Method for the assay of liver fatty acid binding protein, ACE and CA 19-9 for the in vitro diagnosis of colorectal cancer

Abstract

A method for the in vitro diagnosis of colorectal cancer by determining the presence of Liver Fatty Acid-Binding Protein, ACE and CA19-9 tumor markers in a biological sample taken from a patient suspected of having colorectal cancer. Said method can be used for early diagnosis, screening, therapeutic follow-up and prognosis, and also for relapse diagnosis in relation to colorectal cancer.

Claims

1. A method comprising: assaying amounts of Liver Fatty Acid-Binding Protein (L-FABP), Carcinoembryonic Antigen (CEA), and Carbohydrate Antigen 19.9 (CA 19-9) in a biological fluid sample from a person suspected of having colorectal cancer.

2. The method as claimed in claim 1, wherein L-FABP, CEA, and CA 19-9 are assayed by a biochemical test or by mass spectrometry.

3. The method as claimed in claim 1, further comprising assaying for at least one member selected from the group consisting of Leukocyte Elastase Inhibitor, Ezrin, Aminoacylase 1, Intestinal Fatty Acid-Binding Protein, Apolipoprotein AI, Apolipoprotein AII, and Galectin-3.

4. The method as claimed in claim 1, further comprising assaying for at least one member selected from the group consisting of Beta2-Microglobulin, Proteasome 20S, L-Lactate Dehydrogenase Chain B, Calreticulin, Regenerating Islet-Derived Protein 3 Alpha, Tumor-Associated Calcium Signal Transducer 1, Keratin type II Cytoskeletal 8, Keratin type I Cytoskeletal 18, Keratin type I Cytoskeletal 19, Epithelial-Cadherin, Villin, CA 242, CA 50, CA 72-2, Testosterone, TIMP-1, Cripto-1, Intelectin-1, Protein Disulfide Isomerase, Cytokeratin 20, Translationally-Controlled Tumor Protein, (Pro)defensin-A5, methylated DNA in the blood, specific alterations in fecal DNA fragments, and fecal human hemoglobin.

5. The method as claimed in claim 1, further comprising assaying for at least one member selected from the group consisting of Beta2-Microglobulin, Proteasome 20S, L-Lactate Dehydrogenase Chain B, Calreticulin, Regenerating Islet-Derived Protein 3 Alpha, Tumor-Associated Calcium Signal Transducer 1, Epithelial-Cadherin, Testosterone, TIMP-1, Intelectin-1, Protein Disulfide Isomerase, Cytokeratin 20, Translationally-Controlled Tumor Protein, (Pro)defensin-A5, and fecal human hemoglobin.

6. The method as claimed in claim 1, further comprising assaying for Galectin-3.

7. The method as claimed in claim 1, further comprising assaying for Apolipoprotein AI.

8. The method as claimed in claim 1, further comprising assaying for Leukocyte Elastase Inhibitor.

9. The method as claimed in claim 1, further comprising assaying for Leukocyte Elastase Inhibitor and Aminoacylase 1.

10. The method as claimed in claim 1, further comprising assaying for Leukocyte Elastase Inhibitor, Aminoacylase 1, Beta2-Microglobulin, Proteasome 20S, PAP, and E-Cadherin.

11. The method as claimed in claim 1, further comprising assaying for Leukocyte Elastase Inhibitor, Aminoacylase 1, Beta2-Microglobulin, Proteasome 20S, Galectin-3, and Apolipoprotein AI.

12. The method as claimed in claim 1, wherein the biological fluid sample is a blood or serum sample.

13. The method as claimed in claim 1, wherein the biological fluid sample is a stool sample.

14. The method as claimed in claim 1, wherein the biological fluid sample is a urine sample.

15. The method as claimed in claim 1, wherein L-FABP, CEA, and CA 19-9 are assayed by a biochemical test.

16. The method as claimed in claim 1, wherein L-FABP, CEA, and CA 19-9 are assayed by an immunoassay.

17. The method as claimed in claim 1, wherein L-FABP, CEA, and CA 19-9 are assayed by ELISA.

18. The method as claimed in claim 1, wherein L-FABP, CEA, and CA 19-9 are assayed using antibodies specific for L-FABP, CEA, and CA 19-9.

19. The method as claimed in claim 1, wherein L-FABP, CEA, and CA 19-9 are assayed using an automated device.

20. A method comprising: assaying amounts of Liver Fatty Acid-Binding Protein (L-FABP), Carcinoembryonic Antigen (CEA), and Carbohydrate Antigen 19.9 (CA 19-9) in a biological fluid sample from a person suspected of having or having colorectal cancer.

21. The method as claimed in claim 20, further comprising assaying for at least one member selected from the group consisting of Leukocyte Elastase Inhibitor, Ezrin, Aminoacylase 1, Intestinal Fatty Acid-Binding Protein, Apolipoprotein AI, Apolipoprotein AII, and Galectin-3.

22. The method as claimed in claim 20, further comprising assaying for at least one member selected from the group consisting of Beta2-Microglobulin, Proteasome 20S, L-Lactate Dehydrogenase Chain B, Calreticulin, Regenerating Islet-Derived Protein 3 Alpha, Tumor-Associated Calcium Signal Transducer 1, Keratin type II Cytoskeletal 8, Keratin type I Cytoskeletal 18, Keratin type I Cytoskeletal 19, Epithelial-Cadherin, Villin, CA 242, CA 50, CA 72-2, Testosterone, TIMP-1, Cripto-1, Intelectin-1, Protein Disulfide Isomerase, Cytokeratin 20, Translationally-Controlled Tumor Protein, (Pro)defensin-A5, methylated DNA in the blood, specific alterations in fecal DNA fragments, and fecal human hemoglobin.

23. The method as claimed in claim 20, further comprising assaying for at least one member selected from the group consisting of Beta2-Microglobulin, Proteasome 20S, L-Lactate Dehydrogenase Chain B, Calreticulin, Regenerating Islet-Derived Protein 3 Alpha, Tumor-Associated Calcium Signal Transducer 1, Epithelial-Cadherin, Testosterone, TIMP-1, Intelectin-1, Protein Disulfide Isomerase, Cytokeratin 20, Translationally-Controlled Tumor Protein, (Pro)defensin-A5, and fecal human hemoglobin.

24. The method as claimed in claim 20, further comprising assaying for Galectin-3.

25. The method as claimed in claim 20, further comprising assaying for Apolipoprotein AI.

26. The method as claimed in claim 20, further comprising assaying for Leukocyte Elastase Inhibitor.

27. The method as claimed in claim 20, further comprising assaying for Leukocyte Elastase Inhibitor and Aminoacylase 1.

28. The method as claimed in claim 20, further comprising assaying for Leukocyte Elastase Inhibitor, Aminoacylase 1, Beta2-Microglobulin, Proteasome 20S, PAP, and E-Cadherin.

29. The method as claimed in claim 20, further comprising assaying for Leukocyte Elastase Inhibitor, Aminoacylase 1, Beta2-Microglobulin, Proteasome 20S, Galectin-3, and Apolipoprotein AI.

30. The method as claimed in claim 20, wherein the biological fluid sample is a blood or serum sample.

31. The method as claimed in claim 20, wherein the biological fluid sample is a stool sample.

32. The method as claimed in claim 20, wherein the biological fluid sample is a urine sample.

Description

(1) The invention will be understood more clearly by means of the following examples which are given by way of nonlimiting illustration, and also by means of the attached FIGS. 1 to 21, in which:

(2) FIG. 1 is a graph relating to the assaying by ELISA of LEI, in ng/ml, in the serum of patients having colorectal cancer (CRC+) and of healthy patients (CRC−),

(3) FIG. 2 is a graph relating to the assaying by ELISA of Ezrin, in ng/ml, in the serum of patients having colorectal cancer (CRC+) and of healthy patients (CRC−),

(4) FIG. 3 is a graph relating to the assaying by ELISA of Aminoacylase 1, in ng/ml, in the serum of patients having colorectal cancer (CRC+) and of healthy patients (CRC−),

(5) FIG. 4 is a graph relating to the assaying by ELISA of L-FABP, in ng/ml, in the serum of patients having colorectal cancer (CRC+) and of healthy patients (CRC−),

(6) FIG. 5 is a graph relating to the assaying by ELISA of I-FABP, in pg/ml, in the serum of patients having colorectal cancer (CRC+) and of healthy patients (CRC−),

(7) FIGS. 6A and 6B are graphs relating to the assaying by ELISA of Apolipoprotein AI, in μg/ml, in the serum of patients having colorectal cancer (CRC+) and of healthy patients (CRC−), either by microplate ELISA (FIG. 6A), or with the Lincoplex kit (FIG. 6B),

(8) FIG. 7 is a graph relating to the assaying, using the Linco multiplex kit, of Apolipoprotein AII, in μg/ml, in the serum of patients having colorectal cancer (CRC+) and of healthy patients (CRC−),

(9) FIG. 8 is a graph relating to the assaying by ELISA of I-Plastin, in RFV (relative fluorescence value), in the serum of patients having colorectal cancer (CRC+) and of healthy patients (CRC−),

(10) FIG. 9 is a graph relating to the assaying by ELISA of Beta2-Microglobulin, in ng/ml, in the serum of patients having colorectal cancer (CRC+) and of healthy patients (CRC−),

(11) FIG. 10 is a graph relating to the assaying by ELISA of ACE, in ng/ml, in the serum of patients having colorectal cancer (CRC+) and of healthy patients (CRC−),

(12) FIG. 11 is a graph relating to the assaying by ELISA of CA 19-9, in U/ml, in the serum of patients having colorectal cancer (CRC+) and of healthy patients (CRC−),

(13) FIG. 12 is a graph relating to the assaying by ELISA of Testosterone, in ng/ml, in the serum of patients having colorectal cancer (CRC+) and of healthy patients (CRC−),

(14) FIG. 13 is a graph relating to the assaying by ELISA of E-Cadherin, in ng/ml, in the serum of patients having colorectal cancer (CRC+) and of healthy patients (CRC−),

(15) FIG. 14 is a graph relating to the assaying by ELISA of PAP1, in ng/ml, in the serum of patients having colorectal cancer (CRC+) and of healthy patients (CRC−),

(16) FIG. 15 is a graph relating to the assaying by ELISA of Galectin-3, in RFV, in the serum of patients having colorectal cancer (CRC+) and of healthy patients (CRC−),

(17) FIG. 16 is a graph relating to the assaying by ELISA of LDH, in ng/ml, in the serum of patients having colorectal cancer (CRC+) and of healthy patients (CRC−),

(18) FIG. 17 is a graph relating to the assaying by ELISA of Proteasome 20S, in ng/ml, in the serum of patients having colorectal cancer (CRC+) and of healthy patients (CRC−),

(19) FIG. 18 is a graph relating to the assaying by ELISA of Aminoacylase 1, in ng/ml, in the stools of patients having colorectal cancer (CRC+) and of healthy patients (CRC−),

(20) FIG. 19 is a graph relating to the assaying by ELISA of Galectin-3, in RFV, in the stools of patients having colorectal cancer (CRC+) and of healthy patients (CRC−),

(21) FIG. 20 is a graph relating to the assaying by ELISA of Proteasome 20S, in RFV, in the stools of patients having colorectal cancer (CRC+) and of healthy patients (CRC−), and

(22) FIG. 21 is a graphic representation of an ELISPOT assay for LEI, for Ezrin and for Galectin-3, in number of spots per 10.sup.6 cancer cells of the Caco-2, HT-29 and HT29-B6 lines.

EXAMPLE 1: CLONING OF THE GENES ENCODING THE TUMOR MARKERS AND EXPRESSION OF THE RECOMBINANT PROTEINS

(23) 1. cDNA Amplification and Cloning

(24) The Caco-2 colorectal cancer line is cultured in DMEM medium containing 2 mM of L-glutamine, without FCS (fetal calf serum) (all Gibco).

(25) For the cloning of the LEI, L-FABP and Gal-3 genes, the messenger RNAs were extracted from a pellet of 10.sup.8 Caco-2 cells using the Invitrogen FastTrack 2.0 kit (Cat. No. 45-0019) according to the protocol supplied by the manufacturer. The reverse transcription and PCR steps are carried out in a single step using 450 ng of Caco-2 mRNA with the Superscript III One Step RT-PCR System kit (Invitrogen Cat. No. 12574-018) using the Platinum Taq DNA polymerase enzyme according to the protocol supplied by the manufacturer. The PCR primers used for the gene amplification are given in Table 1.

(26) TABLE-US-00001 TABLE 1 Genes and primers Oligonucleotides LEI OL215 5′-ATGGAGCAGCTGAGCTCAGCAAAC-3′ (SEQ ID No. 1) OL216 5′-CTAAGGGGAAGAAAATCTCCCCAA-3′ (SEQ ID No. 2) L-FABP Forward 5′-CGGAGCGTCTCCCATGAGTTTCTCCGGCA (SEQ ID No. 3) AGTA-3′ Reverse 5′-GAAATGCAGACTTGTCTAGATGCGCTTGC (SEQ ID No. 4) TGATGCGCTTGAAGACAATG-3′ Gal-3 OL217 5′-ATGGCAGACAATTTTTCGCTCC-3′ (SEQ ID No. 5) OL218 5′-TTATATCATGGTATATGAAGCACTGG-3′ (SEQ ID No. 6)

(27) The DNA fragments obtained were cloned into the vector pCR2.1 TOPO (LEI and Gal-3) with the TA cloning kit (Invitrogen Cat. No. K4520-01) or the vector pCMV6-XL4 from Origene (L-FABP) after digestion with Bsm BI and Xba I. The plasmids were sequenced in order to verify that the cDNA indeed complies with the expected sequence.

(28) For the cloning of the gene encoding Aminoacylase 1, the total RNA was extracted from a pellet of 10.sup.8 Caco-2 cells using the RNA Easy Mini kit from Qiagen, according to the protocol supplied by the manufacturer. The reverse transcription is carried out using 10 ng of Caco-2 RNA, with the Superscript II enzyme (Invitrogen) according to the protocol supplied by the manufacturer. The reverse transcription primer is an oligo(dT).

(29) The cDNA derived from this reaction was used as template in a PCR reaction using the AccuPrime Pfx kit (Invitrogen Cat. No. 12344-024) according to the protocol supplied by the manufacturer. The PCR primers are: ACY-1 Fwd2 (SEQ ID No. 7: 5′-GCGAATTCTTTAAGAAGGAGATATACATATGACGAGCAAAGGTCCGGAA GAGGAGCACCCATCG-3′) and ACY-1 Rev (SEQ ID No. 8: 5′-GCAAGCTTCAGCTGTCACTGGGCAGGGC-3′).

(30) Under these conditions, it was possible to amplify a 1.3 kb fragment which was cloned into a cloning vector of the Zero Blunt TOPO PCR cloning kit type (Invitrogen Cat. No. K2820-20). This plasmid was sequenced in order to verify that the cDNA indeed complies with the expected sequence.

