facilitate the cloning of DNA fragments and subsequent identification of recombinants.
(64) In the procedures below the plasmid contains either the erythromycine resistance gene, designated as pSH71-ERY.sup.r, or the chloramphenicol resistance gene, designated as pSH71-CM.sup.r.
(65) The gene encoding PAL2, isolated as described in example 1, is reamplified by PCR from the plasmid pESC-URA-PAL2 (example 2), using forward- and reverse primers, with 5′ overhangs containing suitable restriction sites. The introduction of said restriction sites at the 5′ and 3′ ends of the gene allows ligation of the restricted PCR product into a digested pSH71-ERY.sup.r vector that contains the lacA promoter from Lactococcus lactis. The resulting plasmid, pSH71-ERY.sup.r-PAL2, contains the gene encoding PAL2 under the control of the lacA promoter from Lactococcus lactis. The sequence of the gene encoding PAL2 is verified by sequencing of two different clones of pSH71-ERY.sup.r-PAL2.
(66) b) Construction of a Bacterial Vector for Expression of 4CL1 and VST1 in Lactococcus lactis
(67) The gene encoding 4CL1, isolated as described in example 1, is reamplified by PCR from the plasmid pESC-TRP-4CL1-VST1 (example 5), using forward- and reverse primers, with 5′ overhangs containing suitable restriction sites. The introduction of said restriction sites at the 5′ and 3′ ends of the gene allows ligation of the restricted PCR product into a digested pSH71-CM.sup.r vector. The resulting plasmid, pSH71-CM.sup.r-4CL1, contains the gene encoding for 4CL1 under the control of the lacA promoter from Lactobacillus lactis. The gene encoding VST1, isolated as described in example 1, is reamplified by PCR from the plasmid pESC-TRP-4CL1-VST1 (example 5) using forward- and reverse primers, with 5′ overhangs containing suitable restriction sites. The introduction of said restriction sites at the 5′ and 3′ ends of the gene allows ligation of the restricted PCR product into a digested pSH71-ERY.sup.r vector. The resulting plasmid, pSH71-ERY.sup.r-VST1, contains the gene encoding VST1 under the control of the lacA promoter from Lactococcus lactis. The lacA promoter and the gene encoding VST1 are reamplified as one fragment by PCR from the plasmid pSH71-ERY.sup.r-VST1 using forward- and reverse primers, with 5′ overhangs containing suitable restriction sites. The introduction of said restriction sites at the 5′ and 3′ ends of the DNA fragment allows ligation of the restricted PCR product into the digested plasmid pSH71-CM.sup.r-4CL1. The resulting plasmid, pSH71-CM.sup.r-4CL1-VST1, contains the genes encoding 4CL1 and VST1 that are each under the control of their individual lacA promoter. The sequence of the genes encoding 4CL1 and VST1 is verified by sequencing of two different clones of pSH71-CM.sup.r-4CL1-VST1.
(68) c) Expression of the Pathway to Pinosylvin in Lactococcus lactis
(69) Lactococcus lactis strains are transformed with the vectors described in examples 16 and 17, separately or in combination. The transformation of the bacterial cell is conducted in accordance with methods known in the art, for instance, by using competent cells or by electroporation (see, e.g., Sambrook et al., 1989). Transformants are selected on medium containing the antibiotics erythromycin and chloramphenicol and streak purified on the same medium.
(70) Lactococcus lactis strain MG1363 is transformed separately with the vector pSH71-ERY.sup.r-PAL2 (example 16), yielding the strain FSLL-PAL2 In addition, Lactococcus lactis strain MG1363 is co-transformed with pSH71-ERY.sup.r-PAL2 (example 16) and pSH71-CM.sup.r-4CL1-VST1 (example 17), and the transformed strain is named FSLL-PAL24CL1VST1.
(71) d) Fermentation with Recombinant Lactococcus lactis Strains in Fermentors
(72) The recombinant lactococcus strains can be grown in fermenters operated as batch, fed-batch or chemostat cultures.
(73) Batch and Fed-Batch Cultivations
(74) The microorganism is grown in a baffled bioreactor with a working volume of 1.5 liters under anaerobic, aerobic or microaerobic conditions. All cultures are incubated at 30° C., at 350 rpm. A constant pH of 6.6 is maintained by automatic addition of 10 M KOH. Cells are grown on lactose in defined MS10 medium supplemented with the following components to allow growth under aerobic conditions: MnSO.sub.4 (1.25×10.sup.−5 g/l), thiamine (1 mg/l), and DL-6,8-thioctic acid (2.5 mg/l). The lactose concentration is, for example 50 g/l. The bioreactors are inoculated with cells from precultures grown at 30° C. in shake flasks on the medium described above buffered with threefold-higher concentrations of K.sub.2HPO.sub.4 and KH.sub.2PO.sub.4. Anaerobic conditions are ensured by flushing the medium with N.sub.2 (99.998% pure) prior to inoculation and by maintaining a constant flow of 50 ml/min of N.sub.2 through the headspace of the bioreactor during cultivation. The bioreactors used for microaerobic and aerobic cultivation are equipped with polarographic oxygen sensors that are calibrated with air (DOT, 100%) and N.sub.2 (DOT, 0%). Aerobic conditions are obtained by sparging the bioreactor with air at a rate of 1 vvm to ensure that the DOT is more than 80%. During microaerobic experiments the DOT is kept constant 5% by sparging the reactor with gas composed of a mixture of N.sub.2 and atmospheric air, at a rate of 0.25 vvm.
(75) Chemostat Cultures
(76) In chemostat cultures the cells can be grown in, for example, 1-L working-volume Applikon laboratory fermentors at 30° C. and 350 rpm. The dilution rate (D) can be set at different values, e.g. at 0.050 h.sup.−1, 0.10 h.sup.−1, 0.15 h.sup.−1, or 0.20 h.sup.−1. The pH is kept constant, e.g at 6.6, by automatic addition of 5 M KOH, using the growth medium described above, supplemented with antifoam (50 μl/l). The concentration of lactose can be set at different values, e.g. is 3.0 g/l 6.0 g/l, 12.0 g/l, 15.0 g/l or 18.0 g/l. The bioreactor is inoculated to an initial biomass concentration of 1 mg/l and the feed pump is turned on at the end of the exponential growth phase.
(77) An anaerobic steady state is obtained by introducing 50 ml/min of N.sub.2 (99.998% pure) into the headspace of the bioreactor. Different anoxic steady states can obtained by sparging the reactor with 250 ml/min of gas composed of N.sub.2 (99.998% pure) and atmospheric air at various ratios. The oxygen electrode is calibrated by sparging the bioreactor with air (100% DOT) and with N.sub.2 (0% DOT).
(78) For all conditions, the gas is sterile filtered before being introduced into the bioreactor. The off gas is led through a condenser cooled to lower than −8° C. and analyzed for its volumetric content of CO.sub.2 and O.sub.2 by means of an acoustic gas analyser.
(79) Cultivations are considered to be in steady state after at least 5 residence times, and if the concentrations of biomass and fermentation end products remain unchanged (less than 5% relative deviation) over the last two residence times.
(80) e) Extraction and Analysis of Pinosylvin in Lactococcus lactis
(81) Extraction and analysis is performed using the methods as described in example 9.
Example 12
(82) a) Construction of a Fungal Vector for Expression of PAL2 In Species Belonging to the Genus Aspergillus
(83) The plasmid that is used in this example, is derived from pARp1 that contains the AMA1 initiating replication sequence from Aspergillus nidulans, which also sustains autonomous plasmid replication in A. niger and A. oryzae (Gems et al., 1991). Moreover, the plasmid is a shuttle vector, containing the replication sequence of Escherichia coli, and the inherent difficult transformations in Aspergillus niger and Aspergillus oryzae can therefore overcome by using Escherichia coli as an intermediate host for the construction of recombinant plasmids. The plasmid contains one or more marker genes to allow the microorganism that harbour them to be selected from those which do not. The selection system can be either based upon dominant markers e.g. resistance against hygromycin B, phleomycin and bleomycin, or heterologous markers e.g amino acids and the pyrG gene. In addition the plasmid contains promoter- and terminator sequences that allow the expression of the recombinant genes. Suitable promoters are taken from genes of Aspergillus nidulans e.g. alcA, glaA, amy, niaD, and gpdA. Furthermore, the plasmid contains suitable unique restriction sites to facilitate the cloning of DNA fragments and subsequent identification of recombinants.
