Compositions and methods for inhibiting NF-κB and SOD-1 to treat amyotrophic lateral sclerosis
09725719 · 2017-08-08
Assignee
Inventors
Cpc classification
A61P21/00
HUMAN NECESSITIES
A61P25/28
HUMAN NECESSITIES
C12N2750/14143
CHEMISTRY; METALLURGY
C12N15/113
CHEMISTRY; METALLURGY
A61K48/00
HUMAN NECESSITIES
C12N2750/14141
CHEMISTRY; METALLURGY
C12N15/86
CHEMISTRY; METALLURGY
International classification
A61K48/00
HUMAN NECESSITIES
C12N15/11
CHEMISTRY; METALLURGY
C12N15/86
CHEMISTRY; METALLURGY
C12N15/113
CHEMISTRY; METALLURGY
Abstract
The invention relates to pharmaceutical compositions, kits, methods, and uses for the treatment of amyotrophic lateral sclerosis. In particular, the invention relates to compositions, kits, methods, and uses for the treatment of amyotrophic lateral sclerosis by inhibiting NF-κB in microglia or macrophages and by inhibiting motor neuron death. The invention further relates to compositions, kits, methods, and uses for the treatment of amyotrophic lateral sclerosis by inhibiting NF-κB in microglia in combination with inhibiting SOD-1 in astrocytes. The invention also relates to a method for inhibiting the expression or the activity of NF-κB in microglia or macrophages to inhibit motor neuron death, alone or in combination with inhibiting SOD-1 expression in astrocytes.
Claims
1. A method for treating a patient with amyotrophic lateral sclerosis by decreasing the expression of NF-κB in the patient, the method comprising administering to the patient a composition comprising an effective amount of a compound, and a pharmaceutically acceptable carrier therefor, wherein the compound decreases the expression of NF-κB in microglia of the patient, and wherein the compound is a nucleic acid; and inhibiting motor neuron death in the patient.
2. The method of claim 1 wherein the nucleic acid is an shRNA.
3. The method of claim 2 wherein the nucleic acid comprises the sequence of SEQ ID NO: 1 or SEQ ID NO: 2.
4. The method of claim 3 wherein the nucleic acid comprises the sequence of SEQ ID NO:1.
5. The method of claim 3 wherein the nucleic acid comprises the sequence of SEQ ID NO:2.
6. The method of claim 1 wherein the amyotrophic lateral sclerosis is sporadic amyotrophic lateral sclerosis.
7. The method of claim 1 wherein administration of the composition increases the survival of the patient by 40 days or greater.
8. The method of claim 1 wherein the patient has a mutation in a superoxide dismutase 1 gene.
9. The method of claim 1 wherein the purity of the compound is at least 98 percent based on weight percent.
10. The method of claim 1 further comprising administering to the patient a composition comprising an effective amount of a compound that decreases the expression of superoxide dismutase 1 in astrocytes, motor neurons, neurons, and/or oligodendrocytes of the patient.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1)
(2) (A) Immunoblot of lumbar spinal cord protein isolated from wild-type mice at 120 days of age and from SOD1-G93A female mice at pre-symptomatic (Pre), onset (Ons), symptomatic (Sym), late-symptomatic (LSym), and end-stage (ES) shows increase in phospho-p65 with disease progression (top). The blot was reprobed for total p65 (middle) and Actin (bottom) as loading controls. n=3 for each time point.
(3) (B) Fold change of the immunoblot in (A). Phospho-p65 was found to be significantly upregulated by 13.7 fold at the late-symptomatic stage and by 8.7 fold at end stage. Band intensities were normalized to p65/Actin.
(4) (C) Immunoblot of protein isolated from astrocytes obtained from late-symptomatic SOD1-G93A and wild-type littermates shows 4.4 fold increase in activated NF-κB.
(5) (D and E) Kaplan-Meier survival curve (D) of SOD1-G93A mice injected with AAV9-DN-ikBa (median survival=128, n=16) and non-injected controls (median survival=136.5, n=14) and motor performance on accelerating rotarod test (E).
(6) (F and G) Kaplan-Meier survival curve (F) of SOD1-G93A; IKKβf/f; GFAP-cre− (median survival=154, n=10) and SOD1-G93A; IKKβf/f; GFAP-cre+ mice (median survival=149, n=14) and motor performance on accelerating rotarod test (G). Error bars represent s.e.m. *, P<0.05, **, P<0.01.
(7)
(8) (A and B) Representative high magnification images of NF-κB-GFP-positive cells (green) in the lumbar ventral horn of late-symptomatic NF-κBEGFP; SOD1-G93A mice. Most predominant GFP+ cells (A) also positive for microglial marker Iba1+ (red). Other GFP+ cells positive for astrocyte maker GFAP (blue) Scale bar=5 microns (A) 20 microns (B).
(9) (C) Immunoblot of protein isolated from primary microglia obtained from late-symptomatic SOD1-G93A mice and WT littermates confirm NF-κB is activated 12.4 fold in SOD1-G93A microglia compared to control littermates. Microglia from 6 mice were pooled together for protein isolation. Fold change determined by phospho-p65 band intensity normalized to p65/Actin.
(10) (D) Immunohistochemistry of lumbar ventral horn of WT; NF-κB-GFP at 120 days, and SOD1-G93A; NF-κB-GFP mice pre-symptomatic, onset, symptomatic, late-symptomatic, and end-stage. NF-κB activation shown by NF-κBEGFP (green) and microglia shown by tomato lectin (red). Scale bar=50 microns.
(11) (E) Quantification of GFP+ cells co-localizing with tomato lectin in lumbar spinal cord sections of SOD1-G93A; NF-κB -GFP mice.
(12) Error bars represent s.e.m. **, P<0.01, ****, P<0.0001.
(13)
(14) (A and B) Immunocytochemistry of WT and SOD1-G93A microglia for prototypic microglial markers Iba-1, CD11b, F4/80, and astrocytes (GFAP), oligodendrocyte precursors (NG2), and motor neurons (ChAT). Quantification of positive microglial cells per well (B). DAPI (blue) Scale bar=20 microns.
(15) (C) Flow cytometry of adult microglia for CD45 and CD11b.
(16) (D and E) Representative microscopic field (D) and quantification of entire well (E) of surviving Hb9-GFP+ motor neurons after 3 days (72 hours) of co-culture with either WT or SOD1-G93A microglia that were not infected (black bars) or infected with Lv-RFP (dashed bars) or Lv-shRNA-SOD1 (white bars). Scale bar=200 microns
(17) (F) Quantification of human SOD1 protein in SOD1-G93A microglia infected with Lv-RFP and Lv-shRNA-SOD1 determined by ELISA.
(18) Error bars represent s.e.m. *** , P<0.001, ****, P<0.0001.
