Unextracted tooth root canal filler and dental tissue regeneration method for unextracted tooth
09724368 · 2017-08-08
Assignee
Inventors
Cpc classification
A61K35/32
HUMAN NECESSITIES
A61P1/02
HUMAN NECESSITIES
A61K35/32
HUMAN NECESSITIES
A61L27/3834
HUMAN NECESSITIES
A61P43/00
HUMAN NECESSITIES
A61C5/50
HUMAN NECESSITIES
A61K2300/00
HUMAN NECESSITIES
A61K2300/00
HUMAN NECESSITIES
A61K35/28
HUMAN NECESSITIES
International classification
A61L27/36
HUMAN NECESSITIES
A61K35/28
HUMAN NECESSITIES
A61C5/50
HUMAN NECESSITIES
Abstract
Disclosed is a root canal filler for non-extracted tooth which causes no internal resorption or external resorption in a tooth with complete root formation, shows no odontoclast, and contributes to the regeneration of a dental tissue in which odontoblasts are smoothly aligned on the dentin wall. After pulpectomy or enlargement/cleaning of an infected root canal, a root canal filler for non-extracted tooth, which comprises tooth pulp stem cells and an extracellular matrix, is inserted into the apical side of the root canal of the non-extracted tooth. The tooth pulp stem cells may be, for example, dental pulp CXCR4-positive cells. It is preferred to attach, to the crown side of the root canal, migration factor(s) including at least one factor selected from among a cell migration factor, a cell proliferation factor, a neurotrophic factor and an angiogenic factor.
Claims
1. A dental tissue regeneration method without tooth extraction, the method comprising: performing a pulpectomy or enlargement and cleaning of an infected root canal on an unextracted tooth; transplanting an unextracted tooth root canal filler into an apical part of the root canal; and regenerating a dental tissue in the root canal, wherein the unextracted tooth root canal filler comprises: (a) CD105-positive and CD146-negative dental pulp cells, or (b) CXCR4-positive dental pulp stem cells, and (c) an extracellular matrix, and wherein the unextracted tooth root canal filler does not comprise stromal cell-derived factor-1 (SDF1).
2. The dental tissue regeneration method of claim 1, wherein in the unextracted tooth root canal filler, the dental pulp stem cells are transplanted to the apical part of the root canal, and a chemotactic factor comprising at least one factor selected from the group consisting of a cell chemotactic factor, a cell growth factor, a neurotrophic factor, and an angiogenic factor is transplanted to a tooth crown part of the root canal.
3. The dental tissue regeneration method of claim 2, wherein the cell chemotactic factor is at least one cell chemotactic factor selected from the group consisting of VEGF, G-CSF, SCF, MMP3, Slit, and GM-CSF.
4. The dental tissue regeneration method of claim 2, wherein the cell growth factor is at least one cell growth factor selected from the group consisting of IGF, bFGF, and PDGF.
5. The dental tissue regeneration method of claim 2, wherein the neurotrophic factor is at least one neurotrophic factor selected from the group consisting of GDNF, BDNF, NGF, Neuropeptide Y, and Neurotrophin 3.
6. The dental tissue regeneration method of claim 1, wherein the extracellular matrix is made of biocompatible materials containing at least one biocompatible material selected from the group consisting of collagen, synthetic proteoglycans, gelatin, hydrogel, fibrin, phosphophorin, heparan sulfate, heparin, laminin, fibronectin, alginic acid, hyaluronic acid, chitin, PLA, PLGA, PEG, PGA, PDLLA, PCL, hydroxyapatite, β-TCP, calcium carbonate, titanium, and gold.
7. The dental tissue regeneration method of claim 1, wherein the root canal is enlarged before transplantation of the root canal filler into the apical part of the root canal, thereby enlarging the apical part of the root canal to a predetermined size.
8. The dental tissue regeneration method of claim 1, wherein a concentration of the dental pulp stem cells in the extracellular matrix is in the range from 1×10.sup.3 cells/μl to 1×10.sup.6 cells/μl, both inclusive.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1)
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
(12)
(13)
(14)
(15)
(16)
(17)
(18)
(19)
(20)
(21)
(22)
(23)
(24)
(25)
(26)
(27)
(28)
(29)
(30)
(31)
(32)
(33)
(34)
(35)
(36)
(37)
(38)
(39)
(40)
(41)
(42)
(43)
(44)
(45)
(46)
(47)
(48)
(49)
(50)
(51)
(52)
(53)
(54)
(55)
(56)
(57)
(58)
(59)
(60)
(61)
(62)
(63)
(64)
(65)
(66)
(67)
(68)
(69)
(70)
(71)
(72)
(73)
(74)
(75)
(76)
(77)
(78)
(79)
(80)
DESCRIPTION OF EMBODIMENTS
(81) First Embodiment
(82) Embodiments of the present disclosure will be specifically described hereinafter with reference to the drawings. An unextracted tooth root canal filler according to this embodiment includes dental pulp stem cells and an extracellular matrix, and is inserted in the apical part of an infected root canal of an unextracted tooth after pulpectomy or enlargement and cleaning of the root canal.
(83)
(84) The dental pulp stem cells are dental pulp stem cells derived from a permanent tooth or a deciduous tooth. The dental pulp stem cells include at least one of dental pulp CXCR4-positive cells, SSEA-4-positive cells, FLK-1-positive cells, CD105-positive cells, dental pulp SP cells, CD31-negative and CD146-negative cells, CD24-positive cells, CD150-positive cells, CD29-positive cells, CD34-positive cells, CD44-positive cells, CD73-positive cells, or CD90-positive cells. For example, canine permanent tooth dental pulp cells include 0.8% CXCR4-positive cells and have a high tissue regeneration potential such as an angiogenic potential.
(85) The dental pulp SP cells are preferably CXCR4-positive cells, SSEA-4-positive cells, FLK-1-positive cells, CD31-negative and CD146-negative cells, CD24-positive cells, CD105-positive cells, CD150-positive cells, CD29-positive cells, CD34-positive cells, CD44-positive cells, CD73-positive cells, or CD90-positive cells.
(86) When CD31.sup.−/CD146.sup.− side population (SP) cells are transplanted in a mouse hindlimb ischemic site, blood flow recovery and angiogenesis are promoted. When these SP cells are transplanted in a cerebral infarction ischemic site of a rat, nerve cell differentiation is promoted and motor disability is recovered. In addition, when these SP cells are transplanted in a canine amputated pulp, angiogenesis, nerve regeneration, and dental pulp regeneration are observed in a cavity on the amputated vital pulp. In this manner, in the case of using CD31.sup.−/CD146.sup.−SP cells as dental pulp stem cells, potential of dental pulp regeneration is assumed to be high. However, to fractionate SP cells, cells need to be labeled with Hoechst 33342, which is a DNA-binding fluorescent dye, and thus, safety problems might occur in clinical application.