(84) The plasmid contains the strong constitutive gpdA-promoter and auxotropic markers, all originating from Aspergillus nidulans; the plasmid containing the gene methG that is involved in methionine biosynthesis, is designated as pAMA1-MET; the plasmid containing the gene hisA that is involved in histidine biosynthesis, is designated as pAMA1-HIS.
(85) The gene encoding for PAL2, isolated as described in example 1, is reamplified by PCR from the plasmid pESC-URA-PAL2 (example 2) using forward- and reverse primers, with 5′ overhangs containing suitable restriction sites. The introduction of said restriction sites at the 5′ and 3′ ends of the gene allows ligation of the restricted PCR product into a digested pAMA1-MET vector. The resulting plasmid, pAMA1-MET-PAL2, contains the gene encoding for PAL2 under the control of the gpdA promoter from Aspergillus nidulans. The sequence of the gene encoding for PAL2 is verified by sequencing of two different clones of pAMA1-MET-PAL2.
(86) b) Construction of a Fungal Vector for Expression of 4CL1 and VST1 in Species Belonging to the Genus Aspergillus
(87) The gene encoding 4CL1, isolated as described in example 1, is reamplified by PCR from the plasmid pESC-TRP-4CL1-VST1 (example 5), using forward- and reverse primers, with 5′ overhangs containing suitable restriction sites. The introduction of said restriction sites at the 5′ and 3′ ends of the gene allows ligation of the restricted PCR product into a digested pAMA1-HIS vector that contains the gpdA promoter from Aspergillus nidulans. The resulting plasmid, pAMA1-HIS-4CL1 contains the gene encoding 4CL1 under the control of the gpdA promoter from Aspergillus nidulans. The gene encoding VST1, isolated as described in example 1, is reamplified by PCR from the plasmid pESC-TRP-4CL1-VST1 (example 5) using forward- and reverse primers, with 5′ overhangs containing suitable restriction sites. The introduction of said restriction sites at the 5′ and 3′ ends of the gene allows ligation of the restricted PCR product into a digested pAMA1-MET vector to yield pAMA1-MET-VST1. The gpdA promoter and the gene encoding VST1 are reamplified as one fragment by PCR from the plasmid pAMA1-MET-VST1 using forward- and reverse primers, with 5′ overhangs containing suitable restriction sites. The introduction of said restriction sites at the 5′ and 3′ ends of the DNA fragment allows ligation of the restricted PCR product into the digested plasmid pAMA1-HIS-4CL1. The resulting plasmid, pAMA1-HIS-4CL1-VST1, contains the genes encoding 4CL1 and VST1 that are each under the control of an individual pgdA promoter from Aspergillus nidulans. The sequence of the genes encoding 4CL1 and VST1 is verified by sequencing of two different clones of pAMA1-HIS-4CL1-VST1.
(88) c) Expression of the Pathway to Pinosylvin in Aspergillus niger
(89) Aspergillus niger strains are transformed with the vectors described in (a) and (b), separately or in combination. The transformation of the fungal cell is conducted in accordance with methods known in the art, for instance, by electroporation or by conjugation (see, e.g., Sambrook et al., 1989). Transformants are selected on minimal medium lacking methionine and/or histidine.
(90) A strain of Aspergilus niger that is auxotrophic for histidine and methionine, for instance, strain FGSC A919, is transformed separately with the vector pAMA1-MET-PAL2 (a), yielding the strain FSAN-PAL2 and with pAMA1-HIS-4CL1-VST1 (b), yielding strain FSAN-4CL1VST1. In addition, Aspergillus niger strain FGSC A919 is co-transformed with pAMA1-MET-PAL2 (a) and pAMA1-HIS-4CL1-VST1 (b), and the transformed strain is named FSAN-PAL24CL1VST1.
Example 13
(91) Expression of the Pathway to Pinosylvin in Aspergillus oryzae
(92) A strain of Aspergillus oryzae that contains a native set of genes encoding for PAL2 and 4CL1 (Seshime et al., 2005) and that is auxotrophic for methionine, is transformed with the vector pAMA1-MET-VST1 (example 29), yielding the strain FSAO-VST1. The transformation of the fungal cell is conducted in accordance with methods known in the art, for instance, by electroporation or by conjugation (see, e.g., Sambrook et al., 1989). Transformants are selected on minimal medium lacking methionine.
Example 14
(93) Fermentation with Recombinant Strains of Aspergillus niger and Aspergillus oryzae in Fermentors
(94) The recombinant Aspergillus strains can be grown in fermenters operated as batch, fed-batch or chemostat cultures.
(95) Batch and Fed-Batch Cultivations
(96) The microorganism is grown in a baffled bioreactor with a working volume of 1.5 liters under aerobic conditions. All cultures are incubated at 30° C., at 500 rpm. A constant pH of 6.0 is maintained by automatic addition of 10 M KOH, and aerobic conditions are obtained by sparging the bioreactor with air at a rate of 1 vvm to ensure that the DOT is more than 80%. Cells are grown on glucose in defined medium consisting of the following components to allow growth in batch cultivations: 7.3 g/l (NH.sub.4).sub.2SO.sub.4, 1.5 g/l KH.sub.2PO.sub.4, 1.0 g/l MgSO.sub.4.7H.sub.2O, 1.0 g/l NaCl, 0.1 g/l CaCl.sub.2.2H.sub.2O, 0.1 ml/l Sigma antifoam, 7.2 mg/l ZnSO.sub.4.7H.sub.2O, 1.3 mg/l CuSO.sub.4.5H.sub.2O, 0.3 mg/l NiCl.sub.2.6H.sub.2O, 3.5 mg/l MnCl.sub.2.4H.sub.2O and 6.9 mg/l FeSO.sub.4.7H.sub.2O. The glucose concentration is, for example, 10-20-, 30-, 40- or 50 g/l. To allow growth in fed-batch cultivations the medium is composed of: 7.3 g/l (NH.sub.4).sub.2SO.sub.4, 4.0 g/l KH.sub.2PO.sub.4, 1.9 g/l MgSO.sub.4.7H.sub.2O, 1.3 g/l NaCl, 0.10 g/l CaCl.sub.2.2H.sub.2O, 0.1 ml/l Sigma antifoam, 7.2 mg/l ZnSO.sub.4.7H.sub.2O, 1.3 mg/l CuSO.sub.4.5H.sub.2O, 0.3 mg/l NiCl.sub.2.6H.sub.2O, 3.5 mg/l MnCl.sub.2.4H.sub.2O and 6.9 mg/l FeSO.sub.4.H.sub.2O in the batch phase. The reactor is then fed with, for example, 285 g/kg glucose and 42 g/kg (NH.sub.4).sub.2SO.sub.4.
(97) Free mycelium from a pre-batch is used for inoculating the batch- and fed-batch cultures. A spore concentration of 2.10.sup.9 spores/l is used for inoculation of the pre-batch culture at pH 2.5. Spores are obtained by propagation of freeze-dried spores onto 29 g rice to which the following components are added: 6 ml 15 g/l sucrose, 2.3 g/l (NH.sub.4).sub.2SO.sub.4, 1.0 g/l KH.sub.2PO.sub.4, 0.5 g/l MgSO.sub.4.7H.sub.2O, 0.50 g/l NaCl, 14.3 mg/l ZnSO.sub.4.7H.sub.2O, 2.5 mg/CuSO.sub.4.5H.sub.2O, 0.50 mg/l NiCl.sub.2.6H.sub.2O, and 13.8 mg/l FeSO.sub.4.7H.sub.2O. The spores are propagated at 30° C. for 7-14 days to yield a black layer of spores on the rice grains and are harvested by adding 100 ml of 0.1% Tween 20 in sterile water. For all conditions, the gas is sterile filtered before being introduced into the bioreactor. The off gas is led through a condenser cooled to lower than −8° C. and analyzed for its volumetric content of CO.sub.2 and O.sub.2 by means of an acoustic gas analyser.