(31) The following DNA fragment (SEQ ID No. 9) containing the I-FABP open reading frame was obtained by chemical synthesis, carried out by the company Geneart.

(32) TABLE-US-00002 SEQ ID No. 9: GGTACCGAATTCCGCGTTTGACAGCACTTGGAAGGTAGACCGGAGTGAAA ACTATGACAAGTTCATGGAAAAAATGGGTGTTAATATAGTGAAAAGGAAG CTTGCAGCTCATGACAATTTGAAGCTGACAATTACACAAGAAGGAAATAA ATTCACAGTCAAAGAATCAAGCGCTTTTCGAAACATTGAAGTTGTTTTTG AACTTGGTGTCACCTTTAATTACAACCTAGCAGACGGAACTGAACTCAGG GGGACCTGGAGCCTTGAGGGAAATAAACTTATTGGAAAATTCAAACGGAC AGACAATGGAAACGAACTGAATACTGTCCGAGAAATTATAGGTGATGAAC TAGTCCAGACTTATGTGTATGAAGGAGTAGAAGCCAAAAGGATCTTTAAA AAGGATTCTAGAGTCGACGAGCTC.

(33) 2. Expression Vector Construction

(34) The genes encoding LEI and Galectin-3 were subcloned into the prokaryotic expression vector pMR78.sup.71 and the L-FABP gene was cloned into the vector pET3d (New England Biolabs). The restriction sites necessary for the cloning were introduced by PCR using, as template, the plasmids pCR2.1 TOPO-LEI, pCR2.1 TOPO-Gal-3 and pCMV6-LFABP. The PCR enzyme is the Promega Pfu DNA polymerase, the PCR reaction was carried out according to the manufacturer's instructions, with the primers given in Table 2.

(35) TABLE-US-00003 TABLE 2 Genes and primers Oligonucleotides LEI OL228 5′-ATGGGAATTCAGGAGCAGCTGAGCTCAGC (SEQ ID No. 10) AA-3′ OL229 5′-CGATAAGCTTAAGGGGAAGAAAATCTCCC (SEQ ID No. 11) C-3′ L-FABP Forward 5′-GCTGGCCATGGGCAGCAGCCATCATCATC (SEQ ID No. 12) ATCATCACATGAGTTTCTCCGGCAAGTACCAA C-3′ Reverse 5′-GCACGGATCCTAGATGCGCTTGCTGATGC (SEQ ID No. 13) GCTTGAAGAC-3′ Gal-3 OL230 5′-ATGGGAATTCAGGCAGACAATTTTTCGCT (SEQ ID No. 14) CC-3′ OL231 5′-CGATAAGCTTATATCATGGTATATGAAGC (SEQ ID No. 15) ACTGG-3′

(36) The PCR products containing the open reading frames encoding LEI or Galectin-3 were digested with the Eco RI and Hind III restriction enzymes. The fragments were introduced into the vector pMR78 restricted with the same enzymes (plasmids pMR-LEI and pMR-Gal-3). The vector pMR78 contains a 6-histidine sequence in frame with the protein to be expressed, which enables purification by metal-chelate affinity chromatography. The L-FABP PCR product was cloned into the vector pET3d, at the Nco I and Bam HI restriction sites.

(37) For Aminoacylase 1, the TOPO cloning vector was directly digested with the Eco RI and Hind III restriction enzymes in order to generate a 1.3 kb fragment containing the acy1 open reading frame, which was introduced into the vector pStaby1 (Eurogentec). The recombinant plasmid is called pStaby1-ACY.

(38) For I-FABP, the cloning vector provided by Geneart was digested with the Eco RI and Sal I restriction enzymes in order to generate an approximately 400 bp fragment containing the coding sequence, which was introduced into the vector pMRCH79 (derived from the vector pMR78, bioMérieux). The recombinant plasmid is called pMRCH-IFABP.

(39) The plasmids pGEX-Ezrine and pGEX-I-Plastin, which make it possible to express, respectively, Ezrin and I-Plastin fused with GST (glutathione S-transferase), were supplied by the Institut Curie.

(40) 3. Recombinant Protein Expression and Purification

(41) The expression plasmids for producing the recombinant tumor markers are introduced into E. coli BL21 bacteria and derivatives (Stratagene). The cultures are carried out at ambient temperature with shaking. The precise culture conditions for each protein are reproduced in Table 3. IPTG is isopropyl-beta-D-1-thiogalactosidase.

(42) The bacterial pellets are taken up in 2×PBS (phosphate buffered saline) buffer and passed through a cell disintegrator at 1.5 kbar (Constant System). The lysates are centrifuged at 3000 g for 30 min at 4° C. The supernatant contains the soluble proteins. The pellet contains the inclusion bodies. The buffer for solubilizing the inclusion bodies depends on the protein.

(43) For LEI, the purification is carried out using the soluble fraction, on a column containing 5 mL of Ni-NTA-Sepharose resin (Qiagen) and the protein is eluted with 2×PBS containing 450 mM imidazole, pH 7.5.

(44) For Galectin-3, the inclusion bodies are solubilized in 2×PBS containing 1M urea, and passed over 5 mL of Ni-NTA-Sepharose resin (Qiagen) and the Gal-3 protein is eluted with 2×PBS containing 450 mM imidazole and 1M urea, pH 7.5.

(45) For L-FABP, the purification is carried out using the soluble fraction, with the Ni-IDA kit from Macherey-Nagel.

(46) TABLE-US-00004 TABLE 3 Culture IPTG Strain volume induction Purification LEI BL21 250 mL 0.1 mM Ni-NTA Gal-3 BL21-Codon 400 mL 0.5 mM Ni-NTA plus (DE3)-RIPL L-FABP BL21 500 mL 0.1 mM Ni-IDA GST-Ezrin BL21 250 mL 0.1 mM GST ACY-1 BL21-Codon 500 mL 0.1 mM other plus (DE3)-RIPL

(47) For GST-Ezrin, the purification is carried out using the inclusion bodies solubilized in 100 mM Tris buffer containing 8M urea and 10 mM DTT, by GST affinity chromatography. A column containing 5 mL of Glutathione Sepharose 4 fast flow gel (Amersham) is used. The equilibration and washing buffer is 2×PBS containing 0.05% Tween 20. The elution buffer is 50 mM Tris-HCl containing 20 mM reduced glutathione, pH 8.

(48) For Aminoacylase 1, the soluble fraction of the culture is passed over an Amersham HiTrap Q FF column and the ACY-1 protein was eluted with 0.3M NaCl at pH 7.5. Since several other proteins were co-eluted under these conditions, the purification was continued on a hydrophobic-interaction column (HIC Phenyl HP, Amersham). The ACY-1 protein was eluted with 0.5M NaCl at pH 7.

(49) The recombinant GST-I-Plastin protein was provided by the Institut Curie in purified form.

(50) The recombinant Calreticulin protein was produced by the company Proteus Services for Industry (Dijon, France). The sequence encoding Calreticulin was obtained by chemical synthesis.

EXAMPLE 2: PRODUCTION OF MONOCLONAL ANTIBODIES DIRECTED AGAINST THE TUMOR MARKERS

(51) 1. Animal Model

(52) The immunization experiments were carried out in female BALB/c (H-2.sup.d) mice that were 6 to 8 weeks at the time of the first immunization.

(53) 2. Immunogens and Immunizations

(54) In order to increase the immune responses obtained in the mice and to be able to generate monoclonal antibodies, the tumor markers were produced in the form of recombinant proteins produced according to the procedures described in Example 1. The LDH protein was obtained from the company SciPac (Cat. No. 103-133). These proteins were mixed volume for volume with Freund's adjuvant (Sigma), prepared in the form of a water-in-oil emulsion and which is known to have a good immunogenic capacity. 3 mice were immunized for each tumor marker. The mice received 3 successive doses of 10 μg of the immunogens at 0, 2 and 4 weeks. All the injections were given subcutaneously. The first injection is given as a mixture with complete Freund's adjuvant, the following two are given as a mixture with incomplete Freund's adjuvant. Between D50 and D70 after the first injection, the humoral responses were restimulated with an intravenous injection of 100 μg of the recombinant protein.

(55) 3. Monitoring of the Appearance of the Humoral Response

(56) In order to monitor the appearance of the antibodies, blood samples are taken regularly from the mice. The presence of the anti-tumor marker antibodies is tested using an ELISA. The protein of interest is used for capture (1 μg/well); after saturation, the antigen is reacted with various dilutions of the test sera (incubation at 37° C. for 1 h). The specific antibodies present in the serum are revealed with an AffiniPure goat anti-mouse IgG antibody conjugated to alkaline phosphatase (H+L, Jackson Immunoresearch, Cat no. 115-055-146), which binds to the antibodies being sought (0.1 μg/well).

(57) 4. Production of Monoclonal Antibodies

(58) Three days after the final injection, for each tumor marker, one of the immunized mice was sacrificed. The blood and the spleen were taken. The splenocytes obtained from the spleen were cultured with Sp2/0-Ag14 myeloma cells in order for them to fuse and become immortalized, according to the protocol described by Köhler and Milstein.sup.72,73. After an incubation period of 12-14 days, the supernatants of the hybridomas obtained were screened in order to determine the presence of anti-tumor marker antibodies, using the ELISA assay described in point 3 of this example. When GST fusion proteins were used as immunogen, the clones directed against GST are eliminated by carrying out an ELISA screening with uncoupled GST for capture. The positive hybridoma colonies were subcloned twice according to the limiting dilution technique, which is well known to those skilled in the art.

(59) 5. Characterization of the Monoclonal Antibodies by Immunoblotting

(60) The list of monoclonal antibodies obtained against the various tumor markers is given in Table 4. These monoclonal antibodies were analyzed by the Western blotting technique.

(61) TABLE-US-00005 TABLE 4 Tumor markers Monoclonal antibody name Leukocyte Elastase Inhibitor (LEI) 21B10A5 and 10E1H1 Ezrin 4A7A6C1 and 4A9H5 Aminoacylase 1 2A7F6 and 11H7D9 I-plastin 3D11D10, 8C8C5, 3A3H2, 8G2D2 Calreticulin 5C10H10 and 11B6D11 L-lactate dehydrogenase chain 3F11E11 and 12F10G8 B (LDH) Galectin-3 12F8A12 and 14A5G1

(62) 5.1. Methodology

(63) The Caco-2 and HT-29 line cell culture extracts are prepared by directly lyzing the cell pellet with 600 μl of an aqueous solution of 8.3M urea, 2M thiourea, 4% 3[(3-cholamidopropyl)dimethylammonio]-1-propane sulfonate (CHAPS), 100 mM DTT, 2% Servalyte 4-9 (Serva, Heidelberg, Germany) and 0.1 g/l Orange G, and then treated according to the NuPAGE Novex gel sample preparation protocol (Invitrogen). To obtain the tissue extracts, tumor and mucosal biopsies of patients GHBD001, GHBD004 and CLSP109 were dissected with a scalpel, and were then subjected to 10 cycles of extraction in the Medimachine system (Becton Dickinson) using 50-μm Medicons with 1 ml of PBS buffer containing 2.5 mM EDTA and protease inhibitors (tablets, Roche). These 10 ml of cell suspension are pooled, made up to 25 ml, and then centrifuged for 15 min at 600 g. The supernatant corresponds to the tissue extract which is treated according to the NuPAGE Novex gel sample preparation protocol. Reduced samples are used, at a final total protein concentration of 0.4 mg/ml. The deposit volume is 20 μl per well, on a NuPAGE Novex Bis-Tris 4-12% gel, with MOPS running buffer. After migration (at 200 V, for 1 hour) and transfer onto a PVDF membrane (at 400 mA, for 45 min), the quality of the transfer is assessed by staining with amido black.

(64) The membranes are saturated with 5% skimmed milk (Régilait) in a solution of TNT (15 mM Tris, 0.14M NaCl, 0.5% Tween 20, pH 8) at ambient temperature for 1 hour. After saturation, the membranes are incubated for 1 hour with the various test antibodies diluted to 10 μg/ml in the saturating solution. After rinsing with TNT, the membranes are incubated for 1 hour at ambient temperature with an anti-mouse-horseradish peroxidase conjugate diluted to 1:5000, (Cat No. 115-035-062, Jackson Immunoresearch) in the saturating solution. After rinsing, the developing is carried out with the Substrate Supersignal West Dura Extended kit (Cat No. 34076, Pierce) according to the recommended information for use.

(65) The chemiluminescence signal on the membranes was measured with the VersaDoc imaging system from Biorad. Based on the image of the Western blot, the volumes of the bands which correspond to the various tumor markers were evaluated with the QuantityOne software (Bio-Rad). The volume corresponds to the intensity of the chemiluminescence signal multiplied by the surface area of the band.

(66) 5.2. Results

(67) The Western blotting results are reproduced in Table 5, which gives the volume of the bands corresponding to the tumor marker of interest for the Western blotting analyses, as a function of the various samples tested. These results show that the tumor markers tested are indeed expressed by the Caco-2 and HT-29 colon cancer lines, and also in the tissues, as shown with the extracts of tumor and mucosa, obtained from the patients. The intensity of the signal obtained with an antibody on a sample can be compared to the signals obtained with the other samples and the same antibody. The technique used makes it possible to confirm the presence or absence of the marker in the tissue (non-remote sample) and the specificity of the antibodies with respect to the markers. This technique was not used in this example in the remote samples because it would not make it possible to come to a conclusion regarding the presence or absence of the tumor marker in the remote samples, nor to determine whether the concentration of said tumor marker is increased or decreased in said samples. Furthermore, the experimental scheme used does not make it possible to compare the reactivity of one antibody with another.

(68) TABLE-US-00006 TABLE 5 Tumor Tumor Mucosal Tumor Mucosal Tumor marker and tissue tissue tissue tissue tissue antibody Caco-2 HT-29 GHBD001 GHBD004 GHBD004 CLSP109 CLSP109 LEI 21B10A5 8365 7678 NT 60200 36506 NT NT 10E1H1 0 0 NT 13357  6893 NT NT Ezrin 4A9H5 7066 4742 NT NT NT 1588 2446 4A7A6C1 123436 116448 42480 15303 67439 NT NT Aminoacylase 1 2A7F6 10687 4787 NT NT NT 4477 7238 11H7D9 217664 232005 36093 10513 30233 NT NT I-plastin 3D11D10 136725 NT NT NT NT 275477  246564  8C8C5 557 1110  4364 77 0 NT NT Calreticulin 5C10H10 2842 3040 NT NT NT 2503 3294 11B6D11 3261 2937 NT NT NT 2070 2764 LDH 3F11E11 45391 NT NT NT NT 30411  13942  12F10G8 122907 154593 11841 15811 53285 NT NT Galectin-3 12F8A12 245712 65790 18262 12961  7307 NT NT 14A5G1 254531 120010 79833 98361 45872 NT NT NT: not tested.

