Immunogenic proteins and compositions

09725488 · 2017-08-08

Assignee

Inventors

Cpc classification

International classification

Abstract

The invention provides proteins and compositions for the treatment and prevention of Streptococcus agalactiae (Group B streptococcus; GBS).

Claims

1. An immunogenic composition comprising (a) a polypeptide comprising an amino acid sequence having at least 90% sequence identity to a sequence selected from the group consisting of SEQ ID NOS:83, 84, 85, 86, and 87 and (b) one or more pharmaceutical carrier(s) and/or excipient(s).

2. The immunogenic composition of claim 1, wherein said polypeptide comprises the amino acid sequence of SEQ ID NO:83.

3. The immunogenic composition of claim 1, wherein said polypeptide comprises the amino acid sequence of SEQ ID NO:84.

4. The immunogenic composition of claim 1, wherein said polypeptide comprises the amino acid sequence of SEQ ID NO:85.

5. The immunogenic composition of claim 1, wherein said polypeptide comprises the amino acid sequence of SEQ ID NO:86.

6. The immunogenic composition of claim 1, wherein said polypeptide comprises the amino acid sequence of SEQ ID NO:87.

7. The immunogenic composition of claim 1, wherein said polypeptide comprises an amino acid sequence having at least 95% sequence identity to a sequence selected from the group consisting of SEQ NOs: 83, 84, 85, 86, and 87.

8. The immunogenic composition of claim 1, wherein said polypeptide comprises an amino acid sequence having at least 96% sequence identity to a sequence selected from the group consisting of SEQ ID NOs: 83, 84, 85, 86, and 87.

9. The immunogenic composition of claim 1, wherein said polypeptide comprises an amino acid sequence having at least 97% sequence identity to a sequence selected from the group consisting of SEQ ID NOs: 83, 84, 85, 86, and 87.

10. The immunogenic composition of claim 1, wherein said polypeptide comprises an amino acid sequence having at least 98% sequence identity to a sequence selected from the group consisting of SEO ID NOs: 83, 84, 85, 86, and 87.

11. The immunogenic composition of claim 1, wherein said polypeptide comprises an amino acid sequence having at least 99% sequence identity to a sequence selected from the group consisting of SEQ ID NOs: 83, 84, 85, 86, and 87.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

(1) FIG. 1A, pairwise alignment between S. pneumoniae RrgB (SEQ ID NO:271) and S. agalactiae BP-2a 515 variant (SEQ ID NO:2). FIG. 1B, Model of BP-2a 515 variant.

(2) FIGS. 2A-2C: Identification of internal isopeptide bonds by MALDI TOF mass 5 spectrometry. The recombinant protein BP-2a 515 variant was run on a 4-12% acrylamide SDS-PAGE. The protein was “in gel” digested with Lys-C. The peptides produced by the digestion were either directly analyzed by MALDI TOF mass spectrometry (upper panel) or were modified with O-methylisourea prior the analysis (lower panel). FIG. 2A, Signal for isopeptide bonded peptides in domain D4 (A).

(3) FIG. 2B, Signal for isopeptide bonded peptides in domain D2; FIG. 2C, Signal for isopeptide bonded peptides in domain D3 were observed. (.diamond-solid.) Trypsin autodigestion product. (*) Peak not identified

(4) FIG. 3A, SDS-PAGE of purified recombinant BP-2a 515 variant with (WT) and without isopeptide bonds (ΔIB) FIG. 3B, Opsonophagocytosis assay of mice antisera raised against BP-2a 515 variant with (WT) and without isopeptide bonds (ΔIB)

(5) FIG. 4A, schematic representation of four domains of BP-2a-515 variant. FIG. 4B, FACS analysis on 515 GBS strain with mouse sera raised against each BP-2a domain. FIG. 4C, Opsonophagocytosis assay with mouse sera raised against each domain of BP-2a-515 variant.

(6) FIG. 5A, Superimposition of variants 515 and H36B. The best model for H36B variant (SAI_1511) after loop refinement reported a validation score of 165.3 compared with the expected high score value of 215 and low score value of 96.8. FIG. 5B, schematic representation of domains of BP-2a H36B variant

(7) FIG. 6A(i), D3 plus helices. FIG. 6A(ii) and FIG. 6A(iii), multiple alignment of amino acid sequences corresponding to domains D3 plus 2 helices of domains D4 harbouring to allelic variant of BP-2a (D3and2H_515, SEQ ID NO:55; D3and2H_CJB111, SEQ ID NO:59); D3and2H_DK21, SEQ ID NO:71; D3and2H_090, SEQ ID NO:67; D3and2H_H36B, SEQ ID NO:63; and D3and2H_2603, SEQ ID NO:51). FIG. 6B, schematic representation of fusion proteins. FIG. 6C, SDS-PAGE of purified recombinant fusion proteins detected by COOMASSIE® staining. FIG. 6D, FACS analysis on GBS strains expressing different BP-2a variants with mouse antisera sera raised against fusion protein 6xD3. FIG. 6E, Opsonophagocytosis assay with mouse antisera raised against fusion proteins 6xD3 and 4xD3H.

(8) FIGS. 7A-7D(iii): Crystal structure of BP-2a-515 solved and refined at 1.75 Å resolution via molecular replacement. Data collection and refinement statistics are shown in Table 2.

(9) The crystal asymmetric unit contains a dimer of two independent chains, each made up of three distinct domains: D2 (residues 190-332), D3 (residues 333-455) and D4 (residues 456-641). FIG. 7A, residues 192-640. FIG. 7B, residues 190-641). FIG. 7C(i), IP1. FIG. 7C(ii), IP2. FIG. 7C(iii), IP3. FIG. 7D(i), mass spectrometry spectra (NTETKPQVDKNFADK, amino acids 21-34 of SEQ ID NO:57; ITYSATLNGSAVVEVLETNDVK, amino acids 152-173 of SEQ ID NO:56). FIG. 7D(ii), mass spectrometry spectra (ITVNKTWAVDGNEVNK, amino acids 20-35 of SEQ ID NO:38). FIG. 7D(iii), mass spectrometry spectra (FVKTNK, amino acids 130-135 of SEQ ID NO:14; DAQQVINKK, amino acids 159-169 of SEQ ID NO:15).

MODES FOR CARRYING OUT THE INVENTION

(10) Streptococcus agalactiae (Group B Streptococcus [GB S]) is the most common cause of sepsis and meningitis in neonates and is also the primary colonizer of the anogenital mucosa of healthy women. Recently, three pilus types have been discovered in GBS as important virulence factors. The genes involved in pilus assembly are clustered in characteristic genomic loci (named PI-1, PI-2a and PI-2b), each encoding three proteins containing a LPXTG (SEQ ID NO:272) motif representing the structural components of the pilus, and two sortase enzymes catalyzing protein polymerization. Each of the three pilus types carries two protective antigens. Among these, the backbone protein of pilus type 2a (BP-2a), showed the highest degree of gene variability and was able to significantly mediate opsonophagocytic activity and to confer protection in mice only against strains expressing the homologous allele. In order to map immunodominant and protective epitopes of the allelic variants of BP-2a, we performed a structural characterization of the protein by comparative homology modelling and on the basis of this structural information, we generated deletion mutants of the main variants corresponding to the four IgG-like fold domains identified. In vitro and in vivo studies showed that only the C-terminal portion of the protein was highly surface-exposed and able to elicit opsonophagocytic antibodies conferring protection in mice. In particular, domain D3 appeared to be the most important for the protective immunity of the main four allelic variants analyzed. Finally, we showed that a broad protective vaccine against GBS infection can be generated with a fusion protein containing D3 domains from different BP-2a variants.

(11) Materials and Methods

(12) Comparative Homology Modelling

(13) All molecular simulations were performed using Discovery Studio 2.5 software from Accelrys, USA. The amino acid sequences of the BP-2a (515 variant, TIGR annotation SAL_1486 and H36B variant, TIGR annotation SAI_1511) were used to search against the Protein Data Bank (PDB) with the BLAST program tool [247]. The best template structure for both protein sequences for homology modelling resulted to be the crystal portion (residues 187 to 627) of RrgB (PDB code: 650), the backbone protein of S. pneumoniae pilus, that was obtained from the PDB database. Pairwise sequence alignment between SAL_1486 and RrgB and between SAI_1115 and RrgB were done using multiple sequence alignment tool in DS 2.5 followed by manual modifications to improve the alignment quality. The models were generated with MODELER [248] from protein modelling module of DS 2.5, performing both homology modelling and loop refining for the protein. Ten models have been generated and the model which shared the least RMS deviation with respect to trace (Ca atoms) of the crystal structure of the template, was selected for further refinements and validations. The quality of the refined structure obtained for SAL_1486 was checked with verify Profile-3D module in DS 2.5, and its stereochemical quality was examined by Ramachandran plot using DS 2.5. In order to optimize particular loop regions in the generated structure for SAI_1511, the loop refinement module, based on CHARMm and Looper molecular mechanics, of DS 2.5 was used. Finally, the model structures generated have been superimposed using Align Structures module of DS 2.5.

(14) Protein Crystallization

(15) Crystallization trials were set up in 96-well microbatch plates (Greiner) using the Orxy 8.0 crystallization robot (Douglas Instruments). Crystals of BP-2a-515 grew after one to two weeks at 20° C. in a 0.5 μl drop consisting of 0.3 μl protein (180 mg/ml) in 10 mM HEPES pH 7.0 and 0.2 μl crystallization solution (25% (w/v) PEG 4000, 0.1 M HEPES pH 7.0 and 90 mM potassium sodium tartrate tetrahydrate), layered with silicon oil and paraffin, mixed at a ratio of 1:1. Crystals were cryoprotected in the crystallization solution containing increased precipitant concentration (40% (w/v) PEG4000). Crystals belong to the orthorhombic P2.sub.12.sub.12.sub.1 space group with two BP-2a 515 chains present in the asymmetric unit, and an estimated solvent content of 53%.