(98) Chemostat Cultures
(99) In chemostat cultures the cells can be grown in, for example, 1.5-L working-volume Biostat B laboratory fermentors at 30° C. and 500 rpm. A constant pH of 6.0 is maintained by automatic addition of 10 M KOH, and aerobic conditions are obtained by sparging the bioreactor with air at a rate of 1 vvm to ensure that the DOT is more than 80%. The dilution rate (D) can be set at different values, e.g. at 0.050 h.sup.−1, 0.10 h.sup.−1, 0.15 h.sup.−1, or 0.20 h.sup.−1. The pH is kept constant, e.g at 6.6, by automatic addition of 10 M KOH, using a minimal growth medium with the following components: 2.5 g/l (NH.sub.4).sub.2SO.sub.4, 0.75 g/l KH.sub.2PO.sub.4, 1.0 g/l MgSO.sub.4.7H.sub.2O, 1.0 g/l NaCl, 0.1 g/l CaCl.sub.2.2H.sub.2O, 0.1 ml/l Sigma antifoam, 7.2 mg/l ZnSO.sub.4.7H.sub.2O, 1.3 mg/l CuSO.sub.4.5H.sub.2O, 0.3 mg/l NiCl.sub.2.6H.sub.2O, 3.5 mg/l MnCl.sub.2.4H.sub.2O and 6.9 mg/l FeSO.sub.4.7H.sub.2O. The concentration of glucose can be set at different values, e.g. is 3.0 g/l 6.0 g/l, 12.0 g/l, 15.0 g/l or 18.0 g/l. The bioreactor is inoculated with free mycelium from a pre-batch culture as described above, and the feed pump is turned on at the end of the exponential growth phase.
(100) For all conditions, the gas is sterile filtered before being introduced into the bioreactor. The off gas is led through a condenser cooled to lower than −8° C. and analyzed for its volumetric content of CO.sub.2 and O.sub.2 by means of an acoustic gas analyser.
(101) Cultivations are considered to be in steady state after at least 5 residence times, and if the concentrations of biomass glucose and composition of the off-gas remain unchanged (less than 5% relative deviation) over the last two residence times.
Example 15
(102) Extraction and Analysis of Pinosylvin in Aspergillus niger and Aspergillus oryzae
(103) Extraction and analysis is performed using the methods as described in Example 9.
Example 16
(104) Pinosylvin Production in Aspergillus nidulans AR1
(105) Aspergillus nidulans AR1 has deleted the following genes genes argB2, pyrG89, veA.
(106) a) Construction of a Filamentous Fungal Expression Vector, with argB (Ornithine Carbamoyltransferase) Marker.
(107) The gene encoding argB including the homologous promoter and terminator sequence was amplified from Aspergillus nidulans AR1 genomic DNA using forward primer 5-CG GAATTC ATA CGC GGT TTT TTG GGG TAG TCA-3 (SEQ ID NO: 17) and the reverse primer 5-CG CCCGGG TAT GCC ACC TAC AGC CAT TGC GAA-3 (SEQ ID NO: 18) with the 5′ overhang containing the restriction sites EcoRI and XmaI respectively.
(108) The incorporated restriction sites in the PCR product allowed insertion into pUC19 (New England biolabs, Ipswich, Mass.) digested with EcoRI and XmaI giving pUC19-argB.
(109) The trpC (Indole-3-glycerol phosphate synthase) terminator was amplified from A. nidulans genomic DNA using forward primer 5-GC GGATCC ATA GGG CGC TTA CAC AGT ACA CGA-3 (SEQ ID NO: 19) and the reverse primer 5-CGGAGAGGGCGCGCCCGTGGCGGCCGC GGA TCC ACT TAA CGT TAC TGA-3 (SEQ ID NO: 20) with the 5′ overhang containing the restriction site BamHI and a 27 base pair adaptamer respectively.
(110) The gpdA (glyceraldehyde-3-phosphate dehydrogenase) promoter was amplified from A. nidulans AR1 genomic DNA using forward primer 5-GCGGCCGCCACGGGCGCGCCCTCTCCG GCG GTA GTG ATG TCT GCT CAA-3 (SEQ ID NO: 21) and the reverse primer 5-CG AAGCTT TAT AAT TCC CTT GTA TCT CTA CAC-3 (SEQ ID NO: 22) with the 5′ overhang containing a 27 base pair adaptamer and the restriction site HindIII respectively.
(111) The fusion PCR product of fragment trpC and gpdA with the incorporated restriction sites allow insertion into pUC19-argB digested with BamHI and HindIII yielding pAT3.
(112) b) Construction of a Filamentous Fungal Expression Vector with pyrG (Orotidine-5′-Monophosphate Decarboxylase) Marker for Expression of C4H (Cinnamate-4-Hydroxylase) in A. nidulans AR1.
(113) The gene encoding C4H was reamplified from the yeast plasmid pESC-URA-PAL2-C4H (WO2006089898, example 3) using the forward primer 5-CG G CGCG C ATA ATG GAC CTC TTG CTG GAG-3 (SEQ ID NO: 23) and the reverse primer 5-GG GC GGCC GC TTA ACA GTT CCT TGG TTT CAT AAC G-3 (SEQ ID NO: 24) with the 5′ overhang containing the restriction sites BssHII and NotI respectively. The incorporated restriction sites in the PCR product allowed insertion into pAT3 digested with BssHII and NotI giving pAT3-C4H. The construct was verified by restriction enzyme cut and sequencing. The argB marker was removed by using the two following restriction enzymes BsiWI and PciI.
(114) The gene encoding pyrG including the homologous promoter and terminator sequence was reamplified from Aspergillus fumigatus genomic DNA using the forward primer 5-CGT GTAC AATA TTA AT TAA CGAGA GCG AT CGC AAT AAC CGT ATT ACC GCC TTT GAG-3 (SEQ ID NO: 25) and reverse primer 5-CGA CATG TAT TCC CGG GAA GAT CTC ATG GTC A-3 (SEQ ID NO: 26) with the 5′ overhang containing the restriction sites BsrGI, PacI, AsiSI in the forward primer and PciI in the reverse primer. The incorporated restriction sites in the PCR product allowed insertion into pAT3 digested with BsiWI and PciI giving pAT3-C4H-pyrG. The construct was verified by restriction enzyme cut and sequencing.
(115) c) Construction of a Filamentous Fungal Expression Vector with argB Marker for Expression of 4CL1 (4-Coumarate-CoA Ligase) in A. nidulans AR1
(116) The gene encoding 4CL1 was reamplified from the yeast plasmid pESC-TRP-4CL1-VST1 using the forward primer 5-GCGGAGAGGGCGCG ATG GCG CCA CAA GAA CAA GCA-3 (SEQ ID NO: 27) and the reverse primer 5-TGGATCCGCGGCCGC TCA CAA TCC ATT TGC TAG TTT TGC-3 (SEQ ID NO: 28). The 4CL1 gene was inserted into a pAT3 vector digested with BssHII and NotI using the In-Fusion™ PCR cloning Technology (Clontech, Mountain View, Calif.) to yield pAT3-4CL1. The construct was verified by restriction enzyme cut and sequencing.
(117) d) Construction of a Filamentous Fungal Expression Vector with argB Marker for Expression of VST1 (Resveratrol Synthase) in A. nidulans AR1
(118) The gene encoding VST1 was reamplified from the yeast plasmid pESC-TRP-4CL1-VST1 (example 5) using the forward primer 5-CG G CGCG C ATA ATG GCA TCC GTA GAG TTC-3 (SEQ ID NO: 29) and the reverse primer 5-GG GC GGCC GC TTA TCA TTA GTT AGT GAC AGT TGG AA-3 (SEQ ID NO: 30) with the 5′ overhang containing the restriction sites BssHII and NotI respectively. The incorporated restriction sites in the PCR product allowed insertion into pAT3 digested with BssHII and NotI giving pAT3-VST1. The construct was verified by restriction enzyme cut and sequencing.
(119) e) Expression of the Pathway Leading to Pinosylvin in A. nidulans AR1 (The Strain has Deletions (argB2, pyrG89, veA1)) Using C4H, 4CL1 and VST1.
(120) The transformation of the A. nidulans AR1 fungal cell was conducted in accordance with methods known in the art by protoplastation using cell wall lysing enzymes (glucanex, novozymes) Tilburn et al., 1983. Random integration of C4H, 4CL1 and VST1 was conducted in two steps. Plasmid pAT3-4CL1 and pAT3-VST1 were linearized using restriction enzyme BmrI and integrated in the genome by co-transformation according to Guerra et al., 2006 utilizing the auxotrophic marker argB. A transformant containing a 4CL1 and VST1 expression cassette was isolated and a successive transformation with pAT3-C4H-pyrG, which was linearized with BmrI, gave a recombinant A. nidulans strain containing C4H, 4CL1 and VST1.
(121) f) Fermentation with Recombinant A. Nidulans Strains in Shake Flasks.
