Epitope of IP-10 and antibody to same
09725507 · 2017-08-08
Assignee
Inventors
Cpc classification
C07K2317/76
CHEMISTRY; METALLURGY
C07K2317/34
CHEMISTRY; METALLURGY
C07K16/24
CHEMISTRY; METALLURGY
C07K14/522
CHEMISTRY; METALLURGY
International classification
C07K16/24
CHEMISTRY; METALLURGY
Abstract
The present invention relates to a novel epitope of IP-10 (IFN-γ-inducible protein 10), to an antibody to the epitope or an antigen-binding fragment thereof, to a composition comprising the epitope as an active ingredient for inducing an antibody to IP-10, and to a pharmaceutical composition comprising the antibody or the antigen-binding fragment thereof for preventing or treating diseases relating to IP-10. The anti-IP-10 antibody of the present invention can be effectively used in preventing or treating various diseases relating to IP-10 such as multiple sclerosis, rheumatoid arthritis and systemic lupus erythematosus.
Claims
1. An antibody or antigen-binding fragment thereof which specifically binds to an epitope of SEQ ID NO:5 wherein the antibody or the antigen-binding fragment comprises a heavy chain variable region and light chain variable region including the following CDR (Complementarity Determining Region) H1, H2 and H3 and CDR L1, L2 and L3: (i) CDR H1 of SEQ ID NO: 51, CDR H2 of SEQ ID NO: 52 and CDR H3 of SEQ ID NO: 53, and CDR L1 of SEQ ID NO: 72, CDR L2 of SEQ ID NO: 73 and CDR L3 of SEQ ID NO: 74; (ii) CDR H1 of SEQ ID NO: 54, CDR H2 of SEQ ID NO: 55 and CDR H3 of SEQ ID NO: 56, and CDR L1 of SEQ ID NO: 75, CDR L2 of SEQ ID NO: 76 and CDR L3 of SEQ ID NO: 77; (iii) CDR H1 of SEQ ID NO: 57, CDR H2 of SEQ ID NO: 58 and CDR H3 of SEQ ID NO: 59, and CDR L1 of SEQ ID NO: 78, CDR L2 of SEQ ID NO: 79 and CDR L3 of SEQ ID NO: 80; (iv) CDR H1 of SEQ ID NO: 60, CDR H2 of SEQ ID NO: 61 and CDR H3 of SEQ ID NO: 62, and CDR L1 of SEQ ID NO: 81, CDR L2 of SEQ ID NO: 82 and CDR L3 of SEQ ID NO: 83; (v) CDR H1 of SEQ ID NO: 63, CDR H2 of SEQ ID NO: 64 and CDR H3 of SEQ ID NO: 65, and CDR L1 of SEQ ID NO: 84, CDR L2 of SEQ ID NO: 85 and CDR L3 of SEQ ID NO: 86; (vi) CDR H1 of SEQ ID NO: 66, CDR H2 of SEQ ID NO: 67 and CDR H3 of SEQ ID NO: 68, and CDR L1 of SEQ ID NO: 87, CDR L2 of SEQ ID NO: 88 and CDR L3 of SEQ ID NO: 89; or (vii) CDR H1 of SEQ ID NO: 69, CDR H2 of SEQ ID NO: 70 and CDR H3 of SEQ ID NO: 71, and CDR L1 of SEQ ID NO: 90, CDR L2 of SEQ ID NO: 91 and CDR L3 of SEQ ID NO: 92.
2. The antibody or an antigen-binding fragment thereof of claim 1, wherein the antibody or the antigen-binding fragment comprises a heavy chain and a light chain, and the heavy chain and the light chain consist of the amino acid sequence set forth in SEQ ID NOs: (i) 93 and 94, (ii) 95 and 96, (iii) 97 and 98, (iv) 99 and 100, (v) 101 and 102, (vi) 103 and 104, or (vii) 105 and 106.
3. A nucleic acid molecule encoding the heavy chain variable and light chain variable region of the antibody or antigen-biding fragment thereof according to claim 1.
4. A nucleic acid molecule encoding the heavy chain and light chain of the antibody or antigen-biding fragment thereof according to claim 2.
5. A pharmaceutical composition comprising an antibody or antigen-binding fragment thereof according to claim 1 and a pharmaceutically acceptable carrier.
6. A pharmaceutical composition comprising an antibody or antigen-binding fragment thereof according to claim 2 and a pharmaceutically acceptable carrier.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1) These and/or other aspects and advantages of the invention will become apparent and more readily appreciated from the following description of the embodiments, taken in conjunction with the accompanying drawings of which:
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
(12)
(13)
(14)
(15)
DETAILED DESCRIPTION OF THE EMBODIMENTS
(16) In one aspect of the present disclosure, the present disclosure is related to epitopes of IP-10 (IFN-γ-inducible protein 10) which are provided by an amino acid sequence as set forth in SEQ ID NO: 5 and an amino acid sequence composed of 1.sup.st to 20.sup.th amino acids of SEQ ID NO:5, which is represented by SEQ ID NO: 6.
(17) In other aspect, the present disclosure provides an antibody to the epitopes of the present disclosure and antigen-binding fragment thereof.
(18) The present inventors endeavored to find epitopes for the anti-IP-10 (IFN-γ-inducible protein 10) monoclonal antibody. As a result, the present inventors found that the anti-IP-10 monoclonal antibody specifically recognizes an amino acid sequence as set forth in SEQ ID NO: 5 and an amino acid sequence composed of 1.sup.st to 20.sup.th amino acids of SEQ ID NO:5.
(19) The term “epitope” as used herein refers to an amino acid residue(s) which is recognized by major histocompatibility complex (MHC) and/or T cell receptor proteins in a T cell context, or a set of amino acid residues involved in the recognition by a particular antibody. In the present disclosure epitopes and peptides are interchangeably used. Also encompassed in the present disclosure are isolated or purified proteins or peptides which are larger than and comprising the present epitopes.
(20) As evident from the EXAMPLEs below, anti-IP-10 monoclonal antibody of the present disclosure have a specific binding affinity to an amino acid sequence as set forth in SEQ ID NO: 5 and an amino acid sequence composed of 1.sup.st to 20.sup.th amino acids of SEQ ID NO:5 as set forth in SEQ ID NO: 6.
(21) The term “antibody to an epitope of IP-10” refers to proteins that have a specific binding activity an amino acid sequence as set forth in SEQ ID NO: 5 and an amino acid sequence composed of 1.sup.st to 20.sup.th amino acids of SEQ ID NO:5.