(19)
(20) (A and B) Representative microscopic fields (A) and entire well counts (B) of Hb9-GFP+ motor neurons after 12 hours and 72 hours in co-culture with WT or SOD1-G93A microglia not infected (black bars), infected with Ad-RFP (dashed bars) or Ad-DNikBα (white bars). MNs co-cultured with either WT; IKKβf/f or SOD1-G93A; IKKβf/f microglia infected with Ad-cre shown with dashed bars. Scale bar=200 microns.
(21) (C and D) Quantification of TNF-α (C) and nitric oxide (D) in the co-culture medium by ELISA. Nitric oxide measured indirectly by sum of nitrate and nitrite.
(22) (E) Quantification of phospho-p65 by ELISA from microglial-MN co-cultures. Phospho-p65 normalized to total levels of p65 determined by ELISA.
(23) Error bars represent s.e.m. **** , P<0.0001, *** , P<0.001.
(24)
(25) (A) Kaplan-Meier survival curve of SOD1-G93A; IKKβF/wt; CSF1R-cre− (n=22) and SOD1-G93A; IKKβF/wt; CSF-1R-cre+ mice (n=25). Median survival SOD1-G93A; IKKβF/wt; CSF1R-cre−=133 days, SOD1-G93A; IKKβF/wt; CSF-1R-cre+=153 days. Mean survival SOD1-G93A; IKKβF/wt; CSF1R-cre−=134.9±1.4 days, SOD1-G93A; IKKβF/wt; CSF-1R-cre+=153.7±0.9 days, P<0.0001.
(26) (B) Disease onset determined by age at which peak weight was achieved. SOD1-G93A; IKKβF/wt; CSF1R-cre-reached peak onset at 102.8±1.1 days and SOD1-G93A; IKKβF/wt; CSF1R-cre+ mice reached onset at 101.2±1.3 days.
(27) (C) Disease progression defined as time from disease onset to end-stage. SOD1-G93A; IKKβF/wt; CSF1R-cre− had a mean disease progression of 34.8±1.4 days and SOD1-G93A; IKKβF/wt; CSF1R-cre+ had an average disease progression of 51.1±1.7 days.
(28) (D) Immunoblot of lumbar spinal cord protein isolated from WT; IKKβ.sup.F/wt; CSF1R-cre+, WT; IKKβ.sup.F/wt; CSF1R-cre−, and end-stage SOD1-G93A; IKKβ.sup.F/wt; CSF1R-cre−, SOD1-G93A; IKKβ.sup.F/wt CSF1R-cre+ mice probed for phospho-p65 (top), total p65, IKKβ, human SOD1 and Actin (bottom). Fold change represents band intensities of phospho-p65 normalized to p65/Actin and IKKβ normalized to Actin.
(29) (E) Immunohistochemistry of Iba1-positive microglia (red) and GFAP-positive astrocytes (green) in the lumbar spinal cords of end-stage SOD1-G93A; IKKβF/wt CSF1R-cre−, and age-matched SOD1-G93A; IKKβf/wt CSF1R-cre+, and WT IKKβf/wt CSF1R-cre+ littermates. Scale bar=200 microns.
(30) (F and G) Quantification of GFAP and Iba-1 signal intensity in SOD1-G93A; IKKβ.sup.F/wt CSF1R-cre− and age-matched SOD1-G93A; IKKβ.sup.f/wt CSF1R-cre+ immunohistochemistry represented in (E).
(31)
(32) (A) Immunohistochemistry of CD68 (red) and Iba1 (green) cells in lumbar spinal cord of disease-matched end-stage SOD1-G93A; IKKβF/wt CSF1R-cre− and SOD1-G93A; IKKβF/wt CSF1R-cre+ littermates. Scale bar=200 microns.
(33) (B) Quantification of CD68+/Iba-1+ cells per section of SOD1-G93A; IKKβF/wt CSF1R-cre− and SOD1-G93A; IKKβF/wt CSF1R-cre+.
(34) (C) Immunohistochemistry of iNOS (red) and Iba1 (green) cells in lumbar spinal cord of disease-matched end-stage SOD1-G93A; IKKβF/wt CSF1R-cre− and SOD1-G93A; IKKβF/wt CSF1R-cre+ littermates. Scale bar=20 microns.
(35) (D) Quantification of iNOS+/Iba-1+ cells per section of SOD1-G93A; IKKβF/wt CSF1R-cre− and SOD1-G93A; IKKβF/wt CSF1R-cre+.
(36) (E) Immunohistochemistry of CD86 (red) and Iba1 (green) cells in lumbar spinal cord of disease-matched end-stage SOD1-G93A; IKKβF/wt CSF1R-cre− and SOD1-G93A; IKKβF/wt CSF1R-cre+ littermates. Scale bar=20 microns.
(37) (F) Quantification of CD86+/Iba-1+ cells per section of SOD1-G93A; IKKβF/wt CSF1R-cre− and SOD1-G93A; IKKβF/wt CSF1R-cre+.
(38)
(39) (A and B) Representative microscopic fields (A) and entire well counts (B) of Hb9-GFP+ motor neurons after 1 day (12 hours) and 3 days (72 hours) in co-culture with wild-type microglia (WT) (white bar) or wild-type microglia with constitutively active IKKβ (IKKβCA) (black bar).
(40) (C) Quantification of NF-κB activation (phospho-p65) and normalized to total p65, both determined by ELISA.
(41) (D) Immunoblot of lumbar spinal cord protein from WT and IKKβCA mice. The blot was probed for p-p65 (top), IKKβ (top middle), p65 (bottom middle) and Actin (bottom). p-p65 band intensities normalized to p65/Actin. Fold change determined by densitometry in Image J.
(42) (E) Immunohistochemistry of lumbar spinal cords of WT and IKKβCA littermates at 8 months. Iba1-positive microglia (red), GFAP-positive astrocytes (blue), ChAT-positive MNs (green). Scale bar=100 microns.
(43) (F) Counts of ChAT+ MNs in ventral horn of lumbar spinal cord from 8-month old IKKβCA and WT littermates. (n=3).
(44) (G) Mass of IKKβCA (n=6) and WT littermates (n=8).
(45) (H) Grip strength of IKKβCA (n=6) and WT littermates (n=8).
(46) (I) Immunohistochemistry of lumbar spinal cords of WT and IKKβCA littermates at 4 months and 8 months. Ibal-positive microglia (red), GFAP-positive astrocytes (green), ChAT-positive motor neurons (blue). Scale bar=200 microns.
(47)
(48) (A) Model of the mechanism by which SOD1-G93A microglia induce motor neuron death in ALS. SOD1-G93A microglia initiate the NF-κB pathway by a SOD1-G93A-dependent mechanism leading to activation of microglia, characterized by an increase in Iba-1, CD68, iNOS, and CD86 cellular markers. Subsequently, activated microglia induce motor neuron death via inflammatory pathways. Inhibition of NF-κB in ALS mice blocks microglial activation, down-regulates pro-inflammatory markers, and delays motor neuron death.