(69) 5.3. Monoclonal Antibodies Directed Against I-Plastin

(70) In the patient GHBD004, the 8C8C5 antibody does not light up, or only very weakly lights up, the band which corresponds to I-Plastin. The presence of I-Plastin in these samples can be demonstrated using, for example, the 8G2D2 antibody, which has a better affinity for I-Plastin in blotting.

(71) Since I-Plastin is a member of a family of proteins comprising 2 other isoforms (L-Plastin and T-Plastin) with which it has more than 70% homology, we tested all the clones of monoclonal antibodies obtained, for their reactivity with respect to the GST-plastin-L and GST-Plastin-T proteins (provided by the Institut Curie). At the end of this screening, we selected the clones 3D11D10, 8C8C5, 3A3H2 and 8G2D2 which do not exhibit any cross-reactivity with the other members of the family. These antibodies are indeed specific for the I-Plastin isoform.

EXAMPLE 3: SERUM ASSAYS FOR THE TUMOR MARKERS

(72) 1. Patients and Specimens

(73) Blood samples are collected from a network of 8 clinical centers distributed throughout France, in the context of 2 Huriet-law protocols.

(74) In order to obtain serum, the blood sample is taken on a dry tube. In order to obtain plasma, the blood sample is taken on an EDTA tube. After coagulation, the tube is centrifuged for 10 min at 1000 g, and the serum is removed, aliquoted and stored at −80° C. The tube of plasma is directly centrifuged for 10 min at 1000 g, and the plasma is removed, aliquoted and stored at −80° C. The samples are completely documented for the clinical history of the patients.

(75) 2. Serum Assay for the LEI Tumor Marker

(76) The LEI protein was assayed using the antibodies described in Example 2 and an ELISA assay using the Vidas® automated device (bioMérieux). To do this, the ELISA assay was constructed using the reagents of the Vidas® HBs Ag Ultra kit (bioMérieux, Cat. No. 30315). The reagents were used as described in the corresponding information sheet (ref 11728 D-FR-2005/05), with the following modifications: 1. The cones were sensitized with the capture antibody 10E1H1 at a concentration of 10 μg/ml. 2. The content of the second well of the HBs Ag Ultra cartridge was replaced with 300 μl of revealing antibody 21B10A5, coupled to biotin, diluted to 1 μg/ml in the buffer of the second well of the Vidas® HBs Ag Ultra kit (buffer with goat serum and sodium azide at 1 g/l). 3. The serum, plasma or stool samples (50 μl) were diluted directly in the second well of the HBs Ag Ultra cartridge, pure or after a prior dilution to 1/20 in the buffer of the second well of the Vidas® HBs Ag Ultra kit (buffer with goat serum and sodium azide at 1 g/l). 4. The ELISA reaction was carried out using the Vidas® automated device and the protocol of the HBs Ag Ultra kit. 5. The results were obtained in the form of crude values after subtraction of the background noise (reading of the substrate before reaction).
A standard curve was established by assaying a range of concentrations of the tumor marker in the form of recombinant protein. The standard curve was plotted by reporting the concentration of the tumor marker along the x-axis and the signal read by Vidas® (RFV or Relative Fluorescence Value) along the y-axis. The concentration of tumor marker present in the body fluid to be assayed (blood, serum, plasma, stool) was calculated by reporting the concentration corresponding to the RFV signal read by Vidas®.

(77) The amounts obtained for the patients analyzed are reported in FIG. 1. It may be noted, on this figure, that 3 sera of patients having stage IV colorectal cancer and 1 serum of a patient having stage III colorectal cancer show a clear increase in their amount of serum LEI.

(78) 3. Serum Assay for the Ezrin Tumor Marker

(79) The Ezrin protein was assayed using the antibodies described in Example 2 and an ELISA assay using the Vidas® automated device (bioMérieux). To do this, the ELISA assay was constructed using the reagents of the Vidas® HBs Ag Ultra kit (bioMérieux, Cat. No. 30315). The reagents were used as described in the corresponding information sheet (ref. 11728 D-FR-2005/05), with the following modifications:

(80) 1. The cones were sensitized with the capture antibody 4A9H5 at a concentration of 30 μg/ml.

(81) 2. The content of the second well of the HBs Ag Ultra cartridge was replaced with 300 μl of revealing antibody 4A7A6C1, coupled to biotin, diluted to 1 μg/ml in the buffer of the second well of the Vidas® HBs Ag Ultra kit (buffer with goat serum and sodium azide at 1 g/l).

(82) 3. The serum, plasma and stool samples (50 μl) were diluted directly in the second well of the HBs Ag Ultra cartridge.

(83) 4. The ELISA reaction was carried out using the Vidas® automated device and the HBs Ag Ultra protocol, in which the step of incubating the sample with the capture and revealing antibodies had been taken to 100 cycles.

(84) 5. The results were obtained in the form of crude values after subtraction of the background noise (reading of the substrate before reaction).

(85) The concentration of the tumor marker present in the body fluid to be assayed (blood, serum, plasma, stool) was calculated according to the procedure described in paragraph 2 regarding the assaying of LEI.

(86) The amounts obtained for the patients analyzed are reported in FIG. 2. It may be noted, in this figure, that 3 sera from patients having stage IV colorectal cancer show a clear increase in their amount of serum Ezrin.

(87) 4. Serum Assay for the Aminoacylase 1 Tumor Marker

(88) The Aminoacylase 1 protein was assayed using the antibodies described in Example 2 and an ELISA assay using the Vidas® automated device (bioMérieux). To do this, the ELISA assay was constructed using the reagents of the Vidas® HBs Ag Ultra kit (bioMérieux, Cat. No. 30315). The reagents were used as described in the corresponding information sheet (ref 11728 D-FR-2005/05), with the following modifications: 1. The cones were sensitized with the capture antibody 2A7F6 at a concentration of 20 μg/ml. 2. The content of the second well of the HBs Ag Ultra cartridge was replaced with 300 μl of revealing antibody 11H7D9, coupled to biotin, diluted to 1 μg/ml in the buffer of the second well of the Vidas® HBs Ag Ultra kit (buffer with goat serum and sodium azide at 1 g/l). 3. The serum, plasma or stool samples (100 μl) were diluted directly in the second well of the HBs Ag Ultra cartridge. 4. The ELISA reaction was carried out using the Vidas® automated device and the HBs Ag Ultra protocol, in which the step of incubating the sample with the capture and revealing antibodies had been taken to 100 cycles. 5. The results were obtained in the form of crude values after subtraction of the background noise (reading of the substrate before reaction).

(89) The concentration of the tumor marker present in the body fluid to be assayed (blood, serum, plasma, stool) was calculated according to the procedure described in paragraph 2 regarding the assaying of LEI.

(90) The amounts obtained for the patients analyzed are reported in FIG. 3. It may be noted, in this figure, that 1 serum from a patient having stage II colorectal cancer, 1 serum from a patient having stage III colorectal cancer and 2 sera from patients having stage IV colorectal cancer show a clear increase in their amount of serum Aminoacylase 1.

(91) 5. Serum Assay for the L-FABP Tumor Marker

(92) We used an ELISA kit marketed by the company Hycult Biotechnology to assay the human L-FABP protein (Cat. No. HK404). This kit makes it possible to quantify the L-FABP protein in cell culture supernatants or in serum, plasma or urine, in order to determine the presence of lesions in the liver. We followed the procedure recommended by the manufacturer, with 2 modifications: the incubations were carried out at 37° C. and not at ambient temperature, the sera were diluted to 1/10.sup.th before the assay. The assaying of the L-FABP protein can be carried out by alternative techniques, well known to those skilled in the art.

(93) The results of the assaying of serum L-FABP in patients by ELISA are given in Table 6.