(22) The antibody of the present disclosure encompasses a whole antibody as well as its antigen-binding fragments (antibody fragment). A whole antibody includes two full length light chain and two full length heavy chains where each light chain is linked to the heavy chain by disulfide bonds. The heavy chain constant regions is divided into isotypes of γ, μ, α, δ and ε types, which are further subtyped into γ1, γ2, γ3, γ4, α1 and α2. The light chain constant region is divided into κ and λ types.
(23) The antigen-binding fragments (antibody fragment) refers to a fragment having an antigen binding activity and includes Fab, F(ab′), F(ab′)2 and Fv. Fab is composed of variable regions of a light and a heavy chain and a constant region of a light chain and first constant region (CH1) of a heavy chain thus having one antigen binding region. Fab′ is different from Fabs in that it comprises a hinge region which comprises at least one cysteine residue at C-terminal of the CH1 domain of a heavy chain. F(ab′)2 is produced by a disulfide bond formation between cysteine residues in the hinge region of Fab′. Fv is an antibody fragment composed only of variable regions of a heavy and a light chain, which may be produced by a recombinant technology as disclosed in WO 88/10649, WO 88/106630, WO 88/07085, WO 88/07086 and WO 88/09344. In Fv (two-chain Fv), variable regions of a light and heavy chain are linked by a non-covalent bond, and in a single chain Fv, variable regions of a light and heavy chain are linked by a covalent bond through a peptide linker or it may form a dimer structure like a two chain FV through a direct linkage at the C-terminal. These antibody fragments are obtained through a proteinase treatment (for example, a whole antibody may be treated with a papain to obtain Fab fragments) or with a pepsin to obtain F(ab′)2 fragment or preferably obtained through a recombinant DNA technology.
(24) In the present disclosure, the heavy chain constant region is anyone of isotypes of γ, μ, α, δ and ε types, and the light chain constant region is anyone of κ and λ types.
(25) The term “heavy chain” as used herein refers to a full length chain comprising three constant regions CH1, CH2 and CH3 and one variable region VH comprising an amino acid sequence which is sufficient for conferring specificity to an antigen as well fragments thereof. Also The term “light chain” as used herein refers to refers to a full length chain comprising one constant region CL and one variable region VL comprising an amino acid sequence which is sufficient for conferring specificity to an antigen as well fragments thereof.
(26) In one preferred embodiment, the present antibody comprises anyone of the following heavy chain variable region:
(27) (i) CDR H1 of SEQ ID NO: 51, CDR H2 of SEQ ID NO: 52 and CDR H3 of SEQ ID NO: 53;
(28) (ii) CDR H1 of SEQ ID NO: 54, CDR H2 of SEQ ID NO: 55 and CDR H3 of SEQ ID NO: 56;
(29) (iii) CDR H1 of SEQ ID NO: 57, CDR H2 of SEQ ID NO: 58 and CDR H3 of SEQ ID NO: 59;
(30) (iv) CDR H1 of SEQ ID NO: 60, CDR H2 of SEQ ID NO: 61 and CDR H3 of SEQ ID NO: 62;
(31) (v) CDR H1 of SEQ ID NO: 63, CDR H2 of SEQ ID NO: 64 and CDR H3 of SEQ ID NO: 65;
(32) (vi) CDR H1 of SEQ ID NO: 66, CDR H2 of SEQ ID NO: 67 and CDR H3 of SEQ ID NO: 68; or
(33) (vii) CDR H1 of SEQ ID NO: 69, CDR H2 of SEQ ID NO: 70 and CDR H3 of SEQ ID NO: 71.
(34) In one preferred embodiment, the present antibody comprises anyone of the following light chain variable region:
(35) (i) CDR L1 of SEQ ID NO: 72, CDR L2 of SEQ ID NO: 73 and CDR L3 of SEQ ID NO: 74;
(36) (ii) CDR L1 of SEQ ID NO: 75, CDR L2 of SEQ ID NO: 76 and CDR L3 of SEQ ID NO: 77;
(37) (iii) CDR L1 of SEQ ID NO: 78, CDR L2 of SEQ ID NO: 79 and CDR L3 of SEQ ID NO: 80;
(38) (iv) CDR L1 of SEQ ID NO: 81, CDR L2 of SEQ ID NO: 82 and CDR L3 of SEQ ID NO: 83;
(39) (v) CDR L1 of SEQ ID NO: 84, CDR L2 of SEQ ID NO: 85 and CDR L3 of SEQ ID NO: 86;
(40) (vi) CDR L1 of SEQ ID NO: 87, CDR L2 of SEQ ID NO: 88 and CDR L3 of SEQ ID NO: 89; or
(41) (vii) CDR L1 of SEQ ID NO: 90, CDR L2 of SEQ ID NO: 91 and CDR L3 of SEQ ID NO: 92.
(42) In a more preferred embodiment, the present antibody comprises the following heavy chain variable region and light chain variable region.
(43) (i) a heavy chain variable region comprising CDR (complementarity determining region) H1 of SEQ ID NO: 51, CDRH2 of SEQ ID NO: 52 and CDRH3 of SEQ ID NO: 53; and a light chain variable region comprising CDRL1 of SEQ ID NO: 72, CDRL2 of SEQ ID NO: 73 and CDRL3 of SEQ ID NO: 74;
(44) (ii) a heavy chain variable region comprising CDR (complementarity determining region) H1 of SEQ ID NO: 54, CDRH2 of SEQ ID NO: 55 and CDRH3 of SEQ ID NO: 56; and a light chain variable region comprising CDRL1 of SEQ ID NO: 75, CDRL2 of SEQ ID NO: 76 and CDRL3 of SEQ ID NO: 77 (H28G monoclonal antibody);
(45) (iii) a heavy chain variable region comprising CDR (complementarity determining region) H1 of SEQ ID NO: 57, CDRH2 of SEQ ID NO: 58 and CDRH3 of SEQ ID NO: 59; and a light chain variable region comprising CDRL1 of SEQ ID NO: 78, CDRL2 of SEQ ID NO: 79 and CDRL3 of SEQ ID NO: 80 (H77G monoclonal antibody);
(46) (iv) a heavy chain variable region comprising CDR (complementarity determining region) H1 of SEQ ID NO: 60, CDRH2 of SEQ ID NO: 61 and CDRH3 of SEQ ID NO: 62; and a light chain variable region comprising CDRL1 of SEQ ID NO: 81, CDRL2 of SEQ ID NO: 82 and CDRL3 of SEQ ID NO: 83 (H88G monoclonal antibody);
(47) (v) a heavy chain variable region comprising CDR (complementarity determining region) H1 of SEQ ID NO: 63, CDRH2 of SEQ ID NO: 64 and CDRH3 of SEQ ID NO: 65; and a light chain variable region comprising CDRL1 of SEQ ID NO: 84, CDRL2 of SEQ ID NO: 85 and CDRL3 of SEQ ID NO: 86;
(48) (vi) a heavy chain variable region comprising CDR (complementarity determining region) H1 of SEQ ID NO: 66, CDRH2 of SEQ ID NO: 67 and CDRH3 of SEQ ID NO: 68; and a light chain variable region comprising CDRL1 of SEQ ID NO: 87, CDRL2 of SEQ ID NO: 88 and CDRL3 of SEQ ID NO: 89; or
(49) (vii) a heavy chain variable region comprising CDR (complementarity determining region) H1 of SEQ ID NO: 69, CDRH2 of SEQ ID NO: 70 and CDRH3 of SEQ ID NO: 71; and a light chain variable region comprising CDRL1 of SEQ ID NO: 90, CDRL2 of SEQ ID NO: 91 and CDRL3 of SEQ ID NO: 92.