(122) Precultures of A. nidulans were grown for 5 days on agar plates at 37° C. containing 1 g/L glucose, 0.85 g/L NaNO.sub.3, 0.1 g/L KCl, 0.1 g/L MgSO.sub.4.7H.sub.2O; and 0.3 g/L KH.sub.2PO.sub.4, 0.00008 g/L CuSO.sub.4.5H.sub.2O, 0.000008 g/L Na.sub.2B.sub.4O.sub.7.10H.sub.2O, 0.00016 g/L FeSO.sub.4.7H.sub.2O, 0.00016 g/L MnSO.sub.4.2H.sub.2O, 0.00016 g/L Na.sub.2MoO.sub.4.2H.sub.2O, and 0.0016 g/L ZnSO.sub.4.7H.sub.2O. The precultures were used for inoculation of 500 ml baffled shake flasks containing 100 ml Czapek medium (CZ). The shake flasks were incubated at 150 rpm and 30° C. and the initial pH of the medium was 6.2. After an incubation period of 24 hours, the samples were taken and subjected to extraction procedures (see below) and analyzed for the presence of produced pinosylvin.
(123) g) Extraction of Pinosylvin from A. Nidulans Shake Flask Cultures
(124) Samples consisting of 100 ml cultures (both cells and broth) were withdrawn from the shake flasks. Extraction of metabolites were conducted as follows; the samples were transferred into two 50 ml Sartorius tubes and centrifuged at 4500 rpm for 10 minutes. The supernatant was transferred into a beaker and the biomass was divided into eight aliquots that were transferred to 2 ml Sarstedt micro tubes with cap, containing app. 300 μl glass beads (0.25-0.50 mm). The tubes were inserted into a Fastprep 120 (Thermo Fisher Scientific, Waltham, Mass.) for four cycles at level 6.5 for 30 seconds at a time and kept on ice in between cycles. The crushed cells were divided into two 15-ml Sartorius tubes. The tubes were filled with 10 ml of supernatant and 3 ml of ethyl acetate was added. The tubes were vigorously mixed on a whirly mixer for 2 minutes and put on ice for 5 minutes. The ethyl acetate phase was then separated from the water phase via centrifugation at 4500 rpm for 10 minutes and collected in four 1.5 ml Eppendorf tubes. The ethyl acetate was then freeze dried for 45 min and the dried samples were re-dissolved in 0.3 ml 50% methanol for further HPLC analysis, as described in Example 9b.
(125) h) Shake Flask Results from Recombinant A. Nidulans
(126)
(127) The identity of the pinosylvin peak was further confirmed with diode array UV-spectra by comparison with a pure standard UV-chromatogram (
Example 17
(128) Determination of Intracellular and Extracellular Levels of Stilbenoids in a Continuous Culture of PALCPR
(129) A yeast strain FSSC-PAL2C4H4CL2VST1-pADH1CPR1 with overexpressed CPR, was grown in a carbon-limited continuous culture with a working volume of 1 liter. The culture was fed with a defined medium according to Verduyn et al. (1992), containing: 5.0 g/L (NH.sub.4).sub.2SO.sub.4; 3.0 g/L KH.sub.2PO.sub.4; 0.5 g/L MgSO.sub.4.7H2O; trace metals and vitamins and 5 g/l glucose and 35 g/l galactose as the growth-limiting nutrients. Antifoam (300 μl/L, Sigma A-8436) was added to avoid foaming. The carbon source was autoclaved separately from the mineral medium and afterwards added to the fermentor. In addition, the vitamin and trace metal solutions were added to the fermentor by sterile filtration following autoclavation and cooling of the medium. The fermenter system was from Sartorius BBI systems and consisted of a baffled 3-liter reactor vessel with 1 liter working volume equipped with Biostat B Plus controller. The reactor vessel was equipped with two Rushton turbines which were rotating at either 1000 rpm, the temperature was kept at 30±1° C., and the pH was kept at 5.5±0.2 by automatic addition of 2M KOH. The gasflow was controlled by a mass flow controller and was set to 1.5 vvm (1.5 l/min). The off-gas was led through a cooled condenser, and was analyzed for O.sub.2 and CO.sub.2 (Model 1308, Innova, Denmark). An initial batch culture with 35 g/l galactose was started by inoculation of the culture with 10 ml of an exponential growing shakeflask culture containing 5 g/l glucose and 35 g/l galactose. The batch cultivation was switched to a continuous mode by feeding the same medium continuously to the reactor. The dilution rate was controlled on a constant level basis, aiming at D=0.050 h.sup.−1. The continuous culture was regarded to be in steady state when both the dilution rate and off-gas signal had not changed for at least five residence times, and when the metabolite concentrations in two successive samples taken at intervals of 1 residence time, deviated by less than 3%. The dissolved-oxygen concentration, which was continuously monitored, was kept above 60% of air saturation. Under said conditions the strain consumed all the galactose, and mainly produced biomass and CO.sub.2, and only minor amounts of ethanol. Moreover, the RQ was close to unity, indicating that metabolism was predominantly in respirative mode.
(130) For the determination of stilbenoids, samples were taken at approximately 300 hrs into fermentation corresponding to 15 residence times. Cells were harvested by centrifugation 5000 g for 5 minutes. For the determination of extracellular levels of stilbenoids, an aliquot of 25 ml of supernatant was extracted once with 10 ml ethyl acetate. The ethyl acetate was freeze dried and the dry product redissolved in 0.6 ml methanol. The samples were than 50-fold diluted in water transferred into HPLC vials, and analyzed by HPLC. Furthermore, to evaluate whether the level of stilbenoids that was produced exceeded the solubility of the medium, or were either bound to the cell-membranes 1 ml aliquots of cell culture, thus including both cells and medium, were mixed with 1 ml of 100% ethanol, and mixed vigorously prior to centrifugation. The supernatant was then transferred into HPLC vials and directly analyzed for the content of stilbenoids. For the determination of intracellular levels of stilbenoids, an aliquot of 50 ml culture was sampled, and cells and medium were separated by centrifugation. The pellet was washed with 50 ml of water to remove any stilbenoids that were cell-bound or trapped into the pellet; after re-centrifugation the pellet was then dissolved in 1 ml water. The resulting cell suspension was distributed into extraction tubes and broken with glass beads using a fast-prep machine. The crude extracts were pooled into 10 ml of 100% methanol, and extracted in a rotary chamber for 24 hours in a dark cold room at 4° C. Thereafter, the cell debris was removed via centrifugation for 5 min. at 5000 g and the remaining methanol was removed by freeze-drying overnight. The dry residue was redissolved in 0.4 ml methanol and 0.1 ml water. The samples were than 50-fold diluted in water and then transferred into HPLC vials, and analyzed by HPLC.
(131) The following table summarizes the results after continuous culture for 300 hrs:
(132) TABLE-US-00002 Pinosylvin Pinosylvin Pinosylvin Pinosylvin Intracelullar Extracelullar Extracellular Total (a) (b) In EtOH (c) (a + c) mg/l 16.45 12.55 113.57 130.02 % of 12.65 9.65 87.35 100.00 total mg/g dry 1.83 — — — weight
(133) Intracellular levels of stilbenoids were expressed in mg per gram biomass (dry weight), according to the calculation explained in the following section. The concentration of pinosylvin in the extract was determined 1646 mg/l; the volume of the extract was 0.5 ml, hence the absolute amount of pinosylvin extracted was 0.5*1646/1000=0.8230 mg respectively. The stilbenoids were extracted from a 50 ml culture-aliquot and hence the intracellular concentrations of pinosylvin expressed per liter culture were 0.8230*(1000/50)=16.46 mg/l. The biomass concentration of said culture was 9 g/l. The intracellular pinosylvin levels expressed per gram dry weight therefore were 16.46/9=1.83 mg/g dry weight.