(94) TABLE-US-00007 TABLE 6 Pathological L-FABP condition.sup.a Sample identifier Nature Stage ng/ml CRC+ CLSP047/F0 Serum I 6.3 CRC+ CBSE025/F0 Serum I 14.1 CRC+ CLSP162/F0 Serum I 10.9 CRC+ GHBD011/F0 Serum I 17.2 CRC+ GHBD026/F0 Serum I 6.0 CRC+ GHBD060/F0 Serum I 8.6 CRC+ CBSE001/F0 Serum I 29.0 CRC+ CLSP007/F0 Serum I 19.3 CRC+ CLSP016/F0 Serum I 25.9 CRC+ CSEM003/F0 Serum I 30.3 CRC+ CLSP015/F0 Serum I 5.0 CRC+ CBSE011/F0 Serum I 10.3 CRC+ GHBD012/F0 Serum I 7.2 CRC+ CLSP150/F0 Serum I 4.9 CRC+ GHBD015/F0 Serum I 13.6 CRC+ CBSE016/F0 Serum I 10.3 CRC+ CBSE022/F0 Serum I 8.8 CRC+ CLSP118/F0 Serum I 7.1 CRC+ CLSP145/F0 Serum I 12.2 CRC+ CBSE011/F0 Serum I 7.6 CRC+ CLSP150/F0 Serum I 3.6 CRC+ GHBD003/F0 Serum I 9.1 CRC+ GHBD015/F0 Serum I 12.4 CRC+ CLSP059/F0 Serum I 16.3 CRC+ GHBD035/F0 Serum I 11.8 CRC+ CLSP146/F0 Serum I 21.7 CRC+ CLSP067/F0 Serum I 21.0 CRC+ CLSP100/F0 Serum I 21.6 CRC+ GHBD020/F0 Serum II 14.4 CRC+ GHBD025/F0 Serum II 7.7 CRC+ GHBD023/F0 Serum II 5.1 CRC+ GHBD029/F0 Serum II 10.5 CRC+ CLSP076/F0 Serum II 16.5 CRC+ CLSP087/F0 Serum II 7.6 CRC+ CLSP110/F0 Serum II 10.1 CRC+ GHBD047/F0 Serum II 34.5 CRC+ GHBD050/F0 Serum II 20.8 CRC+ CLSP060/F0 Serum II 18.6 CRC+ CLSP085/F0 Serum II 9.8 CRC+ GHBD021/F0 Serum II 8.1 CRC+ GHBD029/F0 Serum II 9.5 CRC+ CLSP086/F0 Serum II 7.4 CRC+ CLSP075/F0 Serum II 14.6 CRC+ CLSP063/F0 Serum II 12.6 CRC+ CLSP088/F0 Serum II 16.6 CRC+ GHBD009/F0 Serum II 13.1 CRC+ CBSE004/F0 Serum II 3.5 CRC+ CLSP136/F0 Serum II 12.3 CRC+ CLSP105/F0 Serum II 8.8 CRC+ CLSP096/F0 Serum II 9.7 CRC+ CLSP154/F0 Serum II 7.6 CRC+ CBSE004/F0 Serum II 4.7 CRC+ CLSP133/F0 Serum II 9.4 CRC+ CLSP136/F0 Serum II 8.9 CRC+ GHBD016/F0 Serum II 7.3 CRC+ P38868 s1 Serum II 13.1 CRC+ GHBD039/F0 Serum II 16.1 CRC+ GHBD066/F0 Serum II 18.0 CRC+ CLSP157/F0 Serum II 7.7 CRC+ CLSP107/F0 Serum II 17.0 CRC+ CLSP102/F0 Serum II 13.8 CRC+ CLSP093/F0 Serum II 25.9 CRC+ CLSP117/F0 Serum II 20.3 CRC+ CLSP115/F0 Serum II 50.4 CRC+ CBSE017/F0 Serum II 13.8 CRC+ CLSP143/F0 Serum II 14.2 CRC+ CLSP122/F0 Serum II 7.4 CRC+ CLSP119/F0 Serum II 16.7 CRC+ CLSP147/F0 Serum II 7.9 CRC+ CLSP050/F0 Serum III 15.7 CRC+ CLSP090/F0 Serum III 3.7 CRC+ CLSP089/F0 Serum III 5.8 CRC+ GHBD019/F0 Serum III 9.1 CRC+ GHBD037/F0 Serum III 14.1 CRC+ CLSP094/F0 Serum III 5.3 CRC+ GHBD059/F0 Serum III 22.4 CRC+ GHBD045/F0 Serum III 5.4 CRC+ CLSP081/F0 Serum III 7.5 CRC+ GHBD004/F0 Serum III 10.4 CRC+ CLSP072/F0 Serum III 6.6 CRC+ CLSP027/F0 Serum III 4.6 CRC+ CLSP072/F0 Serum III 15.5 CRC+ GHBD019/F0 Serum III 10.4 CRC+ GHBD007/F0 Serum III 42.3 CRC+ GHBD034/F0 Serum III 11.1 CRC+ CLSP078/F0 Serum III 53.0 CRC+ CLSP074/F0 Serum III 14.2 CRC+ CLSP044/F0 Serum III 5.0 CRC+ CBSE023/F0 Serum III 11.9 CRC+ CLSP074/F0 Serum III 9.5 CRC+ CLSP144/F0 Serum III 5.0 CRC+ CLSP044/F0 Serum III 4.1 CRC+ CLSP097/F0 Serum III 10.4 CRC+ CLSP098/F0 Serum III 11.5 CRC+ CLSP121/F0 Serum III 8.3 CRC+ GHBD005/F0 Serum III 7.9 CRC+ CBSE007/F0 Serum III 59.6 CRC+ GHBD037/F0 Serum III 14.1 CRC+ GHBD058/F0 Serum III 12.3 CRC+ CBSE010/F0 Serum III 23.3 CRC+ CBSE013/F0 Serum III 19.1 CRC+ CLSP091/F0 Serum III 18.6 CRC+ CLSP123/F0 Serum III 42.5 CRC+ CBSE006/F0 Serum III 11.8 CRC+ CLSP106/F0 Serum III 18.9 CRC+ CLSP141/F0 Serum III 28.9 CRC+ CLSP073/F0 Serum III 16.3 CRC+ CLSP069/F0 Serum III 9.7 CRC+ CLSP101/F0 Serum III 18.9 CRC+ CLSP103/F0 Serum III 7.2 CRC+ CLSP138/F0 Serum III 8.5 CRC+ CBSE005/F0 Serum III 21.0 CRC+ CLSP153/F0 Serum III 47.9 CRC+ CLSP068/F0 Serum IV 12.3 CRC+ CBSE026/F0 Serum IV 18.4 CRC+ CLSP057/F0 Serum IV 31.6 CRC+ GHBD027/F0 Serum IV 8.4 CRC+ CBSE021/F0 Serum IV 8.1 CRC+ CBSE027/F0 Serum IV 16.2 CRC+ CLSP052/F0 Serum IV 6.9 CRC+ CLSP068/F0 Serum IV 21.4 CRC+ CLSP109/F0 Serum IV 97.8 CRC+ CBSE012/F0 Serum IV 5.0 CRC+ CLSP079/F0 Serum IV 11.4 CRC+ CLSP083/F0 Serum IV 9.6 CRC+ GHBD022/F0 Serum IV 16.8 CRC+ CLSP095/F0 Serum IV 15.8 CRC+ CLSP161/F0 Serum IV 13.0 CRC+ GHBD056/F0 Serum IV 32.3 CRC+ CB5E027/F0 Serum IV 12.2 CRC+ CLSP109/F0 Serum IV 99.0 CRC+ GHBD071/F0 Serum IV 38.0 CRC+ GHBD030/F0 Serum IV 12.3 CRC+ CLSP156/F0 Serum IV 11.7 CRC+ CLSP159/F0 Serum IV 12.5 CRC+ CLSP042/F0 Serum IV 22.8 CRC+ CBSE019/F0 Serum IV 19.5 CRC+ CLSP160/F0 Serum IV 101.8 CRC+ CLSP132/F0 Serum IV 29.8 CRC+ CBSE008/F0 Serum IV 4.8 CRC+ CBSE003/F0 Serum IV 17.1 CRC− N017250 Serum HEALTHY 4.8 CRC− N017197 Serum HEALTHY 5.3 CRC− N018640 Serum HEALTHY 10.0 CRC− N006586 Serum HEALTHY 4.3 CRC− N376760 Serum HEALTHY 8.2 CRC− N750712 Serum HEALTHY 3.8 CRC− N491415 Serum HEALTHY 7.5 CRC− N857501 Serum HEALTHY 7.7 CRC− N858045 Serum HEALTHY 8.9 CRC− N518518 Serum HEALTHY 7.9 CRC− N511498 Serum HEALTHY 5.6 CRC− N858491 Serum HEALTHY 5.2 CRC− N418724 Serum HEALTHY 3.3 CRC− N417836 Serum HEALTHY 4.8 CRC− N318421 Serum HEALTHY 8.9 CRC− N858037 Serum HEALTHY 5.6 CRC− N318384 Serum HEALTHY 3.7 CRC− N418687 Serum HEALTHY 5.2 CRC− N418556 Serum HEALTHY 9.0 CRC− N858459 Serum HEALTHY 5.4 CRC− N519078 Serum HEALTHY 3.5 CRC− N748049 Serum HEALTHY 3.9 CRC− N55771- Serum HEALTHY 5.7 CRC− N37663- Serum HEALTHY 7.3 CRC− N593167 Serum HEALTHY 5.0 CRC− N418783 Serum HEALTHY 4.1 CRC− N49128- Serum HEALTHY 7.2 CRC− N857704 Serum HEALTHY 4.3 CRC− N147153 Serum HEALTHY 5.2 CRC− N146601 Serum HEALTHY 7.8 CRC− N469716 Serum HEALTHY 4.5 CRC− N593351 Serum HEALTHY 6.7 CRC− N519043 Serum HEALTHY 4.4 CRC− N491247 Serum HEALTHY 7.6 CRC− N511447 Serum HEALTHY 5.1 CRC− N836141 Serum HEALTHY 4.3 CRC− N370537 Serum HEALTHY 6.9 CRC− N836256 Serum HEALTHY 5.4 CRC− N557680 Serum HEALTHY 3.1 CRC− N469740 Serum HEALTHY 5.9 CRC− N418900 Serum HEALTHY 5.6 CRC− N836205 Serum HEALTHY 3.7 CRC− N748153 Serum HEALTHY 5.9 CRC− N148279 Serum HEALTHY 5.3 CRC− N511463 Serum HEALTHY 5.0 CRC− N314420 Serum HEALTHY 6.7 CRC− N146695 Serum HEALTHY 6.3 CRC− N318077 Serum HEALTHY 9.4 CRC− N148340 Serum HEALTHY 7.8 CRC− N148420 Serum HEALTHY 6.4 CRC− N491052 Serum HEALTHY 17.0 CRC− N858088 Serum HEALTHY 6.1 CRC− N469708 Serum HEALTHY 5.2 CRC− N593255 Serum HEALTHY 6.5 CRC− N887815 Serum HEALTHY 6.6 CRC− N491685 Serum HEALTHY 8.4 CRC− N511471 Serum HEALTHY 8.5 CRC− N148316 Serum HEALTHY 9.1 CRC− N835800 Serum HEALTHY 6.0 CRC− N440507 Serum HEALTHY 7.8 CRC− N858467 Serum HEALTHY 6.8 CRC− N748102 Serum HEALTHY 5.1 CRC− N325015 Serum HEALTHY 6.3 CRC− N557699 Serum HEALTHY 5.5 CRC− N687916 Serum HEALTHY 6.0 CRC− N557701 Serum HEALTHY 9.1 CRC− N862239 Serum HEALTHY 5.2 CRC− N314164 Serum HEALTHY 8.6 CRC− N858248 Serum HEALTHY 7.8 CRC− N376904 Serum HEALTHY 4.2 CRC− N491239 Serum HEALTHY 5.1 CRC− N83615- Serum HEALTHY 9.3 CRC− N557760 Serum HEALTHY 14.7 CRC− N519086 Serum HEALTHY 8.9 CRC− N836280 Serum HEALTHY 6.9 CRC− N83586- Serum HEALTHY 4.7 CRC− N488988 Serum HEALTHY 6.7 CRC− N518067 Serum HEALTHY 7.5 CRC− N491079 Serum HEALTHY 13.9 CRC− N440363 Serum HEALTHY 6.0 CRC− N748268 Serum HEALTHY 7.6 CRC− N469775 Serum HEALTHY 7.8 CRC− N376920 Serum HEALTHY 6.5 CRC− N491677 Serum HEALTHY 8.4 CRC− N418994 Serum HEALTHY 5.6 CRC− N491028 Serum HEALTHY 5.8 CRC− N491044 Serum HEALTHY 6.2 CRC− N518059 Serum HEALTHY 11.7 CRC− N748161 Serum HEALTHY 5.3 CRC− N858133 Serum HEALTHY 9.7 CRC− N557736 Serum HEALTHY 3.6 CRC− N491386 Serum HEALTHY 7.5 CRC− N527100 Serum HEALTHY 6.3 CRC− N857552 Serum HEALTHY 9.8 CRC− N469767 Serum HEALTHY 7.4 CRC− N518542 Serum HEALTHY 0.0 CRC− N49806- Serum HEALTHY 7.8 CRC− N858061 Serum HEALTHY 6.6 CRC− N491124 Serum HEALTHY 5.6 CRC− N030068 Serum HEALTHY 6.2 CRC− N143574 Serum HEALTHY 7.0 CRC− N836301 Serum HEALTHY 4.3 CRC− N146636 Serum HEALTHY 14.5 CRC− N314324 Serum HEALTHY 7.0 CRC− N491722 Serum HEALTHY 15.2 CRC− N370510 Serum HEALTHY 5.3 CRC− N836125 Serum HEALTHY 4.2 CRC− N836221 Serum HEALTHY 8.0 CRC− N518569 Serum HEALTHY 9.6 CRC− N744056 Serum HEALTHY 3.4 CRC− N148324 Serum HEALTHY 3.3 CRC− N314199 Serum HEALTHY 2.1 .sup.aCRC+: patients having colorectal cancer/CRC−: healthy individual

(95) FIG. 4 gives the results of this assay. In the serum panel that we tested, 41 patients out of 141 having colorectal cancer have a serum L-FABP concentration of greater than 17 ng/ml, whereas, in the control group, no individual exceeds this value. Among these 41 patients, are 8 patients with stage I colorectal cancer, 8 with stage II colorectal cancer, 13 with stage III colorectal cancer and 12 with stage IV colorectal cancer. The mean serum L-FABP concentration observed for 141 patients with colorectal cancer is 16.6±1.3 ng/ml. The mean value is 6.6±0.2 ng/ml for 112 healthy individuals (negative controls). This difference is statistically significant (P<0.0001, one-sided t-test with Welch's correction for unequal variances).

(96) 6. Serum Assay for the I-FABP Tumor Marker

(97) We used an ELISA kit marketed by the company Hycult Biotechnology to assay the human I-FABP protein (Cat. No. HK406). This kit makes it possible to quantify the I-FABP protein in cell culture supernatants or in serum, plasma or urine, in order to determine the presence of ischemic lesions in the small intestine. We followed the procedure recommended by the manufacturer. The assaying of the I-FABP protein can be carried out by alternative techniques, well known to those skilled in the art.

(98) FIG. 5 gives the results of this assay. In the serum panel that we tested, 15 patients out of 40 having colorectal cancer have a serum I-FABP concentration of greater than 40 pg/ml, whereas, in the control group, only 2 individuals out of 24 exceed this value. More clearly, 3 sera of patients having stage I colorectal cancer, 2 sera of patients having stage III colorectal cancer and 1 serum of a patient having stage IV colorectal cancer have a serum I-FABP concentration of greater than 100 pg/ml. No concentration above this value was found in the CRC− control group.

(99) 7. Serum Assay for the Apolipoprotein AI Tumor Marker

(100) The assaying of serum Apolipoprotein AI was carried out by means of two different immunoassay techniques. Firstly, we used a microplate sandwich ELISA. The 96-well plates were coated with the anti-Apo AI monoclonal antibody, clone 1404 (Biodesign Cat. No. H45404) at 1 μg per well. After 3 washes with PBS-0.05% Tween 20 (PBS-T), the plates were saturated with 10% milk in PBS-T for 1 h at 37° C. The plates were washed a further 3 times in PBS-T, 100 μl of the dilutions of the standard range or 100 μl of the 1/100 000 dilution of the test serum samples were deposited onto the plates, and the plates were incubated for 2 h at 37° C. The standard range was prepared by diluting the Apo AI protein (Biodesign Cat. No. A50620H) in PBS-T, BSA 1% (1.6 to 100 ng/ml). After 3 washes with PBS-T, the polyclonal detection antibody coupled to horseradish peroxidase (Biodesign Cat. No. K45452P) was added at 0.1 μg per well, and the plates were incubated for 2 h at 37° C. A further 3 washes with PBS-T were carried out, before adding the OptEIA substrate (BD), at 100 μl/well. After 20 min, when the development of the color had taken place, the reaction was stopped with 2N sulfuric acid and the absorbence at 450 nm was measured.

(101) FIG. 6A gives the results of this assay. We demonstrated a decrease in serum concentration of Apo AI in individuals with colorectal cancer. The mean concentration in 38 individuals with stage I to IV CRC is 675±36 μg/ml, whereas it is much higher in 27 healthy individuals (controls): 1040±39 μg/ml. This difference is statistically very significant (P<0.0001, one-sided t-test). By way of comparison, in 13 individuals with liver cancer, the mean serum concentration of Apo AI is 1175±87 μg/ml with the sandwich ELISA technique used. The decrease in the serum concentration demonstrates that Apo AI is therefore a specific marker of colorectal cancer, it being possible for this decrease to be demonstrated by means of an immunoassay.

(102) The second assaying technique that was used is a multiplex assay marketed by the company Linco, which makes it possible to assay several Apolipoproteins, including AI and AII, simultaneously, in the same sample (Cat. No. APO-62K). The procedure recommended by the manufacturer was applied.

(103) FIG. 6B gives the results of this assay. The decrease in the serum concentration of Apo AI in patients with CRC is confirmed with this second technique. The mean concentration of Apo AI in 34 individuals with stage I to IV CRC is 768±30 μg/ml, whereas it is much higher in 17 healthy individuals (controls): 1194±51 μg/ml. This difference is statistically very significant (P<0.0001, one-sided t-test).

(104) 8. Serum Assay for the Apolipoprotein AII Tumor Marker

(105) The assaying of serum Apolipoprotein AII was carried out with the Linco multiplex kit. FIG. 7 gives the results of this assay. We demonstrated a decrease in the serum concentration of Apo AII in the individuals with colorectal cancer. The mean concentration of Apo AII in 34 individuals with stage I to IV CRC is 170±11 μg/ml, whereas it is much higher in 17 healthy individuals (controls): 277±16 μg/ml. This difference is statistically very significant (P<0.0001, one-sided t-test).

(106) 9. Serum Assay for the I-Plastin Tumor Marker

(107) The I-Plastin protein was assayed using the antibodies described in Example 2 and an ELISA assay using the Vidas® automated device (bioMérieux). To do this, the ELISA assay was constructed using the reagents of the Vidas® HBs Ag Ultra kit (bioMérieux, Cat. No. 30315). The reagents were used as described in the corresponding information sheet (ref. 11728 D-FR-2005/05), with the following modifications: 1. The cones were sensitized with the capture antibody 3D11D10 at a concentration of 15 μg/ml. 2. The content of the second well of the HBs Ag Ultra cartridge was replaced with 300 μl of revealing antibody 8C8C5, coupled to biotin, diluted to 1 μg/ml in the buffer of the second well of the Vidas® HBs Ag Ultra kit (buffer with goat serum and sodium azide at 1 g/l). 3. The serum, plasma or stool samples (100 μl) were diluted directly in the second well of the HBs Ag Ultra cartridge. 4. The ELISA reaction was carried out using the Vidas® automated device and the HBs Ag Ultra protocol. 5. The results were obtained in the form of crude values after subtraction of the background noise (reading of the substrate before reaction).

(108) The concentration of the tumor marker present in the body fluid to be assayed (blood, serum, plasma, stool) was calculated according to the procedure described in paragraph 2 regarding the assaying of LEI.

(109) The amounts obtained for the patients analyzed are reported in FIG. 8. The 2 sera of patients having colorectal cancer who were tested show a clear increase in their amount of serum I-Plastin.

(110) 10. Serum Assay for the Group-B, ACE, CA19-9 and Galectin-3 Tumor Markers

(111) The Beta2-Microglobulin, ACE, CA19-9 and Testosterone tumor markers were assayed using the assay kits of the applicant, respectively Vidas® β2-microglobulin, Vidas® ACE, Vidas® CA19-9™ and Vidas® Testosterone, according to the procedure specific to each kit.

(112) The E-Cadherin protein was assayed using the E-Cadherin EIA kit (Takara Biochemicals, Tokyo, Japan) according to the procedure of the kit.

(113) The Regenerating Islet-Derived Protein 3 Alpha protein, otherwise known as Pancreatitis Associated Protein (PAP1), was assayed using the PANCREPAP ELISA kit (DynaBio, Marseilles, France) according to the procedure of the kit.