(16) Structure Solution and Refinement

(17) Diffraction data from a single crystal were collected at a resolution of 1.75 Å at the European Synchrotron Radiation Facility (Grenoble, France; beam line ID23-1). Data were processed using imosflm (32) and SCALA (33) available from the CCP4 Program Suite (34). The crystal structure of BP-2a-515 was solved by molecular replacement using the program Molrep (35) and the structure of the pilus backbone protein (RrgB) from S. pneumoniae (15) (PDB 2X9W), as a search model. The initial Molrep output model was extended using ARP/wARP (36). The structure was refined using REFMAC 5 (37) and modeled to electron density maps using Coot (38). The latter stages of refinement included the translational-libration-screw (TLS) option (39). During model building and refinement, it became apparent that the protein had been cleaved at the N-terminus, lacking approximately 190 residues, as previously observed for RrgB (15). The final model displays optimal stereochemical geometric parameters with 99.1% of residues in the most favorable regions of the Ramachandran plot, with no outliers, according to validation carried out using MolProbity (molprobity.biochem.duke.edu/) (40, 41). Atomic coordinates and structure factors for residues 190-640 of BP-2a-515 have been deposited in the Protein Data Bank, Research Collaboratory for Structural Bioinformatics, Rutgers University, New Brunswick, N.J. (www.rcsb.org) under accession code 2XTL (Reference to add PDB: Berman, H. M., et al., The Protein Data Bank. Nucleic Acids Res, 2000. 28(1): p. 235-42.).

(18) Bacterial Strains and Growth Conditions

(19) The GBS strains used in this work were 2603 V/R (serotype V), 515 (Ia), CJB111 (V), H36B (serotype 1b), 5401 (II) and 3050 (II). Bacteria were grown at 37° C. in Todd Hewitt Broth (THB; Difco Laboratories) or in trypticase soy agar supplemented with 5% sheep blood.

(20) Cloning, Expression, Purification of Recombinant Proteins and Antisera.

(21) GBS strains 515 and H36B were used as source of DNA for cloning the sequences coding for the single domains (D1, D2, D3 and D4) of the BP-2a 515 and H36B allelic variants. Genomic DNA was isolated by a standard protocol for gram-positive bacteria using a NucleoSpin Tissue kit (Macherey-Nagel) according to the manufacturer's instructions. Genes corresponding to each domain were first cloned into pENTR™/TEV/D-TOPO vector (Invitrogen) and then sub-cloned into pET54 DEST vector (N-terminal 6×HIS tag) or pET59 DEST (N-terminal 6×His-TRX tag) (Novagen) using the GATEWAY cloning system (Invitrogen), with the exception of D3 domain of SAI_1511, which was cloned in the pSpeedET vector by PIPE cloning method [249]. The oligos used are listed in Table 1. The resulting constructs were checked for sequencing and then transformed into E. coli BL21(DE3) (Novagen) for the expression as 6His- or TRX-tagged fusion proteins.

(22) The full length recombinant BP-2a proteins, corresponding to 515, CJB111 and 2603 allelic variants (TIGR annotation SAL1486, SAM1372 and SAG1407, respectively), were produced as previously reported [2], while the full length H36B variant (TIGR annotation SAI_1511) was cloned in pET24b+(Novagen) using strain H36B as source of DNA. Primers were designed to amplify the coding regions without the signal peptide and the 3′ terminal sequence starting from the LPXTG (SEQ ID NO:272) motif.

(23) The genes coding for the BP-2a fusion proteins, 6XD3 and 4XD3-H, were synthetically constructed from GENEART. The 6XD3 gene was then cloned into pET15 vector adapted in house using PIPE cloning in E. coli HK100 strain. The 4XD3-H gene was sub-cloned using NdeI and XhoI restriction enzymes into the expression vector pColdI (N-terminal 6×HIS-tag, Takara). The final constructs were sequenced and transformed in BL21(DE3) (Novagen).

(24) For the recombinant protein expression, the cultures were maintained at 25° C. for 5 h after induction with 1 mM IPTG for the pET clones or with 0.2% arabinose for the SpeedET clones. All recombinant proteins were purified by affinity chromatography and gel filtration. Briefly, cells were harvested by centrifugation and lysed in “lysis buffer”, containing 10 mM imidazole, 1 mg\ml lysozyme, 0.5 mg\ml DNAse and COMPLETE inhibitors cocktail (Roche) in PBS. The lysate was clarified by centrifugation and applied onto His-Trap HP column (Armesham Biosciences) pre-equilibrated in PBS containing 10 mM imidazole. Protein elution was performed using the same buffer containing 250 mM imidazole, after two wash steps using 20 mM and 50 mM imidazole buffers. The eluted proteins were then concentrated and loaded onto HiLoad 16/60 Superdex 75 (Amersham Biosciences) pre-equilibrated in PBS. For the expression of the 4XD3-H was maintained at 37° C. until OD 600 nm reached the value of 0.7 and after induction in the presence of 1 mM IPTG, the temperature was switched to 20° C. and the culture was maintained at this temperature overnight. Protein concentration of the pure fractions was estimated using BCA assay (PIERCE).

(25) Antisera specific for each protein were produced by immunizing CD1 mice with the purified recombinant proteins as previously described [250]. Protein-specific immune responses (total Ig) in pooled sera were monitored by ELISA.

(26) Site-Directed Mutagenesis

(27) For the generation of the mutated form of BP-2a 515 variant, containing the lysine residues involved in the isopeptide bonds mutated into alanine, mutations were introduced into the wild type BP-2a 515 variant carrying the LPXTG (SEQ ID NO:272) motif. Primers used for the amplification of the gene coding for BP-2a 515 with LPXTG (SEQ ID NO:272) motif are listed in Table 1. Site-directed mutagenesis was performed using the PIPE method and forward and reverse primer pairs for each mutation were designed, as listed in Table 1. The wild type protein and the mutated form, were cloned into SpeedET vector (N-term 6×His tag) and expressed in E. coli HK100 strain. The sequences of the resulting constructs were confirmed by DNA sequencing. Proteins were purified by affinity chromatography and gel filtration as described above.

(28) Flow Cytometry

(29) Mouse sera raised against purified deletion mutant of the 515 and H36B variants were analyzed on whole bacteria by flow cytometry to evaluate the surface-exposure of the corresponding domains. Exponential phase bacterial cells were fixed in the presence of 0.08% (wt/vol) paraformaldehyde and incubated for 1 h at 37° C. Fixed bacteria were then washed once with PBS, resuspended in Newborn Calf Serum (Sigma) and incubated for 20 min. at 25° C. The cells were then incubated for 1 hour at 4° C. in preimmune or immune sera, diluted 1:200 in dilution buffer (PBS, 20% Newborn Calf Serum, 0.1% BSA). Cells were washed in PBS-01% BSA and incubated for a further 1 h at 4° C. with a 1:100 dilution of R-Phycoerythrin conjugated F(ab)2 goat anti-mouse IgG (Jackson ImmunoResearch Laboratories; Inc.). After washing, cells were resuspended in PBS and analyzed with a FACS Calibur apparatus (Becton Dickinson, Franklin Lakes, NJ) using FlowJo Software (Tree Star, Ashland, Oreg.). Data are expressed as the difference in fluorescence between cells stained with immune sera versus preimmune sera.

(30) Immunoblotting

(31) Group B Streptococcus strains were grown overnight in THB (Difco Laboratories, Detroit, Mich.) to exponential phase (0D600=0.5). Bacteria were pelleted, washed in PBS and resuspended in 50 mM Tris-HCl, containing 400 units of mutanolysin (Sigma-Aldrich). Bacterial suspension was then incubated 2 h at 37° C. and lysed by freeze and thaw. Cellular debris were removed by centrifugation at 14 000 rpm for 10 min and protein concentration measured by Bio-Rad Protein assay. Total cell proteins were separated by 4-12% NuPage Novex pre-cast gels (Invitrogen) and electroblotted onto PVDF membranes using the iBlot™ Dry Blotting System (Invitrogen). After blocking in 1× phosphate-buffered saline (PBS: 140 mM NaCl, 2.7 mM KCl, 10 mM Na2HPO4 and 1.8 mm KH2PO4, pH 7.3) containing 0.05% Tween 20 and 10% skim milk for 1 h at room temperature, membranes were incubated for 1 h at room temperature (RT) with primary antibodies diluted 1:500. After washing three times in PBS containing 0.05% Tween 20 (PBST), the membranes were incubated for 1 h with horseradish peroxidase-conjugated secondary antibodies (Dako). Positive bands were visualized with the Opti-4CN Substrate Kit (Bio-Rad).

(32) Opsonophagocytosis Assay

(33) The opsonophagocytosis assay was performed using differentiated HL-60 as phagocytic cells and strains 515, CJB111, 3050 and 5401 as target cells. GBS strains were grown in Todd-Hewitt broth (THB) to mid-exponential growth phase (A650 nm=0.3). The bacteria were harvested by centrifugation, washed twice with cold saline solution, and finally resuspended in HBSS buffer (Invitrogen) to a concentration of ≈4.2×10.sup.7 CFU/ml. Promyelocytic HL-60 cells (ATCC, CCL-240) were expanded in RPMI 1640 (Gibco, Invitrogen) containing 10% Fetal clone I (HyClone) at 37° C. with 5% CO.sub.2 and differentiated into granulocyte-like cells to a density of 4×10.sup.5 cells/ml by the addition of 100 mM N, N dimethylformamide (DMF, Sigma) to the growth medium. After 4 days, cells were harvested by centrifugation and resuspended in HBSS buffer to a concentration of ≅4×10.sup.7 cells/ml. In brief, the reactions took place in a total volume of 125 μl containing ≈3×10.sup.6 differentiated HL-60, ≈1.5×10.sup.5 CFU of GBS cells, 10% baby rabbit complement (Cedarlane), and heat-inactivated mouse antisera at 37° C. for 1 h with shaking at 600 rpm. Immediately before and after 1 h of incubation, a 25-μl aliquot was diluted in sterile distilled water and plated onto trypticase soy agar plates with 5% sheep blood. A set of negative controls included in each experiment consisted of reactions containing preimmune sera, reactions without HL-60, and reactions with heat-inactivated complement. The amount of opsonophagocytic killing (log kill) was determined by subtracting the log of the number of colonies surviving the 1 h assay from the log of the number of CFU at the zero time point.

(34) Mouse Active Maternal Immunization Model

(35) A maternal immunization/neonatal pup challenge model of GBS infection was used to verify the protective efficacy of the produced proteins in mice, as previously described (Maione et al., 2005). Briefly, CD-1 female mice (6-8 weeks old) were immunized on days 1 (in CFA), 21 and 35 (IFA) with either PBS or 20 mg of recombinant protein and were then bred 3 days after the last immunization. Within 48 h of birth, pups were injected intraperitoneally with a dose of different GBS strains calculated to cause 90% lethality. Survival of pups was monitored for 2 days after challenge. Statistical analysis was performed using Fisher's exact test. All animal studies were performed according to guidelines of the Istituto Superiore di Sanita (Italy).