(87) On the other hand, dental pulp CXCR4-positive cells can be fractionated by a migration method using SDF-1, AMD3100, or G-CSF, for example, without using flow cytometry, which cannot be clinically employed because of the possibility of contamination, and an antibody bead technique, which is expensive and thus has a limited use. For this reason, the dental pulp CXCR4-positive cells can be fractionated with safety at low cost. Accordingly, in the case of using CXCR4-positive cells as dental pulp stem cells, the CXCR4-positive cells can be clinically used promptly, and are economically advantageous.
(88) The dental pulp stem cells may be autologous cells extracted from a target animal itself to be subjected to treatment for dental tissue regeneration, or may be allogeneic cells extracted from an another distinct animal from the target animal to be subjected to treatment for dental tissue regeneration.
(89) The concentration of dental pulp stem cells in the unextracted tooth root canal filler 200 is preferably in the range from 1×10.sup.3 cells/μl to 1×10.sup.6 cells/μl, both inclusive. This is because of the following reasons. If the concentration of dental pulp stem cells is less than 1×10.sup.3 cells/μl, dental tissues in a root canal are insufficiently regenerated. On the other hand, if the cell concentration of dental pulp stem cells is larger than 1×10.sup.6 cells/μl, an unexpected adverse reaction might occur in the target tooth.
(90) The extracellular matrix (Scaffold) 210 is preferably made of a biocompatible material containing at least one of collagen, synthetic proteoglycans, gelatin, hydrogel, fibrin, phosphophorin, heparan sulfate, heparin, laminin, fibronectin, alginic acid, hyaluronic acid, chitin, polylactic acid (PLA), lactic acid/glycolic acid copolymers (PLGA), polyethylene glycol (PEG), polyglycol acid (PGA), poly-DL-lactic acid (PDLLA), polycaprolactone (PCL), hydroxyapatite, β-TCP, calcium carbonate, titanium, or gold. The proteoglycans above are composite sugars consisting of proteins and sugar chains (glucosaminoglycans) covalently bound to each other. The extracellular matrix may be a sponge-shaped three-dimensional structure made of nanofibers each having a number-average diameter of 1 nm to 1000 nm and prepared with a polymer such as thermoplastic polymer. The void rate of such a three-dimensional structure is preferably 80% to 99.99%.
(91) Collagen to be used as the extracellular matrix is preferably a mixture of type I collagen and type III collagen. The type I collagen is basic collagen, which is fibrous. The type III collagen forms a fine network structure, called reticular fiber different from the collagen fiber, and provides a matrix for fixation of cells and others.
(92) The proportion of the type III collagen in the collagen mixture described above is preferably in the range from 30 weight % (wt. %) to 50 wt. %, both inclusive. This is because of the following reasons. If the proportion of the type III collagen is higher than 50 wt. %, the collagen mixture might not be solidified. On the other hand, if the proportion of the type III collagen is lower than 10 wt. %, the proportion of the type I collagen increases, and not angiogenesis described below but regeneration of dentin might occur.
(93) Referring now to
(94) An unextracted tooth root canal filler 200 is formed by transplanting dental pulp stem cells 220 to the apical part of an extracellular matrix 210. The dental pulp stem cells 220 are preferably transplanted to ¼ to ⅔ of the apical part of the unextracted tooth root canal filler 200, and more preferably transplanted to ⅓ of the apical part. In an example of the method for forming a root canal filler, 10 μl to 13 μl of the type I and III collagen mixture is first absorbed, and 7 μl to 10 μl of the type I and III collagen mixture (e.g., collagen XYZ, Nitta Gelatin) including dental pulp stem cells is then absorbed, into the tip of Pipetman, for example, to a total amount of 20 μl. Absorption into the tip of Pipetman, for example, is preferably slow enough to prevent formation of air bubbles. This is because if air bubbles are formed in the root canal filler, the bubbles restrain migration of cells to inhibit acceleration of dental tissue regeneration. The internal diameter of the Pipetman tip is preferably small and may be 0.5 to 0.7 mm at the bottom of the tip, for example. For example, H-010-96RS microcapillary tip from QSP may be used. The shape of the unextracted tooth root canal filler is not specifically limited, and may be a cone, a truncated cone, or a cylinder, for example.
(95) Referring now to
(96) As shown in
(97) As shown in
(98) After pulpectomy, it is preferable to adjust the size of the apical foramen to a predetermined width by enlargement of the root canal of the target tooth. As will be described below, this is because of the following reasons. In filling the root canal subjected to pulpectomy or treatment for the infected root canal with the unextracted tooth root canal filler 200, enlargement of the root canal can ease the filling with the unextracted tooth root canal filler 200, and allows blood vessels and nerves to easily penetrate therein from apical periodontal tissues. The apical area herein is a terminal of a target tooth (i.e., the apex area of the root of the tooth) connected to the alveolar bone.
(99) For example, in
(100) Then, as shown in
(101) After injection of the unextracted tooth root canal filler 200 into the apical part of the root canal, as shown in
(102) In this manner, dental tissues in the root canal are regenerated. As shown in
(103) Subsequently, the resin 620 is temporarily removed, and as shown in
(104) In the dental tissue regeneration using the unextracted tooth root canal filler 200 of this embodiment, none of internal resorption and external resorption is observed in the regenerated tissues, no odontoclast is observed either, and odontoblasts are aligned along the dentinal wall. Although a large amount of blood clots generated by bleeding is expected to be an obstacle of regeneration of dental pulp tissues, the use of an unextracted tooth in this embodiment can reduce generation of blood clots, thereby efficiently promoting regeneration of dental tissues. In addition, since an unextracted tooth is used in this embodiment, filling of a root canal can be delayed with medication of the root canal until bleeding or symptoms after enlargement of the root canal disappears. Thus, the method of this embodiment can approach an actual clinical treatment.
(105) In the above description, the target tooth 100 is a tooth in which microbial infection reaches the coronal pulp or the radicular pulp because of caries or pulpitis, for example. However, the present disclosure is not limited to this tooth, and the target tooth 100 includes a tooth having a degraded nerve function to have a weak sense of occlusion. In such a case, the unextracted tooth root canal filler 200 is injected after pulpectomy to regenerate dental pulp. Then, the sense of occlusion can be improved. In addition, the target tooth 100 also includes a tooth in which microbial infection reaches apical periodontal tissues (i.e., a tooth in which microbes reaches the dental pulp and further reaches dentin in the root canal wall and apical periodontal tissues). Such a tooth often involves periapical periodontitis 110. After enlargement and cleaning of the infected root canal, the unextracted tooth root canal filler 200 is injected.