(50) According to a more preferred embodiment of the present disclosure, the present antibody comprises: (i) a heavy chain variable region of SEQ ID NO: 93 and a light chain variable region of SEQ ID NO: 94 (clone #25 monoclonal antibody); (ii) a heavy chain variable region of SEQ ID NO: 95 and a light chain variable region of SEQ ID NO: 96 (clone #28 monoclonal antibody); (iii) a heavy chain variable region of SEQ ID NO: 97 and a light chain variable region of SEQ ID NO: 98 (clone #77 monoclonal antibody); (iv) a heavy chain variable region of SEQ ID NO: 99 and a light chain variable region of SEQ ID NO: 100 (clone #88 monoclonal antibody); (v) a heavy chain variable region of SEQ ID NO: 101 and a light chain variable region of SEQ ID NO: 102 (clone #112 monoclonal antibody); (vi) a heavy chain variable region of SEQ ID NO: 103 and a light chain variable region of SEQ ID NO: 104 (clone #116 monoclonal antibody); or (vii) a heavy chain variable region of SEQ ID NO: 105 and a light chain variable region of SEQ ID NO: 106 (clone #129 monoclonal antibody).
(51) Encompassed in the present antibody is monoclonal antibody, polyclonal antibody, multispecific antibody, humanized antibody, human antibody, chimeric antibody, a single chain Fvs(scFV), a single chain antibody, Fab fragment, F(ab′) fragment, disulfide-linked Fvs(sdFV) and anti-idiotype (anti-Id) antibody and epitope-binding fragment thereof, but is not limited thereto.
(52) The present epitope, antibody or fragment thereof is represented by the sequences as disclosed herein and also encompassed are their equivalent. For example, to improve the binding affinity and/or other the biological characteristics of antibodies, the antibodies may be modified at the amino acid sequences. These modifications for example include a deletion, insertion and/or substitution in one or more of the amino acid residues. These modifications in the amino acids are usually performed based on the relative similarity such as hydrophobicity, hydrophilicity, charges and sizes between the side chains of the amino acid to be modified and the substituent. For example, side chains of arginine, lysine and histidine are positively charged; side chains of alanine, glycine and serine are similar in size; and side chain of phenylalanine, tryptophan and tyrosine are similar in shape. Therefore, arginine, lysine and histidine; alanine, glycine and serine; and phenylalanine, tryptophan and tyrosine are considered to be equivalent to each other within each group.
(53) In introducing modifications, that which may be considered is a hydrophobicity index. Each amino acid is given an index according to their hydrophobicity and charges as follows: isoleucine (+4.5); valine (+4.2); leucine (+3.8); phenylalanine (+2.8); cysteine/cystine (+2.5); methionine (+1.9); alanine (+1.8); glycine (−0.4); threonine (−0.7); serine (−0.8); tryptophan (−0.9); tyrosine (−1.3); proline (−1.6); histidine (−3.2); glutamate (−3.5); glutamine (−3.5); aspartate (−3.5); asparagine (−3.5); lysine (−3.9); and arginine (−4.5).
(54) In assigning an interactive biological function, hydrophobicity scale of amino acids are very important. It is known in the art that amino acids similar in hydrophobic index are necessary to obtain a similar biological activity. When mutations are introduced in consideration of a hydrophobic index, the differences in the indices preferably within ±2, more preferably within ±1, most preferably within ±0.5 are used for a substitution.
(55) Also known in the art is that substitutions between amino acids with similar hydrophilicity value result in the protein equivalent in biological activity. U.S. Pat. No. 4,554,101 discloses a hydrophilicity value for each amino acid as follows: arginine (+3.0); lysine (+3.0); aspartate (+3.0±1); glutamate (+3.0±1); serine (+0.3); aspargine (+0.2); glutamine (+0.2); glycine (0); threonine (−0.4); proline (−0.5±1); alanine (−0.5); histidine (−0.5); cysteine (−1.0); methionine (−1.3); valine (−1.5); leucine (−1.8); isoleucine (−1.8); tyrosine (−2.3); phenylalanine (−2.5); tryptophan (−3.4).
(56) Amino acid substitutions that do not alter the overall activity of a protein are known in the art (H. Neurath, R. L. Hill, The Proteins, Academic Press, New York, 1979). The most common substitutions are Ala to Ser, Val to Ile, Asp to Glu, Thr to Ser, Ala to Gly, Ala to Thr, Ser to Asn, Ala to Val, Ser to Gly, Thr to Phe, Ala to Pro, Lys to Arg, Asp to Asn, Leu to Ile, Leu to Val, Ala to Glu and Asp to Gly substitutions.