(49) (B) Model of IKKβCA mice in which NF-κB is constitutively active only in myeloid cells. Microglia in these mice have shorter, thickened processes and exhibit a pro-inflammatory phenotype characterized by an increase in Iba-1, CD68, iNOS, and CD86 markers. These activated microglia induce motor neuron death in a mutant SOD1-independent mechanism.
(50)
(51) (A) Electrophoretic mobility shift assay of total spinal cord nuclear extracts from 130 day old wild-type mice and end-stage SOD1-G93A mice.
(52) (B) Supershifts of nuclear extract from SOD1-G93A sample #3 and #2. Arrow shows supershifted band from p65 antibody.
(53) (C) and (D) Immunoblot of nuclear extracts probed for p65, p50, and Tubulin.
(54) (E) Immunoblot of lumbar spinal cord protein lysate from wild-type (n=2), late-stage (n=6), and end-stage (n=6) SOD1-G93A mice. The blot was probed for phospho-p65 and reprobed for total p65 (middle) and Actin (bottom) as loading controls.
(55) (F) Fold change of the immunoblot in (A) determined using Image J to measure band intensities of phospho-p65 normalized to p65/Actin. Phospho-p65 is upregulated by 13.4±1.6 fold compared to wild-type at the late-symptomatic stage and by 14.1±4.8 fold at end stage.
(56)
(57) (A) Quantification of surviving Hb9-GFP+ motor neurons per well during 6-day co-culture with wild-type (dashed) or SOD1-G93A astrocytes infected with Ad-RFP (black) or Ad-IκBα-SR (gray). (n=3)
(58) (B) Quantification of phospho-p65 by ELISA in wild-type and SOD1-G93A astrocytes infected by Ad-RFP or Ad-IκBα-SR and stimulated with 10 ng/mL TNF-α for 12 hours.
(59) (C and D) Representative images of GFAP-cre-negative and positive Rosa26-Stop.sup.Flox-CAG-tdTomato mice. Native RFP fluorescence was analyzed for co-localization with immunohistochemical markers for (C) astrocytes (GFAP and EAAT2), microglia (Iba1), and (D) motor neurons (ChAT). Scale bar=100 microns (top) 50 microns (bottom).
(60) (E) Immunoblot of lumbar spinal cord protein isolated from WT; IKKβ.sup.f/f; GFAP-cre−, WT; IKKβ.sup.f/f; GFAP-cre+, and symptomatic SOD1-G93A; IKKβ.sup.f/f; GFAP-cre−, SOD1-G93A; IKKβ.sup.f/f; GFAP-cre+ mice probed for phospho-p65 (top) and Actin (bottom) confirm reduction in NF-κB activation in cre+ mice. Fold change represents band intensities of phospho-p65/Actin determined by ImageJ.
(61) Error bars represent s.e.m. *, P<0.05; **, P<0.01; ****, P<0.0001.
(62)
(63) (A and B) Representative images of CSF1R-cre-negative and positive Rosa26-Stop.sup.Flox-CAG-tdTomato mice. Native RFP fluorescence was analyzed for co-localization with immunohistochemical markers for (A) microglia (Iba-1) and astrocytes (GFAP), and (B) motor neurons (ChAT). Scale bar=100 microns (top) and 10 microns (bottom).
(64) (C) Immunohistochemical analysis of end-stage SOD1-G93A; IKKβ.sup.F/wt; CSF1R-cre negative and positive mice for IKKβ (red) and IKKγ (green) and tomato lectin (blue). Scale bar=50 microns.
(65)
(66) (A and B) Quantification of TNF-α (A) and nitric oxide (B) in the co-culture medium by ELISA. Nitric oxide measured indirectly by sum of nitrate and nitrite.
(67) Error bars represent s.e.m. *, P<0.05, **, P<0.01.
(68)
(69) (A) Immunohistochemistry of CD68 (red) and Iba1 (green) cells in lumbar spinal cord of WT and IKKβCA littermates at 4 and 8 months. Scale bar=50 microns.
(70) (B) Immunohistochemistry of CD86 (red) and Iba1 (green) cells in lumbar spinal cord of WT and IKKβCA littermates at 4 and 8 months. Scale bar=20 microns.
(71) (C) Immunohistochemistry of iNOS (red) and Iba1 (green) cells in lumbar spinal cord of WT and IKKβCA littermates at 8 months. Scale bar=10 microns.
(72)
(73)
(74)
(75)
(76)
(77)
(78)
(79)
DETAILED DESCRIPTION OF ILLUSTRATIVE EMBODIMENTS
(80) Several embodiments of the invention are described in this Detailed Description section of the patent application and each of the embodiments described in this Detailed Description section of the application applies to each of the embodiments, or combinations thereof, described in the enumerated clauses in the Background and Summary section of the patent application.
(81) In any of the various embodiments described herein, the following features may be present where applicable, providing additional embodiments of the invention. For all of the embodiments, any applicable combination of embodiments is also contemplated.
(82) In one embodiment there is provided a method for treating a patient with amyotrophic lateral sclerosis by decreasing the expression of NF-κB in the patient. The method comprises the steps of administering to the patient a composition comprising an effective amount of a compound that decreases the expression of NF-κB in microglia or macrophages of the patient, and inhibiting motor neuron (MN) death in the patient.
(83) In another embodiment, a method is provided for treating amyotrophic lateral sclerosis by inhibiting the activity of NF-κB in microglia or macrophages of a patient. The method comprises the step of administering to the patient a composition comprising an effective amount of a compound that inhibits the activity of NF-κB in microglia or macrophages of the patient, and inhibiting motor neuron death in the patient.
(84) In yet another embodiment, a method is provided for inhibiting the expression or the activity of NF-κB in microglia or macrophages to inhibit motor neuron death. The method comprises the steps of contacting the microglia or macrophages with a composition comprising an effective amount of an exogenous compound that decreases the expression or the activity of NF-κB in the microglia or the macrophages, and inhibiting motor neuron death.
(85) In still another embodiment, a method is provided for treating a patient with amyotrophic lateral sclerosis. The method comprises the steps of administering to the patient a first composition comprising an effective amount of a first compound that decreases the expression or the activity of NF-κB in microglia or macrophages of the patient, administering to the patient a second composition comprising an effective amount of a second compound that decreases the expression of SOD-1 in astrocytes of the patient, and inhibiting motor neuron death in the patient. In this embodiment, the first and second compositions can contain different compounds (i.e., active agents), and the first and second compounds may, thus, be different compounds (i.e., active agents).