(106) Second Embodiment
(107)
(108) The reason why the dental pulp stem cells 220 are transplanted to the apical part of the root canal and the chemotactic factor 230 is transplanted to the tooth crown part of the root canal is as follows. Even after the dental pulp stem cells 220 are transplanted to the tooth crown part of the root canal, failures in supplying nutrition from tissues might occur to cause a necrosis. In addition, the dental pulp stem cells 220 transplanted to the apical part of the root canal are likely to be pulled by the chemotactic factor transplanted to the tooth crown part of the root canal to promote regeneration of dental tissues. Alternatively, as illustrated in
(109) The cell chemotactic factor means a molecule which activates a signal transduction involved in cell migration when the molecule binds to the receptor. The cell growth factor means a molecule which activates a signal transduction involved in cell growth when the molecule binds to the receptor. The neurotrophic factor means a molecule which activates a signal transduction involved in cell survival when the molecule binds to the receptor. The angiogenic factor means a molecule which activates a signal transduction involved in growth, migration, and anti-apoptosis of vascular endothelial cells when the molecule binds to the receptor.
(110) The cell chemotactic factor is preferably at least one of SDF-1, VEGF, G-CSF, SCF, MMP3, Slit, or GM-CSF. In particular, MMP3 has a high cell migration potential, and thus is preferably used.
(111) The cell growth factor is preferably at least one of IGF, bFGF, or PDGF.
(112) The neurotrophic factor is preferably at least one of GDNF, BDNF, NGF, Neuropeptide Y, or Neurotrophin 3.
(113) The angiogenic factor is preferably at least one of E-selectin, VCAM1, ECSCR, or SLC6A6.
(114) The concentration of the chemotactic factor in the extracellular matrix to which the chemotactic factor is transplanted is preferably in the range from 0.1 ng/μ1 to 500 ng/μl, both inclusive. This is because of the following reasons. If the concentration of the chemotactic factor is lower than 0.1 ng/μl, migration might be less stimulated. On the other hand, if the concentration of the chemotactic factor is higher than 500 ng/μl, an unexpected adverse reaction might occur in the target tooth 100.
(115) Referring now to
(116) In an example method of formation of an unextracted tooth root canal filler 200 according to the second embodiment, 10 μl to 13 μl of a type I and III collagen mixture (where the mixture ratio between type I collagen and type III collagen is 1:1) including a chemotactic factor is first absorbed, and 7 μl to 10 μl of a type I and III collagen mixture including dental pulp stem cells is then absorbed, into the tip of Pipetman, for example, to a total amount of 20 μl. In the second embodiment, absorption into the tip of Pipetman, for example, is also preferably slow enough to prevent formation of air bubbles. The internal diameter of the tip of Pipetman is preferably small. In this manner, a root canal filler 200 illustrated in
(117) In the same manner as in the first embodiment, the unextracted tooth root canal filler 200 of the second embodiment is injected into the apical part of the root canal without tooth extraction after pulpectomy or after enlargement and cleaning of the infected root canal.
(118) The unextracted tooth root canal filler 200 of this embodiment includes the chemotactic factor. Accordingly, dental tissues can be more efficiently regenerated without internal resorption and odontoclast differentiation in the regenerated tissues, and odontoblasts are aligned along the dentinal wall.
(119) Third Embodiment
(120) In the unextracted tooth root canal filler 200 of the first embodiment, the dental pulp stem cells 220 are transplanted to the apical part of the root canal. However, the present disclosure is not limited to this example, and the dental pulp stem cells 220 may be uniformly mixed in the entire unextracted tooth root canal filler 200. In such an unextracted tooth root canal filler 200, dental tissues can be regenerated in a tooth with a complete apical closure, without internal resorption, external resorption and odontoclast differentiation in the regenerated tissues, and odontoblasts are aligned along the dentinal wall.
(121) This unextracted tooth root canal filler 200 can be obtained by, for example, uniformly mixing dental pulp stem cells with a type I and III collagen mixture (e.g., collagen XYZ, Nitta Gelatin) without formation of bubbles.
(122) In the unextracted tooth root canal filler 200 of the second embodiment described above, the dental pulp stem cells 220 are transplanted to the apical part of the root canal, and the chemotactic factor 230 is transplanted to the tooth crown part of the root canal. However, the present disclosure is not limited to this example, and the dental pulp stem cells 220 and the chemotactic factor 230 may be uniformly mixed in the entire unextracted tooth root canal filler 200. In such an unextracted tooth root canal filler 200, dental tissues can also be regenerated in a tooth with a complete apical closure, without internal resorption and external resorption and odontoclast differentiation, and odontoblasts are aligned along the dentinal wall.
(123) This unextracted tooth root canal filler 200 can be obtained by, for example, uniformly mixing dental pulp stem cells, a chemotactic factor, and a type I and III collagen mixture (e.g., collagen XYZ, Nitta Gelatin) without formation of bubbles.
EXAMPLES
First Example
(124) [Fractionation and Characterization of Cells]
(125) Human dental pulp was extracted, and digested with collagenase at 37° C. for one hour and a half for isolation of dental pulp cells. Then, the cells were dispersed in DMEM containing 2% serum at a concentration of 1×10.sup.6 cells/ml, and labeled using CXCR4 antibodies at 4° C. for 30 minutes. Thereafter, flow cytometry was performed. The CXCR4-positive cells derived from human dental pulp represented 20% of the total cells.
(126) Table 1 shows the results of the flow cytometry. Regarding CD29 and CD44, the percentage of CXCR4-positive cells was 90% or more, in the same manner as that of CD105-positive cells. Regarding CD105, the percentage of CD105-positive cells was 90.0%, but the percentage of CXCR4-positive cells was 1.7%. Regarding CD146, CXCR4-positive cells showed a percentage as low as CD105-positive cells. Regarding CD150, which is a marker of further undifferentiated stem cells, the percentage of CXCR4-positive cells was slightly higher than that of CD105-positive cells.
(127) TABLE-US-00001 TABLE 1 Canine dental Canine dental pulp pulp Canine total CXCR4-positive CD105-positive dental pulp cells cells cells CD29 99.4% 90.6% 95.6% CD34 61.6% 45.5% 47.1% CD44 99.8% 96.2% 99.9% CD90 0.5% 0.6% 1.6% CD105 1.7% 90.0% 4.6% CD146 0.5% 0.8% 0.9% CD150 3.6% 2.3% 0.9% MHC class I 82.8% 36.0% 73.8%
(128) In Real-time RT-PCR, CXCR4-positive cells derived from dental pulp and CD105-positive cells derived from dental pulp are compared with respect to RNA expression using primers shown in Tables 2 and 3. This comparison demonstrates that the vascular endothelial growth factor (VEGF)-A shows substantially the same amount of expression in both types of the cells. Expression of cytokine GM-CSF is 2.5 times higher in the CXCR4-positive cells than that in the CD105-positive cells, and expression of the neurotrophic factor NGF in the CD105-positive cells is 2.0 times higher than that in the CXCR4-positive cells. Expression of Neuropeptide Y, Neurotrophine 3, and BDNF in the CXCR4-positive cells is slightly higher than that in the CD105-positive cells. The stem cell marker, SOX2, is expressed higher in the CXCR4-positive cells compared with the CD105-positive cells. Stat3 and Rex1 are expressed similarly between the CXCR4-positive cells and the CD105-positive cells.