(114) The Galectin-3 and LDH proteins were assayed using the antibodies described in Example 2. The Proteasome 20 S was assayed using the antibodies described in patent EP 0434670. To do this, the ELISA assays were constructed using the Vidas® automated device (bioMérieux) and the reagents of the Vidas® HBs Ag Ultra kit (bioMérieux, Cat. No. 30315). The reagents were used as described in the corresponding information sheet (ref. 11728 D-FR-2005/05), with the following modifications: 1. The cones were sensitized with the capture antibody at a concentration of between 5 and 30 μg/ml. 2. The content of the second well of the HBs Ag Ultra cartridge was replaced with 300 μl of revealing antibody, coupled to biotin, diluted to 1 μg/ml in buffer with goat serum and sodium azide at 1 g/l. 3. The serum, plasma or stool samples were diluted directly in the second well of the HBs Ag Ultra cartridge after, if necessary, a dilution in buffer of the second well. 4. The ELISA reaction was carried out using the Vidas® automated device and the HBs Ag Ultra protocol. The step of incubating the sample with the capture and revealing antibodies was between 14 and 100 cycles. 5. The results were obtained in the form of crude values after subtraction of the background noise (reading of the substrate before reaction).

(115) The concentration of the tumor marker present in the body fluid to be assayed (blood, serum, plasma, stool) was calculated according to the procedure described in paragraph 2 regarding the assaying of LEI. The assay conditions for various tumor markers have been reproduced in Table 7.

(116) TABLE-US-00008 TABLE 7 Protein Galectin-3 LDH-B Proteasome 20 S Capture antibody 12F8A12 at 3F11E11 at GD6 at 30 μg/mL 15 μg/mL 10 μg/mL Revealing antibody 14A5G1 12F10G8 7A11 Goat Serum in dilution with with without buffer Stool volume 50 μL 50 μL 200 μL Serum volume 50 μL 50 μL 100 μL Sample deposit 2.sup.nd well 2.sup.nd well 1.sup.st well Incubation time 100 cycles 14 cycles 14 cycles

(117) The amounts obtained for the patients analyzed with the Beta2-Microglobulin, ACE, CA19-9, Testosterone, E-Cadherin, Regenerating Islet-Derived Protein 3 Alpha, Galectin-3, LDH and Proteasome 20S tumor markers have been reported respectively in FIGS. 9 to 17.

(118) Three sera of patients having colorectal cancer show an increase in their amount of serum β2-microglobulin.

(119) Ten sera of patients having colorectal cancer show an increase in their amount of serum ACE. More clearly, 1 serum of a patient having stage III colorectal cancer and 7 sera of patients having stage IV colorectal cancer show a considerable increase in their amount of serum ACE.

(120) Nine sera of patients having colorectal cancer show an increase in their amount of serum CA 19-9. More clearly, 1 serum of a patient having stage III colorectal cancer and 7 sera of patients having stage IV colorectal cancer show a considerable increase in their amount of serum CA 19-9.

(121) Ten sera of patients having colorectal cancer show a decrease in their amount of serum Testosterone. More clearly, 1 serum of a patient having stage II colorectal cancer, 1 serum of a patient having stage III colorectal cancer and 2 sera of patients having stage IV colorectal cancer show a fall in their amount of serum testosterone.

(122) Two sera of patients having colorectal cancer show an increase in their amount of serum Regenerating Islet-Derived Protein 3 Alpha.

(123) Four sera of patients having stage IV colorectal cancer, 2 sera of patients having stage III colorectal cancer and 1 serum of a patient having stage II colorectal cancer show a clear increase in their amount of serum Galectin-3.

EXAMPLE 4: USE OF THE SERUM ASSAYS FOR TUMOR MARKERS IN COMBINATION

(124) The applicant showed in Example 3 that abnormally elevated or abnormally reduced amounts of tumor markers could be observed in the bloodstream of certain patients having colorectal cancer. Surprisingly, the increase or the decrease in the amount, in the blood, of two given markers is not systematically observed in the same patients. As a result, the combination of several tumor markers makes it possible to increase the number of patients identified as having colorectal cancer. Thus, a patient A may present an increase or a decrease in one or more tumor markers (group X), it being possible for said markers of group X to be normal in a patient B; in this same patient B, one or more other tumor markers (group Y) may be elevated or reduced, it being possible for said markers of group Y to be normal in patient A.

(125) The various tumor markers assayed by the applicant may thus be combined by means of various mathematical algorithms well known to those skilled in the art. By way of illustration, and without this example being exhaustive in nature, the following method was carried out: 1. A threshold value was set for each tumor marker. 2. When the amount of the tumor marker in the blood was increased in the case of colorectal cancer, the amount in the blood, obtained for a given patient, was divided by its threshold value. When the amount of the tumor marker in the blood was decreased in the case of colorectal cancer, the amount in the blood, obtained for a given patient, was inverted and then multiplied by its threshold value. 3. When the “amount in the blood divided by threshold value” ratio was greater than 1, the ratio was multiplied by a coefficient, for example 10. The value thus obtained was named the “score”, for the patient studied, for the tumor marker under consideration. 4. The scores obtained for various tumor markers were added, with them being weighted by a factor specific to each marker. In the case of the example below, all the weighting factors were set at 1. 5. The sum of the scores was divided by the total number of scores added, and the value thus obtained was named the “total score”. 6. The patient is diagnosed as having colorectal cancer when his or her total score is increased relative to a threshold score.

(126) The total scores for a selection of 2, 3, 4, 5, 8 and 9 markers comprising L-FABP are given in Table 8.

(127) The combination of the L-FABP and LEI tumor markers thus makes it possible to obtain, for the same group of 79 patients, increased total scores “2” in 29 patients having colorectal cancer, whereas assaying L-FABP or LEI alone showed an increase, respectively, in 27 and 4 patients only.

(128) The combination of the L-FABP, ACE and CA19-9 tumor markers thus makes it possible to obtain, for the same group of 79 patients, increased total scores “3” in 48 patients having colorectal cancer, whereas assaying L-FABP, ACE or CA19-9 alone showed an increase, respectively, in 27, 23 and 12 patients only.

(129) The combination of the L-FABP, ACE, CA19-9 and Gal-3 tumor markers thus makes it possible to obtain, for the same group of 79 patients, increased total scores “4c” in 50 patients having colorectal cancer, whereas assaying L-FABP, ACE, CA19-9 or Gal-3 alone showed an increase, respectively, in 27, 23, 12 and 10 patients only.

(130) The combination of the L-FABP, ACE, LEI and Aminoacylase 1 tumor markers thus makes it possible to obtain, for the same group of 79 patients, increased total scores “4d” in 46 patients having colorectal cancer, whereas assaying L-FABP, ACE, LEI or Aminoacylase 1 alone showed an increase, respectively, in 27, 23, 4 and 3 patients only.

(131) The combination of the L-FABP, ACE, CA19-9 and ApoA1 tumor markers thus makes it possible to obtain, for the same group of 79 patients, increased total scores “4e” in 51 patients having colorectal cancer, whereas assaying L-FABP, ACE or CA19-9 alone showed an increase, respectively, in 27, 23 and 12 patients only, and assaying ApoA1 alone showed a decrease in 3 patients only.

(132) The combination of the L-FABP, ACE, CA19-9 and LEI tumor markers thus makes it possible to obtain, for the same group of 79 patients, increased total scores “4f” in 50 patients having colorectal cancer, whereas assaying L-FABP, ACE, CA19-9 or LEI alone showed an increase, respectively, in 27, 23, 12 and 4 patients only.

(133) The combination of the L-FABP, ACE, CA19-9, LEI and ACY tumor markers thus makes it possible to obtain, for the same group of 79 patients, increased total scores “5” in 50 patients having colorectal cancer, whereas assaying L-FABP, ACE, CA19-9, LEI or ACY alone showed an increase, respectively, in 27, 23, 12, 4 and 3 patients only.

(134) The combination of the L-FABP, ACE, LEI, ACY, Beta2-Microglobulin, Proteasome 20S, PAP and E-Cadherin tumor markers thus makes it possible to obtain, for the same group of 79 patients, increased total scores “8” in 52 patients having colorectal cancer, whereas assaying L-FABP, ACE, LEI, ACY, Beta2-Microglobulin, Proteasome 20S, PAP or E-Cadherin alone showed an increase, respectively, in 27, 23, 4, 3, 8, 5, 6 and 1 patient(s) only.

(135) The combination of the L-FABP, ACE, CA19-9, LEI, ACY, Beta2-Microglobulin, Proteasome 20S, PAP and E-Cadherin tumor markers thus makes it possible to obtain, for the same group of 79 patients, increased total scores “91” in 55 patients having colorectal cancer, whereas assaying L-FABP, ACE, CA19-9, LEI, ACY, Beta2-Microglobulin, Proteasome 20S, PAP or E-Cadherin alone showed an increase, respectively, in 27, 23, 12, 4, 3, 8, 5, 6 and 1 patient(s) only.

(136) The combination of the L-FABP, ACE, CA19-9, LEI, ACY, Beta2-Microglobulin, Proteasome 20S, Gal-3 and ApoA1 tumor markers thus makes it possible to obtain, for the same group of 79 patients, increased total scores “9j” in 60 patients having colorectal cancer, whereas assaying L-FABP, ACE, CA19-9, LEI, ACY, Beta2-Microglobulin, Proteasome 20S or Gal-3 alone showed an increase, respectively, in 27, 23, 12, 4, 3, 8, 5 and 10 patients only, and assaying ApoA1 alone showed a decrease in 3 patients only.