(36) Results

(37) We have previously shown that the Backbone Protein of pilus 2a (BP-2a) in Group B Streptococcus is able to confer protection in an active maternal/pup challenge model in mouse [1]. However, the existence of seven highly variable allelic variants and the demonstration that each variant confers protection only against the homologous strain restricts the possibility of using this antigen alone or in combination with other antigens in a broad-spectrum vaccine against GBS [2]. Nevertheless, BP-2a is an antigen of interest since it is able to promote high levels of opsonic killing of GBS when tested in an opsonophagocytosis assay in the presence of specific antibodies. We used this specific feature in order to explore the protective capability of this antigen and identify the immunodominant epitopes of BP-2a.

(38) Comparative Homology Modelling of the BP-2a 515 Variant

(39) In order to design appropriate deletion mutants of BP-2a, we performed a structural characterization of the protein, first focusing on the 515 variant (TIGR annotation SAL_1486), by comparative homology modelling. The PDB was searched for a protein sharing significant sequence identity with BP-2a. The best template structure found was PBD code 650 corresponding to the RrgB pilus protein of S. pneumoniae. The RrgB crystal comprises the region from residues 187 to 647 and it is arranged in three immunoglobulin-like domains, each one carrying a stabilizing isopeptide bond. The first two domains (D2 and D3) are closely packed to form a compact structure from which two anti-parallel helixes and the third domain (D4) protrude. The PDB 650 crystal does not include the first domain (D1) of the RrgB protein.

(40) The amino acid sequences of BP-2a 515 variant and RrgB were aligned and reported to share 43% sequence identity and 61% sequence similarity. Sequence comparison revealed that the pilin motif YPK, the E-Box cassette, the LPXTG (SEQ ID NO:272) motif and all the residues involved in isopeptide bonds are well conserved (FIG. 1A). The pairwise alignment was further manually optimized to cope with the secondary structures in order to refine the homology modelling procedure input. The quality of the model was assessed by calculating the compatibility score with Profile-3D module (Discovery Studio 2.5 Software Inc., San Diego, Calif.). The template reported a score of 168.6 compared with the expected high score value of 201.7 and low score value of 90.7. The best model for BP-2a-515 reported a validation score as computed by Profile-3D of 154, while the minimum and the maximum possible scores for this model are 92.2379 and 204.973, respectively. Given that even the template crystal structure does not reach the expected score for the correctly folded protein, the model obtained a validation score comparable to the crystal one.

(41) As shown in FIG. 1B, the model of our protein, corresponding to amino acid residues 191 to 640, revealed three IgG-like fold domains (D2, D3 and D4), each one characterized by a stabilizing isopeptide bond. Superimposing the template structure against the generated model, a RMSD as low as 1.2 Å is obtained, meaning that the sequence of BP-2a fitted well in the template structure. Only minor differences in loops were identified, all due to short residue insertions or deletions. Moreover, the superimposition of crystallized isopeptide bonds shows that the region in the vicinity of the bonds is relatively conserved. In particular, there is a glutamic acid or an aspartatic acid which catalyze bonds, completely immersed in a surrounding hydrophobic cavity. In the BP-2a 515 variant, the residues involved in isopeptide bonds are: Lys199-Asn325 in the D2 domain with Asp 247 as the catalyzing and stabilizing residue; Lys355-Asn437 in the D3 domain with Glu416; and Lys463-Asn636 in the D4 domain with Glu589. Based on secondary structure and fold prediction of the N-terminal portion of the BP-2a protein (residues 1 to 190), we hypothesise that this portion has the same IgG-like fold of D2, D3 and D4 (data not shown).

(42) Mass Spectrometry Analysis Confirms the Presence of Three Internal Isopeptide Bonds

(43) Recombinant full length SAL_1486 was purified and used to confirm the presence of the isopeptide bonds hypothesized from the modelling study. The method selected for their identification was based on the total digestion of the diverse constructs with Lys-C and analysis of the digestion products by mass spectrometry. In order to easily sort the bond peptides, the digestion products were derivatized with O-methylisourea that modifies the C-terminal lysine in homoarginine with a mass increase of 42 Da for each modified C-terminal extremity. Isopeptide bonded peptides are those presenting a shift of mass of 42 D (partial derivatization) and 84 Da (complete derivatization). The protein was resistant to “in solution” enymatic digestions (data not shown). The approach that allowed the larger peptide coverage was obtained from “in gel” digestion of the polypeptide run on SDS-PAGE. FIG. 2 reports the mass spectrometry spectra obtained from the full length recombinant SAL_1486 allowing the confirmation of the hypothesized isopeptides.

(44) An isopeptide bond involving amino acids carried by the D4 domain of the protein was evidenced by the molecular ion of m/z 1762.05 Da that corresponds to the molecular mass of the peptide .sup.461FVKTNK.sup.466 (amino acids 130-135 of SEQ ID NO:14) linked by an isopeptide bond to the peptide .sup.630DAQQVINKK.sup.638 (amino acids 159-169 of SEQ ID NO:15) (expected molecular mass 1761.90 Da) (FIG. 2A, upper panel). The guanidination reaction induced a shift of 42 and 84 Da of the signal that corresponds to the single and double C-terminal peptide derivatization, respectively, confirming the covalent linkage of the two peptides. In the same way, isopeptide bonds in domains D2 and D3 were assigned from the ions of m/z 2145.18 and 4040.85 that correspond to the molecular mass of peptide .sup.53ITVNKTWAVDGNEVNK.sup.68 (amino acids 20-35 of SEQ ID NO:38) linked to peptide 139 N.sub.NK141 (expected molecular mass 2145.13 Da), and of peptide .sup.185ITYSATLNGSAVVEVLETNDVK.sup.206 (amino acids 152-173 of SEQ ID NO:56) linked by an isopeptide bond to the peptide .sup.68NTETKPQVDKNFADK.sup.82 (amino acids 21-34 of SEQ ID NO:57) (expected molecular mass 4040.07 Da), respectively (FIGS. 2B and 2C). The guanidination reaction confirmed the covalent linkage of the peptides by the double shift of mass of 42 and 84 Da. It was noteworthy that no isopeptide bond was identified in the N-terminal part corresponding to domain D1 of the full-length recombinant protein.

(45) In order to confirm that the lysines involved in the isopeptide bonds of domains D2, D3 and D4 corresponded exactly to K199, K355 and K463 predicted by structural model, we generated a recombinant form of the protein by site-directed mutagenesis in which these lysine residues were mutated into alanine residues (K199A/K355A/K463A). The same protocol of enzymatic digestion and mass spectrometry analysis was applied, and none of the signals, corresponding with isopeptide linked peptides and reported above, were identified (data not shown).

(46) X-Ray Crystal Structure of BP-2a-515 Pilus Subunit

(47) With the aim to identify the domain(s) carrying the protective epitopes, the crystal structure of BP-2a-515 was solved and refined at 1.75 Å resolution via molecular replacement. Data collection and refinement statistics are shown in Table 2. The crystal asymmetric unit was confirmed to contain a dimer of two independent chains (A: residues 192-640 and B: residues 190-641), each made up of three distinct domains: D2 (residues 190-332), D3 (residues 333-455) and D4 (residues 456-641) (FIG. 7). The observed BP-2a-515 dimer does not display extensive intermolecular interactions at the association interface, therefore the dimer is not expected to occur in solution and it is a likely consequence of crystal packing, as indicated by the Protein Interfaces, Surfaces and Assemblies (PISA) Service [251] at the European Bioinformatics Institute (www.ebi.ac.uk/msd-srv/prot_int/pistart html).

(48) Although crystallization was carried out using the full-length protein, approximately 190 amino acids from the N-terminus (D1 domain) were absent in the crystal, suggesting that they are cleaved off prior to crystallization. A similar behavior was reported for the pneumococcal RrgB pilus protein whose structure was recently solved at 1.6 Å resolution [252] and is highly homologous to the structure of BP-2a-515.

(49) Potassium-sodium tartrate present in the crystallization solution was relevant for optimizing crystal growth and improving diffraction resolution. In fact, three potassium cations are bound at strategic and stabilizing positions in the structure. Two (identically-coordinated) potassium cations are bound to the D2 domain in both chains and stabilize a flexible linker, connecting the D3 and D4 domains, via contributing residues from domains D2, D3, and a water molecule (FIG. 7). The third potassium cation stabilizes a flexible loop in the D4 domain from chain A.

(50) The organization of the three domains was confirmed to show a modified IgG fold [252], a structural feature already observed for RrgB of S. pneumoniae. Indeed, superimposition of the C-alpha atoms of BP-2a-515 chain B and RrgB using the pairwise structural alignment C-alpha match program (bioinfo3d.cs.tau.ac.il/c_alpha_match/), yields a r.m.s.d value of 1.37 Å over 280/452 residues. The major structural differences between the two proteins regard the spatial location of the D3 domain, the movement of two α-helices in the D4 domain that are connected to the β-sandwich by two β-strands not present in RrgB, and flexible regions.

(51) Similarly to RrgB, each domain is characterized by a stabilizing, covalent intramolecular isopeptide bond, formed between the ε-amino group of lysine side chains and the δ-carboxyamide group of asparagine. The three isopeptide bonds occur between Lys199 and Asn325 (D2 domain), Lys437 and Asn355 (D3 domain), and Lys463 and Asn636 (D4 domain), and stabilize the secondary structural elements of their respective domains. Due to the conformational movement of D3 in comparison with RrgB, the latter isopeptide bond is the only one that does not match the spatial location of the equivalent bond in RrgB. The surrounding area around these bonds is largely hydrophobic, comprising several aromatic residues, in agreement with observations made for the isopeptide bonds in several pilus proteins.

(52) Each of the four domains D1, D2, D3 and D4 appear to fold independently. This was demonstrated by expressing and purifying each domain from E. coli, as independent constructs whose N and C termini were selected on the basis of the domain boundaries defined in the crystal structure of BP-2a-515. All four domains were expressed in soluble form in E. coli, and Mass Spectrometry analysis of tryptic digests of D2, D3 and D4 revealed that the domains carried the same isopeptide bonds found in the full-length protein data not shown). This suggested that the overall structural organization of the independently expressed domains was sufficiently preserved to bring the lysine and asparagine residues at a suitable reaction distance.

(53) In conclusion, the crystal structure of the backbone subunit of PI-2a (515 allele) indicates that the protein is organized into four domains, which are shown to be independently structured and stable.