(129) TABLE-US-00002 TABLE 2 SEQ ID Product Accession Gene 5′←DNA Sequence.fwdarw.3′ NO size number CXCR4 Forward CTGTGGCAAACTGGTACTTC 1 210 bp NM_001 Reverse TCAACAGGAGGGCAGGTATC 2 048026 Sox2 Forward AGCTAGTCTCCAAGCGACGA 3 193 bp XM_545 Reverse CCACGTTTGCAACTGTCCTA 4 216 Stat3 Forward GTGGTGACGGAGAAGCAACA 5 191 bp XM_844 Reverse TTCTGTCTGGTCACCGACTG 6 672 Bmi1 Forward CACTCCCGTTCAGTCTCCTC 7 150 bp XM_544 Reverse CCAGATGAAGTTGCTGACGA 8 225 Rex1 Forward TGGACACGTCCGTGCTCTTC 9 168 bp XM_533 Reverse CTCGGATCTTCCAGATCACC 10 958 MMP3 Forward CCCTCTGATTCCTCCAATGA 11 210 bp AY1831 Reverse GGATGGCCAAAATGAAGAGA 12 43 VEGF-A Forward CTACCTCCACCATGCCAAGT 13 183 bp NM_001 Reverse ACGCAGGATGGCTTGAAGAT 14 003175 GM-CSF Forward GCAGAACCTGCTTTTCTTGG 15 195 bp S49738 Reverse CCCTCAGGGTCAAACACTTC 16 SDF-1 Forward GCCATGAACGCCAAGGTC 17 270 bp DQ1827 Reverse CTTGTTTTAGAGCTTTCTCCAGGT 18 00 NGF Forward CAACAGGACTCACAGGAGCA 19 156 bp XM_540 Reverse ATGTTCACCTCTCCCAGCAC 20 250 BDNF Forward GTTGGCCGACACTTTTGAAC 21 202 bp NM_001 Reverse CCTCATCGACATGTTTGCAG 22 002975 Neuropeptide Y Forward ATCACCAGGCAGAGGTATGG 23 206 bp XM_532 Reverse TTGGGAGGATAGGCAGATTC 24 492 Neurotrophin 3 Forward CCCCCTCCCTTGTATCTCAT 25 311 bp XM_532 Reverse CGTAGGTTTGGGACGTTTTG 26 492 E-selectin Forward GTATGTGCGTTTGCATGTCC 27 195 bp L23087 Reverse CAGGAGCCAGAGGAGAAATG 28 VCAM-1 Forward GGGATTAACCAGGCTGGAAT 29 190 bp CFU320 Reverse TGTCTCCCGTCTCTGCTTTT 30 86 Rhombotin-2 Forward GGCGCCTCTACTACAAGCTG 31 199 bp XM_846 Reverse TATCTGTCGCCCACACAGAA 32 184
(130) TABLE-US-00003 TABLE 3 SEQ ID Product Accession Gene 5′←DNA Sequence.fwdarw.3′ NO size number ECSCR Forward CCCCAGGTGTTATCAGCTTC 33 169 bp XM_549577 Reverse TCTTTCTCTCCGTTGGCTGT 34 SLC6A6 Forward CACGTCCTTGGTCGATCTTT 35 188 bp NM_0010033 Reverse AGAATGCAACCCACAAAAGG 36 11 ap2 Forward CGGATGACAGAAAAGTCAAG 37 194 bp XM_543759 Reverse TTCAGCTTGATGTCCCTTGG 38 Neurofilament Forward GCTGGACCGACTATCAGAGG 39 196 bp NM_0010033 Reverse CTGGTAGGATGCGATGTCAG 40 52 Neuromodulin Forward ACAAGATGGCATCAAACCAG 41 181 bp XM_535747 Reverse CTTCTTCTCCAGGCCATCAG 42 Enamelysin Forward TATTCACCGTTGCTGCTCAC 43 151 bp XM_849546 Reverse TACAATGCCTGGATCCCTTT 44 Osteocalcin Forward GGCAGCGAGGTGGTGAGGAG 45 180 bp AF205942 Reverse CTAGACCGGGCCATAGAAG 46 DSPP Forward GTCCTAGTGGGAATGGAGCA 47 190 bp XM_544971 Reverse TCTTCAGGGCCATCATCTTC 48 Axin2 Forward GAAAGGGTCAGGTCACCAAA 49 190 bp XM_548025 Reverse CATTTGTCCCTCTCCAGGAA 50 Periostin Forward AAACCATTGGAGGCAAACAG 51 209 bp XM_534490 Reverse TGCAGCTTCAAGTAGGCTGA 52 PLAP-1 Forward TCCCGTCAGGATTACAGGAG 53 210 bp XM_848228 Reverse GAACGCTCATTCTGCTCACA 54 Tenascin-C Forward TGGCTGTCTTGGACACAGAG 55 181 bp XM_538811 Reverse GACTCCAGAGTTGGGGTCTG 56 Syndecan 3 Forward TCATGCAGGACAGCTTCAAC 57 186 bp XM_544449 Reverse AGGGCTGGAATCTAGGGAAA 58 collagen α1(I) Forward CTTCCTGGAATGAAGGGACA 59 205 bp NM_0010030 Reverse CAGTAGCACCATCGTTTCCA 60 90 collagen α1(III) Forward AGGGTCCTGCTGGAAAGAAT 61 199 bp XM_857956 Reverse GGAACTCCAGGTGAACCAGA 62 β-actin Forward AAGTACCCCATTGAGCACGG 63 257 bp Z70044 Reverse ATCACGATGCCAGTGGTGCG 64
(131) [Regeneration of Canine Dental Pulp after Pulpectomy]
(132) Regeneration of canine dental pulp after transplantation of CD105-positive cells and CXCR4-positive cells in the pulpectomized root canal will be described hereinafter.