Example 18
(134) Cloning of Trans-Pinosylvin Pathway in Oleaginous Yeast Yarrowia lipolytica
(135) a) Isolation of Genes
(136) PAL (phenylalanine ammonialyase), CL (cinnamoyl:CoA ligase) and VST1 genes, where gene is defined as protein coding sequence, are produced as synthetic genes (GenScript Corporation, Piscataway, N.J.) with codon optimization for expression in Yarrowia lipolytica. The determination of codon usage in Y. lipolytica has been described previously (WO2006125000). PAL and 4CL genes can also be isolated by PCR from A. thaliana cDNA (Stratagene). Cinnamoyl:CoA ligase CL can be any hydroxycinnamoyl:CoA ligase accepting cinnamic acid as substrate. For example, the 4-coumaroyl:CoA ligases from A. thaliana, encoded by 4CL1 and 4CL2 genes, accept cinnamic acid although the preferred substrate is 4-hydroxycinnamic acid (coumaric acid) (Hamberger and Hahlbrock, 2004; Costa et al, 2005). Most preferably, the CL is a codon optimized ligase specific for cinnamic acid as substrate exemplified by cinnamate:CoA ligase from Streptomyces coelicolor (Kaneko et al, 2003). Likewise, VST1 gene can be any codon optimized or non optimized stilbene synthase accepting cinnamoyl:CoA as substrate even though the preferred substrate is usually 4-coumaroyl:CoA in stilbene synthases that produce resveratrol, so called resveratrol synthases. This type of dual substrate acceptance is in the nature of the VST1 gene (seq id: 9) from Vitis vinifera. Most preferably a stilbene synthase from the family of Pinus specific for cinnamoyl:CoA as substrate is used (Schanz et al, 1992; Kodan et al, 2002).
(137) b) Isolation of Promoters and Terminators
(138) Promoters that can be used for expression of heterologous genes in Yarrowia lipolytica are exemplified but not limited to the following promoters: long chain acyl:CoA oxidase PDX2, hp4d, isocitrate lyase ICL1, extracellular alkaline protease XPR2, translation elongation factor TEF, ribosomal protein S7 RPS7, glyceraldehyde-3-phosphate dehydrogenase GPD, YAT1, GPAT, FBA1, and FBAIN promoters (Müller et al, 1998: WO2006055322; WO2006125000).
(139) Terminators that can be used for expression of heterologous genes in Yarrowia lipolytica are exemplified but not limited to the following terminators: XPR2, LIP2, PEX20, and SQS terminators (Merkulov et al, 2000; WO2006055322; WO2006125000).
(140) Isolation of terminator and promoter DNA fragments can be done via PCR from Yarrowia lipolytica genomic DNA prepared from whole cells of Y. lipolytica exemplified by but not limited to cells from the America Type Culture Collection, such as ATCC16618, ATCC18943, and ATCC18944, ATCC90811, ATCC90812, and ATCC90903.
(141) c) Generation of an Expression Cassette
(142) The generation of an expression cassette means the assembly of a linear double stranded DNA-fragment consisting of a promoter (constitutive or inducible) fused together with the protein coding sequence of a heterologous gene and a terminator sequence, i.e. 5′-Promoter:Gene:Terminator-3′ DNA fragment.
(143) The expression cassette can be generated by a combination of fusion PCR of the different gene fragments; promoter, gene coding sequence and terminal fragment. For example PAL gene can be fused with PCR technology to XPR2 promoter and the resulting XPR2:PAL fragment can be further fused via a second PCR reaction to the terminator to generate the expression cassette XPR2:PAL:terminator.
(144) An alternative way to generate an expression cassette is to clone the protein coding sequence of the heterologous gene (such as PAL) in an existing expression vector, examplified but not limited to ATCC vector 69355™. This ATCC vector already has a promoter (XPR2) and a terminator region and a multiple cloning site (MCS) with unique restriction sites between the promoter and terminator for introduction of a heterologous gene by standard molecular biology tools. If the number of restriction sites between promoter and terminator region in the target vector are limited the Infusion cloning kit technology can be used (Clontech, CA, USA) since it requires only one restriction site in the vector for gene insertion. By inserting the gene in a vector between a promoter and terminator the expression cassette Promoter:Gene:Terminator is created inside a circular vector and not as a single double stranded DNA-fragment. If a linear DNA expression cassette fragment is needed PCR can be used for amplification of the expression cassette from the expression vector. One of skill in the art would recognize that several expression cassettes can be introduced into the same plasmid or vector resulting in cluster of expression cassettes preferably with genes from a whole metabolic pathway, such as the pinosylvin production pathway (PAL, CL and VST1 genes). The cluster of expression cassettes for the three genes needed for pinosylvin production (PAL, CL and VST1) is defined as pinosylvin pathway expression cluster.
(145) d) Insertion of Heterologous Gene, PAL, CL and VST1 for Pinosylvin Production in Y. lipolytica
(146) The pinosylvin pathway genes (PAL, CL, VST1) are assembled as expression cassettes with a promoter and terminator Promoter::Gene:Terminator. The promoters and terminators can be the same or a combination of different promoters and terminators for the different genes, PAL, CL and VST1. One of skill in the art would recognize available cloning techniques, cloning vectors, or cloning tools needed for introduction and expression of the pinosylvin pathway expression cluster (comprising the expression cassettes with the genes PAL, CL and VST1) in Y. lipolytica, since these tools have been described in several publications (Le DAll et al, 1994; Pignede et al, 2000; Juretzek et al, 2001; Madzak et al, 2004) and patent applications (WO2006055322; WO2006125000).
(147) In summary, once the expression cassettes suitable for expressing the pinosylvin pathway (PAL, CL and VST1) in Y. lipolytica has been obtained, they can be (i) placed in a plasmid vector capable of autonomous replication in a host cell or (ii) directly integrated into the genome of the host cell or a combination thereof in order to establish the pinosylvin pathway expression cluster in the Y. lipolytica host. Expression cassettes can be designed to integrate randomly within the host genome or can be targeted to specific locations. In both cases the expression cassette is further constructed to contain surrounding regions of homology to the host genome on both sides of the expression cassette. The regions of homology can be 20-1000 base pairs sufficient to target recombination with the host locus. Single copies can be targeted to any part of the genome which will not lead to deletion of an essential gene. Integration into multiple locations within the Y. lipolytica genome can be particularly useful when high expression levels of genes are desired and targets for integration of multiple copies of expression cassettes are exemplified but not limited to ribosomal DNA sequence (rDNA) or retrotransposon-like elements (TY1 elements) (Pignede et al, 2000). When integrating multiple copies of expression cassettes targeted to random positions into the Y. lipolytica genome the expression cassette Promoter-Gene-Terminator can actually be made shorter, including only Promoter-Gene since the integration will allow terminators already present in the Y. lipolytica genome to serve as the terminator for the expression cassette.
(148) It is also possible to integrate plasmid DNA comprising expression cassettes into alternate loci to reach the desired copy number for the expression cassette, exemplified by but not limited to the URA3 locus (Accession No AJ306421) and the LEU2 locus (Accession No AF260230). The LEU2 integrative vector is exemplified by but not limited to ATCC vector 69355™. This expression vector containing an expression cassette can be used directly for transformation into Y. lipolytica cells auxotrophic for leucine for selection of the expression vector that contains Y. lipolytica LEU2 marker gene. The expression cassette can also be amplified from the expression vector by PCR technique to be further used for construction of other expression vectors containing appropriate selective antibiotic markers or biosynthetic amino acid markers.
(149) The URA3 integration site can be used repeatedly in combination with 5-fluoroorotic acid (5-FOA) selection. In detail, native URA3 gene is deleted in Y. lipolytica host strain to generate a strain having URA-auxotrophic phenotype, wherein selection occurs based on 5-FOA resistance. When URA3 is present 5-FOA is degraded to a toxic compound 5-fluorouracil by the orotidine-5′-phosphate decarboxylase encoded by URA3 gene and only cells lacking URA3 gene will be resistant. Consequently, a cluster of multiple expression cassettes and a new URA3 gene can be integrated in multiple rounds into different locus of the Yarrowia lipolytica genome to thereby produce new strain having URA+ prototrophic phenotype. Subsequent integration produces a new URA3-auxotrophic strain, again using 5-FOA selection, when the introduced URA3 gene is autonomously deleted (so called loop-out or pop-out). Thus, URA3 gene in combination with 5-FOA selection can be used as a selection marker in multiple rounds of genetic modifications and integration of expression cassettes.
(150) e) Transformation of Y. lipolytica
(151) Standard transformation techniques (Chen et al, 1997; WO2006125000) can be used to introduce the foreign DNA, self replicative vectors, or DNA fragments comprising the expression cassettes into Y. lipolytica host, exemplified by but not limited to host cells such as ATCC90811, ATCC90812, and ATCC90903. The selection method used to maintain the introduced foreign DNA in Y. lipolytica can be based on amino acid markers (Fickers et al, 2003) or antibiotic markers (Cordero et al, 1996).