(57) In consideration of the modifications as described above, it is interpreted that the present epitopes, antibodies, or nucleic acid molecules encoding the same also encompass the ones having a substantial similarity to the sequences as disclosed herein. The substantial similarity means at least 61% homology, more preferably 70% homology, further more preferably 80% homology, most preferably 90% homology in when the present sequences are aligned with any other sequences and the alignment is analyzed by a conventional algorithm. Methods for alignment for sequence comparison are known in the art. For various methods for alignment and algorithm, Smith and Waterman, Adv. Appl. Math. (1981) 2:482; Needleman and Wunsch, J. Mol. Bio. (1970) 48:443; Pearson and Lipman, Methods in Mol. Biol. (1988) 24: 307-31; Higgins and Sharp, Gene (1988) 73:237-44; Higgins and Sharp, CABIOS (1989) 5:151-3; Corpet et al., Nuc. Acids Res. (1988) 16:10881-90; Huang et al., Comp. Appl. BioSci. (1992) 8:155-65 and Pearson et al., Meth. Mol. Biol. (1994) 24:307-31 may be referred. NCBI Basic Local Alignment Search Tool (BLAST)(Altschul et al., J. Mol. Biol. (1990) 215:403-10) is accessible at NBCI, which may be used with a sequence analysis program such as blastp, blasm, blastx, tblastn and tblastx on the internet. BLSAT is accessible at www.ncbi.nlm.nih.gov/BLAST/. Methods for comparing sequence homology using BLAST can be found in www.ncbi.nlm.nih.gov/BLAST/blast_help.html.
(58) In other aspect, the present disclosure provides a nucleic acid molecule encoding the present epitopes.
(59) In still other aspect, the present disclosure provides a nucleic acid molecule encoding the antibody or the antigen-binding fragments of heavy chain variable region or light chain variable region of the present antibody.
(60) The term “nucleic acid molecules” as used herein refers to a DNA (gDNA and cDNA) and RNA. Also included are nucleic acids which comprises a natural nucleotide as a building block as well as its analogues in which sugar moiety or bases are modified (Scheit, Nucleotide Analogs, John Wiley, New York (1980); Uhlman and Peyman, Chemical Reviews, (1990) 90:543-584). The nucleic acid sequences may be modified. Such modifications include an addition, a deletion of at least one of nucleotides, or a conservative and non-conservative substitution.
(61) In one preferred embodiment of the present disclosure, the nucleic acid molecule encoding the present heavy chain variable region is represented by SEQ ID NOs: 107, 108, 109, 110, 111, 112 or 113, and the nucleic acid molecule encoding the present light chain variable region is represented by SEQ ID NOs: 114, 115, 116, 117, 118, 119 or 120.
(62) In one preferred embodiment of the present disclosure, the nucleic acid molecule encoding the variable region of the present antibody may be a part of a nucleic acid molecule encoding the entire heavy chain or the entire light chain.
(63) It is interpreted that the present nucleic acid molecule also comprises ones that is substantially identical to the sequences as disclosed herein. The substantially identical or substantial identity means at least 80% homology, more preferably at least 90% homology, most preferably at least 95% homology in sequences when the present nucleotide sequences are aligned with any other sequences and the alignments are analyzed using algorithms conventionally used in the art.
(64) According to other embodiment of the present disclosure, the present disclosure provides a vector comprising a nucleic acid molecule encoding the present epitope.
(65) According to other embodiment of the present disclosure, the present disclosure a recombinant vector comprising: (a) a nucleic acid molecule encoding the present heavy chain variable region; and (b) a nucleic acid molecule encoding the present light chain variable region.
(66) The term “vector” as used herein is a means to express a desired gene in a host cell and includes vectors such as a plasmid vector; a cosmid vector; and a bacteriophage vector, an adenovirus vector, a retro virus vector and an adeno-associated vector.
(67) In one preferred embodiment of the present disclosure, the nucleic acid molecule in the vector is operatively linked to a promoter.
(68) The term “operatively linked” means a functional linkage between a regulatory sequence for nucleic acid expression (example: a promoter, a signal sequence, or array of positions to which transcriptional factors bind) and other nucleic acid sequences, and by which the regulatory sequences are able to control the transcription and/or translation of the other nucleic acid sequence.
(69) The recombinant vector system can by constructed using various methods known in the art and Sambrook et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory Press (2001), which is incorporated herein by reference may be referred.
(70) The present vectors may be constructed as a vector for cloning or for expression. Also, the present vectors may be constructed for eukaryotic or prokaryotic cells. For example, when the present vector is an expression vector in a prokaryotic cell, a strong promoter for transcription such as a tac promoter, a lac promoter, a lacUV5 promoter, a lpp promoter, a pLλ promoter, a pRλ promoter, a rac5 promoter, amp promoter, a recA promoter, SP6 promoter, trp promoter and a T7 promoter and the like and a ribosomal binding site for a translational initiation and a transcriptional/translational termination sequence. As a host cell, when E. coli such as HB101, BL21, DH5α and the like is used, an operator and promoter for E. coli tryptophan biosynthesis (Yanofsky, C., J. Bacteriol., (1984) 158:1018-1024) and a phage λ left promoter (pLλ promoter, Herskowitz, I. and Hagen, D., Ann. Rev. Genet., (1980) 14:399-445) may be used a regulatory sequence. When bacilli are used as host cells, the promoter for a toxin gene from bacillus thuringiensis (Appl. Environ. Microbiol. (1998) 64:3932-3938; Mol. Gen. Genet. (1996) 250:734-741) or any promoters which may drive the expression of a gene may be used as a regulatory sequence.
(71) When the present vector is an expression vector in a eukaryotic cell, promoters derived from genomes of mammalian cells (examples: a metallothionein promoter, β-actin promoter, human hemoglobin promoter and human muscle creatinine promoter) or promoters derived from mammalian viruses (examples: an adenovirus late promoter, a vaccinia virus 7.5K promoter, SV40 promoter, cytomegalovirus (CMV) promoter, a tk promoter of HSV, a promoter of mouse mammary tumor virus (MMTV), a LTR promoter of HIV, a promoter of moloney virus, a promoter of Epstein Barr Virus, a promoter of Rous Sarcoma Virus may be use. And the vector includes a polyadenylate sequence as a transcriptional termination sequence.
(72) The present recombinant vector may be fused with additional nucleotide sequences to facilitate the isolation and purification of the polypeptide expressed from the vector. The nucleotide sequences to be fused with the present vector include for example Glutathione S-Transferase (Pharmacia, USA), Maltose Binding Protein (NEB, USA), FLAG (IBI, USA) and 6× His (hexahistidine; Quiagen, USA) and the like. Also when the protein expressed from the present vector is an antibody, the antibody expressed may be isolated using Protein A column and the like and the additional nucleotide sequences may not be needed.