(133) CD105-positive cells and CXCR4-positive cells were fractionated from canine dental pulp tissues. Specifically, 40 μl of collagen XYZ (Nitta Gelatin, a type I and III collagen mixture) including SDF-1 (200 ng) was first absorbed into a tip of Pipetman, and 20 μl of collagen XYZ (Nitta Gelatin, a type I and III collagen mixture) including 1×10.sup.6 CD 105-positive cells was then absorbed, to a total amount of 60 μl. In this manner, a root canal filler to be injected into a root canal of an extracted tooth was formed. After extraction of a canine upper-jaw anterior tooth, dental pulp was completely removed and the root canal was enlarged to #70 in a culture medium, thereby enlarging the width of the root canal in the apical portion to 0.7 mm or more. Then, within 30 minutes after the dental pulp removal, the above root canal filler was injected into a site corresponding to a region where the dental pulp in the root canal originally existed. The tooth was replanted in the canine tooth extraction socket within 30 minutes, and the upper part of the tooth was sealed with phosphate cement and a chemically polymerized resin. The tooth was extracted for preparation of a paraffin sample after 14 days.
(134) Then, 13 μl of collagen XYZ (Nitta Gelatin, a type I and III collagen mixture) including SDF-1 (200 ng) was first absorbed into a tip of Pipetman, and 7 μl of collagen XYZ (Nitta Gelatin, a type I and III collagen mixture) including 1×10.sup.6 CD105-positive cells was then absorbed, to a total amount of 20 μl. In this manner, an unextracted tooth root canal filler 200 was obtained. In this unextracted tooth root canal filler 200, SDF-1 was transplanted to ⅔ of the tooth crown part of the root canal, and CD105-positive cells were transplanted to ⅓ of the apical part of the root canal. Without extraction of the canine upper-jaw anterior tooth, dental pulp was removed and the root canal was enlarged to #70, and the width of the root canal in the apical area was enlarged to 0.7 mm or more. Then, within 30 minutes after the dental pulp removal, the unextracted tooth root canal filler 200 was injected into a site corresponding to a region where the dental pulp in the root canal originally existed. The upper part of the tooth was sealed with phosphate cement and a chemically polymerized resin within 30 minutes. The tooth was extracted for preparation of a paraffin sample after 14 days.
(135) Then, 13 μl of collagen XYZ (Nitta Gelatin, a type I and III collagen mixture) including SDF-1 (200 ng) was first absorbed into a tip of Pipetman, and 7 μl of collagen XYZ (Nitta Gelatin, a type I and III collagen mixture) including 1×10.sup.6 CXCR4-positive cells was then absorbed, to a total amount of 20 μl. In this manner, an unextracted tooth root canal filler 200 was obtained. In this unextracted tooth root canal filler 200, SDF-1 was transplanted to ⅔ of the tooth crown part of the root canal, and CXCR4-positive cells were transplanted to ⅓ of the apical part of the root canal. Without extraction of the canine upper-jaw anterior tooth, dental pulp was removed and the root canal was enlarged to #70, and the width of the root canal in the apical area was enlarged to 0.7 mm or more. Then, within 30 minutes after the dental pulp removal, the unextracted tooth root canal filler 200 was injected into a site corresponding to a region where the dental pulp in the root canal originally existed. The upper part of the tooth was sealed with phosphate cement and a chemically polymerized resin within 30 minutes. The tooth was extracted for preparation of a paraffin sample after 14 days.
(136) In the newly regenerated dental pulp tissues, blood clots remained and inflammation was slightly observed in the case of tooth extraction (
(137) On the other hand, in the case of tooth unextraction, no odontoclasts were observed in the dentinal wall in the root canal, none of internal resorption and external resorption was observed, and odontoblasts were aligned along the dentinal wall (see
(138) The foregoing results proved that the case of injecting the filler into the root canal of an unextracted tooth is more advantageous for dental pulp regeneration than the case of injecting the filler into the root canal of an extracted tooth. In addition, it is also concluded that transplantation of CXCR4-positive cells derived from dental pulp are also effective on dental pulp regeneration, to the same degree as that of CD105-positive cells.
Second Example
(139) Then, in a second example, potential of the dental tissue regeneration of the unextracted tooth root canal filler will be more specifically examined.
(140) [Cell Fractionation with Flow Cytometry]
(141) Dental pulp cells were isolated from an upper canine. Primary adipocytes were isolated from adipose tissues of the same canine as control. The cells were subjected to immunostaining as mouse IgG1-negative control (W3/25) (AbD Serotec Ltd., Oxford, UK). The cells were subjected to immunostaining with mouse IgG1-negative control (Phycoerythrin, PE) (MCA928PE) (AbD Serotec) and mouse anti-human CD105 (PE) (43A3) (BioLegend, San Diego, Calif., USA) at 4° C. for 90 minutes. The resultant cells were incubated in 2 μg/ml of a propidium iodide-containing HEPES buffer (Sigma), and subjected to fractionation with JSAN (Bay Bioscience, Kobe, Japan). CD105-positive cells and CD105-negative cells derived from dental pulp and adipose tissues, and total pulp cells without cell fractionation were plated on a 35-mm collagen type I coated dish (Asahi Technoglass Corp., Funabashi, JAPAN), and cultured in EBM2 (Cambrex Bio Science, Walkersville, Md., USA) supplemented with 10 ng/ml of IGF (Cambrex Bio Science), 5 ng/ml of EGF (Cambrex Bio Science), and 10% fetal bovine serum (Invitrogen Corporation, Carlsbad, Calif., USA) to maintain the phenotype of the cells. The culture medium was replaced with a fresh medium once in four or five days. After reaching 60-70% confluence, the cells were detached at 37° C. for 10 minutes in 0.02% EDTA. Then, the cells were subcultured with a 1:4 dilution.
(142) Dental pulp CD105-positive cells were further characterized at the third passage of culture, and were compared with adipose CD105-positive cells and unfractionated total dental pulp cells. The cells were stained with mouse IgG1 negative control (AbD Serotec Ltd.), mouse IgG1 negative control (fluoresceinisothiocyanate, FITC) (MCA928F) (AbD Serotec), mouse IgG1 negative control (Phycoerythrin-Cy5,PE-Cy5) (MCA928C) (AbD Serotec), mouse IgG1 negative control (Alexa 647) (MRC OX-34) (AbDSerotec), and antibodies to CD24 (Alexa Fluor 647) (ML5) (BioLegend), CD29 (PE-Cy5) (MEM-101A) (eBioscience), CD31 (FITC) (Qbend10) (Dako), CD33 (FITC) (HIM3-4) (BD Bioscience), CD34 (Allophycocyanin, APC) (1H6) (R&D Systems, Inc., Minneapolis, Minn., USA), CD44 (Phycoerythrin-Cy7, PE-Cy7) (IM7) (eBioscience), CD73 (APC) (AD2) (BioLegend), CD90 (FITC) (YKIX337.217) (AbD Serotec), CD146 (FITC) (sc-18837) (Santa Cruz, Biotech, Santa Cruz, Calif., USA), CD150 (FITC) (A12) (AbD Serotec), MHC class I (R-PE) (3F10) (Ancell Corporation, Bayport, Minn., USA), MHC class II (APC) (TDR31.1) (Ancell), and CXCR4 (FITC) (12G5) (R&D).