(54) Intramolecular Isopeptide Bonds are Dispensable for Protection

(55) It has been demonstrated that intramolecular isopeptide bonds that are dispensable for pilus assembly, contribute to structural and proteolytic stability of pili. The SDS-PAGE of the wild-type and mutated BP-2a protein showed that the protein without isopeptide bonds had a slower electrophoretic mobility compared to the wild-type form. The presence of internal cross-links within the naïve protein may make the wild-type protein structure more compact and more able to pass through the matrix of the gel, whereas the mutated form has a larger structure which runs to a higher molecular weight (FIG. 3A).

(56) In order to evaluate if the presence of these internal linkages could influence the protective capability of the protein BP-2a and investigate if the mutant protein is able to induce protective immunity in vivo as well as the wild type, we tested both proteins in a mouse maternal immunization model [250]. We immunized groups of adult female CD1 mice with the purified recombinant proteins and after three immunizations, mice were mated and the resulting offspring were challenged with a dose of GBS calculated to kill about 90% of the pups. The high levels of protection observed with the mutated form of the protein (Table 3) revealed that the loss of isopeptide bonds did not interfere with capacity of the protein to confer protection in mice and to elicit opsonic antibodies (FIG. 3B).

(57) Domain D3 is Highly Surface Exposed and Essential for Protection

(58) Based on the information obtained from the structural model described above, we generated four deletion mutants of the BP-2a 515 variant, dividing the protein in four overlapping fragments corresponding to the four IgG-like domains predicted by modelling (FIG. 4A): D1 corresponds to the region from amino acids 30 to 162; D2 corresponds to the region from amino acids 156 to 338; D3 corresponds to the region from amino acids 332 to 499; and D4 corresponds to the region from amino acids 457 to 640.

(59) The deletion fragments were cloned, expressed in E. coli and purified as HIS- or TRX-tagged recombinant proteins, as described in Materials and Methods. Interestingly, the isopeptide bonds present into domains D2 and D3 and D4 were also identified in the single recombinant forms of these domains, indicating that the single domain had all the requirements for the formation of this covalent bond (data not shown).

(60) The four purified soluble domains were used for immunizing CD1 mice and protein-specific immune responses (i.e., the total immunoglobulin level) were monitored by ELISA and Western Blotting. Sera raised against each fragment were also analyzed by flow cytometry using whole bacteria strain 515 in order to evaluate which domain was exposed on the polymerized pilus protruding from bacterial surface. As shown in FIG. 4B, domains D3 and D4 were highly exposed at a level comparable to those observed with the antiserum raised against the full length protein. A weak shift was obtained using antibodies anti-D2 suggesting it is not highly exposed, whereas D1 was not exposed.

(61) To investigate which of the domains were able to confer protection against GBS infection, we performed an in vitro opsonophagocytosis analysis using sera from immunized mice and an in vivo active maternal mouse immunization/neonatal pup challenge model. According to the FACS results, only domains D3 and D4 domains were able to elicit opsonophagocytic antibodies and confer protection in mice against GBS infection (FIG. 4C and Tables 3 and 4). In particular, domain D3 showed the highest level of surface exposure and opsonic activity.

(62) The selection of FACS positive and opsonic mAbs mapping in the D3 domain confirmed that the C-terminal portion of the protein and in particular D3 is essential for protective immunity (data not shown).

(63) Domain D3 Represents the Immunodominant Epitope of the Main Allelic Variants of BP-2a

(64) We have observed that all the allelic variants described so far, sharing a sequence homology ranging from 48% to 98%, were protective in mouse model, although they protected only pups challenged with strains carrying the allelic variant used to immunize the respective mothers ([2] and data not shown).

(65) To investigate if the results obtained with the 515 allele were confirmed in the other variants, we applied the same approach described above to map the immunodominant portion in the most representative variants (named 515, CJB111, H36B and 2603) belonging to the two major families.

(66) In order to understand if the BP-2a variants shared the same structural organization, a new structural model of the H36B allele (TIGR annotation SAI_1511), was generated.

(67) This variant was chosen because it is the most divergent in terms of sequences identity and similarity, from the 515 variant (48% of sequence identity). The RrgB pilus protein of S. pneumoniae was used as template structure (PDB code: 650). The amino acid sequences of SAI_1511 and RrgB were aligned and reported to share 38% sequence identity and 56% sequence similarity. The model of SAI_1511, as reported in FIG. 5A, revealed the same modular structure as the 515 variant, comprising 4 IgG-like fold domains, 3 of which contain internal Lys-Asn isopeptide with relatively conserved surroundings. Moreover, even though the main protein structure organization is conserved (RMSD=0.9 Å), in the H36B variant model structure there are two insertion loops which are not present in RrgB crystal structure. The first one spans residues 200 to 214, while the second one spans residues 402 to 410 (FIG. 5A). The function of these two additional loop regions is still unknown.

(68) Based on the information obtained from structural analysis, we generated deletion mutants of the H36B variant, dividing this variant in four overlapping fragments, expressed in E. coli and purified as recombinant proteins. D1 corresponded to the region from amino acids 30 to 158, D2 to the region from amino acids 152 to 350, D3 to the region from amino acids 343 to 493 and D4 to the region from amino acids 487 to 658 (FIG. 5B). The purified soluble domains were used to immunize CD1 mice and sera raised against each fragments were tested in in vitro and in vivo protection assays.

(69) As observed for the 515 variant, antisera raised against domain D3 showed the highest fluorescence shift when tested in Flow Cytometry Analysis on whole bacterial cells (FIG. 5C), and was able to promote efficient killing of bacteria when analyzed in an opsonophagocytosis assay in presence of human polymorphonuclear leukocytes (PMNs) and baby rabbit complement (FIG. 5D). In addition, domain D3 conferred significant levels of protection against the challenge strain in which the H36B variant was well expressed and exposed on the bacterial surface (Tables 5 and 6).

(70) Domain D3 has further been confirmed as the immunodominant epitope for BP-2a in all the known allelic variants (data not shown). For example, as shown in Table 7, domain D3 from the CJB111 variant confers significant levels of protection against challenge with the CJB111 strain. In addition, two monoclonal antibodies (17C4/A3 and 4H11/B7, SEQ ID NOs: 262-269) have been found to bind an epitope comprising amino acids 411-436 (SEQ ID NO: 270) within the D3 sub-fragment from the 515 clade (SEQ ID NO: 38, fragment of SEQ ID NO: 2) (data not shown).

(71) Fusion Proteins Carrying Protective Epitopes Confer Cross Protection Against GBS Strains Expressing Different Alleles.

(72) The mapping of the D3 domains as the immunodominant and protective region of the different variants was then used to facilitate the design of chimeric proteins to test in the animal model in order to evaluate the ability of these fusion proteins to confer broad-spectrum protection.

(73) Two fusion proteins were generated. The first one, fusion protein 6XD3, is composed of domain D3 of six backbone protein variants (515, CJB111, H36B, DK21, 090 and 2603) (FIGS. 6A and B). The second one, fusion protein 4XD3Helix, is composed of domain D3 plus the two protruding helices of domain D4 of the four most representative variants (515, CJB111, H36B and 2603) (FIGS. 6A and B). Each fusion protein has been cloned and expressed in E. coli and purified as recombinant proteins, as reported in Material and Methods (FIG. 6C).

(74) The purified fusion proteins were used to immunize CD1 mice and sera raised against each fusion protein were tested in in vitro and in vivo protection assays. In order to understand if the sera were able to recognize pilus-like structures containing the different variants of BP-2a, we performed Western Blotting and FACS analysis (data not shown and FIG. 6D). The results showed that the immune sera generated against the two fusion proteins are able to recognize the pilus-like structures from the total extracts. Opsonophagocytosis experiments confirmed that antisera against fusion proteins were able to mediate complement-dependent phagocytic killing of GBS strains expressing different allelic variants of BP-2a (FIG. 6E). In addition, data from the in vivo protection model show that both fusion proteins were able to elicit protective immunity in mice challenged with strains expressing the different variant of the protein and can thus be used as a broadly-protective vaccine against GBS infections (Tables 8 and 9). Finally, Table 9 shows that the protective effect of the 6XD3 fusion is maintained if a His tag is used.

(75) Discussion

(76) Many bacterial pathogens, including S. agalactiae (GBS), have evolved a wide range of mechanisms to escape the immune system of their hosts or to adapt to environmental variation, for instance, adopting the strategy of gene variability and/or differential gene expression. These strategies play a crucial role in the capacity of pathogens to trigger disease and also explain why it is so difficult to develop vaccines against these microorganisms. Advances in sequencing technology and bioinformatics have resulted in an exponential growth of genome sequence information and complete genomes of multiple isolates are now available for a large number of pathogens. Multigenome analysis has revealed unexpectedly high gene variation between strains of a single species, with implications for effective vaccine and drug-discovery programs. Species such as streptococci may have a relatively small genome, but the total number of dispensable genes in the population permits sufficient flexibility for the species to adapt to environmental challenge.

(77) Pathogenicity islands, such as pilus islands discovered in GBS and in other Gram-positive pathogens in the recent years, belong to the class of genomic islands, which have been acquired by horizontal gene transfer and are a typical example of dispensable genome. Because they promote genetic variability, genomic islands play an important role in microbial evolution. The three pilus islands identified in GBS (named PI-1, PI-2a and PI-2b) encode high molecular weight structures whose subunits are potential protein vaccine candidates. However, since pilin antigens are not universally present, conserved and expressed on the bacterial surface of a large subpopulation of GBS, only a combination of more proteins would be suitable for a broad-spectrum vaccine.

(78) The backbone protein of pilus 2a (BP-2a), is essential for pilus polymerization. Although BP-2a is able to confer protection in mice and to mediate opsonophagocytic killing of live GBS bacteria at a level comparable to killing observed with antibodies against capsular polysaccharide antigens, it has the highest level of gene variability among all pilin antigens. The existence of at least seven non-cross protective allelic variants of BP-2a blocks the possibility to use this antigen alone for a broad-spectrum vaccine, except by including all the identified alleles in the vaccine.

(79) For an immunogenic multi-variant antigen such as BP-2a, the selection of only a small protective portion of the protein (the highly surface-exposed IgG-like fold domain D3 of the protein) allowed us to rationally design and produce chimeric proteins by fusion of the single immunodominant domains from the different non-cross-reacting alleles. These chimeras acquired the capability to confer broad cross-protection in mice against infections from GBS strains expressing all BP-2a variants. The combined approach of structural and functional analysis reported herein, together to use of tools of genetic engineering allowed us generate fusion proteins containing the immunodominant domain of all main variants of BP-2a whilst conserving the native structural architecture of the selected domain. Interestingly, our results show that the ability of the domains to elicit protective immunity was not dependent on the present of internal isopeptide bonds.