(86) In another illustrative aspect, a method for inhibiting the expression or activity of NF-κB in microglia or macrophages of a patient with amyotrophic lateral sclerosis and for inhibiting the expression of SOD-1 in the patient is provided. The method comprises the steps of contacting the microglia or macrophages in the patient with a first composition comprising an effective amount of a first compound that decreases the expression or the activity of NF-κB in the microglia or the macrophages in the patient, contacting the astrocytes in the patient with a second composition comprising an effective amount of a second compound that decreases the expression of SOD-1 in astrocytes in the patient, and inhibiting motor neuron death. In this embodiment, the first and second compositions can contain different compounds (i.e., active agents), and the first and second compounds may, thus, be different compounds (i.e., active agents).
(87) In any of these method embodiments, or any corresponding use, the decreased expression or activity of NF-κB in microglia or macrophages of the patient, results in an effect on motor neurons of the patient selected from, but not limited to, the group consisting of an increase in the number of motor neurons, a decrease in soma atrophy, and an increase in neurite length after administration of the compound. In various embodiments, the motor neurons may be in the motor cortex, brain stem, or spinal cord of the patient, or combinations thereof. In any of the method embodiments described herein, the decreased expression or activity of NF-κB in microglia or macrophages of the patient may also slow down the progression of amyotrophic lateral sclerosis.
(88) In another illustrative aspect, a pharmaceutical composition is provided. The composition comprises a dosage form of a compound effective to decrease the expression or the activity of NF-κB in microglia or macrophages of a patient with amyotrophic lateral sclerosis. Kits comprising these pharmaceutical compositions are also provided. In other aspects, uses of these pharmaceutical compositions for the manufacture of a medicament for treating amyotrophic lateral sclerosis are provided. In yet other embodiments, these pharmaceutical compositions are provided, for use in treating amyotrophic lateral sclerosis.
(89) In another illustrative aspect of the invention, the methods and uses described herein may decrease the expression of proinflammatory markers. In one embodiment, the proinflammatory markers are selected from the group consisting of CD68, CD86, and NOS.
(90) The methods, kits, uses, and pharmaceutical compositions described herein can be used to treat either sporadic or familial amyotrophic lateral sclerosis, and can be used for both human clinical medicine (i.e., the patient may be a human patient) and veterinary medicine. In one embodiment the patient may have a mutation in the SOD1 gene and may be a human patient. In one embodiment, the compounds described herein that can be used to treat sporadic or familial amyotrophic lateral sclerosis are compounds that are effective to decrease the expression, or reduce the activity, of NF-κB in microglia or macrophages of a patient with amyotrophic lateral sclerosis. In another embodiment, the compounds described herein can be effective to decrease the expression of SOD-1 in astrocytes of the patient. The compounds are selected from the group consisting of drugs, peptides, and nucleic acids, or combinations thereof.
(91) Expression or activity of NF-κB can be reduced, for example, by treatment of a patient with a drug, peptide, or nucleic acid, or a combination thereof, that reduces the expression or the activity of NF-κB in microglia or macrophages of a patient with amyotrophic lateral sclerosis. For example, compounds that reduce activity of NF-κB include Withaferin A. In another embodiment, expression or activity of NF-κB in the microglia or macrophages of a patient with amyotrophic lateral sclerosis can be reduced by treatment of the patient with a pharmaceutical composition comprising a nucleic acid such as an antisense RNA molecule, an siRNA, an shRNA, or an miRNA that inhibits expression or activity of NF-κB. Inhibitors of NF-κB expression or activity also include, for example, Bay 11-7082 [(E)-3-(4-Methylphenylsulfonyl)-2-propenenitrile], Wedelolactone, BMS-345541 [N-(1,8-Dimethylimidazo[1,2-a]quinoxalin-4-yl)-1,2-ethanediamine hydrochloride], Withaferin A, Resveratrol, IMD 0354 [N-(3,5-Bis-trifluoromethylphenyl)-5-chloro-2-hydroxybenzamide], BOT-64 [6,6-Dimethyl-2-(phenylimino)-6,7-dihydro-5H-benzo[1,3]oxathiol-4-one], CAY1065 [3-[(aminocarbonyl)amino]-5-[4-(4-morpholinylmethyl)phenyl]-2-thiophenecarboxamide], Asprin, Sodium Salicylate, NF-κB Essential Modulator binding domain (NBD) peptides, SC-514 [4-amino-[2,3′-bithiophene]-5-carboxamide], AS602868 Ikk2 inhibitor, IKKβ inhibitors that are nucleic acids such as an antisense RNA molecule, an siRNA, an shRNA (e.g., the AAV9-DNiKβ-α construct described herein), or an miRNA, PS-1145 [N-(6-Chloro-9H-pyrido[3,4-b]indol-8-yl)-3-pyridinecarboxamide dihydrochloride], ML120B [N-(6-chloro-7-methoxy-9H-β-carbolin-8-yl)-2-methylnicotinamide], and TPCA-1 [[5-(p-Fluorophenyl)-2-ureido]thiophene-3-carboxamide].
(92) In another embodiment, the expression of SOD-1 in a patient can be reduced, for example, by treatment of the patient with a drug, peptide, or nucleic acid, or a combination thereof, that reduces the expression of SOD-1 in the astrocytes of a patient with amyotrophic lateral sclerosis. For example, compounds that reduce expression of SOD-1 can include pharmaceutical compositions comprising a nucleic acid such as an antisense RNA molecule, an siRNA, an shRNA, or an miRNA that inhibits expression of SOD-1 in astrocytes. In one embodiment, such an shRNA is the shRNA of SEQ ID NO: 1 described herein.
(93) Suitable methods for delivery of antisense RNA molecules, siRNAs, shRNAs, or miRNAs to a patient include bacterial or viral vectors, such as lentiviral vectors or adenovirus vectors. In another embodiment, a suitable method for delivery is an adeno-associated virus vector. Exemplary of such an RNA molecule is the nucleic acid with SEQ ID NO: 1 that targets the human SOD1 transgene in SOD1-.sup.G93A microglia shown by the present inventors to efficiently ablate expression of the mutant SOD1 gene in SOD1-.sup.G93A microglia, resulting in effective suppression of motor neuron toxicity in motor neurons exposed to the microglia (see Example 18). In another embodiment, a nucleic acid with SEQ ID NO: 2 can be delivered. The RNA molecule of SEQ ID NO: 1 can also inhibit expression of wild type SOD-1.
(94) In accordance with these embodiments, pharmaceutical compositions are provided comprising a purified nucleic acid comprising, or consisting of, a sequence of SEQ ID NO: 1. A purified nucleic acid is also provided comprising a complement of SEQ ID NO: 1, or a sequence that hybridizes under highly stringent conditions to a complement of a sequence consisting of SEQ ID NO: 1. cDNAs are also contemplated and are in accordance with the invention. In accordance with the invention “highly stringent conditions” means hybridization at 65° C. in 5×SSPE and 50% formamide, and washing at 65° C. in 0.5×SSPE. Conditions for high, low, and moderately stringent hybridization are described in Sambrook et al., “Molecular Cloning: A Laboratory Manual”, 3rd Edition, Cold Spring Harbor Laboratory Press, (2001), incorporated herein by reference. In some illustrative aspects, hybridization occurs along the full-length of the nucleic acid.