(143) [Expression Analysis of Stem Cell Marker, Angiogenic Factor and Neurotrophic Factor by Real-Time RT-PCR]
(144) To further characterize the phenotype of the cell populations, total RNA was extracted from dental pulp and adipose CD105-positive cells and total dental pulp cells at the third passage of culture, using Trizol (Invitrogen). In each experiment, the number of these cells was normalized to 5×10.sup.4 cells in each experiment. First-strand cDNA was synthesized from total RNA using ReverTra Ace-α (Toyobo, Tokyo, Japan). Real-time RT-PCR amplifications were performed using stem cell markers, canine CXCR4, Sox2, Stat3, Bmi1, and Rex1 (Tables 2 and 3), labeled with Light Cycler-Fast Start DNA master SYBR Green I (Roche Diagnostics). at 95° C. for 10 seconds, at 62° C. for 15 seconds, and 72° C. for 8 seconds in Light Cycler (Roche Diagnostics, Pleasanton, Calif.). The design of the oligonucleotide primers was based on published canine cDNA sequences. When canine sequences were not available, human sequences were used. To study mRNA expression of angiogenic and neurotrophic factors, real-time RT-PCR amplifications of canine matrix metalloproteinase (MMP)-3, VEGF-A, a granulocyte-monocytecolony-stimulating factor (GM-CSF), SDF-1, NGF, BDNF, Neuropeptide Y, Neurotrophin 3, E-selectin, VCAM1, rhombotin 2, ECSCR, and SLC6A6 were also performed. The RT-PCR products were confirmed by sequencing based on published cDNA sequences. The expression in dental pulp CD105-positive cells and adipose CD105-positive cells was compared with that in total dental pulp cells at the third passage of culture after normalizing with β-actin.
(145) [Proliferation and Migration Analysis]
(146) First, 10.sup.3 dental pulp CD105-positive cells were inoculated in a 96-well plate in EBM2 supplemented with 0.2% bovine serum albumin (Sigma) and SDF-1 (50 ng/ml). Then, the proliferation potential of the dental pulp CD105-positive cells in response to stromal cell-derived factor-1(SDF-1) (Acris, Herford, Germany) was compared with those of total dental pulp cells and adipose CD105-positive cells at the fourth passage of culture. Thereafter, 10 μl of Tetra-color one (registered trade name, Seikagaku Kogyo, Co., Tokyo, JAPAN) was added to the 96-well plate, and the number of cells was measured at 2, 12, 24, and 36 hours of culture using a spectrophotometer at an absorbance of 450 nm Wells containing no cells served as negative controls.
(147) The migration potential of dental pulp CD105-positive cells in response to SDF-1 was compared with those of total dental pulp cells and adipose CD105-positive cells by a horizontal chemotaxis assay. A real-time horizontal chemotaxis assay was performed using TAXIScan-FL (Effector Cell Institute, Tokyo, JAPAN). In the TAXIScan-FL, a channel optimized to the cell size was formed between silicon with 6-μm holes and a glass plate, and 1 μl of cells (10.sup.5 cells/ml) was placed in one end of the channel, and 10 ng/μl of SDF-1 was placed in the other end of the channel with a constant concentration gradient. Then, video images of cell migration were taken with a microscope for 6 hours.
(148) [Fractionation and Characterization of CD105-Positive Cells Derived from Dental Pulp and Adipose]
(149) As shown in
(150) To characterize dental pulp CD105-positive cells, flow cytometry was performed using cell surface antigen markers, and dental pulp CD105-positive cells were compared with adipose CD105-positive cells and total dental pulp cells. The dental pulp CD105-positive cells, the adipose CD105-positive cells, and the total dental pulp cells were at the third passage of culture, CD29, CD44, CD90, and CD105 were positive, and CD31 was negative. As shown in Table 4 below, it is notable that the dental pulp CD105-positive cells expresses CD73, CD150, and CXCR4 more strongly than the adipose CD105-positive cells and the total dental pulp cells.
(151) TABLE-US-00004 TABLE 4 Dental pulp Adipose Total CD105-positive CD105-positive dental pulp cells cells cells CD24 1.8% 1.7% 0.3% CD29 95.9% 90.5% 99.2% CD31 0% .sup. 0% .sup. 0% CD33 3.7% .sup. 0% 0.2% CD34 45.5% 0.1% 47.1% CD44 96.2% 92.3% 99.9% CD73 97.2% 0.8% 22.3% CD90 98.1% 95.6% 97.5% CD105 98.5% 74.0% 4.6% CD146 0.8% 0.2% 0.9% CD150 2.3% 0.2% 0.9% MHC class I 36.0% 80.0% 73.8% MHC class II 0.4% .sup. 0% 0.4% CXCR4 12.2% 5.9% 5.3%
(152) In the dental pulp CD105-positive cells, stem cell markers of, for example, CXCR4, Sox2, and Bmi1 mRNA were expressed 16.8-, 64-, and 3.5-fold, respectively, higher than those in the total dental pulp cells, suggesting the stem properties of the pulp CD105-positive cells. In the dental pulp CD105-positive cells, CXCR4, Sox2, and Bmi1 mRNA were more highly expressed than those in the adipose CD105-positive cells. As shown in Table 5, in the dental pulp CD105-positive cells, angiogenic factors or neurotrophic factors of, for example, VEGF-A, GM-CSF, a nerve growth factor (NGF), a brain-derived neurotrophic factor (BDNF), neuropeptide Y, neurotrophin 3, E-selectin, and VCAM-1 were more highly expressed than those in the adipose CD105-positive cells.
(153) TABLE-US-00005 TABLE 5 Dental pulpCD105-positive Adipose CD105-positive cells/ cells/ total dental pulp cells total dental pulp cells CXCR4 16.8 7.0 Sox2 64.0 16.0 Stat3 0.8 0.1 Bmi1 3.5 0.1 Rex1 0.9 1.9 MMP3 26.1 11.6 VEGF-A 3.6 1.6 GM-CSF 5.8 1.9 SDF-1 1.7 1.8 NGF 4.1 0.5 BDNF 16.0 0.5 Neuropeptide Y 5.2 0.1 Neurotrophin 3 5.3 0.2 E-selectin 18.1 1.1 VCAM-1 54.6 18.7 Rhombotin-2 23.8 1.7 ECSCR 28.5 0.8 SLC6A6 12.7 1.5
(154) [Multipotency In Vitro]
(155) Dental pulp CD105-positive cells at the third through fifth passages of culture were differentiated into adipose, blood vessels, nerves, and dentin/bones by induction, and were compared with adipose CD105-positive cells and unfractionated dental pulp cells.