(73) The vector which may be used to express the present antibody may express a heavy and a light chain in one vector or each of a heavy and a light chain in a separate vector, respectively. In the latter case, the two vectors employed are introduced to a host cell by co-transfection and targeted transfection. The co-transformation is a method to introduce into a host cell two vector DNAs each encoding a light and a heavy chain, respectively and select a transfected cell which express both a light and a heavy chain. A targeted transfection is a method to first select a transfected cell which expresses a light (or a heavy chain) chain and then the transfected cell is transfected again with a vector encoding a heavy (or a light chain) chain to select a cell that expresses both a light and a heavy chain.
(74) In other aspect of the present disclosure, the present disclosure provides a cell which is transfected with a recombinant vector harboring the present epitope-coding nucleic acid molecule or antibody (or its antigen-binding fragment)-coding nucleic acid molecule.
(75) Host cells which may be used for the present disclosure any host cells which are known in the art and may be used for a cloning and expression, and include prokaryotic cells such as Escherichia coli, Bacillus sp. such as Bacillus subtilis and Bacillus thuringiensis, Streptomyces sp., Pseudomonas sp. (for example, Pseudomonas putida)), Proteus mirabilis or Staphylococcus sp. (for example, Staphylococcus carnosus), but are not limited thereto.
(76) Eukaryotic host cells which are suitable to be used with the present vector include fugi such as Aspergillus sp. and yeast such as Pichia pastoris, Saccharomyces cerevisiae, Schizosaccharomyces and Neurospora crassa and other lower eukaryotic cells, and a higher eukaryotic cells such as insect-derived cells, and cells derived from plants and mammals. Microorganisms such as E. coli may have a high yield but may not be suitable for producing Ig in a intact form but may be used for producing Fab and Fv and the like.
(77) The terms “transformation” and/or “transfection” as used herein refer to any methods to introduce nucleic acid molecules to organisms, cells, tissues or organs which may be performed according to the suitable standard procedures selected from what is known in the art. Such methods include an electroporation, a plasma fusion, CaPO.sub.4 precipitation methods, CaCl.sub.2 precipitation methods, stirring methods using silicon carbide fibers, a transformation mediated by agro bacteria, a chemical mediated gene transfer such as PEG, dextran sulfate and lipid, and a dry/inhibition-mediated transformation but are not limited thereto.
(78) According to other aspect of the present disclosure, the present disclosure provides a method for preparing the present antibody, antigen-binding fragment thereof which comprises (a) a step of culturing cells which are transformed with anyone of the present vector; and (b) a step of expressing the present antibody, antigen-binding fragment thereof in the cell.
(79) The culturing step of the present methods can be performed using a suitable medium and conditions known in the related art. The person skilled in the art would be able to modify the culture conditions according to the particular cells employed without difficulty. These methods are disclosed in various documents for example such as James M. Lee, Biochemical Engineering, Prentice-Hall International Editions, 138-176). Methods for culturing cells may be divided into a suspension culture and an adherent culture based on the cell growth mode, and into a batch method, a fed-batch method and a continuous method according to the culture mode. The media employed for the culture should be selected to meet the conditions required by the particular cells employed.
(80) The epitopes or the antibodies thus obtained from the cells transformed and cultured as described above may be used without purification, or may be used with purification which may be performed using methods known in the art for example, a dialysis, a salt precipitation and a chromatography method and the like.
(81) According to other aspect of the present disclosure, the present disclosure provides composition for inducing antibody to IP-10 comprising the present polypeptides as an effective ingredient.
(82) According to still other aspect of the present disclosure, the present disclosure provides a pharmaceutical composition for treating or preventing IP-10 related disease comprising (a) a pharmaceutically effective amount of the present antibody or antigen-binding fragments thereof; and (b) a pharmaceutically acceptable carrier.
(83) The present antibody or antigen-binding fragment thereof which is included in the present composition is as described above.
(84) In one preferred embodiment, the present composition for inducing antibody to IP-10 may be used to induce an antibody formation and to prepare antibody to IP-10, which may be achieved by a method comprising a step of inducing an immune reaction in an animal by administering the present composition to the animal; and a step of isolating an antibody that specifically recognize the polypeptide from the serum of the animal.
(85) In one preferred embodiment, the present composition for inducing antibody to IP-10 may be a pharmaceutical composition for treating or preventing IP-10 related disease.
(86) Preferably, the IP-10 related disease is selected from the group consisting of bone disease associated by osteoclast related to RANKL (receptor agonist for NF-κB ligand), multiple sclerosis, ulcerative colitis, hepatitis, systemic lupus erythematosus and Sjogren's syndrome. More preferably, the bone disease is selected from the group consisting of osteoporosis, juvenile osteoporosis, dysostosis, hypercalcemia, hyperparathyroidism, osteomalacia, osteolytic bone disease, osteonecrosis, Paget's disease of bone, bone loss associated with rheumatoid arthritis, osteomyelitis, metastatic bone disease, alveolar bone loss, cancer-related bone loss, age-related loss of bone mass.
(87) The present pharmaceutical composition comprises a pharmaceutically acceptable carrier. The pharmaceutically acceptable carrier which may be used for the present disclosure is a material conventionally employed for preparing medicaments and includes a lactose, a dextrose, a sucrose, a sorbitol, a mannitol, a starch, acacia gum, calcium phosphate, alginate, gelatin, calcium silicate, microcrystalline cellulose, polyvinylpyrrolidone, cellulose, water, syrup, methyl cellulose, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oils but is not limited thereto. The present pharmaceutical composition may additionally include lubricants, moistening agents, sweetening agents, flavoring agents, emulsifiers, suspending agents and preservatives and the like. Suitable agents and pharmaceutically acceptable carriers are disclosed in detail in Remington's Pharmaceutical Sciences (19th ed., 1995).
(88) The present pharmaceutical composition may be administered via a oral or parenteral route. The parenteral administration may include an intravenous injection, a subcutaneous injection, an intramuscular injection, a peritoneal injection, an endothelial administration, a nasal administration, an intrapulmonary administration, and a rectal administration and the like. For the oral administration, the active ingredient in the composition needs to be formulated into a coated dosage form or into a dosage form which can protected the active ingredient from being disintegrated in stomach considering that peptides and proteins are digested in stomach. Or the present composition may be administered via a means by which the active ingredient moves to the target cell of interest.
(89) The amount of administration may vary depending on various factors such as dosage forms, routes of administration, age, body weight, sex, disease states, foods, time of administration, excretion rate and susceptibility and the like. The experts of ordinary skilled in the art would be able to determine and prescribe the amount to be administered, which is effective for treating and preventing disease of interest.