(95) The invention encompasses isolated or substantially purified nucleic acids. An “isolated” or “purified” nucleic acid molecule is substantially free of chemical precursors or other chemicals when chemically synthesized, or is substantially free of cellular material if made by recombinant DNA techniques (e.g., a cDNA). In various embodiments described herein, the nucleic acids for use in the methods, compositions, and kits described herein may be double-stranded (e.g., antisense RNAs) or single-stranded, but the nucleic acids are typically single-stranded.
(96) The nucleic acids for use in the methods, uses, pharmaceutical compositions, and kits described herein can be modified by substitution, deletion, truncation, and/or can be fused with other nucleic acid molecules wherein the resulting nucleic acids hybridize specifically under highly stringent conditions to the complement of SEQ ID NO: 1, for example, and wherein the modified nucleic acids are useful in the methods or uses described herein. Derivatives can also be made such as phosphorothioate, phosphotriester, phosphoramidate, and methylphosphonate derivatives (Goodchild, et al., Proc. Natl. Acad. Sci. 83:4143-4146 (1986), incorporated herein by reference).
(97) In another embodiment, nucleic acid molecules are provided having about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 96%, about 97%, about 98%, or about 99% homology to SEQ ID NO: 1. Determination of percent identity or similarity between sequences can be done, for example, by using the GAP program (Genetics Computer Group, software; now available via Accelrys on http://www.accelrys.com), and alignments can be done using, for example, the ClustalW algorithm (VNTI software, InforMax Inc.). A sequence database can be searched using the nucleic acid sequence of interest. Algorithms for database searching are typically based on the BLAST software (Altschul et al., 1990). In some embodiments, the percent identity can be determined along the full-length of the nucleic acid.
(98) Techniques for synthesizing the nucleic acids described herein, such as SEQ ID NO: 1, or fragments thereof, are well-known in the art and include chemical syntheses. Such techniques are described in Sambrook et al., “Molecular Cloning: A Laboratory Manual”, 3rd Edition, Cold Spring Harbor Laboratory Press, (2001), incorporated herein by reference. Nucleic acids for use in the methods described herein can be made commercially. Techniques for purifying or isolating the nucleic acids described herein are well-known in the art. Such techniques are described in Sambrook et al., “Molecular Cloning: A Laboratory Manual”, 3rd Edition, Cold Spring Harbor Laboratory Press, (2001), incorporated herein by reference.
(99) In one embodiment, the compounds described herein for ablating expression of NF-κB in microglia or macrophages (i.e., drugs, peptides, or nucleic acids), for inhibiting activity of NF-κB in microglia or macrophages, or for inhibiting expression of SOD-1 in astrocytes may be administered as a formulation in association with one or more pharmaceutically acceptable carriers. The carriers can be excipients. The choice of carrier will to a large extent depend on factors such as the particular mode of administration, the effect of the carrier on solubility and stability, and the nature of the dosage form. Pharmaceutical compositions suitable for the delivery of the compound, or additional therapeutic agents to be administered with the compound, and methods for their preparation will be readily apparent to those skilled in the art. Such compositions and methods for their preparation may be found, for example, in Remington: The Science & Practice of Pharmacy, 21st Edition (Lippincott Williams & Wilkins, 2005), incorporated herein by reference.
(100) In various illustrative embodiments, the compositions and compounds described herein may be in a dosage form selected from the group consisting of an inhalation dosage form, an oral dosage form, and a parenteral dosage form. The parenteral dosage form may be selected from the group consisting of an intradermal dosage form, a subcutaneous dosage form, an intramuscular dosage form, an intraperitoneal dosage form, an intravenous dosage form, and an intrathecal dosage form.
(101) In one embodiment, a pharmaceutically acceptable carrier may be selected from any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like, and combinations thereof, that are physiologically compatible. In some embodiments, the carrier is suitable for parenteral administration. Pharmaceutically acceptable carriers include sterile aqueous solutions or dispersions, and sterile powders for the preparation of sterile injectable solutions or dispersions. Supplementary active compounds can also be incorporated into the pharmaceutical compositions of the invention.
(102) In various embodiments, liquid formulations may include suspensions and solutions. Such formulations may comprise a carrier, for example, water, ethanol, polyethylene glycol, propylene glycol, methylcellulose, or a suitable oil, and one or more emulsifying agents and/or suspending agents. Liquid formulations may also be prepared by the reconstitution of a solid, such as a lyophilizate. Thus, in one embodiment, the lyophilizate can be a reconstitutable lyophilizate.
(103) In one illustrative aspect, an aqueous suspension may contain the active materials in admixture with appropriate excipients. Such excipients are suspending agents, for example, sodium carboxymethylcellulose, methylcellulose, hydroxypropylmethylcellulose, sodium alginate, polyvinylpyrrolidone, gum tragacanth and gum acacia; dispersing or wetting agents which may be a naturally-occurring phosphatide, for example, lecithin; a condensation product of an alkylene oxide with a fatty acid, for example, polyoxyethylene stearate; a condensation product of ethylene oxide with a long chain aliphatic alcohol, for example, heptadecaethyleneoxycetanol; a condensation product of ethylene oxide with a partial ester derived from fatty acids and a hexitol such as polyoxyethylene sorbitol monooleate; or a condensation product of ethylene oxide with a partial ester derived from fatty acids and hexitol anhydrides, for example, polyoxyethylene sorbitan monooleate. The aqueous suspensions may also contain one or more preservatives, for example, ascorbic acid, ethyl, n-propyl, or p-hydroxybenzoate; or one or more coloring agents. In other embodiments, isotonic agents, for example, sugars, polyalcohols such as mannitol, sorbitol, or sodium chloride can be included in the pharmaceutical composition.
(104) In one embodiment the excipient comprises a buffer. In one embodiment, the pH of the buffer is about 5.0 to about 8.0. The buffer may be any acceptable buffer for the indicated pH range and physiological compatibility. In addition a buffer may additionally act as a stabilizer. In one embodiment, the buffer comprises an ascorbate, sorbate, formate, lactate, fumarate, tartrate, glutamate, acetate, citrate, gluconate, histidine, malate, phosphate or succinate buffer.
(105) In one aspect, a compound (i.e., a drug, a peptide, or a nucleic acid), or additional therapeutic agent as described herein, may be administered directly into the blood stream, into muscle, or into an internal organ. Suitable routes for parenteral administration include intravenous, intraarterial, intraperitoneal, intrathecal, epidural, intracerebroventricular, intrasternal, intracranial, intramuscular, and subcutaneous delivery. Suitable means for parenteral administration include needle (including microneedle) injectors, needle-free injectors and infusion techniques. Examples of parenteral dosage forms include aqueous solutions of the active agent, in an isotonic saline, glucose (e.g., 5% glucose solutions), or other well-known pharmaceutically acceptable liquid carriers such as liquid alcohols, glycols, esters, and amides. Prolonged absorption of the injectable compositions can be brought about by including in the composition an agent which delays absorption, for example, monostearate salts and gelatin.