(156) As shown in
(157) However, as shown in
(158) [Autologous Transplantation in Root Canal after Pulpectomy of Stem Cells/Progenitor Cells]
(159) The dental pulp was completely removed from a canine (Narc, Chiba, Japan) permanent tooth with a complete apical closure, and an experimental model to which cellular fractions were transplanted to regenerate dental pulp was established. After general anesthesia with sodium pentobarbital (Schering-Plough, Germany), dental pulp was completely removed from the maxillary second incisor and the mandibular third incisor, and the apical foramen was enlarged to 0.7 mm using #70K-file (MANI. INC, Tochigi, Japan). A root canal filler in which dental pulp stem cells were transplanted to the apical part and SDF-1 was transplanted to the tooth crown part using collagen XYZ as an extracellular matrix. Specifically, autologous transplantation of dental pulp CD105-positive cells, adipose CD105-positive cells, or total dental pulp cells, 1×10.sup.6 cells in each, from the third to fourth passages of culture after Dil labeling was performed together with collagen XYZ (Nitta Gelatin, Osaka, Japan) into a lower part of the root canals. SDF-1 with a final concentration of 15 ng/μl and collagen XYZ were further transplanted into an upper part of the root canal. The cavity was sealed with zinc phosphate cement (Elite Cement, GC, Tokyo, Japan) and a bonding agent (Clearfil Mega Bond, Kuraray), and then repaired with composite resin (Clearfil HI, Kuraray, Kurashiki, Japan). In this experiment, 60 teeth of 15 canines were used. Samples were prepared after 14 days by injecting dental pulp CD105-positive cells and SDF-1 into 10 teeth, adipose CD105-positive cells and SDF-1 into five teeth, total dental pulp cells and SDF-1 into five teeth, only SDF-1 without cells into five teeth, only dental pulp CD105-positive cells without SDF-1 into five teeth, and only scaffold without cells into five teeth. Dental pulp CD105-positive cells and SDF-1 were injected into six teeth, and a two-dimensional electrophoresis analysis was performed after 28 days. Samples were prepared after 90 days by injecting dental pulp CD105-positive cells with SDF-1, adipose CD105-positive cells with SDF-1, and total dental pulp cells with SDF-1 into four teeth. Seven normal teeth were used as controls. For morphological analysis, the samples were fixed at 4° C. overnight in 4% paraformaldehyde (PFA) (Nakarai Tesque, Kyoto, Japan), decalcified with 10% formic acid, and then embedded in paraffin wax (Sigma). Then, the paraffin sections (with a thickness of 5 μm) were morphologically examined after staining with hematoxylin and eosin (HE).
(160) For blood vessel staining, 5-μm paraffin sections were deparaffinized, stained with Fluorescein Griffonia (Bandeiraea) Simplicifolia Lectin 1/fluorescein-galanthus nivalis (snowdrop) lectin (20 μg/ml, Vector laboratories, Inc., Youngstown, Ohio) for 15 minutes. Then, the presence and localization of transplanted cells in newly formed blood vessels were observed with a fluorescence microscope BIOREVO, BZ-9000 (KEYENCE, Osaka, Japan). Regenerated dental pulp after 14 days from transplantation and normal dental pulp were fixed for 45 minutes in 4% paraformaldehyde, subjected to treatment with PBS containing 0.3% Triton X, subjected to blocking, and then subjected to whole-mount immunostaining at 4° C. for 12 hours with GS-IB4 (Griffoniasimplicifolia, Alexa Fluor 488) lecitin. Three-dimensional photographs of the newly formed blood vessels and the transplanted cells were taken with a microscope FV1000MPE (Olympus).
(161) Staining of newly generated nerves was performed in the following manner. First, 5-μm paraffin sections were deparaffinized, treated with PBS containing 3% Triton X, blocked with 2% goat serum, and primarily stained with PGP-9.5 for 12 hours at 4° C. Then, the sections were washed three times with PBS, and secondary staining was performed with biotinylatedgoat anti-rabbit IgG (Vector) (1:200) for one hour at room temperature. Then, the sections were treated with an ABC reagent (VectorLaboratories, Burlingame, Calif.), and color was developed with DAB for 10 minutes.
(162) To confirm connection of a newly formed nerve projection to an inferior alveolar nerve, dental pulp CD105-positive cells without Dil labeling, were transplanted into the mandibular third incisor, and Dil was applied onto regenerated dental pulp on day 14 after transplantation. The mandible was extracted on day 17, and the tissues were observed with a fluorescence microscope (Leica, M 205 FA, Wetzlar, Germany).
(163) To statistically analyze relative amounts of the regenerated dental pulp tissue at the 14th day, five sections at 150 μm intervals for each tooth from a total of 5 teeth, each transplanted with dental pulp CD105-positive cells with SDF-1, adipose CD105-positive cells with SDF-1, total dental pulp cells with SDF-1, only SDF-1 without cells, only dental pulp CD105-positive cells without SDF-1, and only scaffold without cells were examined. Then, photographs of these samples were taken with a binocular microscopy (Leica, M 205 FA), and analyzed with Leica Application Suite software. The ratio of newly regenerated tissues to the surface area of the root canal was calculated by averaging three positions on each tooth. Statistical analyses were performed using a Student's t-test.
(164) Expressions of dentinsialophosphoprotein (Dspp) and enamelysin, differentiation markers of odontoblast in vivo were observed alignment along the root canal surface by in situ hybridization in 5 μm-paraffin sections 90 days after transplantation of dental pulp CD105-positive cells with SDF-1. Canine cDNA of Dspp (183 bp) and enamelysin (195 bp) were cut with NcoI and Spe I, respectively, and linearized, thereby forming anti-sense probes. The probes were formed from plasmid after subcloning of a PCR product, and obtained from primers shown in Tables 2 and 3 used in real-time RT-PCR. DIG signals were detected with a TSA system (PerkinElmer, Waltham, Mass., USA).