(90) The present pharmaceutical composition may be manufactured by encasing the composition in multi-dose vials or in a dosage form which may be formulated in pharmaceutically acceptable carriers and/or excipients according to the methods which can be easily practiced by the person of ordinary skill in the field to which the present invention pertains. The dosage form may be a solution in a lipid or aqueous medium, suspensions, emulsions and elixirs, suppository forms, granules, powders, tablets or capsules and additionally include dispersion agents and stabilizers,
(91) In a further aspect, the present disclosure provides a method for treating or preventing IP-10 related disease selected from the group consisting of osteoporosis, juvenile osteoporosis, dysostosis, hypercalcemia, hyperparathyroidism, osteomalacia, osteolytic bone disease, osteonecrosis, Paget's disease of bone, bone loss associated with rheumatoid arthritis, osteomyelitis, metastatic bone disease, alveolar bone loss, cancer-related bone loss, age-related loss of bone mass by administering to a subject in need thereof an effective amount of the composition according to the present disclosure comprising (a) an antibody and antigen-binding fragment thereof; (b) a pharmaceutically acceptable carriers of the present disclosure.
(92) The methods described above utilize the present composition as described above and thus the description is omitted to avoid the unnecessary complexity of the specification.
(93) The present disclosure is further explained in more detail with reference to the following examples. These examples, however, should not be interpreted as limiting the scope of the present invention in any manner.
EXAMPLES
(94) Material and Methods
(95) Epitope Analysis
(96) IP-10 protein (represented by SEQ ID NO: 1) was divided into 4 segments to determine its epitope recognized by anti IP-10 antibody, Each segment was 40 amino acids long and they are partially overlapped. As shown in
(97) DNA for each segment was amplified by PCR. Fifty ng of a commercial plasmid encoding IP-10 (catalogue number: MHS1011-74663, BENEBIOSIS, Korea) was used as a template and primers used are shown in the table below. To facilitate the cloning process, primers were designed to contain EcoRI (GATTC) and XhoI (CTCGAG) recognition site on the 5′ and 3′ ends, respectively.
(98) TABLE-US-00001 TABLE 1 SEQ Primer Sequence ID NO IP-10-segment GCTAGAATTCATGAATCAAACTGCCA 7 1 sense IP-10-segment GATCCTCGAGAATAGGTTGATTAC 8 1 anti-sense IP-10-segment GCTAGAATTCGGAGTACCTCTCTCTAG 9 2 sense IP-10-segment ATCCTCGAGAACACGTGGACAAAATTG 10 2 anti-sense IP-10-segment GCTAGAATTCAATCCAAGGTCTTTAG 11 3 sense IP-10-segment ATCCTCGAGCTTCGATTCTGGATTC 12 3 anti-sense IP-10-segment GCTAGAATTCGAGATCATTGCTACAATG 13 4 sense IP-10-segment GATCCTCGAGAGGAGATCTTTAGAG 14 4 anti-sense
Gel-Elution Method
(99) The PCR products were separated on a 1% agarose gel and JetSorb Gel extraction Kit (GENOMED, USA) was used to extract DNA from the agarose gel. Each band on the gel was excised out under UV. The excised gel was dissolved in 300 μl of A1 buffer and 10 μl of JetSorb suspension for 15 min at 50° C. Then the solution was centrifuged at 10000 rpm for 1 min and the supernatant was removed. Then 300 μl of A1 buffer was added to the pellet. The same procedure was repeated twice. After the washing JetSorb suspension was exposed to air for 40 min and DNA was eluted for 5 min at 50° C. by adding 200 μl of distilled water, which was then centrifuged at 10000 rpm for 1 min and used for cloning.
(100) The purified DNA and PET41 vector (catalogue number: 70556-3, Novagen, Germany) was digested with EcoRI and XhoI, which was then separated on a 1% agarose gel. The DNA fragment was purified from the gel as described above and ligated using T4 ligase.
(101) The ligated products were then transformed into E. coli (catalog number: C66411, Invitrogen, USA), which was then spread on agar plate containing kanamycin. Each of the colonies formed was inoculated in a 2 ml of LB-kanamycin broth and incubated overnight at 37° C. while shaking. The plasmids were purified using QIA prep Spin Miniprep kit (catalog number: 27106, QUIAGEN, UA). The plasmid was confirmed by DNA sequencing and used for E. coli TOP10 (catalog number: C66411, Invitrogen, USA) transformation to obtain a colony containing the plasmid desired.
(102) Production of Recombinant IP-10 Protein
(103) A colony harboring the plasmid pET41-IP10 part/BL21 (DE3) as obtained above was inoculated and incubated overnight at 37° C. while shaking (200 rpm), which was repeated next day. When OD was reached 0.4-0.6 at 600 nm, IPTG (Isopropyl β-D-1-thiogalactopyranoside) was added to the broth at the final concentration of 1 nm to induce the expression of protein for 4 hours, Then the culture was centrifuged for 20 min at 7000 rpm and the pellet was collected.
(104) Western Blot Analysis
(105) E. coli expressing each of the 4 epitopes of recombinant IP-10 was suspended in PBS buffer (137 mM NaCl, 2.7 mM KCl, 10 mM Na2HPO4.2 mM KH2PO4) and the same volume of SDS-gel loading buffer (100 mM Tris-Cl (pH 6.8), 4% SDS, 0.2% bromophenol blue, 20% glycerol, 200 mM DTT) and heated at 100° C. for 5 min. The mixture was then centrifuged at 13,000 rpm for 10 min and the supernatant was separated on 12% SDS-PAGE, and the proteins separated on the gel were transferred to a polyvinylidenfluoride membrane. Western blot was performed using anti-IP-10 antibody and enhanced chemiluminescent reagent.
(106) Cell Migration Assay
(107) To the upper chamber of a transwell of 3 μm in size (trans well, Corning N.Y.), 0.1 ml of Jurkat cell (clone E 6-1, 2.5×10.sup.5) in a medium without fetal bovine serum was added. To the lower chamber of the transwell, 0.6 ml of medium without FBS and 200 ng/ml of recombinant IP-10 (Peprotech, USA) were added. Then 200 ng/ml of mouse IgG (BD Pharmingen, USA) or 0-200 ng/ml of anti-IP-10 antibody was added to the upper and lower chamber. The upper chamber was put inside of the lower chamber and incubated for 37° C. for 16-18 hours and the content of the chamber was removed. Number of cells migrated was counted using a phase contrast microscopy in 9 different fields, which were confirmed by trypan blue staining. Results are representative of three independent experiments in triplicates
(108) Immunoglobulin PCR Analysis
(109) To obtain the sequence information of the produced IP-10 antibody protein and DNA, a total RNA was separated from hybridoma cells producing monoclonal antibody for cDNA synthesis, the sequence of which was confirmed by PCR using primers specific for immunoglobulin.