(80) The cross protective immune response of the fusion proteins is of fundamental importance in the development of a vaccine, since it decreases the risk of generating escape mutants and enables the generation of a protective immune response against genetically different GBS strains.

(81) TABLE-US-00011 TABLE 1 Primers used in the experiments described herein SEQ ID Primers Sequence (5′-3′) NO Gene amplified 515-D1 for CACCATGGAAGAAGCAAAAACTACTGAC 228 fragment coding for the 515-D1 rev TCATTAATCAGCCAAGATAGAACCATC 229 domain 1 (30-162aa) of BP- 2a 515 variant 515-D2 for CACCATGGATGGTTCTATCTTGGCTGAT 230 fragment coding for the 515-D2 rev TCATTATTCAATTGTTGGGTTGTTGCC 231 domain 2 (158-338aa) of BP- 2a 515 variant 515-D3 for CACCATGGGCAACAACCCAACAATTGAA 232 fragment coding for the 515-D3 rev TCATTAAGCTTTTTCTGCATCTGTTGC 233 domain 3 (332-499aa) of BP- 2a 515 variant 515-D4 for CACCATGTTGGCAGGAGCTACCTTCCTT 234 fragment coding for the 515-D4 rev TCATTAAGTAACCTTCTTATTGATAAC 235 domain 4 (472-640aa) of BP- 2a 515 variant H36B-D1 CACCATGGCTGAGATGGGAAATATCACT 236 fragment coding for the for domain 1 (30-158aa) of BP- H36B-D1 TCATTAGTCAGCAAGAACTTTGTCACC 237 2a H36B variant rev H36B-D2 CACCATGGGTGACAAAGTTCTTGCTGAC 238 fragment coding for the for domain 2 (152-350aa) of BP- H36B-D2 TCATTATACTTTTTTACCTGGTTTGTTACC 239 2a H36B variant rev H36B-D3 CTGTACTTCCAGGGCAACAAACCAGGTAAAAAAGTA 240 fragment coding for the for domain 3 (343-493aa) of BP- H36B-D3 AATTAAGTCGCGTTATTATGCACCTTGCAAGCGTTCTGT 241 2a H36B variant rev H36B-D4 CACCATGACAGAACGCTTGCAAGGTGCA 242 fragment coding for the for domain 4 (487-658aa) of BP- H36B-D4 TCATTAAGTCACTTTTTTGTTTTCTAT 243 2a H36B variant rev BP-2a-H36B GTTTGCGCATATGGCTGAGATGGGAAATATCACT 244 gene coding for the full for length BP-2a H36B variant BP-2a-H36B GTGGAATCTCGAGAGTCACTTTTTTGTTTTCTAT 245 without the signal peptide Rev and the LPXTG (SEQ ID NO: 272) motif BP-2a 515 CTGTACTTCCAGGGCGAAGAAGCAAAAACTACTGACACAGTG 246 gene coding for the full LPXTG-for length BP-2a 515 variant with BP-2a 515 AATTAAGTCGCGTTATGTACCAATACCACCTGTTTGTGGAAT 247 LPXTG (SEQ ID NO:272) LPXTG-rev motif. 6XD3 FP- CTGTACTTCCAGGGCAATAATCCGACCATTGAAAATG 248 gene coding for the fusion for protein 6XD3 6XD3 FP- AATTAAGTCGCGTTAAATCGGCGTCGGATCGTTACTGTT 249 rev LYS42ALA CACGCTATTGTCATGCCTCGAACTGCATTTGACGGTTTTACT 250 gene coding for the mutated for form of BP-2a 515 variant LYS42ALA CATGACAATAGCGTGCAAGGTCACTGTGTCAGTAGTTTTTGC 251 containing K42A rev LYS83ALA GAAGCGGCGGAAATCGCAGGTGCTTACTTTGCTTTC 252 gene coding for the mutated for form of BP-2a 515 variant LYS83ALA GATTTCCGCCGCTTCGCCTGAGCCAAAGTAAGTTTTAAG 253 containing K83A rev CJB111-D1 CACCATGGACGACGCAACAACTGATACT 254 fragment coding for for domain 1 (30- CJB111-D1 TCATTATGAATCAGCCAAGATAGAACCGTT 255 162aa) of BP-2a CJB111 rev variant CJB111-D2 CACCATGAACGGTTCTATCTTGGCTGATTCA 256 fragment coding for for domain 2 (155- CJB111-D2 TCATTATTCTTCCGTTGGGTTATTACC 257 337aa) of BP-2a CJB111 rev variant CJB111-D3 CACCATGGGTAATAACCCAACGGAAGAA 258 fragment coding for for domain 3(331- CJB111-D3 TCATTAAGCTCCTGCCAAGCGTTCAGT 259 474aa) of BP-2a CJB111 rev variant CJB111-D4 CACCATGACTGAACGCTTGGCAGGAGCT 260 fragment coding for for domain 4 (468- CJB111-D4 TCATTAGGTTACTTTTTTGTTTTGAACTTG 261 639aa) of BP-2a CJB111 rev variant

(82) TABLE-US-00012 TABLE 2 Data collection and refinement statistics of BP-2a-515 (molecular replacement). One crystal was used to solve the structure. Values in parentheses are for the highest resolution shell. BP-2a-515 (residues 190-640) Data collection Space group P2.sub.12.sub.12.sub.1 Cell dimensions a, b, c (Å) 63.7, 104.7, 159.3 α = β = γ (°) 90 Resolution (Å) 40-1.75 (1.75-1.84) R.sub.merge 0.099 (0.6) I/σI 14.9 (3.7) Completeness (%) 100 (100) Redundancy 9.6 (9.7) Refinement Resolution (Å) 40-1.75 No. reflections 103,7178 R.sub.work/R.sub.free 18.5/21.6 No. atoms Protein 7076 Potassium ion 3 Water 895 B-factors Protein 32.3 Potassium ion 24.8 Water 20.2 R.m.s. deviations Bond lengths (Å) 0.007 Bond angles (°) 1.047

(83) TABLE-US-00013 TABLE 3 Results of an active maternal mouse immunization/neonatal pup challenge model to determine protection conferred by single domain of GBS59 515 variant against group B streptococcus 515 strain. Protection conferred by single domains of BP- 2a 515 variant against GBS 515 strain assessed by active maternal mouse immunization/neonatal pup challenge model. Protection values was calculated as [(% dead in control-% dead in vaccine)/% dead in control]*100. Protection Statistical significance Antigen Alive/Treated (%) (p value) D1-515 17/59 20 0.0235 D2-515  6/25 15 0.1310 D3-515 19/28 64 p < .0001 D4-515 38/60 58 p < .0001 BP-2a-515 full length 42/60 66 p < .0001 BP-2a-515 ΔIB 28/38 71 p < .0001 PBS  4/39

(84) TABLE-US-00014 TABLE 4 Protection conferred by single domains of BP-2a-515 allele against GBS strain 515, assessed by active maternal mouse immunization/neonatal pup challenge model. Protection values were calculated as [(% sepsis in control-% sepsis in vaccine)/% sepsis in control]*100. Statistical Protection significance Antigen Protected/Treated (%) (p value)* D1-515 19/59 24 0.0098 D2-515  7/25 20 0.0687 D3-515 21/28 72 p < .0001 D4-515 42/60 67 p < .0001 full length BP-2a-515 44/60 70 p < .0001 PBS  4/39 NOTE. Groups of female mice received 3 doses (on days 1, 21, and 35) of either 20 μg antigen or buffer (PBS) combined with Freund's adjuvant. Mice were then mated, and their offspring were challenged with a GBS dose calculated to induce sepsis in 90% of the pups. *p value, by Fisher's exact test.

(85) TABLE-US-00015 TABLE 5 Protection conferred by single domains of BP-2a H36B variant against GBS 515 strain assessed by active maternal mouse immunization/neonatal pup challenge model. Protection values was calculated as [(% dead in control-% dead in vaccine)/% dead in control]*100. Statistical Protection significance Antigen Alive/Treated (%) (p value) D1-1136B 49/60 9 0.1562 D2-1136B 31/48 28 0.0016 D3-1136B  2/40 94 p < .0001 D4-1136B 19/37 43 p < .0001 BP-2a-1136B full length 10/47 77 p < .0001 PBS 53/59

(86) TABLE-US-00016 TABLE 6 Neonatal protection conferred by single domains of BP-2a-H36B against GBS strain 5401, expressing the H36B BP-2a variant, assessed by active maternal mouse immunization/neonatal pup challenge model. Protection values were calculated as [(% sepsis in control-% sepsis in vaccine)/% sepsis in control]*100. Statistical Protection significance Antigen Protected/Treated (%) (p value)* D1-1136B 15/60 1 0.52 D2-1136B 22/48 29 0.019 D3-1136B 38/40 93 p < .0001 D4-1136B 20/37 39 0.0025 full length BP-2a-H36B 39/47 78 p < .0001 PBS 14/59 NOTE. Groups of female mice received 3 doses (on days 1, 21, and 35) of either 20 μg antigen or buffer (PBS) combined with Freund's adjuvant. Mice were then mated, and their offspring were challenged with a GBS dose calculated to induce sepsis in 90% of the pups. *p value, by Fisher's exact test.

(87) TABLE-US-00017 TABLE 7 Protection conferred by single domains of BP-2a-CJB111 variant against GBS CJB111 strain, expressing the BP-2a CJB111 variant, assessed by active maternal mouse immunization/neonatal pup challenge model. Protection values were calculated as [(% sepsis in control-% sepsis in vaccine)/% sepsis in control]*100. Statistical Protection significance Antigen Protected/Treated (%) (p value)* D1-CJB111  2/39  0 0.3619 D2-CJB111 12/50 16 0.065 D3-CJB111 41/54 73 p < .0001 D4-CJB111 13/46 20 0.0269 full length BP-2a-CJB111 19/40 42 p < 0.00015 PBS  4/41 NOTE. Groups of female mice received 3 doses (on days 1, 21, and 35) of either 20 μg antigen or buffer (PBS) combined with Freund's adjuvant. Mice were then mated, and their offspring were challenged with a GBS dose calculated to induce sepsis in 90% of the pups. *p value, by Fisher's exact test.