(106) Also contemplated herein are kits comprising the pharmaceutical composition described herein. In another embodiment, a kit comprising a sterile vial, the pharmaceutical composition of any one of the preceding embodiments, and instructions for use describing use of the composition for treating a patient with amyotrophic lateral sclerosis is described.
(107) In another embodiment, the kit of the preceding embodiment wherein the compound or the composition is in the form of a reconstitutable lyophlizate is described.
(108) In another embodiment, any of the preceding kit embodiments wherein the dose of the compound in the pharmaceutical composition is in the range of 1 to 5 μg/kg is described.
(109) In another embodiment, any of the preceding kit embodiments wherein the dose of the compound in the pharmaceutical composition is in the range of 1 to 3 μg/kg is described.
(110) In another embodiment, the kit of any of the preceding kit embodiments is described wherein the purity of the compound is at least 90% based on weight percent. In another embodiment, the kit of any of the preceding embodiments is described wherein the purity of the compound is at least 95% based on weight percent. In another embodiment, the kit of any of the preceding kit embodiments is described wherein the purity of the compound is at least 98% based on weight percent. In another embodiment, the kit of any of the preceding kit embodiments is described wherein the purity of the compound is at least 99% based on weight percent.
(111) In another illustrative aspect, the kit of any of the preceding kit embodiments is described wherein the compound or the composition is in a parenteral dosage form. The parenteral dosage form can be selected from the group consisting of an intradermal dosage form, a subcutaneous dosage form, an intramuscular dosage form, an intraperitoneal dosage form, an intravenous dosage form, and an intrathecal dosage form. In yet another embodiment, the kit can comprise the composition and the composition can further comprise a pharmaceutically acceptable carrier. The pharmaceutically acceptable carrier can be a liquid carrier selected from the group consisting of saline, glucose, alcohols, glycols, esters, amides, and a combination thereof.
(112) Any effective regimen for administering the compound can be used. For example, the compound can be administered as a single dose, or can be divided and administered as a multiple-dose daily regimen. Further, a staggered regimen, for example, one to five days per week can be used as an alternative to daily treatment, and for the purpose of the pharmaceutical compositions, kits, methods, and uses described herein, such intermittent or staggered daily regimen is considered to be equivalent to every day treatment and is contemplated. In one illustrative embodiment the patient is treated with multiple injections of the compound to eliminate the disease state (i.e., amyotrophic lateral sclerosis) or to reduce or stabilize the symptoms of disease. In one embodiment, the patient is injected multiple times (preferably about 2 up to about 50 times), for example, at 12-72 hour intervals or at 48-72 hour intervals. Additional injections of the compound can be administered to the patient at an interval of days or months after the initial injections(s) of the compound, and the additional injections can prevent recurrence of the disease or can prevent an increase in the severity of the symptoms of disease.
(113) In one embodiment, administration of the compounds and compositions described herein according to the methods and uses of the invention may increase the survival of the patient by 90 days or greater. In another embodiment, administration of the compounds and compositions described herein according to the methods and uses of the invention may increase the survival of the patient by at least 20 days, at least 30 days, at least 35 days, at least 40 days, at least 45 days, at least 50 days, at least 55 days, at least 60 days, at least 65 days, at least 70 days, at least 75 days, at least 80 days, at least 85 days, at least 90 days, at least 95 days, at least 100 days, at least 150 days, at least 200 days, at least 250 days, or at least 300 days as compared to a patient who does not receive the treatment described herein.
(114) The unitary daily dosage of the compound can vary significantly depending on the patient condition, the purity of the compound and its route of administration and tissue distribution, and the possibility of co-usage of other therapeutic treatments. The effective amount to be administered to a patient is based on body surface area, mass, and physician assessment of patient condition. Effective doses can range, for example, from about 1 ng/kg to about 1 mg/kg, from about 1 μg/kg to about 500 μg/kg, and from about 1 μg/kg to about 100 μg/kg. These doses are based on an average patient weight of about 70 kg, and the kg are kg of patient body weight (mass). In one embodiment, the compound or pharmaceutical composition is in a multidose form. In another embodiment, the compound or pharmaceutical composition is a single dose form (i.e., a unit dose form or a dosage unit).
(115) In one embodiment, the compound can be administered in a dose of from about 1.0 ng/kg to about 1000 μg/kg, from about 10 ng/kg to about 1000 μg/kg, from about 50 ng/kg to about 1000 μg/kg, from about 100 ng/kg to about 1000 μg/kg, from about 500 ng/kg to about 1000 μg/kg, from about 1 ng/kg to about 500 μg/kg, from about 1 ng/kg to about 100 μg/kg, from about 1 μg/kg to about 50 μg/kg, from about 1 μg/kg to about 10 μg/kg, from about 5 μg/kg to about 500 μg/kg, from about 10 μg/kg to about 100 μg/kg, from about 20 μg/kg to about 200 μg/kg, from about 10 μg/kg to about 500 μg/kg, or from about 50 μg/kg to about 500 μg/kg. The total dose may be administered in single or divided doses and may, at the physician's discretion, fall outside of the typical range given herein. These dosages are based on an average patient weight of about 70 kg and the “kg” are kilograms of patient body weight. The physician will readily be able to determine doses for subjects whose weight falls outside this range, such as infants and the elderly.
(116) In another embodiment, the compound can be administered at a dose of from about 1 μg/m.sup.2 to about 500 mg/m.sup.2, from about 1 μg/m.sup.2 to about 300 mg/m.sup.2, or from about 100 μg/m.sup.2 to about 200 mg/m.sup.2. In other embodiments, the compound can be administered at a dose of from about 1 mg/m.sup.2 to about 500 mg/m.sup.2, from about 1 mg/m.sup.2 to about 300 mg/m.sup.2, from about 1 mg/m.sup.2 to about 200 mg/m.sup.2, from about 1 mg/m.sup.2 to about 100 mg/m.sup.2, from about 1 mg/m.sup.2 to about 50 mg/m.sup.2, or from about 1 mg/m.sup.2 to about 600 mg/m.sup.2. The total dose may be administered in single or divided doses and may, at the physician's discretion, fall outside of the typical range given herein. These dosages are based on m.sup.2 of body surface area.