(110) Generation of Hybridoma Cell Line and Production of Anti-IP-10 Antibody
(111) An emulsion of PBS (phosphate-buffered saline) comprising IP-10 antigen and the same volume of complete Freund's adjuvant was administered peritoneally to a female BALB/C mouse of 6-8 weeks. Three to five mice were used and 1 to 100 μg of antigen in a total volume of 200-400 μl was used per mouse. The injection was repeated two weeks after the first injection and then the last injection was given in half the amount of antigen in PBS that was used for the previous injection. Two days after the last booster injection, a blood sample was taken from the tail vein and the serum prepared therefrom was diluted 1:1000 in PBS and subjected to ELISA to determine the titer. The successful immunization was judged based on the absorption reading of at least 0.2 compared to that of a negative control which did not receive the antigen. If the titer was below that value, additional booster injection was given. Two weeks before the hybridoma experimentation, myeloma cells were retrieved from the liquid nitrogen storage and cultured in complete DMEM comprising 10% fetal bovine serum. The state of the cell and contamination was examined under the inverted microscope. When the concentration of cells reached 5×10.sup.5/ml and the cells were diluted to 1/10-1/20 ratio and the medium was changed every 1.5 to 2 days. One day before the fusion experiment, the concentration of the cells was adjusted to 2×10.sup.5/ml.
(112) The mouse was sacrificed to harvest the spleen, from which the fat tissue was removed. Then the spleen was placed on a petri dish and perfused with 8 ml of washing medium using a syringe and mashed. The cell suspension was placed in 15 ml of conical tube and allowed to settle for 3 min and the supernatant was transferred to a new tube. In the meantime, cultured myeloma cells were harvested and transferred to a 50 ml conical tune and centrifuged at 200 g for 5 min. To the cell, washing medium was added and the cells were resuspended by repeated pipetting and centrifuged again at 200 g for 5 min and the supernatant was removed. The prepared myeloma cells were resuspended in 10 ml of washing medium and the number of cells was counted. Then myeloma cells and the spleen cells prepared as above was mixed at the concentration of 1×10.sup.7 cells/ml and 1×10.sup.8 cells/ml, respectively in a 50 ml tube in a washing medium. Then the mixture was centrifuged at 200 g for 5 min and the supernatant was discarded. Then the cells were incubated in a beaker with 37° C. water for 2 min, after which 1 ml of PEG was added to the tube with a gentle shaking followed by a centrifuge at 100 g for 2 min. Then 5 ml of washing medium was added over 3 min followed by additional 5 ml over 2 min. The medium was then removed by centrifuge at 200 g for 2.5 min and the cells were suspended in 30 ml of HAT and incubated in a CO2 incubator for 30 min with the lid open. Then 100 μl of the cells was added to each well of a 96 well plate with feeder cells from the mouse plated thereon. After 4-5 days, 70 μl of HAT was added. Colonies were formed at 5-7 days after the seeding, and the supernatant was harvested every 2 days to confirm the presence of the antibody by ELISA.
(113) Isolation of Total RNA and cDNA Synthesis
(114) A total RNA was isolated from the hybridoma cell line producing IP-10 monoclonal antibody as prepared above using TRIZOL® (catalog number: 15596, Invitrogen, USA) according to the manufacturer's instruction. Then cDNA was synthesized using SUPERSCRIPT III® First-strand Synthesis System (catalog number: 18080-051, Invitrogen, USA) according to the manufacturer's instruction. Five μg of RNA was used for the synthesis per sample and a primer corresponding to a 3′-conserved site in each type subtype of the immunoglobulin gene was used instead of oligo-d(T). For example, For a heavy chain of IgM, MuIgMVH3′-1 was used and for a heavy chain of IgG, MuIgGVH3′-2 was used. Also, for kappa light chain MuIgkVL3′-1 was used and for lamda light chain MuIgλ VL3′-1 was used. These primers were from Ig-primer set (catalog number 69831-3, Novagen, USA) and the sequences are presented in Table 2 to 4.
(115) TABLE-US-00002 TABLE 2 Position of the Sequence SEQ ID Name Base Degeneracy amino acid (5′-3′) NO MuIgV.sub.H5′-A 33 512 -20 to -13 GGGAATTCATGGRASTTSKG 15 GYTMARCTKGRTT MuIgV.sub.H5′-B 34 64 -20 to -13 GGGAATTCATGRAATGSASC 16 TGGGTYWTYCTCTT MuIgV.sub.H5′-C 39 — -20 to -11 ACTAGTCGACATGGACTCCA 17 GGCTCAATTTAGTTTTCCT 36 48 -20 to -12 ACTAGTCGACATGGCTGTCY 18 TRGRGCTGYTCYTCTG 39 24 -20 to -11 ACTAGTCGACATGGVTTGGS 19 TGGAMCTTGCYATTCCT MuIgV.sub.H5′-D 36 8 -20 to -12 ACTAGTCGACATGAAATGCA 20 GCTGGRTYATSTTCTT 36 32 -20 to -12 ACTAGTCGACATGGRCARGC 21 TTACYTYYTCATTCCT 36 — -20 to -12 ACTAGTCGACATGATGGTGT 22 TAAGTCTTCTGTACCT MuIgV.sub.H5′-E 36 8 -20 to -12 ACTAGTCGACATGGGATGGA 23 GCTRTATCATSYTCTT 33 24 -20 to -13 ACTAGTCGACATGAAGWTGT 24 GGBTRAACTGGRT 35 64 -20 to -13 ACTAGTCGACATGGRATGGA 25 SCKKIRTCTTMTCT MuIgV.sub.H5′-F 35 32 -20 to -13 ACTAGTCGACATGAACTTYG 26 GGYTSAGMTTGRTTT 35 — -20 to -13 ACTAGTCGACATGTACTTGG 27 GACTGAGCTGTGTAT 33 — -20 to -13 ACTAGTCGACATGAGAGTGC 28 TGATTCTTTTGTG 38 — -20 to -12 ACTAGTCGACATGGATTTTG 29 GGCTGATTTTTTTTATTG MuIgMV.sub.H3′-1 32 — 125 to 118 CCCAAGCTTACGAGGGGGAA 30 GACATTTGGGAA