(137) TABLE-US-00009 TABLE 8 Pathological Sample L-FABP Total Total Total Total Total Total Total Total Total condition identifier Stage ng/ml score 2.sup.a score 3.sup.b score 4.sup.c score 4.sup.d score 4.sup.e score 4.sup.f score 5.sup.g score 8.sup.h score 9.sup.i Total score 9.sup.j Healthy N017250 4.77 0.19 0.19 0.19 0.17 0.19 0.17 0.17 0.38 0.33 0.17 individual Healthy N017197 5.26 0.20 0.28 0.28 0.25 0.25 0.23 0.23 0.25 0.23 0.23 individual Healthy N018640 10.01 0.33 0.29 0.22 0.26 0.29 0.24 0.24 0.34 0.30 0.19 individual Healthy N006586 4.32 0.37 0.51 0.42 0.27 0.51 0.50 0.41 0.23 0.35 0.32 individual Healthy N376760 8.21 0.46 0.62 0.67 0.42 0.62 0.58 0.46 0.38 0.43 0.48 individual Healthy N750712 3.78 0.13 0.26 0.27 0.13 0.26 0.21 0.17 0.14 0.17 0.19 individual Healthy N491415 7.53 0.24 0.22 0.26 0.14 0.22 0.17 0.16 0.14 0.15 0.18 individual Healthy N857501 7.65 0.29 0.43 0.40 0.30 0.43 0.35 0.28 0.28 0.27 0.28 individual Healthy N858045 8.90 0.52 0.25 0.29 0.27 0.25 0.31 0.25 0.24 0.23 0.26 individual Healthy N518518 7.95 0.48 0.35 0.28 0.35 0.35 0.38 0.31 0.30 0.27 0.24 individual Healthy N511498 5.63 0.19 0.23 0.21 0.15 0.23 0.18 0.15 0.14 0.14 0.14 individual Healthy N858491 5.23 0.18 0.15 0.24 0.12 0.15 0.13 0.11 0.11 0.11 0.16 individual Healthy N418724 3.32 0.25 0.11 0.15 0.14 0.11 0.16 0.12 0.16 0.14 0.17 individual Healthy N417836 4.82 0.33 0.19 0.32 0.22 0.19 0.24 0.19 0.26 0.23 0.30 individual Healthy N318421 8.89 0.36 0.40 0.49 0.33 0.40 0.35 0.28 0.33 0.29 0.36 individual Healthy N858037 5.61 0.40 0.17 0.31 0.23 0.17 0.24 0.19 0.25 0.21 0.29 individual Healthy N318384 3.74 0.23 0.20 0.27 0.21 0.20 0.21 0.17 0.26 0.22 0.25 individual Healthy N418687 5.22 0.41 0.21 0.25 0.28 0.21 0.29 0.23 0.32 0.27 0.28 individual Healthy N418556 9.02 0.52 0.24 0.32 0.30 0.24 0.30 0.24 0.33 0.28 0.33 individual Healthy N858459 5.37 0.18 0.38 0.35 0.32 0.38 0.29 0.26 0.29 0.25 0.25 individual Healthy N519078 3.50 0.35 0.08 0.16 0.18 0.08 0.18 0.14 0.18 0.15 0.19 individual Healthy N748049 3.92 0.13 0.49 0.41 0.12 0.49 0.37 0.30 0.12 0.26 0.25 individual Healthy N55771- 5.69 0.35 0.52 0.47 0.24 0.52 0.48 0.39 0.24 0.36 0.36 individual Healthy N37663- 7.25 0.36 0.55 0.56 0.26 0.55 0.48 0.39 0.30 0.40 0.42 individual Healthy N593167 5.04 0.33 0.37 0.46 0.25 0.37 0.36 0.31 0.25 0.30 0.37 individual Healthy N418783 4.12 0.37 0.32 0.35 0.22 0.32 0.37 0.29 0.30 0.34 0.36 individual Healthy N49128- 7.24 0.31 0.38 0.45 0.43 0.35 0.33 0.46 0.52 0.52 0.51 individual Healthy N857704 4.32 0.34 0.31 0.37 0.22 0.27 0.34 0.27 0.22 0.26 0.28 individual Healthy N147153 5.21 0.31 0.29 0.32 0.19 0.29 0.29 0.23 0.27 0.29 0.31 individual Healthy N146601 7.81 0.47 0.42 0.48 0.34 0.42 0.43 0.35 0.36 0.36 0.40 individual Healthy N469716 4.45 0.35 0.29 0.32 0.25 0.29 0.33 0.26 0.25 0.26 0.28 individual Healthy N593351 6.75 0.54 0.40 0.50 0.42 0.40 0.47 0.38 0.43 0.40 0.45 individual Healthy N519043 4.39 0.31 0.20 0.21 0.19 0.20 0.24 0.20 0.18 0.18 0.19 individual Healthy N491247 7.62 0.33 0.34 0.39 0.26 0.34 0.30 0.24 0.29 0.27 0.31 individual Healthy N511447 5.06 0.31 0.20 0.34 0.19 0.20 0.23 0.18 0.20 0.19 0.27 individual Healthy N836141 4.29 0.40 0.15 0.16 0.21 0.18 0.25 0.20 0.20 0.20 0.20 individual Healthy N370537 6.87 0.25 0.25 0.34 0.17 0.21 0.21 0.17 0.19 0.18 0.23 individual Healthy N836256 5.40 0.40 0.22 0.33 0.25 0.37 0.29 0.23 0.25 0.23 0.36 individual Healthy N557680 3.09 0.35 0.19 0.28 0.23 0.19 0.27 0.22 0.22 0.20 0.25 individual Healthy N469740 5.93 0.44 0.23 0.31 0.27 0.23 0.31 0.25 0.30 0.27 0.31 individual Healthy N418900 5.56 0.30 0.21 0.28 0.19 0.21 0.22 0.18 0.23 0.21 0.25 individual Healthy N836205 3.68 0.42 0.13 0.10 0.22 0.32 0.25 0.20 0.20 0.19 0.26 individual Healthy N748153 5.88 0.31 0.21 0.26 0.21 0.25 0.23 0.20 0.23 0.22 0.26 individual Healthy N148279 5.30 0.41 0.20 0.27 0.24 0.20 0.28 0.22 0.27 0.24 0.28 individual Healthy N511463 5.05 0.32 0.16 0.24 0.18 0.25 0.21 0.17 0.16 0.16 0.24 individual Healthy N314420 6.67 0.22 0.23 0.25 0.18 0.23 0.19 0.17 0.22 0.20 0.21 individual Healthy N146695 6.31 0.37 0.17 0.22 0.20 0.17 0.22 0.18 0.25 0.23 0.25 individual Healthy N318077 9.39 0.41 0.31 0.38 0.28 0.31 0.30 0.24 0.34 0.30 0.34 individual Healthy N148340 7.75 0.29 0.20 0.23 0.16 0.20 0.18 0.14 0.19 0.18 0.20 individual Healthy N148420 6.44 0.29 0.18 0.33 0.16 0.18 0.18 0.14 0.20 0.18 0.27 individual Healthy N491052 16.96 0.73 0.36 0.43 0.37 0.41 0.38 0.31 0.40 0.34 0.41 individual Healthy N858088 6.14 0.21 0.17 0.14 0.15 0.17 0.14 0.13 0.14 0.12 0.12 individual Healthy N469708 5.23 0.45 0.22 0.28 0.30 0.22 0.32 0.25 0.36 0.31 0.33 individual Healthy N593255 6.52 0.69 0.22 0.25 0.42 0.22 0.42 0.35 0.37 0.32 0.32 individual Healthy N887815 6.58 0.21 0.17 0.14 0.14 0.17 0.13 0.12 0.11 0.10 0.09 individual Healthy N491685 8.39 0.36 0.25 0.36 0.23 0.25 0.24 0.19 0.23 0.20 0.27 individual Healthy N511471 8.46 0.48 0.24 0.24 0.28 0.22 0.29 0.23 0.25 0.22 0.22 individual Healthy N148316 9.05 0.41 0.21 0.26 0.22 0.21 0.23 0.19 0.24 0.21 0.23 individual Healthy N835800 5.99 0.41 0.21 0.29 0.26 0.29 0.27 0.22 0.24 0.21 0.29 individual Healthy N440507 7.82 0.48 0.24 0.41 0.32 0.24 0.31 0.26 0.42 0.35 0.43 individual Healthy N858467 6.76 0.22 0.47 0.38 0.41 0.47 0.36 0.33 0.36 0.30 0.27 individual Healthy N748102 5.10 0.29 0.48 0.46 0.31 0.48 0.43 0.39 0.30 0.36 0.38 individual Healthy N325015 6.25 0.28 0.48 0.43 0.25 0.39 0.41 0.33 0.25 0.32 0.29 individual Healthy N557699 5.52 0.40 0.43 0.42 0.29 0.35 0.44 0.35 0.26 0.32 0.30 individual Healthy N687916 5.98 0.29 0.42 0.42 0.24 0.36 0.37 0.30 0.23 0.28 0.29 individual Healthy N557701 9.06 0.44 0.37 0.42 0.26 0.48 0.36 0.29 0.25 0.28 0.38 individual Healthy N862239 5.16 0.32 0.36 0.33 0.25 0.36 0.35 0.28 0.24 0.27 0.27 individual Healthy N314164 8.62 0.37 0.33 0.40 0.22 0.27 0.31 0.25 0.28 0.29 0.31 individual Healthy N858248 7.82 0.29 0.33 0.36 0.20 0.30 0.28 0.22 0.18 0.21 0.23 individual Healthy N376904 4.17 0.29 0.19 0.20 0.16 0.16 0.22 0.18 0.22 0.23 0.22 individual Healthy N491239 5.10 0.27 0.25 0.24 0.20 0.26 0.25 020 0.27 0.26 0.26 individual Healthy N83615- 9.28 0.46 0.30 0.28 0.27 0.34 0.32 0.25 0.25 0.24 0.27 individual Healthy N557760 14.65 0.50 0.41 0.47 0.29 0.51 0.34 0.27 0.27 0.26 0.38 individual Healthy N519086 8.94 0.46 0.29 0.33 0.27 0.26 0.31 0.25 0.26 0.25 0.26 individual Healthy N836280 6.85 0.42 0.20 0.15 0.21 0.25 0.26 0.21 0.19 0.19 0.20 individual Healthy N83586- 4.75 0.42 0.21 0.17 0.25 0.20 0.30 0.24 0.24 0.23 0.20 individual Healthy N488988 6.68 0.31 0.26 0.28 0.21 0.38 0.25 0.20 0.24 0.23 0.31 individual Healthy N518067 7.45 0.42 0.32 0.30 0.31 0.32 0.34 0.27 0.31 0.28 0.28 individual Healthy N491079 13.85 0.45 0.36 0.33 0.28 0.36 0.29 0.25 0.32 0.29 0.28 individual Healthy N440363 6.02 0.42 0.23 0.35 0.27 0.28 0.30 0.24 0.31 0.27 0.35 individual Healthy N748268 7.59 0.31 0.24 0.20 0.20 0.27 0.22 0.18 0.23 0.20 0.21 individual Healthy N469775 7.82 0.47 0.24 0.30 0.28 0.37 0.30 0.24 0.31 0.27 0.36 individual Healthy N376920 6.49 0.24 0.21 0.29 0.16 0.18 0.18 0.15 0.23 0.21 0.23 individual Healthy N491677 8.44 0.34 0.25 0.18 0.25 0.23 0.23 0.22 0.25 0.22 0.19 individual Healthy N418994 5.55 0.29 0.18 0.23 0.18 0.22 0.20 0.16 0.21 0.19 0.23 individual Healthy N491028 5.78 0.32 0.19 0.28 0.20 0.36 0.22 0.17 0.25 0.22 0.34 individual Healthy N491044 6.20 0.32 0.20 0.25 0.20 0.34 0.22 0.17 0.21 0.19 0.29 individual Healthy N518059 11.71 0.57 0.29 0.39 0.31 0.29 0.33 0.26 0.28 0.24 0.30 individual Healthy N748161 5.32 0.26 0.17 0.27 0.17 0.18 0.18 0.15 0.18 0.16 0.21 individual Healthy N858133 9.67 0.55 0.22 0.36 0.29 0.39 0.30 0.24 0.27 0.23 0.39 individual Healthy N557736 3.57 0.20 0.32 0.34 0.52 0.28 0.28 0.43 0.46 0.39 0.37 individual Healthy N491386 7.48 0.40 0.16 0.21 0.21 0.18 0.21 0.18 0.26 0.22 0.24 individual Healthy N527100 6.27 0.39 0.14 0.19 0.25 0.15 0.21 0.20 0.24 0.20 0.22 individual Healthy N857552 9.79 0.39 0.31 0.29 0.28 0.48 0.28 0.22 0.31 0.26 0.35 individual Healthy N469767 7.41 0.43 0.22 0.27 0.27 0.38 0.27 0.22 0.33 0.28 0.37 individual Healthy N518542 0.00 0.14 0.05 0.09 0.11 0.21 0.11 0.09 0.11 0.10 0.18 individual Healthy N49806- 7.77 0.43 0.20 0.26 0.25 0.31 0.25 0.20 0.23 0.20 0.28 individual Healthy N858061 6.55 0.61 0.22 0.40 0.38 0.30 0.38 0.30 0.35 0.29 0.40 individual Healthy N491124 5.63 0.22 0.31 0.29 0.18 0.31 0.26 0.22 0.21 0.23 0.23 individual Healthy N030068 6.20 0.27 0.33 0.31 0.26 0.33 0.29 0.24 0.36 0.33 0.25 individual Healthy N143574 7.02 0.25 0.37 0.37 0.27 0.37 0.30 0.24 0.44 0.40 0.38 individual Healthy N836301 4.34 0.26 0.26 0.34 0.23 0.26 0.26 0.20 0.57 0.51 0.44 individual Healthy N146636 14.49 0.64 0.35 0.51 0.35 0.35 0.37 0.30 0.49 0.43 0.50 individual Healthy N314324 7.03 0.24 0.27 0.20 0.16 0.27 0.22 0.19 0.43 0.41 0.28 individual Healthy N491722 15.21 0.63 0.39 0.29 0.39 0.39 0.38 0.34 0.42 0.38 0.32 individual Healthy N370510 5.34 0.20 0.32 0.30 0.23 0.32 0.26 0.21 0.36 0.33 0.27 individual Healthy N836125 4.22 0.45 0.13 0.13 0.23 0.13 0.26 0.21 0.32 0.30 0.29 individual Healthy N836221 7.98 0.28 0.33 0.35 0.24 0.33 0.27 0.22 0.36 0.33 0.34 individual Healthy N518569 9.64 0.30 0.29 0.29 0.20 0.29 0.23 0.19 0.45 0.41 0.30 individual Healthy N744056 3.37 0.16 0.33 0.33 0.14 0.33 0.28 0.23 0.32 0.35 0.30 individual Healthy N148324 3.33 0.16 0.20 0.26 0.13 0.20 0.18 0.15 0.41 0.38 0.35 individual Healthy N314199 2.10 0.08 0.21 0.23 0.13 0.21 0.17 0.14 0.30 0.29 0.19 individual Benign T. CLSP148 5.73 0.22 0.15 0.25 0.12 0.15 0.14 0.11 0.19 0.17 0.22 Benign T. CLSP149 111.39 32.90 21.93 16.50 16.46 21.93 16.47 13.18 13.22 11.02 9.48 Benign T. CLSP108 4.34 0.17 0.12 0.19 0.12 0.12 0.11 0.10 0.18 0.16 0.19 Benign T. CLSP120 8.41 0.29 0.18 0.23 0.16 0.18 0.16 0.13 0.18 0.15 0.18 Benign T. CLSP116 17.64 5.26 3.74 2.92 2.73 3.74 2.83 2.27 2.27 1.96 1.75 Benign T. CLSP142 6.55 0.32 0.27 0.25 0.27 0.27 0.27 0.21 0.27 0.23 0.22 Benign T. CLSP099 17.72 5.25 3.59 2.81 2.74 3.59 2.70 2.19 2.26 1.88 1.68 Benign T. CLSP055 5.74 0.24 0.17 0.22 0.16 0.17 0.16 0.13 0.16 0.13 0.17 Benign T. CLSP061 10.96 0.37 0.39 0.37 0.20 0.39 0.32 0.25 0.22 0.26 0.26 CRC+ CLSP104 0 10.91 0.46 4.45 3.48 0.29 4.45 3.40 2.72 0.38 2.39 2.13 CRC+ CBSE025 I 14.10 0.58 0.51 0.51 0.41 0.51 0.46 0.37 0.37 0.34 0.34 CRC+ CLSP146 I 21.72 6.57 4.42 3.49 3.32 3.44 3.40 2.72 2.76 2.35 1.91 CRC+ CBSE011 I 10.30 0.57 0.25 0.25 0.31 0.27 0.32 0.26 0.27 0.24 0.25 CRC+ CLSP067 I 20.99 6.28 4.18 3.23 3.18 4.18 3.19 2.55 2.56 2.14 1.89 CRC+ CLSP118 I 7.10 0.27 0.15 0.21 0.14 0.16 0.14 0.11 0.18 0.16 0.19 CRC+ CBSE016 I 10.35 0.42 6.84 6.84 5.23 5.16 5.19 4.19 4.25 3.54 3.05 CRC+ CLSP100 I 21.61 6.39 4.46 3.46 3.31 3.46 3.35 2.68 2.68 2.26 1.81 CRC+ CLSP145 I 12.23 0.45 0.34 0.48 0.28 0.34 0.30 0.24 0.27 0.24 0.33 CRC+ CLSP047 I 6.30 0.23 0.20 0.25 0.17 0.20 0.17 0.14 2.16 1.85 1.67 CRC+ CLSP059 I 16.34 0.53 0.46 0.40 0.35 0.38 0.37 0.30 0.33 0.29 0.26 CRC+ CLSP157 II 7.65 0.29 0.23 0.31 0.19 0.23 0.20 0.16 0.19 0.17 0.23 CRC+ CLSP107 II 17.01 5.06 3.73 2.87 2.66 3.73 2.82 2.26 2.18 1.93 1.69 CRC+ CLSP102 II 13.79 0.49 0.46 0.52 0.26 3.09 0.38 0.30 0.25 0.29 1.68 CRC+ CBSE004 II 4.75 19.61 0.41 0.41 9.94 0.35 10.05 8.04 7.99 6.73 5.79 CRC+ CLSP154 II 7.57 0.42 5.06 3.93 3.81 3.84 3.89 3.12 3.12 2.66 2.08 CRC+ CLSP136 II 12.34 0.48 0.46 0.56 0.32 0.41 0.40 0.32 0.32 0.33 0.38 CRC+ CLSP096 II 9.67 0.34 10.09 7.65 7.52 7.62 7.60 6.08 6.04 5.09 3.88 CRC+ CLSP093 II 25.85 7.66 5.24 4.01 3.88 5.24 3.95 3.16 3.15 2.67 2.33 CRC+ CLSP117 II 20.32 6.16 4.24 3.41 3.20 3.37 3.26 2.61 2.68 2.27 1.92 CRC+ CLSP133 II 9.37 0.30 0.30 0.37 0.18 0.28 0.23 0.19 0.19 0.19 0.25 CRC+ CLSP115 II 50.36 14.98 10.09 10.14 7.59 7.80 7.63 6.10 6.15 5.15 5.27 CRC+ CBSE017 II 13.84 0.45 8.84 8.84 6.74 6.79 6.65 5.42 5.44 4.56 4.00 CRC+ CLSP085 II 9.77 0.39 0.28 0.37 0.23 0.28 0.26 0.21 0.22 0.20 0.26 CRC+ CLSP143 II 14.20 0.46 4.10 3.20 3.07 3.25 3.09 2.48 2.52 2.12 1.74 CRC+ CLSP110 II 10.12 0.36 0.23 0.26 0.19 0.23 0.20 0.16 0.21 0.19 0.21 CRC+ CLSP060 II 18.62 5.64 4.01 3.15 2.93 4.01 3.08 2.46 2.42 2.11 1.89 CRC+ CLSP122 II 7.35 0.26 0.47 0.51 0.29 2.94 0.38 0.30 0.33 0.33 1.61 CRC+ CLSP119 II 16.72 0.55 0.36 0.47 0.28 2.85 0.30 0.24 0.33 0.29 1.61 CRC+ CLSP147 II 7.94 0.29 0.26 2.87 0.21 0.32 0.22 0.18 0.35 0.29 1.62 CRC+ CLSP105 II 8.80 0.41 12.03 11.73 8.90 9.07 9.10 7.28 7.17 6.11 5.96 CRC+ CLSP075 II 14.61 0.49 0.40 0.37 0.30 0.40 0.33 0.26 0.30 0.27 0.27 CRC+ CLSP088 II 16.64 0.53 11.70 8.78 5.34 11.70 8.80 7.04 5.37 6.58 5.75 CRC+ CLSP086 II 7.36 0.25 83.24 62.51 62.37 83.24 62.45 49.96 49.91 41.65 35.74 CRC+ GHBD020 II 14.40 0.47 0.38 0.34 0.27 0.38 0.31 0.26 3.09 2.77 1.78 CRC+ GHBD029 II 10.52 0.34 0.33 0.36 0.26 0.33 0.26 0.27 0.46 0.44 0.41 CRC+ GHBD025 II 7.67 0.25 0.22 0.37 0.16 0.22 0.18 0.15 2.49 2.19 2.17 CRC+ CLSP076 II 16.46 0.51 0.40 0.41 0.32 0.40 0.31 0.26 2.85 2.53 1.59 CRC+ CBSE007 III 59.64 17.94 11.83 11.83 17.31 8.90 9.05 13.88 13.95 11.65 10.00 CRC+ CBSE010 III 23.32 7.00 34.14 34.14 3.76 34.14 25.66 20.56 3.03 17.15 17.15 CRC+ CBSE013 III 19.10 5.66 4.25 4.25 3.05 3.30 3.21 2.64 2.54 2.28 2.02 CRC+ CBSE023 III 11.91 0.45 0.56 0.56 0.36 0.46 0.47 0.38 0.37 0.38 0.35 CRC+ CLSP091 III 18.63 5.57 4.05 3.13 2.99 4.05 3.07 2.46 2.40 2.06 1.81 CRC+ CLSP144 III 4.98 0.18 0.35 0.26 0.21 0.30 0.28 0.22 0.21 0.22 0.18 CRC+ CLSP123 III 42.46 12.72 8.50 9.33 6.41 8.50 6.48 5.18 5.28 4.44 5.49 CRC+ CBSE006 III 11.78 10.90 0.34 0.34 16.22 0.33 5.53 13.02 12.98 10.85 9.34 CRC+ CLSP097 III 10.37 0.36 0.32 0.29 0.22 0.28 0.27 0.21 0.21 0.21 0.20 CRC+ CLSP106 III 18.88 5.63 3.76 2.95 2.81 3.76 2.85 2.28 2.29 1.93 1.73 CRC+ CLSP141 III 28.93 8.60 5.77 4.52 4.34 5.77 4.36 3.49 3.52 2.95 2.64 CRC+ CLSP073 III 16.34 0.55 8.64 6.54 0.37 6.69 6.51 5.21 0.32 4.36 3.41 CRC+ CLSP069 III 9.72 0.33 0.41 0.41 0.22 0.44 0.33 0.26 0.22 0.26 0.31 CRC+ CLSP121 III 8.28 0.34 0.27 2.76 0.21 0.24 0.25 0.20 0.26 0.25 1.49 CRC+ CLSP101 III 18.92 5.59 3.96 3.20 2.94 3.21 2.98 2.39 2.39 2.02 1.74 CRC+ CLSP103 III 7.16 0.29 0.22 0.24 0.18 0.24 0.20 0.16 0.22 0.19 0.22 CRC+ CLSP098 III 11.49 0.38 0.31 0.23 0.24 0.30 0.25 0.20 0.21 0.19 0.18 CRC+ CLSP138 III 8.51 0.34 4.79 3.72 3.62 4.79 3.64 2.91 3.03 2.54 2.25 CRC+ CLSP044 III 4.98 0.23 51.43 38.69 38.56 38.62 38.61 30.89 30.88 25.77 19.41 CRC+ CBSE005 III 20.97 15.29 4.30 3.43 17.66 4.30 7.78 14.23 28.03 24.10 20.61 CRC+ CLSP074 III 14.21 0.47 0.48 0.42 0.29 0.41 0.39 0.32 0.26 0.29 0.27 CRC+ CLSP153 III 47.87 14.16 25.18 18.89 14.45 25.18 18.91 15.14 11.09 11.94 10.90 CRC+ CLSP050 III 15.69 0.49 0.44 0.41 0.32 0.44 0.34 0.28 3.34 2.88 2.56 CRC+ CLSP072 III 15.50 0.49 5.98 4.63 0.45 5.98 4.50 3.60 3.56 5.36 4.76 CRC+ CLSP089 III 5.75 0.20 12.91 9.88 9.53 12.91 9.70 7.77 8.92 8.01 7.73 CRC+ CLSP078 III 53.04 15.76 10.48 7.96 7.90 10.48 7.92 6.34 4.24 3.78 4.20 CRC+ GHBD019 III 10.37 0.34 3.57 2.76 2.70 3.57 2.69 2.16 1.66 1.47 1.57 CRC+ CLSP159 IV 12.45 0.52 53.31 42.90 25.12 53.31 40.06 32.05 20.24 26.83 24.66 CRC+ CBSE012 IV 4.98 0.23 7.49 7.49 0.32 7.49 5.66 4.52 0.33 3.83 3.83 CRC+ CLSP042 IV 22.79 16.50 80.47 63.87 65.23 80.47 65.24 52.32 52.23 43.64 39.42 CRC+ CLSP161 IV 12.99 0.43 9.27 7.13 6.82 7.00 6.97 5.58 5.53 4.71 3.65 CRC+ CBSE019 IV 19.47 5.80 4.26 4.26 3.12 3.44 3.22 2.58 2.52 2.17 2.00 CRC+ CLSP057 IV 31.56 9.53 13.81 10.59 10.41 13.81 10.46 8.37 8.44 7.07 6.20 CRC+ CLSP160 IV 101.79 30.07 20.33 15.36 15.22 20.33 15.27 12.22 12.25 10.25 8.85 CRC+ CLSP095 IV 15.79 0.65 74.92 56.37 56.10 56.24 56.28 45.03 44.92 37.56 28.28 CRC+ CLSP132 IV 29.79 8.84 6.23 7.57 4.53 4.83 4.70 3.76 3.74 3.24 3.95 CRC+ CBSE008 IV 4.77 0.18 0.20 0.16 0.36 0.20 0.17 0.32 0.37 0.34 0.31 CRC+ CBSE003 IV 17.08 5.07 72.70 54.58 48.16 72.70 54.54 43.72 32.36 31.45 36.47 CRC+ CLSP068 IV 21.38 6.64 241.47 184.41 128.03 241.47 181.27 145.03 84.44 100.51 115.01 CRC+ CBSE026 IV 18.36 5.71 171.19 128.55 75.29 171.19 128.54 102.84 46.46 67.29 75.20 CRC+ CLSP156 IV 11.69 0.38 36.88 32.92 17.04 36.88 27.67 22.15 11.68 15.55 20.63 CRC+ CBSE021 IV 8.06 0.36 121.06 90.93 90.62 121.06 90.86 72.69 54.24 47.58 54.30 Threshold 16.96 0.73 0.62 0.67 0.52 0.62 0.58 0.46 0.57 0.52 0.51 Specificity (%) 100 100 100 100 100 100 100 100 100 100 100 Sensitivity (%) 33.75 36.25 60.00 62.50 57.50 63.75 62.50 62.50 65.00 68.75 75.00 CRC + greater than 27 29 48 50 46 51 50 50 52 55 60 the threshold .sup.acombination of L-FABP and LEI .sup.bcombination of L-FABP, ACE and CA 19-9 .sup.ccombination of L-FABP, ACE, CA 19-9 and Gal-3 .sup.dcombination of L-FABP, ACE, ACY and LEI .sup.ecombination of L-FABP, ACE, CA 19-9 and Apo A1 .sup.fcombination of L-FABP, ACE, CA 19-9 and LEI .sup.gcombination of L-FABP, ACE, CA 19-9, LEI and ACY .sup.hcombination of L-FABP, ACE, LEI, ACY, Beta2-Microglobulin, E-Cadherin, PAP and Proteasome 20S .sup.i:combination of L-FABP, ACE, CA19-9, LEI, ACY, Beta2-Microglobulin, E-Cadherin, PAP and Proteasome 20S .sup.j:combination of L-FABP, ACE, CA19-9, LEI, ACY, Beta2-Microglobulin, Gal-3, Apo A1 and Proteasome 20S