(88) TABLE-US-00018 TABLE 8 Protection by active maternal mouse immunization/neonatal pup challenge model conferred by fusion proteins against a panel of GBS strains expressing different BP-2a allelic variants. Protection values was calculated as [(% dead in control-% dead in vaccine)/% dead in control]*100. GBS Protection (%) challenge BP-2a Fusion Protein Fusion Protein Fusion Protein strains allele 6XD3 4XD3Helix (I) 4XD3Helix (II) 515 515 63 43 62 CJB111 CJB111 70 52 36 3050 2603 68 100 79 5401 H36B 65 90 60

(89) TABLE-US-00019 TABLE 9 Protection by active maternal mouse immunization/neonatal pup challenge model conferred by fusion protein 6xD3 against a panel of GBS strains expressing different BP-2a allelic variants. Protection values were calculated as [(% sepsis in control-% sepsis in vaccine)/% sepsis in control]*100. GBSchallenge antigen 6xD3 PBS strain BP-2a allele (protected/treated) (protected/treated) Protection (%) 515 515 50/68 13/50 65* CJB111 CJB111 38/48  7/30 73* 3050 2603 53/70 12/40 66* 5401 H36B 22/30 11/40 63* DK21 DK21 29/38  6/29 70* CDC89 CJB110 26/40  6/26 55* NOTE. Groups of female mice received 3 doses (on days 1, 21, and 35) of either 20 μg antigen or buffer (PBS) combined with Freund's adjuvant. Mice were then mated, and their offspring were challenged with a GBS dose calculated to induce sepsis in 90% of the pups. *p value, p < .0001 by Fisher's exact test.

(90) TABLE-US-00020 TABLE 10 Protection by active maternal mouse immunization/neonatal pup challenge model conferred by fusion proteins with and without tags against a panel of GBS strains. Fusion protein Fusion protein PBS GBS 6xD3-His tag 6xD3-native (pro- challenge (protected/ % (protected/ % tected/ % strain treated) survival treated) survival treated) survival 515  59/104 57 43/69 62 16/83 19 5401 37/58 64 53/64 83  2/50 4 CJB111 33/80 41 36/70 51  9/54 17

LIST OF SEQUENCES

(91) SEQ ID NO:1 (GBS59 2603) SEQ ID NO:2 (GBS59 515) SEQ ID NO:3 (GBS59 cjb111) SEQ ID NO:4 (GBS59 h36b) SEQ ID NO:5 (GBS59 CJB110) SEQ ID NO:6 (GBS59 DK21) SEQ ID NO:7 (GBS59 NEM316) SEQ ID NO:8 (D1 2603) SEQ ID NO:9 (D2 2603) SEQ ID NO:10 (D3 2603) SEQ ID NO:11 (D4 2603) SEQ ID NO:12 (D1 515) SEQ ID NO:13 (D2 515) SEQ ID NO:14 (D3 515) SEQ ID NO:15 (D4 515) SEQ ID NO: 16 (cjb111 D1) SEQ ID NO:17 (cjb111 D2) SEQ ID NO:18 (cjb111 D3) SEQ ID NO:19 (cjb111 D4) SEQ ID NO:20 (h36b D1) SEQ ID NO:21 (h36b D2) SEQ ID NO:22 (h36b D3) SEQ ID NO:23 (h36b D4) SEQ ID NO:24 (CJB110 D1) SEQ ID NO:25 (CJB110 D2) SEQ ID NO:26 (CJB110 D3) SEQ ID NO:27 (CJB110 D4) SEQ ID NO:28 (DK21 D1) SEQ ID NO:29 (DK21 D2) SEQ ID NO:30 (DK21 D3) SEQ ID NO:31 (DK21 D4) SEQ ID NO:32 (D1 NEM316) SEQ ID NO:33 (D2 NEM316) SEQ ID NO:34 (D3 NEM316) SEQ ID NO:35 (D4 NEM316) SEQ ID NO:36 (2603 D3 sub-fragment) SEQ ID NO:37 (2603 D4H) SEQ ID NO:38 (515 D3 sub-fragment) SEQ ID NO:39 (515 D4H) SEQ ID NO:40 (cjb111 D3 sub-fragment) SEQ ID NO:41 (cjb111 D4H) SEQ ID NO:42 (h36b D3 sub-fragment) SEQ ID NO:43 (h36b D4H) SEQ ID NO:44 (CJB110 D3 sub-fragment) SEQ ID NO:45 (CJB110 D4H) SEQ ID NO:46 (DK21 D3 sub-fragment) SEQ ID NO:47 (DK21 D4H) SEQ ID NO:48 (NEM316 D3 sub-fragment) SEQ ID NO:49 (DK21 D4H) SEQ ID NO:50 (2603 D3+D4) SEQ ID NO:51 (2603 D3+D4H) SEQ ID NO:52 (2603 D2+D3+D4) SEQ ID NO:53 (2603 D2+D3+D4H) SEQ ID NO:54 (515 D3+D4) SEQ ID NO:55 (515 D3+D4H) SEQ ID NO:56 (515 D2+D3+D4) SEQ ID NO:57 (515 D2+D3+D4H) SEQ ID NO:58 (cjb111 D3+D4) SEQ ID NO:59 (cjb111 D3+D4H) SEQ ID NO:60 (cjb111 D2+D3+D4) SEQ ID NO:61 (cjb111 D2+D3+D4H) SEQ ID NO:62 (h36b D3+D4) SEQ ID NO:63 (h36b D3+D4H) SEQ ID NO:64 (h36b D2+D3+D4) SEQ ID NO:65 (h36b D2+D3+D4H) SEQ ID NO:66 (CJB110 D3+D4) SEQ ID NO:67 (CJB110 D3+D4H) SEQ ID NO:68 (CJB110 D2+D3+D4) SEQ ID NO:69 (CJB110 D2+D3+D4H) SEQ ID NO:70 (DK21 D3+D4) SEQ ID NO:71 (DK21 D3+D4H) SEQ ID NO:72 (DK21 D2+D3+D4) SEQ ID NO:73 (DK21 D2+D3+D4H) SEQ ID NO:74 (NEM316 D3+D4) SEQ ID NO:75 (NEM316 D3+D4H) SEQ ID NO:76 (NEM316 D2+D3+D4) SEQ ID NO:77 (NEM316 D2+D3+D4H) SEQ ID NO:78 (515 short fragment of D3) SEQ ID NO:79 (his tag) SEQ ID NO:80 (linker) SEQ ID NO:81 (linker) SEQ ID NO:82 (linker) SEQ ID NO:83 (Fusion E) SEQ ID NO:84 (Fusion F) SEQ ID NO:85 (Fusion G) SEQ ID NO:86 (Fusion H) SEQ ID NO:87 (Fusion I) SEQ ID NO:88 (encoding Fusion E) SEQ ID NO:89 (encoding Fusion F) SEQ ID NO:90 (encoding Fusion G) SEQ ID NO:91 (encoding Fusion H) SEQ ID NO:92 (encoding Fusion I) SEQ ID NO:93 (encoding Fusion E—E. Coli optimised) SEQ ID NO:94 (encoding Fusion F—E. Coli optimised) SEQ ID NO:95 (encoding Fusion G—E. Coli optimised) SEQ ID NO:96 (encoding Fusion H—E. Coli optimised) SEQ ID NO:97 (encoding Fusion I—E. Coli optimised) SEQ ID NO:98 (IC adjuvant) SEQ ID NO:99 (Polycationic peptide adjuvant) SEQ ID NO:100 (encoding GBS59 2603) SEQ ID NO:101 (encoding GBS59 515) SEQ ID NO:102 (encoding GBS59 cjb111) SEQ ID NO:103 (encoding GBS59 h36b) SEQ ID NO:104 (encoding GBS59 CJB110) SEQ ID NO:105 (encoding GBS59 DK21) SEQ ID NO:106 (encoding GBS59 NEM316) SEQ ID NO:107 (encoding 2603 D1) SEQ ID NO:108 (encoding 2603 D2) SEQ ID NO:109 (encoding 2603 D3) SEQ ID NO:110 (encoding 2603 D4) SEQ ID NO:111 (encoding 515 