(116) TABLE-US-00003 TABLE 3 Position of the Sequence SEQ ID Name Base Degeneracy amino acid (5′-3′) NO MuIgGV.sub.L3′-2 35 32 126 to 119 CCCAAGCTTCGAGGGRCCARR 31 GGATARACIGRTGG MuIgκV.sub.L5′-A 32 32 -20 to -13 GGGAATTCATGRAGRCACARW 32 CYCAGGTCTTT MuIgκV.sub.L5′-B 33 — -20 to -13 GGGAATTCATGGAGACAGACA 33 CACTCCTGCTAT MuIgκV.sub.L5′-C 39 8 -20 to -11 ACTAGTCGACATGGAGWCAGA 34 CACACTSCTGTYATGGGT MuIgκV.sub.L5′-D 42 16 -20 to -10 ACTAGTCGACATGAGGRCCCC 35 TGCTCAGWTTYTTGGIWTCTT 41 128 -20 to -14 ACTAGTCGACATGGGCWTCAA 36 GATGRAGTCACAKWYYCWGG MuIgκV.sub.L5′-E 39 4 -20 to -11 ACTAGTCGACATGAGTGTGCY 37 CACTCAGGTCCTGGSGTT 41 32 -15 to -5 ACTAGTGGACATGTGGGGATC 38 GKTTTYAMMCTTTTCAATTG 38 — -20 to -11 ACTAGTCGACATGGAAGCCCC 39 AGCTCAGCTTCTCTTCC MuIgκV.sub.L5′-F 36 32 -20 to -12 ACTAGTCGACATGAGIMMKTC 40 TMTTCATTTCYTGGG 36 96 -20 to -12 ACTAGTCGACATGAKGTMCYC 41 TGCTCAGYTYCTIRG 35 8 -20 to -12 ACTAGTCGACATGGTRTCCWC 42 ASCTCAGTTCCTTG 37 — -16 to -8 ACTAGTCGACATGTATATATG 43 TTTGTTGTCTATTTCT MuIgκV.sub.L5′-G 39 — -19 to -10 ACTAGTCGACATGAAGTTGCC 44 TGTTAGGCTGTTGGTGCT 39 8 -22 to -13 ACTAGTCGACATGGATTTWCA 45 RGTGCAGATTWTCAGCTT 37 12 -15 to -7 ACTAGTCGACATGGTYCTYAT 46 YTCCTTGCTGTTCTGG 37 24 -15 to -7 ACTCGTCGACATGGTYCTYAT 47 YTTRCTGCTGCTATGG
(117) TABLE-US-00004 TABLE 4 Position of the Sequence SEQ ID Name Base Degeneracy amino acid (5′-3′) NO MuIgκV.sub.L3′-1 30 — 122 to 116 CCCAAGCTTACTGGATG 48 GTGGGAAGATGGA MuIgλV.sub.L5′-A 33 128 -20 to -13 GGGAATTCATGGCCTGG 49 AYTYCWCTYQIMYTCT MuIgλV.sub.L3′-1 32 32 125 to 118 CCCAAGCTTAGCTCYTC 50 WGWGGAIGGYGGRAA *Amino acid position of the primer relative to the start codon of the Ig variable region coding sequence
Immunoglobulin-PCR
(118) The cDNA synthesized using the mouse Ig-primer set as described above and 2× PCR pre-mix (catalog number STD01-M50 h, SolGent, Korea) was used for Immunoglobulin-PCR. Different 5′-primers was used for PCR according to the subtype of immunoglobulin amplified. Specifically, for a heavy chain of IgG or IgM, MuIgV.sub.H5′-A, MuIgV.sub.H5′-B, MuIgV.sub.H5′-C, MuIgV.sub.H5′-D, MuIgV.sub.H5′-E and MuIgV.sub.H5′-F were used. For a kappa light chain, MuIgkV.sub.L5′-A, MuIgkV.sub.L5′-B, MuIgκV.sub.L5′-C, MuIgκV.sub.L5′-D, MuIgκV.sub.L5′-E, MuIgκV.sub.L5′-F and MuIgκV.sub.L5′-G were used as a 5′-primer. For a lamda light chain MuIgλV.sub.L5′-A was used (refer to Table 2).
(119) The PCR conditions using 5′-primers of A and B was as follows: 94° C., 3 min.fwdarw.94° C., 1 min/50° C., 1 min/72° C., 2 min (35 cycles).fwdarw.72° C., 6 min.fwdarw.4° C., termination.
(120) The PCR conditions using 5′-primers of C-G was as follows: 94° C., 1 min/60° C., 1 min/72° C., 2 min (35 cycles).fwdarw.72° C., 6 min.fwdarw.4° C., termination.
(121) After the PCR reaction, the products were separated on a 2% DNA agarose gel. Then the amplified DNA was extracted from the gel using gel-elution method as described above.
(122) Results
(123) Production of Anti-IP-10 Antibody from the Hybridoma Cell Line Established
(124) Anti-IP-10 monoclonal antibodies were prepared from the hybridoma cell line established as above. The antibodies produced were tested using a recombinant human IP-10 protein in a western blot and clones #25, #28, #77, #88, #112, #116 and #129 were confirmed to be positive for IP-10 antigen (
(125) Then the sequence of the monoclonal antibodies #25, #28, #77, #88, #112, #116 and #129 were confirmed by PCR. The sequences are shown in Table 5. Also CDR 1-3 of heavy and light chain of the monoclonal antibodies are shown in
(126) TABLE-US-00005 TABLE 5 Monoclonal Heavy chain Light chain Ab variable region varaible region #25 93 94 #28 95 96 #77 97 98 #88 99 100 #112 101 102 #116 103 104 #129 105 106
Cell Migration Assay
(127) To test whether the anti-IP-10 antibody can inhibit the cell migration, cell migration assay was performed. Also, the epitope to which anti-IP-10 antibody recognized was also examined.
(128) As shown in
(129) Identification of Epitopes to which Anti-IP-10 Monoclonal Antibody Recognizes
(130) Epitopes to which anti-IP-10 monoclonal antibody binds are indicated in
(131) Although a few embodiments of the present disclosure have been shown and described, it would be appreciated by those skilled in the art that changes may be made in this embodiment without departing from the principles and sprit of the invention, the scope of which is defined in the claims and their equivalents.