Example 19
(152) (a) Batch Cultivations with Recombinant Escherichia coli Strains
(153) The recombinant strains of Escherichia coli FSEC-PAL24CL1VST1 and BL21 (DE3) (control strain) were grown in baffled bioreactors with a working volume of 1.5 liters, under aerobic conditions. The cultures were incubated at 30° C., at 800 rpm. A constant pH of 7 was maintained by automatic addition of 2N KOH. Aerobic conditions were obtained by sparging the bioreactor with air at a rate of 1 vvm to ensure that the dissolved oxygen density (DOT) was greater than 60%. The air was sterile filtered before being introduced into the bioreactors. The off gas was led through a condenser cooled to lower than 6° C. and analyzed for its volumetric content of CO.sub.2 and O.sub.2 by means of an acoustic gas analyser. The bioreactors were equipped with polarographic oxygen sensors that were calibrated with air (DOT, 100%) and N.sub.2 (DOT, 0%).
(154) Cells were grown on glycerol in semi-defined medium consisting of the following components to allow growth in batch cultivations: 6.0 g/l yeast extract, 27.2 g/l Na.sub.2HPO.sub.4 (anhydrous), 12.0 g/l KH.sub.2PO.sub.4, 2.0 g/l NaCl, and 4.0 g/l NH.sub.4Cl. The glycerol concentration was 20 g/l. The medium was supplemented with 50 mg/l ampicillin and 50 mg/l kanamycin. Antifoam was added to a final concentration of 50 ul/l.
(155) The bioreactors were inoculated with 1 ml of glycerol stock culture of the recombinant strain, leading to a final optical density at 600 nm of approximately 0.03. The glycerol stock cultures were obtained by growing the cells in shake flasks on semi-defined medium, at 30° C. and 150 rpm. The composition of the medium was identical to the one described above, but re-scaled 4-fold lower, i.e.: 5 g/l glycerol, 1.5 g/l yeast extract, 6.8 g/l Na.sub.2HPO.sub.4 (anhydrous), 3.0 g/l KH.sub.2PO.sub.4, 0.5 g/l NaCl, and 1.0 g/l NH.sub.4Cl. The medium was supplemented with 50 mg/l ampicillin and 50 mg/l kanamycin. The cells were harvested during the late exponential phase, collected by centrifugation and resuspended in an appropriate volume of sterile glycerol solution 15% (w/v), such that the final optical density at 600 nm was 30. Aliquots of 1 ml of suspended cells were stored at −80° C.
(156) After the cells started growing in the bioreactors (5.5 h after inoculation), isopropyl β-thiogalactopyranoside (IPTG) was added to a final concentration of 1 mM, as an inducer of the T7 promoter that is in front of each of the three genes PAL2, 4CL1, and VST1.
(157) Samples of cellular broth were taken in the course of the batch cultivations and analysed for the presence of pinosylvin. In addition, the samples were analysed for biomass (in terms of optical density OD600), carbon source (glycerol) and major by-products (ethanol, acetate, pyruvate, succinate).
(158) (b) Extraction of Pinosylvin in Escherichia coli
(159) The intracellular pinosylvin was extracted with ethyl acetate. For the purpose, 4 mL of ethyl acetate was added to 8 mL of cell broth. The extraction was enforced by mixing (30 s) and the separation of phases, by centrifugation (4500 rpm for 5 min, at 4° C.). The acetate phase was subjected to freeze-drying (approximately 2 h) and the dry product was redissolved in 0.5 ml methanol and analysed by HPLC. These samples were further diluted in water (1:5) and analysed by HPLC.
(160) (c) Analysis of Pinosylvin
(161) The analysis of pinosylvin in samples from the batch cultivation was performed using the method as described in Example 9b. The sample was previously subjected to the following sample preparation procedures, carried out in parallel: (i) Centrifugation of cell broth (5 min) and analysis of supernatant; (ii) Addition of ethanol (99.9%) to a final concentration of 50% (v/v), vortex (30 s), centrifugation (5 min) and analysis of supernatant; (iii) Extraction with ethyl acetate, according to (b) above, and analysis of dried sample redissolved in methanol.
(162) Results
(163) The recombinant strains of Escherichia coli FSEC-PAL24CL1VST1 and BL21 (DE3) (control strain), as described in example 10c, were cultivated on 20 g/L of glycerol in bioreactors in batch mode, as described in (a) above. In the course of the cultivations, the recombinant strains were analysed for their content of pinosylvin according to (c) above.
(164) The HPLC-analysis showed that the strain FSEC-PAL24CL1VST1 contained a component with a retention time identical to the standard of trans-pinosylvin (
(165) The maximal concentrations of pinosylvin detected are shown in the following table:
(166) TABLE-US-00003 Pinosylvin Pinosylvin Pinosylvin Pinosylvin intracellular extracellular extracellular total (a) (b) In EtOH (c) (a) + (c) mg/l 0.016 (*) (*) 0.016 % of 100 0 0 100 total mg/g dry (**) (**) (**) (**) weight (*) below detection level. (**) not determined.
(167) No pinosylvin was detected in the samples from the batch cultivation with the control strain.
(168) The results, therefore, demonstrated the presence of an active phenyl-propanoid pathway that led to in vivo production of trans-pinosylvin, in E. coli grown in a bioreactor in batch mode.
Example 20
(169) (a) Batch Cultivation with Recombinant Aspergillus nidulans Strain
(170) The recombinant strain of Aspergillus nidulans containing C4H, 4CL1, and VST1 was grown in a baffled bioreactor with a working volume of 1.5 liters, under aerobic conditions. The cultures were incubated at 30° C., at 700 rpm. A constant pH of 6 was maintained by automatic addition of 2N KOH. Aerobic conditions were obtained by sparging the bioreactor with air at a rate of 1 vvm to ensure that the dissolved oxygen tension (DOT) was greater than 60%. The air was sterile filtered before being introduced into the bioreactors. The off gas was led through a condenser cooled to lower than 6° C. and analyzed for its volumetric content of CO.sub.2 and O.sub.2 by means of an acoustic gas analyser. The bioreactors were equipped with polarographic oxygen sensors that were calibrated with air (DOT, 100%) and N.sub.2 (DOT, 0%). Cells were grown on sucrose in defined medium consisting of the following components: 3.0 g/l NaNO, 1.0 g/l KH.sub.2PO.sub.4, 0.5 g/l KCl, 0.5 g/l MgSO.sub.4.7H.sub.20, 0.5/1 g FeSO.sub.4.7H.sub.20. The concentration of sucrose was 30 g/l. Antifoam was added to a final concentration of 50 ul/l.
(171) The bioreactor was inoculated with spores of the A. nidulans strain containing C4H, 4CL1, and VST1, previously propagated on solid minimal medium, with the following composition: 1 g/L glucose, 0.85 g/L NaNO.sub.3, 0.1 g/L KCl, 0.1 g/L MgSO.sub.4.7H.sub.2O; and 0.3 g/L KH.sub.2PO.sub.4, 0.00008 g/L CuSO.sub.4.5H.sub.2O, 0.000008 g/L Na.sub.2B.sub.4O.sub.7.10H.sub.2O, 0.00016 g/L FeSO.sub.4.7H.sub.2O, 0.00016 g/L MnSO.sub.4.2H.sub.2O, 0.00016 g/L Na.sub.2MoO.sub.4.2H.sub.2O, and 0.0016 g/L ZnSO.sub.4.7H.sub.2O. The spores were cultivated at 37° C. for 5 days and harvested by adding Tween 80% solution (0.25% (w/v)).
(172) (b) Extraction of Pinosylvin in Aspergillus nidulans
(173) The cells were disrupted by homogenization (in a Polytron tissue homogenizer) and the intracellular pinosylvin was extracted with 10 ml ethyl acetate. The extraction was enforced by mixing in a rotary mixer (approximately 15 min) and the separation of phases, by centrifugation (4500 rpm, at 4° C., for 5 min). The acetate phase was subjected to freeze-drying (approximately 2 h) and the dry product was redissolved in 0.5 ml methanol and analysed by HPLC.
(174) (c) Analysis of Pinosylvin
(175) The analysis of pinosylvin in samples from the batch cultivation was performed using the method as described in example 9b.
(176) Results
(177) The recombinant strain of Aspergillus nidulans containing C4H, 4CL1, and VST1, as described in Example 16e, was cultivated on 30 g/L of sucrose in a bioreactor in batch mode, according to Example HD4. After approximately 48 h of cultivation, the cells were harvested from the bioreactor, disrupted by homogenization and analysed for their intracellular content of pinosylvin according to (b) and (c) above.