(117) In the embodiment where a viral vector is used, the titer may be about 1×10.sup.2, 1 ×10.sup.3, 1×10.sup.4, 1×10.sup.5, 1×10.sup.6, 1×10.sup.7, 1×10.sup.8, 1×10.sup.9, 1×10.sup.10, 1×10.sup.11, 1×10.sup.12, 1×10.sup.13, or 1×10.sup.14, DNase resistant particles per ml. In another embodiment, the pharmaceutical compositions and/or dosage forms of the compound for administration are prepared from compounds with a purity of at least about 90%, or about 95%, or about 96%, or about 97%, or about 98%, or about 99%, or about 99.5%. In another embodiment, pharmaceutical compositions and or dosage forms of the compound for administration are prepared from compounds with a purity of at least 90%, or 95%, or 96%, or 97%, or 98%, or 99%, or 99.5%. The purity of the compound may be measured using any conventional technique, including various chromatography or spectroscopic techniques, such as high pressure or high performance liquid chromatography, nuclear magnetic resonance spectroscopy, TLC, UV absorbance spectroscopy, fluorescence spectroscopy, and the like.
(118) As used herein, purity determinations may be based on weight percentage, mole percentage, and the like. In addition, purity determinations may be based on the absence or substantial absence of certain predetermined components. It is also to be understood that purity determinations are applicable to solutions of the compounds and pharmaceutical compositions prepared by the methods described herein. In those instances, purity measurements, including weight percentage and mole percentage measurements, are related to the components of the solution exclusive of the solvent. In another embodiment, the compound or the pharmaceutical composition is provided in a sterile container (e.g., a vial) or package, for example, an ampoule or a sealed vial.
(119) In another embodiment, the methods, pharmaceutical compositions, uses, and kits, described herein include the following examples. The examples further illustrate additional features of the various embodiments of the invention described herein. However, it is to be understood that the examples are illustrative and are not to be construed as limiting other embodiments of the invention described herein. In addition, it is appreciated that other variations of the examples are included in the various embodiments of the invention described herein.
EXAMPLE 1
Transgenic Mice
(120) All procedures were performed in accordance with the NIH Guidelines on the care and use of vertebrate animals and approved by the Institutional Animal Care and Use Committee of the Research Institute at Nationwide Children's Hospital. Animals were housed under light:dark (12:12 h) cycle and provided with food and water ad libitum. Transgenic female B6SJ/L(SOD1-G93A)1Gur/J mice and non-transgenic littermates (Jackson Laboratories) were utilized for time course immunoblot studies and primary cell isolations. Transgenic male B6SJ/L(SOD1-G93A)1Gur/J mice were used for breeding with other transgenic lines. SOD1 transgene copy number was confirmed by real time PCR. SOD1-G93A-NFκBEGFP reporter mice were generated by breeding SOD1-G93A mice to C57BL/6 NFκBEGFP mice (Christian Jobin) (Magness et al., 2004). SOD1-G93A; hGFAP-cre; IKKβflox/flox were generated by breeding SOD1-G93A mice to FVB hGFAP-cre (Jackson Labs) mice that had been crossed to C57B116 IKKβflox/flox mice (Li et al., 2003). SOD1-G93A; CSF-1R-icre; IKKβflox/wt were generated by breeding SOD1-G93A mice to C57BL/6 CSF-1R-cre mice (Deng et al., 2010) that had been bred to IKKβflox/flox mice. CSF1R-cre; IKKβCA were generated by breeding CSF-1R cre mice to C57BL/6 Rosa26-StopFloxIKKβCA mice (Jackson Labs). Cre specificity was confirmed by crossing cre lines to C57BL/6 Rosa26-StopFlox-CAG-tdTomato mice and assessed for tdTomato expression by immunohistochemistry. See
(121) TABLE-US-00001 TABLE 1 Genotyping Qualitative PCR PCR Forward Primer (5′-3′) Reverse Primer (5′-3′) human SOD1 CAT CAG CCC TAA TCC ATC CGC GAC TAA CAA TCA AAG TGA TGA Control for SOD1 CTA GGC CAC AGA ATT GAA GTA GGT GGA AAT TCT AGC reaction AGA TCT ATC ATC C IKKβ GTC ATT TCC ACA GCC CTG CCT TGT CCT ATA GAA GCA TGA CAA iCre CAGGGCCTTCTCCACACCAGC CTGGCTGTGAAGACCATC Cre GGACATGTTCAGGGATCGCCAGG CGACGATGAAAGCATGTTTAGCT CG G eGFP GAG CTG AAG GGC ATC GAC GGA CTG GGT GCT CAG GTA TTC AAG GTG G negative for eGFP TCAGGCCCACCTAGTCAGAT AAAGCGGTCTGAGGAGGAA tdTomato CTG TTC CTG TAC GGC ATG GGC ATT AAA GCA GCG TAT G CC negative for tdTomato AAG GGA GCT GCA GTG GAG CCG AAA ATC TGT GGG AAG TA TC Copy Number Real Time PCR Primer 5′ label Sequence 5′ −> 3′ 3′ Label Transgenic Probe 6-FAM CTG CAT CTG GTT CTT Zen probe with Iowa GCA AAA CAC CA Black Internal Positive — CAC GTG GGC TCC AGC — Control Forward ATT Internal Positive — TCA CCA TTC ATT TCT — Control Reverse GCC TTT G hSOD1 Forward — GGG AAG CTG TTG TCC — CAA G hSOD1 Reverse — CAA GGG GAG GTA AAA — GAG AGC Internal Control Cy5 CCA ATG GTC GGG CAC Black Hole Quencher 2 Probe TGC TCA A
EXAMPLE 2
AAV9-DNiκBα Injections
(122) Adult tail vein injections were performed on 60 day old SOD1-G93A mice as previously described (Foust et al., 2009; 2010) with a 100 μl viral solution containing a mixture of PBS and 4×10.sup.12 DNase-resistant particles of scAAV9-CB-DNiκBα or scAAV9-CB-GFP (Virapur).
EXAMPLE 3
Disease Scoring and Behavior Analysis
(123) Mice were classified as “pre-symtomatic” when they displayed no clinical symptoms of disease and had not reached peak weight. “Onset” was determined at the stage mice reach peak body weight. The “symptomatic” stage was determined when mice had lost 10 percent of their body weight and displayed motor impairment tremors or impaired hindlimb splay reflex. The “late-symptomatic” stage was determined when mice experienced pronounced hindlimb paralysis, but could reach food and water using forelimbs. “End-stage” was determined when animals could no longer “right” themselves within 30 seconds after the animal was placed on its back.
(124) Testing of motor function using a rotarod device (Columbus Instruments, Columbus, OH) began at 50 days of age. Each session consisted of three trials that were averaged on the elevated accelerating rotarod beginning at 5 r.p.m./minute measuring the time the mouse was able to remain on the rod. Grip strength measurements for hindlimb were tested weekly using a grip strength meter (Columbus Instruments). Each session consisted of three tests per animal and values were averaged.