D1) SEQ ID NO:112 (encoding 515 D2) SEQ ID NO:113 (encoding 515 D3) SEQ ID NO:114 (encoding 515 D4) SEQ ID NO:115 (encoding cjb111 D1) SEQ ID NO:116 (encoding cjb111 D2) SEQ ID NO:117 (encoding cjb111 D3) SEQ ID NO:118 (encoding cjb111 D4) SEQ ID NO:119 (encoding h36b D1) SEQ ID NO:120 (encoding h36b D2) SEQ ID NO:121 (encoding h36b D3) SEQ ID NO:122 (encoding h36b D4) SEQ ID NO:123 (encoding CJB110 D1) SEQ ID NO:124 (encoding CJB110 D2) SEQ ID NO:125 (encoding CJB110 D3) SEQ ID NO:126 (encoding CJB110 D4) SEQ ID NO:127 (encoding DK21 D1) SEQ ID NO:128 (encoding DK21 D2) SEQ ID NO:129 (encoding DK21 D3) SEQ ID NO:130 (encoding DK21 D4) SEQ ID NO:131 (encoding NEM316 D1) SEQ ID NO:132 (encoding NEM316 D2) SEQ ID NO:133 (encoding NEM316 D3) SEQ ID NO:134 (encoding NEM316 D4) SEQ ID NO:135 (encoding 2603 D3 sub-fragment) SEQ ID NO:136 (encoding 2603 D4H) SEQ ID NO:137 (encoding 515 D3 sub-fragment) SEQ ID NO:138 (encoding 515 D4H) SEQ ID NO:139 (encoding cjb111 D3 sub-fragment) SEQ ID NO:140 (encoding cjb111 D4H) SEQ ID NO:141 (encoding h36b D3 sub-fragment) SEQ ID NO:142 (encoding h36b D4H) SEQ ID NO:143 (encoding CJB110 D3 sub-fragment) SEQ ID NO:144 (encoding CJB110 D4H) SEQ ID NO:145 (encoding DK21 D3 sub-fragment) SEQ ID NO:146 (encoding DK21 D4H) SEQ ID NO:147 (encoding NEM316 D3 sub-fragment) SEQ ID NO:148 (encoding NEM316 D4H) SEQ ID NO:149 (encoding 2603 D3+D4) SEQ ID NO:150 (encoding 2603 D3+D4H) SEQ ID NO:151 (encoding 2603 D2+D3+D4) SEQ ID NO:152 (encoding 2603 D2+D3+D4H) SEQ ID NO:153 (encoding 515 D3+D4) SEQ ID NO:154 (encoding 515 D3+D4H) SEQ ID NO:155 (encoding 515 D2+D3+D4) SEQ ID NO:156 (encoding 515 D2+D3+D4H) SEQ ID NO:157 (encoding cjb111 D3+D4) SEQ ID NO:158 (encoding cjb111 D3+D4H) SEQ ID NO:159 (encoding cjb111 D2+D3+D4) SEQ ID NO:160 (encoding cjb111 D2+D3+D4H) SEQ ID NO:161 (encoding h36b D3+D4) SEQ ID NO:162 (encoding h36b D3+D4H) SEQ ID NO:163 (encoding h36b D2+D3+D4) SEQ ID NO:164 (encoding h36b D2+D3+D4H) SEQ ID NO:165 (encoding CJB110 D3+D4) SEQ ID NO:166 (encoding CJB110 D3+D4H) SEQ ID NO:167 (encoding CJB110 D2+D3+D4) SEQ ID NO:168 (encoding CJB110 D2+D3+D4H) SEQ ID NO:169 (encoding DK21 D3+D4) SEQ ID NO:170 (encoding DK21 D3+D4H) SEQ ID NO:171 (encoding DK21 D2+D3+D4) SEQ ID NO:172 (encoding DK21 D2+D3+D4H) SEQ ID NO:173 (encoding NEM316 D3+D4) SEQ ID NO:174 (encoding NEM D3+D4H) SEQ ID NO:175 (encoding NEM316 D2+D3+D4) SEQ ID NO:176 (encoding NEM316 D2+D3+D4H) SEQ ID NO:177 (GBS80 2603) SEQ ID NO:178 (GBS80 2603 without leader) SEQ ID NO:179 (GBS80 2603 without transmembrane/cytoplasmic region) SEQ ID NO:180 (GBS80 2603 without transmembrane/cytoplasmic region and cell wall anchor) SEQ ID NO:181 (GBS80 2603 without extracellular domain) SEQ ID NO:182 (N-terminal immunogenic fragment of GBS80 2603) SEQ ID NO:183 (GBS67 2603) SEQ ID NO:184 (GBS67 2603 without transmembrane region) SEQ ID NO:185 (GBS67 2603 without transmembrane and cell wall anchor motif) SEQ ID NO:186 (N-terminal fragment of GBS67 2603) SEQ ID NO:187 (N-terminal fragment of GBS67 2603) SEQ ID NO:188 (GBS67 h36b) SEQ ID NO:189 (N-terminal fragment of GBS67 h36b) SEQ ID NO:190 (N-terminal fragment of GBS67 h36b) SEQ ID NO:191 (GBS67 CJB111) SEQ ID NO:192 (N-terminal fragment of GBS67 CJB111) SEQ ID NO:193 (N-terminal fragment of GBS67 CJB111) SEQ ID NO:194 (GBS67 515) SEQ ID NO:195 (N-terminal fragment of GBS67 515) SEQ ID NO:196 (N-terminal fragment of GBS67 515) SEQ ID NO:197 (GBS67 NEM316) SEQ ID NO:198 (N-terminal fragment of GBS67 NEM316) SEQ ID NO:199 (N-terminal fragment of GBS67 NEM316) SEQ ID NO:200 (GBS67 DK21) SEQ ID NO:201 (N-terminal fragment of GBS67 DK21) SEQ ID NO:202 (N-terminal fragment of GBS67 DK21) SEQ ID NO:203 (GBS67 CJB110) SEQ ID NO:204 (N-terminal fragment of GBS67 CJB110) SEQ ID NO:205 (N-terminal fragment of GBS67 CJB110) SEQ ID NO:206 (GBS1523 COH1) SEQ ID NO:207 (GBS1523 COH1 without signal sequence region) SEQ ID NO:208 (GBS1523 COH1 with mutation at position 41) SEQ ID NO:209 (GBS80-GBS1523 hybrid) SEQ ID NO:210 (GBS80-GBS1523 hybrid) SEQ ID NO:211 (GBS80-GBS1523 hybrid) SEQ ID NO:212 (GBS80-GBS1523 hybrid) SEQ ID NO:213 (GBS104 2603) SEQ ID NO:214 (GBS1524) SEQ ID NO:215 (GBS3 2603) SEQ ID NO:216 (GBS3 2603 without signal sequence region) SEQ ID NO:217 (GBS3 2603 coiled coil and proline-rich segments) SEQ ID NO:218 (GBS3 2603 signal sequence and coiled coil) SEQ ID NO:219 (GBS3 2603 coiled coil segment) SEQ ID NO:220 (GBS3 2603 signal sequence, coiled coil and proline rich segment) SEQ ID NO:221 (GBS3 515) SEQ ID NO:222 (GBS3 cjb111) SEQ ID NO:223 (GBS3 coh1) SEQ ID NO:224 (SAN1485 coh1) SEQ ID NO:225 (GBS147 2603) SEQ ID NO:226 (GBS328 2603) SEQ ID NO:227 (GBS84 2603) SEQ ID NO:228-261 (Primers) SEQ ID NO:262 (4H11/B7-VH DNA sequence) SEQ ID NO:263 (4H11/B7-VH amino acid sequence) SEQ ID NO:264 (4H11/B7-VLk DNA sequence) SEQ ID NO:265 (4H11/B7-VLk amino acid sequence) SEQ ID NO:266 (17C4/A3-VH DNA sequence) SEQ ID NO:267 (17C4/A3-VH amino acid sequence) SEQ ID NO:268 (17C4/A3-VLk DNA sequence) SEQ ID NO:269 (17C4/A3-VLk amino acid sequence) SEQ ID NO:270 (epitope of D3 bound by 4H11/B7 and 17C4/A3) SEQ ID NO:271 (RrgB)