(165) [Dental Pulp Regeneration by Transplantation in Root Canal after Pulpectomy of Dental Pulp CD105-Positive Cells]
(166) Then, by the method as described above in
(167) However, as shown in
(168) [Two-Dimensional Electrophoresis Analysis and Gene Expression Analysis in Dental Pulp Regeneration]
(169) For a two-dimensional electrophoresis analysis of regenerated tissues, regenerated dental pulp-like tissues, normal dental pulp tissues, and periodontium tissues on day 28 were minced into pieces, and were dissolved in a lysis buffer (6M urea, 1.97M thiourea, 2% (w/v) CHAPS, 64.8 mM DTT, 2% (v/v) Pharmalyte), and subjected to ultrasound. Then, the resultant samples were centrifuged at 15,000 rpm for 15 minutes at 4° C., and two-dimensional electrophoresis was performed on the supernatant. Isoelectric focusing (IEF) was performed on a CoolPhoreSter2-DE system. IPG strips (Immobiline DryStrips, pH 4 to 7, 18 cm, GE) were used according to an instruction of the manufacturer. The IPG strips were hydrated again in a rehydration solution (6M urea, 1.97 M thiourea, 2% (v/v) Triton X-100, 13 mM DTT, 2% (v/v) Pharmalyte, 2.5 mM acetic acid, 0.0025% BPB) overnight at 20° C. The isoelectric focusing (IEF) was performed with the voltage gradually increased with 500V for two hours, 700-3000 V for one hour, and 3500V for 24 hours. After the isoelectric focusing, the IPG strips were caused to react in an equilibration buffer (6 M urea, 2.4 mM DTT, 5 mM Tris-HCl, pH 6.8, 2% (w/v) SDS, 0.0025% BPB, 30% (v/v) Glycerol) for 30 minutes at room temperature. The IPG strips were further equilibrated in 5 mM Tris-HCl, pH 6.8, 2% (w/v) SDS, 0.0025% BPB, 30% (v/v) Glycerol, 243 mM iodoacetamid for 20 minutes at room temperature. Thereafter, in the second dimension, proteins were migrated in 12.5% SDS-PAGE gel (20 cm×20 cm) with 25 mA/gel for 15 minutes and then 30 mA/gel. The gel was stained with Flamingo Fluorescent Gel Stain (Bio-Rad Laboratories, CA, USA), and scanned with a FluoroPhorester 3000 (Anatech, Tokyo, Japan). The gel image was analyzed with a progenesis (Nonlinear Dynamics, NC, USA), and patterns of the gel were compared with one another.
(170) Real-time RT-PCR analyses were performed using canine axin2, periostin, and asporin/periodontium-associated protein 1 (PLAP-1) specific to a periodontium. Expression of collagen type αI (I), syndecan3, and tenascin C in the regenerated tissues was compared with those in normal dental pulp and a periodontium.
(171) [Protein Chemical Analyses and Gene Expression Analysis by Two-Dimensional Electrophoreses of Regenerated Dental Pulp]
(172) As shown in
(173) A marker specific to dental pulp tissues has not been found yet. Thus, to prove that the regenerated tissues are normal dental pulp tissues, axin2, periostin, and asporin/periodontium-associated protein 1 (PLAP-1) were additionally used as markers specific to periodontal ligament tissues. Expression of Axin2, periostin, and PLAP-1 mRNA in normal periodontal tissues was 25, 531 times, 179 times, and 11 times higher, respectively, than that in the regenerated dental pulp tissues on the 28th day. As shown in Table 6, expression of these genes in the normal dental pulp were almost the same (0.4, 0.4, and 2.4 times, respectively) as that in the regenerated tissues.
(174) TABLE-US-00006 TABLE 6 Normal dental Normal periodontium/ pulp/regenerated dental regenerated dental pulp tissues pulp tissues Axin2 0.4 25531.7 Periostin 0.4 178.5 PLAP-1 2.4 11.2 Tenascin C 1.0 0.01 Syndecan 3 2.0 0.07 collagenα1(I) 2.3 9.3
(175) As shown in Table 6, collagen αI (I) was 9.3 times more expressed in periodontal ligament compared with that in regenerated tissues, and no significant difference was observed between normal dental pulp and regenerated dental pulp. Syndecan 3 and Tenascin C, known to be highly expressed in dental pulp, were 14.3 times and 50.0 times more expressed in regenerated tissues, respectively, compared with periodontal ligament. Accordingly, a two-dimensional electrophoresis analysis and a gene expression analysis indicate that that the regenerated tissue is identical to true functional normal dental pulp.
(176) [Dental Pulp Regeneration by Autologous Transplantation of Dental Pulp CD105-Positive Cells in Root Canal after Infected Root Canal Treatment]
(177) Dental pulp was completely removed from a canine permanent tooth with a complete apical closure, and the apical foramen was enlarged to #30 with a K-file. Then, the root canal was left open for two weeks. In this manner, an experimental tooth model for infected root canal was produced. Thereafter, the model was cleaned with sodium hypochlorite and oxydol alternately used. Subsequently, Smearclean was placed in the root canal for 30 seconds, and then the root canal was further cleaned with physiologic saline. Thereafter, the root canal was medicated with formocresol (FC) for one week to be sterilized. Subsequently, the root canal was cleaned again with physiologic saline, and the inside of the root canal was dried with a paper point. A root canal filler in which dental pulp stem cells were transplanted to the apical part, and SDF-1 were transplanted to the crown part using collagen XYZ as an extracellular matrix. Specifically, in the same manner as autologous transplantation in the root canal after pulpectomy, 1×10.sup.6 dental pulp CD105-positive cells at the third to fourth passages of culture and collagen XYZ were autologously transplanted in the lower part of the root canal. SDF-1 with a final concentration of 15 ng/ml and collagen XYZ were further transplanted into the upper part of the root canal, and the cavity was sealed with zinc phosphate cement and composite resin. On day 14, a sample was prepared. This sample was morphologically observed by a common procedure.
(178)
Third Example
(179) Then, in a third example, a comparison was made between the case of filling a root canal with extraction and the case of filling a root canal without extraction, using a chemotactic factor G-CSF and dental pulp CD105-positive cells.
(180) In the same manner as in the first and second examples described above, after a canine anterior tooth has been extracted, 5×10.sup.5 (10 μl) of dental pulp CD105-positive cells and collagen XYZ as a scaffold were transplanted into the lower part of the root canal, and 200 ng (10 μl) of G-CSF as a chemotactic factor was transplanted into the upper part of the root canal. The resultant tooth was left for 14 days.
(181) Then, without extraction of a canine anterior tooth, 5×10.sup.5 (10 μl) of dental pulp CD105-positive cells and collagen XYZ as a scaffold were transplanted into a lower part of the root canal, and 200 ng (10 μl) of G-CSF as a chemotactic factor was transplanted into an upper part of the root canal. The resultant tooth was left for 14 days.
DESCRIPTION OF REFERENCE CHARACTERS
(182) 100 target tooth
(183) 110 periapical periodontitis
(184) 200 unextracted tooth root canal filler
(185) 210 extracellular matrix
(186) 220 dental pulp stem cells
(187) 230 chemotactic factor
(188) 400 blood vessel
(189) 500 dentin
(190) 610 gelatin
(191) 620 resin
(192) 630 morphogen
SEQUENCE LISTING FREE TEXT
(193) SEQ ID NOs 1-64: primer