EXAMPLE 5: FECAL TUMOR MARKER ASSAYS

(138) The stools are extracted using a piece weighing approximately 1 g, to which 10 ml of 100 mM sodium phosphate buffer, pH 7.2, containing 1 g/L of azide are added. The mixture is homogenized on a vortex for 1 min. The sample is then subjected to 4 cycles of ultrasound for 7 s on ice. The unsolubilized fraction is removed by centrifugation at 2000 g, for 10 min at 4° C. The supernant is stored at −30° C. until it is assayed.

(139) The ELISA assays described in Example 3 were used to search for the tumor markers in the stools after, if necessary, an appropriate dilution of the stools in the buffer of the first well of the HBs Ag Ultra cartridge.

(140) The assay determinations with the tests, Aminoacylase 1, Galectin-3 and Proteasome 20S, have been represented, respectively, in FIGS. 18 to 20. An increase in the amount of Aminoacylase 1, of Galectin-3 and of Proteasome 20S is observed, respectively, for 10, 14 and 8 stools of patients having colorectal cancer.

EXAMPLE 6: DETECTION OF THE TUMOR MARKERS BY THE ELISPOT TECHNIQUE

(141) 1. Cell Culture

(142) The LnCAP prostate cancer line is cultured in RPMI 1640 medium supplemented with 2 mM L-glutamine, 10 mM HEPES, 1 mM sodium pyruvate and 10% FCS (all Gibco). The cells are used as a negative control.

(143) The Caco-2 colorectal cancer line is cultured in DMEM medium containing 2 mM L-glutamine, without FCS (all Gibco).

(144) The HT-29 colorectal cancer line is cultured in MEM medium containing 2 mM L-glutamine and 10% FCS (all Gibco).

(145) The HT-29/B6 colorectal cancer line is cultured in DMEM medium containing 4 mM L-glutamine, without FCS (all Gibco).

(146) The cells are maintained at 37° C., in an incubator with 5% CO.sub.2.

(147) 2. The ELISPOT Technique

(148) This procedure makes it possible to determine the number of cells secreting the protein. The 96-well ELISPOT plates with PVDF membranes (Multiscreen IP, Millipore) are coated with the mouse anti-tumor marker monoclonal antibody at 10 μg/ml (capture antibody, see Table 9 below, which gives the antibodies used in ELISPOT), 100 μl per well, in sterile PBS, overnight at +4° C. The plates are then washed with PBS and saturated with culture medium containing 10% FCS. In parallel, the cells are trypsinized, counted, and then diluted to 10.sup.5 cells/ml. 200 μl of this cell suspension are distributed per well, as are cascade dilutions of this stock solution. The plates are then incubated for 20 h at 37° C. in a humid atmosphere at 5% CO.sub.2, and then washed with PBS containing 0.05% Tween-20. The remaining cells are then lyzed by treatment with ice-cold water for 10 minutes, and then the plates are again washed. The revealing antibody, the biotinylated monoclonal directed against the tumor marker to be assayed (Table 9), is then added at 0.1 μg/well (incubation for 2 h at ambient temperature). The spots are revealed by adding extravidin-alkaline phosphatase (Sigma) and the substrate 5-bromo-4-chloro-3-indolyl phosphate/nitro blue tetrazolium (BCIP/NBT, Biorad). The background noise corresponds to the number of spots measured in the LnCap wells and varies between 0 and 8 spots under the reading conditions used. The average number of nonspecific spots was subtracted from the specific signal.

(149) TABLE-US-00010 TABLE 9 Marker Capture Ab Detection Ab LEI 10E1H1 21B10A5 Ezrin 4A9H5 4A7A6C1 Galectin-3 12F8A12 14A5G1

(150) 3. Results

(151) The number of Caco-2, HT-29 and HT-29/B6 cells secreting the tumor marker of interest, per million incubated cells, is shown in FIG. 21. The ELISPOT technique makes it possible to confirm the release or the secretion of the tumor markers by the colon cancer lines. It will be possible to carry out a search for circulating tumor cells in patients using this technique, according to the method of patent application WO 03/076942 filed by the applicant.

EXAMPLE 7: IMMUNOHISTOCHEMICAL DETECTION OF THE TUMOR MARKERS USING COLONIC TISSUES

(152) 1. Methodology

(153) Firstly, the tissue-microarray slides are deparaffinized. For this, they are incubated successively in the following baths for 10 minutes: methylcyclohexane (twice), 100% ethanol, 95% ethanol, 70% ethanol and water. The slides are then rinsed with TBS containing 0.1% Tween 20 (TBS-T), for 10 min, with stirring. The antigens are reactivated in 10 mM citrate buffer, pH 6, by heating to 90° C. for 40 min, and then by allowing to cool to ambient temperature for 30 min. The endogenous peroxidases are inhibited by incubation in TBS-T containing 3% H.sub.2O.sub.2, for 5 min. The slides are then saturated with 3% BSA in TBS-T, for 1 h at 37° C., in a humid chamber.

(154) The slides are then incubated for 2 h with the anti-Leukocyte Elastase Inhibitor (clone 3D9C2), anti-Ezrin (clone 5G2D12), anti-Aminoacylase 1 (clone 8A8A10) or anti-I-Plastin (clone 8D6A3) primary antibody diluted to 10 μg/ml in TBS-T containing 3% BSA (incubation at 37° C. in a humid chamber). After 3 washes of 10 min in TBS-T, the slides are incubated for 2 h at 37° C., in a humid chamber, with the horseradish peroxidase-coupled anti-mouse secondary antibody (Cat. No. 115-035-003 Jackson Immunoresearch) diluted to 1/400 in the saturating solution. The slides are washed 3 times for 10 minutes in TBS-T, and then 3 times for 10 min in PBS. The slides are developed with the Sigma Fast substrate (Cat. No. D-4168, Sigma-Aldrich) for 5 min. The staining is stopped by washing in PBS. Counterstaining with Harris hematoxylin (Cat. No. MHS16, Sigma-Aldrich) is carried out for 30 sec. After washing with water and with PBS, the slides are mounted for observation under a microscope.

(155) The antibodies used for the immunohistochemical labeling were selected specifically for this application, independently of their reactivity in ELISA or in Western blotting.

(156) 2. Immunohistochemical Detection of Leukocyte Elastase Inhibitor

(157) Tissue-microarray slides were used to screen a large number of samples. These samples are colonic tissues spotted onto slides. The characteristics of the patients (characteristics of the colonic tissue spots present on the colorectal cancer tissue-microarray), and also the results of the immunolabelings with the anti-Leukocyte Elastase Inhibitor antibody, are reproduced in Table 10.