(178) The HPLC-analysis showed that the A. nidulans strain containing C4H, 4CL1, and VST1 exhibited intracellularly a component with a retention time identical to the standard of trans-pinosylvin (
(179) The results, therefore, demonstrated the presence of an active phenyl-propanoid pathway that led to in vivo production of trans-pinosylvin, in A. nidulans grown in a bioreactor in batch mode.
REFERENCES
(180) The following publications are all hereby incorporated by reference: Patent no. ZA200408194 Patent no. EP0309862 Patent no. EP0464461 U.S. Pat. No. 5,391,724 U.S. Pat. No. 5,973,230 Patent application WO2006125000 Method for the production of resveratrol in a recombinant oleaginous microorganism Huamg Lixuan Lisa, Du Pont (US) Patent application WO2006055322 High arachidonic acid producing strains of Yarrowia lipolytica Damude Howard, Du Pont (US) Abe, I., Watanabe, T. and Noguchi, H. (2004). Enzymatic formation of long-chain polyketide pyrones by plant type III polyketide synthases. Phytochemistry. 6, 2447-2453. Aggarwal B B, Bhardwaj A, Aggarwal R S, Seeram N P, Shishodia S, Takada Y. (2004). Role of resveratrol in prevention and therapy of cancer: preclinical and clinical studies. Anticancer Res. 24, 2783-840. Review. Allina, S. M., Pri-Hadash, A., Theilmann, D. A., Ellis, B. E. and Douglas, C. J. (1998) 4-coumarate: Coenzyme A ligase in hybrid poplar. Properties of enzymes, cDNA cloning, and analysis of recombinant clones. Plant Physiol. 116, 743-754. Becker J V, Armstrong G O, van der Merwe M J, Lambrechts M G, Vivier M A, Pretorius I S. (2003). Metabolic engineering of Saccharomyces cerevisiae for the synthesis of the wine-related antioxidant resveratrol. FEMS Yeast Res. 4, 79-85. Chen D C, Beckerich J M, Gaillardin C. One-step transformation of the dimorphic yeast Yarrowia lipolytica. Appl Microbiol Biotechnol. 1997:48:232-5. Cochrane, F. C., Davin, L. B. and Lewis N. G. (2004). The Arabidopsis phenylalanine ammonia lyase gene family: kinetic characterization of the four PAL isoforms. Phytochemistry 65, 1557-1564. Cordero Otero R, Gaillardin C. Efficient selection of hygromycin-B-resistant Yarrowia lipolytica transformants. Appl Microbiol Biotechnol. 1996:46:143-8. Costa M L, Bedgar D L, Moinuddin S G A, Kim K, Cardenas C L, Cochrane F C, Shockey J M, Helms G L, Amakura Y, Takahashi H et al. Characterization in vitro and in vivo of the putative multigene 4-coumarate:CoA ligase network in Arabidopsis: syringyl lignin and sinapate/sinapyl alcohol derivative formation Phytochemistry, 2005:66:2072-2091 Ehlting, J., Büttner, D., Wang, Q., Douglas, C. J., Somssich, I. E. and Kombrink, E. (1999). Three 4-coumarate:coenzyme A ligases in Arabidopsis thaliana represents two evolutionary divergent classes in angiosperms. The plant journal. 19, 9-20. Fickers P, Le Dall M T, Gaillardin C, Thonart P, Nicaud J M. New disruption cassettes for rapid gene disruption and marker rescue in the yeast Yarrowia lipolytica. J Microbiol Methods. 2003:55:727-37. Gehlert, R., Schoppner, A. and Kindl, H. Stilbene synthase from seedlings of Pinus sylvestris-purification and induction in response to fungal infection. Mol. Plant-Microbe Interaction 3 (1990) 444-449. Gems, D., Johnstone, I. L. and Clutterbuck, A. J. (1991). An autonomously replicating plasmid transforms Aspergillus nidulans at high frequency. Gene 98, 61-67. Hain, R., Reif, H. J., Krause, E., Langebartels, R., Kindl, H., Vornam, B., Wiese, W., Schmelzer, E., Schreier, P. H., Stocker, R. H. and Stenzel, K. (1993). Disease resistance results from foreign phytoalexin expression in a novel plant. Nature 361, 153-156. Hwang E I, Kaneko M, Ohnishi Y, Horinouchi S. (2003). Production of plant-specific flavanones by Escherichia coli containing an artificial gene cluster. Appl. Environ. Microbiol. 69, 2699-706. Hamberger, B. and Hahlbrock, K. (2004). The 4-coumarate:CoA ligase gene family in Arabidopsis thaliana comprises one rare, sinapate-activating and three commonly occurring isoenzymes. Proc. Natl. Acad. Sci. USA. 101, 2209-2214. Hart, J. H. (1981) Role of phytostilbenes in decay and disease resistance. Annu. Rev. Phytopathology 19, 437-458. Hart, J. H., Shrimpton, D. M. (1979). Role of stilbenes in resistance of wood to decay. Phytopathology 69, 1138-1143. Hemingway R. W., McGraw, G. W. and Barras, S. J. (1977). Polyphenols in Ceratocystis minor infected Pinus taeda: Fungal Metabolites, phloem and xylem phenols. J. Agric. Food Chem., 25, 717-722. Juvvadi, P. R., Seshime, Y., Kitamoto, K. (2005). Genomics reveals traces of fungal phenylpropanoid-flavonoid metabolic pathway in the filamentous fungus Aspergillus oryzae. J. Microbiol. 43, 475-486. Juretzek T, Le Dall M, Mauersberger S, Gaillardin C, Barth G, Nicaud J. Vectors for gene expression and amplification in the yeast Yarrowia lipolytica. Yeast. 2001:18:97-113. Kaneko, M., Ohnishi, Y. and Horinouchi, S. Cinnamate:Coenzyme (2003). A ligase from the Filamentous Bacteria Streptomyces coelicolor A3(2), J. Bact. 185, 20-27. Kindl, H. (1985) Biosynthesis of stilbenes. In Higuchi T, ed, Biosynthesis and Biodegradation of Wood Components. Academic Press, London, pp 349-377. Kodan, A., Kuroda, H. and Sakai, F. (2002). A stilbene synthase from Japanese red pine (Pinus densiflora): Implications for phytoalexin accumulation and down-regulation of flavonoid biosynthesis. Proc. Natl. Acad. Sci. 99, 3335-3339. Le Dall M T, Nicaud J M, Gaillardin C. Multiple-copy integration in the yeast Yarrowia lipolytica. Curr Genet. 1994:26:38-44. Lieutier, F., Sauvard, D., Brignolas, F., Picron, V., Yart, A., Bastien, C. and Jay-Allemand, C. (1996) Changes in phenolic metabolites of Scots pine phloem induced by Ophiostoma brunneo-ciliatum, a bark beetle-associated fungus. Eur. J. For Pathol. 26, 145-158 Lindberg L E, Willfor S M, Holmbom B R. (2004) Antibacterial effects of knotwood extractives on paper mill bacteria. J Ind Microbiol Biotechnol. 31, 137-147. Madzak C, Gaillardin C, Beckerich J M. Heterologous protein expression and secretion in the non-conventional yeast Yarrowia lipolytica: a review. J. Biotechnol. 2004:109:63-81. Martin, V. J. J., Pitera, D. J., Withers, S. T., Newman, J. D. and Keasling, J. D. (2003). Engineering a mevalonate pathway in Escherichia coli for production of terpenoids. Nature biotechnology 21, 796-802. Melchior F, Kindl H (1991). Coordinate and elicitor dependent expression of stilbene synthase and phenylalanine ammonialyase genes in Vitis cv. Optima. Arch. Biochem. Biophys 288, 552-557. Mellanen, P., Petanen, T., Lehtimaki, J., Makela, S., Bylund, G., Holmbom, B., Mannila, E., Oikari, A. and Santti, R. (1996). Wood-derived estrogens: studies in vitro with breast cancer cell lines and in vivo in trout. Toxicol. App. Pharm. 136, 381-388. Merkulov S, van Assema F, Springer J, Fernandez Del Carmen A, Mooibroek H. Cloning and characterization of the Yarrowia lipolytica squalene synthase (SQS1) gene and functional complementation of the Saccharomyces cerevisiae erg9 mutation. Yeast. 