REFERENCES

(92) [1] Rosini et al, Molecular Microbiology, 2006, 61(1): 126-141 [2] Margarit et al, Journal of Infectious Diseases, 2009, 199: 108-115 [3] Needleman & Wunsch (1970) J. Mol. Biol. 48, 443-453. [4] Rice et al (2000) Trends Genet 16:276-277. [5] Bodanszky (1993) Principles of Peptide Synthesis (ISBN: 0387564314). [6] Fields et al. (1997) Meth Enzymol 289: Solid-Phase Peptide Synthesis. ISBN: 0121821900. [7] Chan & White (2000) Fmoc Solid Phase Peptide Synthesis. ISBN: 0199637245. [8] Kullmann (1987) Enzymatic Peptide Synthesis. ISBN: 0849368413. [9] Ibba (1996) Biotechnol Genet Eng Rev 13:197-216. [10] U.S. Pat. No. 5,707,829 [11] Vaccine Design . . . (1995) eds. Powell & Newman. ISBN: 030644867X. Plenum. [12] WO90/14837. [13] WO90/14837. [14] Podda & Del Giudice (2003) Expert Rev Vaccines 2:197-203. [15] Podda (2001) Vaccine 19: 2673-2680. [16] Vaccine Design: The Subunit and Adjuvant Approach (eds. Powell & Newman) Plenum Press 1995 (ISBN 0-306-44867-X). [17] Vaccine Adjuvants: Preparation Methods and Research Protocols (Volume 42 of Methods in Molecular Medicine series). ISBN: 1-59259-083-7. Ed. O'Hagan. [18] Allison & Byars (1992) Res Immunol 143:519-25. [19] Hariharan et al. (1995) Cancer Res 55:3486-9. [20] US-2007/014805. [21] WO95/11700. [22] U.S. Pat. No. 6,080,725. [23] WO2006/113373. [24] WO2005/097181. [25] U.S. Pat. No. 5,057,540. [26] WO96/33739. [27] EP-A-0109942. [28] WO96/11711. [29] WO00/07621. [30] Barr et al. (1998) Advanced Drug Delivery Reviews 32:247-271. [31] Sjolanderet et al. (1998) Advanced Drug Delivery Reviews 32:321-338. [32] Niikura et al. (2002) Virology 293:273-280. [33] Lenz et al. (2001) J Immunol 166:5346-5355. [34] Pinto et al. (2003) J Infect Dis 188:327-338. [35] Gerber et al. (2001) J Virol 75:4752-4760. [36] WO03/024480. [37] WO03/024481. [38] Gluck et al. (2002) Vaccine 20:B10-B16. [39] EP-A-0689454. [40] Johnson et al. (1999) Bioorg Med Chem Lett 9:2273-2278. [41] Evans et al. (2003) Expert Rev Vaccines 2:219-229. [42] Meraldi et al (2003) Vaccine 21:2485-2491. [43] Pajak et al (2003) Vaccine 21:836-842. [44] Kandimalla et al. (2003) Nucleic Acids Research 31:2393-2400. [45] WO02/26757. [46] WO99/62923. [47] Krieg (2003) Nature Medicine 9:831-835. [48] McCluskie et al. (2002) FEMS Immunology and Medical Microbiology 32:179-185. [49] WO98/40100. [50] U.S. Pat. No. 6,207,646. [51] U.S. Pat. No. 6,239,116. [52] U.S. Pat. No. 6,429,199. [53] Kandimalla et al. (2003) Biochemical Society Transactions 31 (part 3):654-658. [54] Blackwell et al. (2003) J Immunol 170:4061-4068. [55] Krieg (2002) Trends Immunol 23:64-65. [56] WO01/95935. [57] Kandimalla et al. (2003) BBRC 306:948-953. [58] Bhagat et al (2003) BBRC 300:853-861. [59] WO03/035836. [60] Schellack et al. (2006) Vaccine 24:5461-72. [61] WO95/17211. [62] WO98/42375. [63] Beignon et al. (2002) Infect Immun 70:3012-3019. [64] Pizza et al (2001) Vaccine 19:2534-2541. [65] Pizza et al. (2000) Int J Med Microbiol 290:455-461. [66] Scharton-Kersten et al. (2000) Infect Immun 68:5306-5313. [67] Ryan et al (1999) Infect Immun 67:6270-6280. [68] Partidos et al. (1999) Immunol Lett 67:209-216. [69] Peppoloni et al. (2003) Expert Rev Vaccines 2:285-293. [70] Pine et al. (2002) J Control Release 85:263-270. [71] Tebbey et al. (2000) Vaccine 18:2723-34. [72] Domenighini et al. (1995) Mol Microbiol 15:1165-1167. [73] WO99/40936. [74] WO99/44636. [75] Singh et all (2001) J Cont Release 70:267-276. [76] WO99/27960. [77] U.S. Pat. No. 6,090,406. [78] U.S. Pat. No. 5,916,588. [79] EP-A-0626169. [80] WO99/52549. [81] WO01/21207. [82] WO01/21152. [83] Andrianov et al (1998) Biomaterials 19:109-115. [84] Payne et al. (1998) Adv Drug Delivery Review 31:185-196. [85] Stanley (2002) Clin Exp Dermatol 27:571-577. [86] Jones (2003) Curr Opin Investig Drugs 4:214-218. [87] WO99/11241. [88] WO94/00153. [89] WO98/57659. [90] European patent applications 0835318, 0735898 and 0761231. [91] Donnelly et al (1997) Annu Rev Immunol 15:617-648. [92] Strugnell et al (1997) Immunol Cell Biol 75(4):364-369. [93] Cui (2005) Adv Genet 54:257-89. [94] Robinson & Torres (1997) Seminars in Immunol 9:271-283. [95] Brunham et al. (2000) J Infect Dis 181 Suppl 3:S538-43. [96] Svanholm et al (2000) Scand J Immunol 51(4):345-53. [97] DNA Vaccination—Genetic Vaccination (1998) eds. Koprowski et al (ISBN 3540633928). [98] Gene Vaccination: Theory and Practice (1998) ed. Raz (ISBN 3540644288). [99] Findeis et al., Trends Biotechnol. (1993) 11:202 [100] Chiou et at (1994) Gene Therapeutics: Methods And Applications Of Direct Gene Transfer. ed. Wolff [101] Wu et al. Biol. Chem. (1988) 263:621 [102] Wu et al. Biol. Chem. (1994) 269:542 [103] Zenke et at, Proc. Natl. Acad. Sci. (USA) (1990) 87:3655 [104] Wu et al., J. Biol. Chem. (1991) 266:338 [105] Jolly, Cancer Gene Therapy (1994) 1:51 [106] Kimura, Human Gene Therapy (1994) 5:845 [107] Connelly, Human Gene Therapy (1995) 1:185 [108] Kaplitt, Nature Genetics (1994) 6:148 [109] WO 90/07936. [110] WO 94/03622. [111] WO 93/25698. [112] WO 93/25234. [113] U.S. Pat. No. 5,219,740. [114] WO 93/11230. [115] WO 93/10218. [116] U.S. Pat. No. 4,777,127. [117] GB Patent No. 2,200,651. [118] EP-A-0345242. [119] WO 91/02805. [120] WO 94/12649. [121] WO 93/03769. [122] WO 93/19191. [123] WO 94/28938. [124] WO 95/11984. [125] WO 95/00655. [126] Curiel, Hum. Gene Ther. (1992) 3:147 [127] Wu, J. Biol. Chem. (1989) 264:16985 [128] U.S. Pat. No. 5,814,482. [129] WO 95/07994. [130] WO 96/17072. [131] WO 95/30763. [132] WO 97/42338. [133] WO 90/11092. [134] U.S. Pat. No. 5,580,859 [135] U.S. Pat. No. 5,422,120 [136] WO 95/13796. [137] WO 94/23697. [138] WO 91/14445. [139] EP-0524968. [140] Philip, Mot Cell Biol. (1994) 14:2411 [141] Woffendin, Proc. Natl. Acad. Sci. (1994) 91:11581 [142] U.S. Pat. No. 5,206,152. [143] WO 92/11033. [144] U.S. Pat. No. 5,149,655. [145] Zwijnenburg et al (2001) J Infect Dis 183:1143-6. [146] WO2009/016515. [147] Tettelin et al, Proc. Natl. Acad. Sci. U.S.A. 99 (19), 12391-12396 (2002) [148] Tettelin et al, Proc. Natl. Acad. Sci. U.S.A. 102 (39), 13950-13955 (2005) [149] WO09/101403 [150] WO2006/130328 [151] Lewis et al. (2004) PNAS USA 101:11123-8. [152] WO2006/050341. [153] Paoletti et al (1992) J Clin Invest 89:203-9 [154] WO96/40795 [155] Wessels et al. (1989) Infect Immun 57:1089-94. [156] WO2006/082527. [157] Paoletti et al (1990) J Biol Chem 265:18278-83. [158] Wessels et al. (1990) J Clin Invest 86:1428-33. [159] Paoletti et al. (1992) Infect Immun 60:4009-14. [160] Wessels et al. (1987) Proc Natl Acad Sci USA 84:9170-4. [161] Wang et al (2003) Vaccine 21:1112-7. [162] Wessels et al. (1993) Infect Immun 61:4760-6 [163] Wessels et al. (1995) J Infect Dis 171:879-84. [164] Baker et al. (2004) J Infect Dis 189:1103-12. [165] U.S. Pat. No. 4,356,170. [166] Paoletti & Kasper (2003) Expert Opin Biol Ther 3:975-84. [167] WO2005/000346 [168] Anonymous (January 2002) Research Disclosure, 453077. [169] Anderson (1983) Infect Immun 39(1):233-238. [170] Anderson et al. (1985) J Clin Invest 76(1):52-59. [171] EP-A-0372501. [172] EP-A-0378881. [173] EP-A-0427347. [174] WO93/17712. [175] WO94/03208. [176] WO98/58668. [177] EP-A-0471177. [178] WO91/01146. [179] Falugi et al. (2001) Eur J Immunol 31:3816-3824. [180] Baraldo et al. (2004) Infect Immun 72(8):4884-7. [181] EP-A-0594610. [182] Ruan et al. (1990) J Immunol 145:3379-3384. [183] WO00/56360. [184] WO01/72337. [185] WO00/61761. [186] WO00/33882 [187] WO99/42130. [188] U.S. Pat. No. 4,761,283. [189] U.S. Pat. No. 4,356,170. [190] U.S. Pat. No. 4,882,317. [191] U.S. Pat. No. 4,695,624. [192] Mol. Immunol., 1985, 22, 907-919 [193] EP-A-0208375. [194] Bethell G. S. et al., J. Biol. Chem., 1979, 254, 2572-4 [195] Hearn M. T. W., J Chromatogr., 1981, 218, 509-18 [196] WO00/10599. [197] Geyer et al., Med. Microbiol. Immunol, 165: 171-288 (1979). [198] U.S. Pat. No. 4,057,685. [199] U.S. Pat. Nos. 4,673,574; 4,761,283; 4,808,700. [200] U.S. Pat. No. 4,459,286. [201] U.S. Pat. No. 4,965,338. [202] U.S. Pat. No. 4,663,160. [203] WO2007/000343. [204] Vaccines. (eds. Plotkin & Orenstein). 4th edition, 2004, ISBN: 0-7216-9688-0. [205] Rappuoli et al (1991) TIBTECH 9:232-238. [206] Harper et al. (2004) Lancet 364(9447):1757-65. [207] Brandt et al. (2006) J Antimicrob Chemother. 58(6):1291-4. Epub 2006 Oct. 26 [208] Winter et al., (1991) Nature 349:293-99 [209] U.S. Pat. No. 4,816,567. [210] Inbar et al., (1972) Proc. Natl. Acad. Sci. U.S.A. 69:2659-62. [211] Ehrlich et al., (1980) Biochem 19:4091-96. [212] Huston et al., (1988) Proc. Natl. Acad. Sci. U.S.A. 85:5897-83. [213] Pack et al., (1992) Biochem 31, 1579-84. [214] Cumber et al., (1992) J. Immunology 149B, 120-26. [215] Riechmann et al., (1988) Nature 332, 323-27. [216] Verhoeyan et al., (1988) Science 239, 1534-36. [217] GB 2,276,169. [218] Gennaro (2000) Remington: The Science and Practice of Pharmacy. 20th edition, ISBN: 0683306472. [219] Methods In Enzymology (S. Colowick and N. Kaplan, eds., Academic Press, Inc.) [220] Handbook of Experimental Immunology, Vols. I-IV (D. M. Weir and C. C. Blackwell, eds, 1986, Blackwell Scientific Publications) [221] Sambrook et al. (2001) Molecular Cloning: A Laboratory Manual, 3rd edition (Cold Spring Harbor Laboratory Press). [222] Handbook of Surface and Colloidal Chemistry (Birdi, K. S. ed., CRC Press, 1997) [223] Ausubel et al. (eds) (2002) Short protocols in molecular biology, 5th edition (Current Protocols). [224] Molecular Biology Techniques: An Intensive Laboratory Course, (Ream et al., eds., 1998, Academic Press) [225] PCR (Introduction to Biotechniques Series), 2nd ed. (Newton & Graham eds., 1997, Springer Verlag) [226] Geysen et al (1984) PNAS USA 81:3998-4002. [227] Carter (1994) Methods Mol Biol 36:207-23. [228] Jameson, B A et al 1988, CABIOS 4(1):181-186. [229] Raddrizzani & Hammer (2000) Brief Bioinfonn 1(2):179-89. [230] Bublil et al. (2007) Proteins 68(1):294-304. [231] De Lalla et al. (1999) J. Immunol. 163:1725-29. [232] Kwok et al. (2001) Trends Immunol 22:583-88. [233] Brusic et al. (1998) Bioinformatics 14(2):121-30 [234] Meister et al. (1995) Vaccine 13(6):581-91. [235] Roberts et al. (1996) AIDS Res Hum Retroviruses 12(7):593-610. [236] Maksyutov & Zagrebelnaya (1993) Comput Appl Biosci 9(3):291-7. [237] Feller & de la Cruz (1991) Nature 349(6311):720-1. [238] Hopp (1993) Peptide Research 6:183-190. [239] Welling et al. (1985) FEBS Lett. 188:215-218. [240] Davenport et al. (1995) Immunogenetics 42:392-297. [241] Tsurui & Takahashi (2007) J Pharmacol Sci. 105(4):299-316. [242] Tong et al. (2007) Brief Bioinform. 8(2):96-108. [243] Schirle et al. (2001) J Immunol Methods. 257(1-2):1-16. [244] Chen et al. (2007) Amino Acids 33(3):423-8. [245] Current Protocols in Molecular Biology (F. M. Ausubel et al., eds., 1987) Supplement 30 [246] Smith & Waterman (1981) Adv. Appl. Math. 2: 482-489. [247] Altschul (1997) Nucleic Acids Res. 1997 Sep. 1; 25(17):3389-402. [248] Proteins. 1995 November; 23(3):318-26. [249] Klock et al, (2008), Proteins, 71:982-994 [250] Maione et al (2005), Science, 309: 148-150 [251] Krissinel E., and Hendrick, K. (2007): J. Mol. Biol. 372: 774-797 [252] Spraggon G. et al (2010) PLoS One 5, e10919