(158) TABLE-US-00011 TABLE 10 Labeling Labeling Histology and genetic in epithelial in the Diagnosis characterization cells stroma Malignant tumor Conserved adenocarcinoma Positive Negative Malignant tumor Conserved adenocarcinoma Positive Negative Normal Normal mucosa Negative Negative Normal Normal mucosa Negative Negative Normal Normal mucosa Negative Negative Normal Normal mucosa Negative Negative Benign tumor Adenoma Negative Negative Malignant tumor Conserved adenocarcinoma Positive Negative Malignant tumor LOH adenocarcinoma Positive Negative Malignant tumor LOH adenocarcinoma Positive Negative Normal Normal mucosa Negative Negative Normal Normal mucosa Negative Negative Normal Normal mucosa Negative Negative Normal Normal mucosa Negative Negative Malignant tumor LOH adenocarcinoma Negative Negative Malignant tumor LOH adenocarcinoma Positive Negative Malignant tumor MSI-high adenocarcinoma Positive Negative Malignant tumor MSI-high adenocarcinoma Positive Negative Malignant tumor Colloid adenocarcinoma Negative Negative Malignant tumor Colloid adenocarcinoma Negative Negative Normal Normal mucosa Negative Negative Normal Normal mucosa Negative Negative

(159) The results in the table demonstrate that, in the healthy colonic mucosa biopsies, there is no labeling (10 negatives). The labeling is also negative in the adenoma (1/1). The labeling is positive in the epithelial cells of the colonic adenocarcinomas (+ in 8/11 patients). There is no labeling in the stroma.

(160) 3. Immunohistochemical Detection of Ezrin

(161) Tissue-microarray slides were used to screen a large number of samples. These samples are colonic tissues spotted onto slides. For each patient with a colonic adenocarcinoma, 3 samples were taken at the center of the tumor, 3 samples were taken at the invasion front and 3 samples were taken in the healthy tissue. Table 11 shows the results of the immunolabelings with the anti-Ezrin antibody; the level of labeling indicated is the maximum intensity over the 3 samples analyzed.

(162) TABLE-US-00012 TABLE 11 Patient Tumor invasion HEALTHY identifier Tumor center front tissue 55 + ++ 0 127 + + 0 329 + ++ + 475 + ++ + 544 + ++ + 726 + + + 1203 ++ ++ + 1310 ++ +++ + 2003 + 0 + 2296 ++ ++ 0 2301 + ++ + 2377 + + 0 3095 + + 0 3430 + + 0 3636 + + 0 3748 + + 0 3839 + ++ 0 3891 0 0 0 4054 + + 0 4322 + ++ 0 445 0 ++ + 4474 ++ ++ 0 4792 + + + 4958 ++ ++ + 5101 + ++ + 5318 ++ +++ 0 5374 + + 0 5472 + 0 + 6340 ++ + 0 6353 ++ + 0

(163) In a sampling of 30 patients, 25 exhibit overexpression of Ezrin in the tumor (tumor center or invasion front) compared with the adjacent healthy tissue.

(164) 4. Immunohistochemical Detection of Aminoacylase 1

(165) Tissue-microarray slides were used to screen a large number of samples. These samples are colonic tissues spotted onto slides. For each patient with a colonic adenocarcinoma, 3 samples were taken at the center of the tumor, 3 samples were taken at the invasion front and 3 samples were taken in the healthy tissue. Table 12 shows the results of the immunolabelings with the anti-Aminoacylase antibody; the level of labeling indicated is the maximum intensity over the 3 samples analyzed.

(166) TABLE-US-00013 TABLE 12 Patient Tumor invasion Healthy identifier Tumor center front tissue 55 ++ ++ 0 127 0 0 0 329 ++ ++ 0 475 ++ ++ + 544 + 0 0 726 0 0 0 1203 0 + 0 1310 0 + + 2003 ++ 0 0 2296 + + 0 2301 + + + 2377 + + + 3095 + + 0 3430 + + + 3636 ++ + + 3748 ++ ++ 0 3839 ++ ++ + 3891 ++ ++ 0 4054 + ++ 0 4322 +++ +++ + 445 + ++ + 4474 + ++ + 4792 ++ ++ + 4958 + + + 5101 + + ++ 5318 +++ ++ 0 5374 + + 0 5472 ++ ++ + 6340 ++ ++ + 6353 ++ ++ ++

(167) In a sampling of 30 patients, 21 exhibited overexpression of Aminoacylase in the tumor (tumor center or invasion front) compared with the adjacent healthy tissue.

(168) 5. Immunohistochemical Detection of I-Plastin

(169) Tissue-microarray slides were used to screen a large number of samples. These samples are colonic and rectal tissues spotted onto slides. The characteristics of the patients (characteristics of the colonic tissue spots present on the colorectal cancer tissue-microarray), and also the results of the immunolabelings with the anti-I-Plastin antibody, are reproduced in Table 13.

(170) TABLE-US-00014 TABLE 13 Histology and genetic Labeling in the Labeling in the Diagnosis characterization epithelial cells stroma Malignant colon tumor Conserved adenocarcinoma ++ Negative Malignant colon tumor Conserved adenocarcinoma ++ Negative Normal colon Normal mucosa + Negative Normal colon Normal mucosa + Negative Normal colon Normal mucosa + Negative Benign colon tumor Adenoma + Negative Malignant colon tumor Conserved adenocarcinoma + Negative Malignant colon tumor LOH adenocarcinoma ++ Negative Malignant colon tumor LOH adenocarcinoma ++ Negative Normal colon Normal mucosa + Negative Normal colon Normal mucosa + Negative Normal colon Normal mucosa + Negative Malignant colon tumor LOH adenocarcinoma ++ Negative Malignant colon tumor LOH adenocarcinoma ++ Negative Malignant colon tumor MSI-high adenocarcinoma + Negative Normal colon Normal mucosa + Detached Normal colon Normal mucosa + Detached Malignant colon tumor Colloid adenocarcinoma + Negative Normal colon Normal mucosa ++ Negative Normal colon Normal mucosa ++ Negative Normal rectum Normal rectal mucosa ++ Negative Normal rectum Normal rectal mucosa Nonspecific Negative Normal rectum Normal rectal mucosa Nonspecific Negative Normal rectum Normal rectal mucosa Nonspecific Negative Malignant rectal tumor LOH adenocarcinoma + Negative Malignant rectal tumor LOH adenocarcinoma ++ Negative Malignant rectal tumor LOH adenocarcinoma ++ Negative Malignant rectal tumor LOH adenocarcinoma ++ Negative Benign rectal tumor Adenoma with low-grade dysplasia ++ Negative Benign rectal tumor Adenoma with low-grade dysplasia ++ Negative Benign rectal tumor Adenoma with low-grade dysplasia + Negative Benign rectal tumor Adenoma with low-grade dysplasia + Negative Benign rectal tumor Adenoma with low-grade dysplasia + Negative Benign rectal tumor Adenoma with low-grade dysplasia + Negative Benign rectal tumor Adenoma with low-grade dysplasia ++ Negative Benign rectal tumor Adenoma with low-grade dysplasia ++ Negative Benign rectal tumor Adenoma with low-grade dysplasia ++ Negative

(171) The results in the table demonstrate that: in the healthy colonic mucosa biopsies, the labeling is weak in 8 samples (+) and 2 samples are ++. The labeling is also weak (+) in the colonic adenoma (1/1). The labeling is strongly positive ++ in the epithelial cells of the colonic adenocarcinomas (++ in 6/9 patients and 3 weak +, including the colonic colloid adenocarcinomas). There is no labeling in the stroma; in the healthy rectal mucosa biopsies, labeling is present in the surface epithelium in a nonspecific manner (3/4) and at ++ level in one sample. The labeling is strongly positive ++ in the rectal adenomas (5/9) or discreet + (4/9). The labeling is also strong ++ in the epithelial cells of the rectal adenocarcinomas (++ in 3/4 patients, 1 weak +). There is no labeling in the stroma.

LITERATURE REFERENCES

(172) 1. J. D. Potter, J Natl Cancer Inst., 91, 916-32 2: J. Faivre, 2001, Epidémiologie et dépistage du cancer colorectal [Colorectal cancer epidemiology and screening], publisher Springer 3: E. Chan et al., 1985, J Biol Chem, 260, 2629-2632 4: R. Das et al., 2001, Clin Cancer Res, 7, 1706-1715 5: J. Stulik et al., 2001, Electrophoresis, 22, 3019-3025 6: T. Yamazaki et al., 1999, J Surg Oncol, 72, 83-87 7: P. Gold et S. Freedman, 1965, J Exp Med, 467-481 8: M. Duffy, 2001, Clin Chem, 624-630 9: Y. Kim et al., 2003, Ann Clin Lab Sci, 32-38 10: J. L. Magnani et al., 1983, Cancer Research, 43, 5489-5492 11: E. Remold-O'Donnell et al., 1992, Proc Natl Acad Sci USA, 89, 563-5639 12: J. Cooley et al., 2001, Biochemistry, 15762-15770 13: M. Algrain et al., 1993, J Cell Biol, 120, 129-139 14: W. G. Jiang et S. Hiscox, 1996, Anticancer Res, 16, 861-865 15: S. Hiscox et W. G. Jiang, 1999, J Cell Sci, 112, 3081-3090 16: T. Xiao et al, 2005, Mol. Cell. Proteomics, 4, 1480-1486 17: M. Anders et W. Dekant, 1994, Advances in Pharmacology, 431-448 18: K. Lorentz et al., 1975, Clinica Chimica Acta, 263-269 19: K. Lorentz et B. Flatter, 1975, Clinica Chimica Acta, 271-274 20: R. M. Cook et al., 1993, J Bio Chem, 17010-17017 21: Y. E. Miller et al., 1989, J Clin Invest, 2120-2124 22: S. Balabanov et al., 2001, Eur J Biochem, 5977-5980 23: D. A. Sweetser et al., 1987, J Biol Chem, 266, 16060-16071 24: M. Pelsers et al., 2003, Clin Biochem, 36, 529-535 25: R. Xiao, et al., 2005, Molecular Cancer, 4, 1-17 26: E. E. Niederkofler et al., 2003, J Lipid Res, 44, 630-639 27: G. L. Hortin, 2006, Clinical Chemistry, 52(7), 1223-1237 28: J. Y. Engwegen et al., 2006, World J Gastroenterol, 12(10), 1536-1544 29: Z. Zhang et al., 2004, Cancer Research, 64, 5882-5890 30: H. Hachem et al., 1986, J Chem Clin Biochem, 24, 161-166 31: C. S. Lin, et al., 1993, J Biol Chem, 268, 2781-92 32: V. Delanote et al., 2005, Acta Pharama Sinica 769-779 33: S. Nakahara et al., 2005, Apoptosis, 10, 267-275 34: I. Iurisci et al., 2000, Clin Can Res, 6, 1389-1393 35: A. P. Arrigo et al., 1988, Nature, 331, 192-194 36: T Lavabre-Bertrand et al., 2001, Cancer, 92, 2493-2500 37: M. K. Scwartz, 2006, Clin Chim Acta, 1992, 77-82 38: D. J. McCool et al., 1999, Biochem J, 593-600 39: J. L. Iovanna et al., 1994, Gastroenterology, 106, 728-734 40: Y. Motoo et al., 1999, Dig Dis Sci, 44, 1142-1147 41: M. Herlyn et al., 1979, Proc Natl Acad Sci USA, 76, 1438-1442 42: A. Armstrong et S. Eck, 2003, Cancer Biol Ther, 2, 320-325 43: D. Herlyn et al., 1982, Proc Natl Acad Sci USA, 79, 4761-4765 44: H Abe et al., 2002, J Immunol Methods, 270, 227-233 45: V. Barak et al., 2004, Clin Biochem, 37, 529-540 46: H. Kim et al., 2006, Ann Clin Lab Sci, 36, 294-298 47: F. Roca et al., 2006, J Surg Oncol, 151-160 48: C. H. Damsky et al., 1983, Cell, 455-466 49: M. Katayama et al., 1994, Br J Cancer, 580-585 50: C. Willmanns et al., 2004, Clin Exp Metastasis, 75-78 51: J. Holmgren et al., 1984, Br Med J (Clin. Re. Ed.), 288, Ed.), 288, 1479-1482 52: T. L. Klug et al., 1986, Int. J. Cancer, 38, 6661-669 53: P. Kuusela et al., 1991, Br. J. Cancer, 63, 636-640 54: M. Holland et al., 1993; Medicina (B. Aires), 53(2):117-23 55: F. Model et al., July 2006, World Congress on Gastrointestinal Cancer, <<Detection of Methylated DNA in Plasma from Colorectal Cancer Patients and Controls by Real-Time PCR Analysis of Septin 9>> 56: M. P. Ebert et al., 2006, Gastroentrology, 131(5), 1418-1430 57: C. Bianco et al., 2006, Clin. Cancer Res., 12, 5158-5164 58: R. Yasumatsu et al., 2006, Am J Physiol Lung Cell Mol Physiol 291, L619-L627 59: J. Chevalier et al., 1997, J Histochem Cytochem, 45, 481-491 60: S. Patterson, 2000, Mass spectrometry and proteomics. Physiological Genomics 2, 59-65 61: L. Anderson and C. L. Hunter, 2006, Mol Cell Proteomics, 5, 573-588. 62: L. J. Kricka et al., 1999, Clinical Chemistry, 45(4), 453-458 63: S. Tyagi and F. R. Kramer, 1996, Nature Biotech, 14, 303-308 64: T. F. Imperiale et al., 2004, N Engl J Med, 351(26), 2704-2714 65: D. A. Ahlquist et al., 2000, Gastroenterology, 119, 1219-1227 66: I. H. Wong, 2006, Methods Mol Biol, 336, 33-46 67: M. P. Ebert et al., 2005, Neoplasia, 7(8), 771-778 68: C. Lofton-Day et al., 2007, AACR Annual Meeting 2007, Los Angeles, U.S.A., Poster no LB-165, Clinical case-control study in plasma shows that the DNA methylation biomarker, Septin-9, detects 70% of stage I-III colorectal cancer patients 69: P. Métézeau et al., La cytométrie en flux pour l'étude de la cellule normale ou pathologique (Tome I), Eds Medsi-MacGrawhill 70: Mathieu J. et al. 2006. Fonctions cellulaires et métabolisme. In: (coordonnateurs: Ronot X. et al.). La cytométrie en flux. Tec & Doc, 255-298. ISBN 978-2-7430-0898-7 71: V. Cheynet et al., 1993, Protein Expr Purif, 4(5), 367-372 72: G. Köhler and C. Milstein, 1975, Nature, 256, 495-497 73: G. Köhler and C. Milstein, 1976, Eur J Immunol, 6, 511-519