2000:16:197-206. Mizutani M and Ohta D et al, 1998 Two Isoforms of NADPH:Cytochrome P450 Reductase in Arabidopsis thaliana. Gene Structure, Heterologous Expression in Insect Cells, and Differential Regulation Plant Physiol. 116, 357-367 Morita, H., Noguchi, H., Schöder, J. and Abe, I. (2001). Novel polyketides synthesized with a higher plant stilbene synthase. Eur. J. Biochem. 268, 3759-3766. Müller S, Sandal T, Kamp-Hansen P, Dalbøge H. Comparison of expression systems in the yeasts Saccharomyces cerevisiae, Hansenula polymorpha, Klyveromyces lactis, Schizosaccharomyces pombe and Yarrowia lipolytica. Cloning of two novel promoters from Yarrowia lipolytica. Yeast. 1998:14:1267-83. Nicaud J M, Madzak C, van den Broek P, Gysler C, Duboc P, Niederberger P. Gaillardin C. Protein expression and secretion in the yeast Yarrowia lipolytica. FEMS Yeast Res. 2002:2:371-9. Pignède G, Wang H J, Fudalej F, Seman M, Gaillardin C, Nicaud J M. Autocloning and amplification of LIP2 in Yarrowia lipolytica. Appl Environ Microbiol. 2000:66:3283-9. Preisig-Muller, R., Schwekendiek, A., Brehm, I., Reif, H. J. and Kindl, H. (1999). Characterization of a pine multigene family containing elicitor-responsive stilbene synthase genes. Plant Mol. Biol. 1999 39, 221-229. Pacher T, Seger C, Engelmeier D, Vajrodaya S, Hofer O, Greger H. (2002). Antifungal stilbenoids from Stemona collinsae. J Nat Prod. 65, 820-827. Raiber S, Schröder G, Schröder J. (1995). Molecular and enzymatic characterization of two stilbene synthases from Eastern white pine (Pinus strobus). A single Arg/His difference determines the activity and the pH dependence of the enzymes. FEBS Lett. 361, 299-302. Richter, C., Wild, A. (1992). Phenolic compounds in needles of Norway spruce trees in relation to novel forest decline: I. Studies on trees from site of the Northern Black Forest. Biochem. Biophys. Pflanz 188, 305-320. Ro D. K., Douglas C. J. (2004). Reconstitution of the entry point of plant phenylpropanoid metabolism in yeast (Saccharomyces cerevisiae): implications for control of metabolic flux into the phenylpropanoid pathway. J. Biol. Chem. 279, 2600-2607. Rosemann, D., Heller, W. and Sandermann, H. (1991). Biochemical Plant Responses to Ozone. II. Induction of Stilbene Biosynthesis in Scots Pine (Pinus sylvestris L.) Seedlings. Jr. Plant Physiol. 97, 1280-1286. Roupe, K. A., Fukuda, C., Halls, S., Yáñez, J. A. and Davies N. M. (2005) Pinosylvin: Method of Analysis, Anti-Cancer Activity and Metabolism. American Association of Pharmaceutical Scientists Annual Meeting. November. Accepted. Roupe, K. A., Remsberg, C. M., Yáñez. J. A. and Davies, N. M. (2006). Pharmacometrics of Stilbenes: Seguing Towards the Clinic. Curr. Clin. Pharmac. 1, 81-101. Samappito, S., Page, J. E., Schmidt, J., De-Eknamkul, W. and Kutchan, T. M. (2003). Aromatic and pyrone polyketides synthesized by a stilbene synthase from Rheum tataricum. Phytochemistry 62, 313-323. Sambrook, J., Fritsch, E. F. and Maniatis, T. (1989). Molecular Cloning, A Laboratory Manual, 2d edition, Cold Spring Harbor, N.Y. Schanz, S., Schröder, G. and Schröder, J. (1992). Stilbene synthase from Scot's pine (Pinus sylvestris) FEBS Lett. 313, 71-74. Schöppner, A. and Kindl, H. (1984) Purification and properties of a stilbene synthase from induced cell suspension cultures of peanut. J. Biol. Chem. 259, 6806-6811. Schröder G, Brown J W S, Schröder J. (1988). Molecular analysis of resveratrol synthase. cDNA clones and relationship with chalcone synthase. Eur J Biochem 172, 161-169. Seshime, Y., Juvvadi, P. R., Fujii, I. and Kitamoto, K. (2005). Genomic evidences for the existence of a phenylpropanoid metabolic pathway in Aspergillus oryzae. Biochem. Biophys. Res Commun. 337, 747-51. Skinnider, L. and Stoessl A. (1986). The effect of the phytoalexins, lubimin, (-)-maackiain, pinosylvin, and the related compounds dehydroloroglossol and hordatine M on human lymphoblastoid cell lines. Experientia 42, 568-570. Stojanovic, S., Sprinz, H. and Brede, O. (2001). Efficiency and mechanism of the anti-oxidant action of trans-resveratrol and its analogues in the radical liposome oxidation. Arch. Biochem. Biophys. 391, 79-89. Suga T., Ohta S., Munesada K., Ide N., Kurokawa M., Shimizu M., Ohta E. (1993). Endogenous pine wood nematicidal substances in pines, Pinus massoniana, P. strobes and P. palustris. Phytochemistry 33, 1395-1401. Tropf, S., Karcher, B., Schröder, G. and Schröder, J. (1995). Reaction mechanisms of homodimeric plant polyketide synthase (stilbenes and chalcone synthase). A single active site for the condensing reaction is sufficient for synthesis of stilbenes, chalcones, and 6′-deoxychalcones. J. Biol. Chem. 270, 7922-7928. Urban P, Werck-Reichhart D, Teutsch H G, Durst F, Regnier S, Kazmaier M, Pompon D (1994). Characterization of recombinant plant cinnamate 4-hydroxylase produced in yeast. Kinetic and spectral properties of the major plant P450 of the phenylpropanoid pathway. Eur J Biochem. 222:843-50 Verduyn C, Postma E, Scheffers W A, Van Dijken J P. (1992). Effect of benzoic acid on metabolic fluxes in yeasts: a continuous-culture study on the regulation of respiration and alcoholic fermentation. Yeast. 8, 501-517. Watts et al; Watts K T, Mijts B N, Lee P C, Manning A J, Schmidt-Dannert C. (2006). Discovery of a substrate selectivity switch in tyrosine ammonia-lyase, a member of the aromatic amino acid lyase family. Chem Biol. 13:1317-26. Wiese W, Vornam B, Krause E, Kindl H (1994). Structural organization and differential expression of three stilbene synthase genes located on a 13 kb grapevine DNA fragment. Plant Mol Biol 26, 667-677.
(181) The following is a summary of the nucleotide and amino acid sequences appearing herein:
(182) SEQ ID NO: 1 is a nucleotide sequence from Arabidopsis thaliana encoding a phenylalanine ammonia lyase (PAL2).
(183) SEQ ID NO: 2 is the amino acid sequence encoded by SEQ ID NO: 1.
(184) SEQ ID NO: 3 is a nucleotide sequence from Arabidopsis thaliana encoding a 4-coumarate:CoenzymeA ligase (4CL1).
(185) SEQ ID NO: 4 is the amino acid sequence encoded by SEQ ID NO: 3.
(186) SEQ ID NO: 5 is a nucleotide sequence from Rheum tataricum encoding a resveratrol synthase (RES).
(187) SEQ ID NO: 6 is the amino acid sequence encoded by SEQ ID NO: 5.
(188) SEQ ID NO: 7 is a nucleotide sequence from Rheum tataricum encoding a resveratrol synthase (RES), which is codon-optimized for expression in S. cerevisiae.
(189) SEQ ID NO: 8 is the amino acid sequence encoded by SEQ ID NO: 7.
(190) SEQ ID NO: 9 is a nucleotide sequence from Vitis vinifera encoding a resveratrol synthase (VST1), which is codon-optimized for expression in S. cerevisiae.
(191) SEQ ID NO: 10 is the amino acid sequence encoded by SEQ ID NO: 9.
(192) SEQ ID NOs 11-16 are primer sequences appearing in Table 1, Example 1.
(193) SEQ ID Nos 17 to 22 are primer sequences used in Example 16a.
(194) SEQ ID Nos 23 to 26 are primer sequences used in Example 16b.
(195) SEQ ID Nos 27 to 30 are primer sequences used in Example 16c.