EXAMPLE 4
Isolation and Culture of Adult Primary Astrocytes
(125) Adult astrocyte cultures from brains of SOD1-G93A and wild-type littermates were prepared and purified as previously described (Noble and Mayer-Proschel, 1998) with minor modifications. Enzymatically dissociated cells were cultured for 2 to 3 weeks, and then shaken overnight when the cells reached confluency. Adhered confluent astrocytes were treated with cytosine arabinose (20 μM) for 48 hours to kill rapidly dividing cells. Astrocytes were cultured in DMEM GlutaMAX™ DMEM+10% FBS+N2+antibiotic-antimycotic (all from Life Technologies).
EXAMPLE 5
Isolation and Culture of Adult Primary Microglia
(126) Adult microglia were isolated from brains of SOD1-G93A and wild-type littermates as previously described (Moussaud and Draheim, 2010) with minor modifications. Four-month old SOD1-G93A and wild-type littermate mice were deeply anesthetized and perfused transcardially with ice-cold Ringers solution (Fisher Scientific). Brains that appeared to not be fully exsanguinated were discarded. Brains were fragmented with a scalpel and incubated with an enzymatic solution containing papain for 60 minutes at 37° C., 5% CO2. The papain solution was quenched with 20% FBS in HBSS and centrifuged for 4 minutes at 200 g. The pellet was resuspended in 2 ml of 0.5 mg/ml DNase I (Worthington Biochemical) in HBSS and incubated for 5 min at room temperature. The brain tissue was gently disrupted with fire-polished Pasteur pipettes and then filtered through a 70 micron cell strainer (Fischer Scientific) and centrifuged at 200 g for 4 minutes. The resulting pellet was then resuspended in 20 ml of 20% isotonic Percoll (GE healthcare) in HBSS. 20 mL of pure HBSS was carefully laid on top the percoll layer and centrifugation was performed at 200 g for 20 min with slow acceleration and no brake. The interphase layer containing myelin and cell debris was discarded, and the pellet containing the mixed glial cell population was washed once with HBSS and suspended in Dulbecco's modified Eagle's/F12 medium with GlutaMAX™ (DMEM/F12) supplemented with 10% heat inactivated FBS, antibiotic-antimycotic (all from Life Technologies) and 5 ng/ml of carrier-free murine recombinant granulocyte and macrophage colony stimulating factor (GM-CSF) (R&D systems). The cell suspension from four mouse brains were plated on a 15 cm.sup.2 plate (Corning) coated with poly-1-lysine (Sigma) and maintained in culture at 37° C. in a 95% air/5% CO2. The medium was replaced every 3 days until the cells reached confluency (after approximately 2 weeks). After the glial layer becomes confluent, microglia form a non-adherent, floating cell layer that can be collected, replated, and cultured for an extended period of time. After collecting the floating layer, microglia were incubated for 3 days without GM-CSF before re-plating for co-culture with motor neurons. Collected microglia were characterized by immunocytochemistry and flow cytometry (antibodies are listed in Table 2). Direct isolation of microglia for western blot analysis was performed as previously described (Cardona et al., 2006; Henry et al., 2009).
(127) TABLE-US-00002 TABLE 2 Western blot Phospho-p65 1:500 Cell Signaling p65 1:500 Cell Signaling Beta-Actin 1:1000 Cell Signaling IKK-beta 1:125 Imgenex Immunohistochemistry GFP 1:400 Abcam Tomato Lectin 1:300 Vector Laboratories GFAP 1:500 Abcam Iba-1 1:400 Wako CD68 1:100 AbDserotec CD86 1:100 Millipore iNOS 1:100 Sigma IKK-gamma 1:100 Cell Signaling IKK-beta 1:100 Imgenex Immunocytochemistry CD11b 1:200 AbDserotec F4/80 1:100 AbDserotec NG2 1:200 Millipore ChAT 1:100 Millipore Iba-1 1:500 Wako GFAP 1:200 Abcam Flow Cytometry APC-CD11b 1:50 eBiosciences PE-CD45 1:25 eBiosciences 1:50 CD16/32 1:25 eBiosciences EMSA supershift and nuclear western blots p65 1:1000 Santa Cruz Biotechnology p50 1:1000 Santa Cruz Biotechnology c-Rel 1:1000 Santa Cruz Biotechnology Rel-B 1:1000 Santa Cruz Biotechnology IgG
EXAMPLE 6
Flow Cytometry of Microglia Cultures
(128) Flow cytometric analysis of microglial cell surface markers was performed by first blocking Fc receptors with anti-CD16/CD32 antibody (eBiosciences, CA). Next, cells were incubated with anti-CD11b APC, anti-CD45 FITC (eBiosciences). Expression of these surface receptors was determined by flow cytometry using a Becton-Dickinson LSR II Cytometer. Ten thousand events were collected and microglia incubated with isotype control were used as a negative control. Flow data were analyzed using FlowJo software (Tree Star, San Carlos, Calif.).
EXAMPLE 7
Motor Neuron Differentiation
(129) Mouse embryonic stem cells expressing GFP driven by the Hb9 promoter (HBG3 cells) were cultured on primary mouse embryonic fibroblasts (Millipore) and differentiated to motor neurons with the addition of 2 μM retinoic acid (Sigma) and 2 μM purmorphamine (Calbiochem). After 5 days of differentiation, the embryoid bodies were dissociated and sorted for GFP on a FACSVantage/DiVa sorter (Becton Dickinson).
EXAMPLE 8
Microglia/Motor Neuron Co-Culture
(130) Hb9-GFP+ motor neurons were plated in 96-well plates coated with laminin (5 μg/ml, Invitrogen) at a density of 6,000 cells per well. The day after microglia were plated on top of motor neurons at a density of 35,000 cells per well in motor neuron media (DMEM:F12 (Invitrogen), 5% horse serum, 2% N2 (Invitrogen), 2% B27 (Invitrogen)+GDNF (10 ng/ml, Invitrogen), BDNF (10 ng/ml, Invitrogen), CNTF (10 ng/ml, Invitrogen)). The co-culture plate was imaged each day by the IN Cell Analyzer 6000 (GE Healthcare). Images were processed and analyzed using IN Cell Developer Toolbox 1.9 and IN Cell Analyzer Workstation 3.7 software (GE Healthcare) to quantify number of surviving GFP+ motor neurons per well.
EXAMPLE 9
Virus Production
(131) Transgenic SOD1 expression in microglia was knocked down by lentiviral transduction expressing short interfering RNA sequences previously described (Haidet-Phillips et al., 2011; Miller et al., 2006). Lentivirus SOD1-shRNA and scramble-shRNA were produced by transient transfection into HEK293 cells using calcium phosphate, followed by supernatant viral purification by ultracentrifugation. Adenoviral vectors (Ad-RFP, Ad-cre, Ad-DNiκBα, and Ad-IκBα-SR) were purchased from Vector Biolabs. Microglia were infected with an MOI of 25 overnight, then washed with HBSS and incubated 3 days before co-culture with motor neurons.
EXAMPLE 10
Western Blot
(132) Cells and tissues were homogenized in Tissue Protein Extraction Reagent (Pierce) with EDTA, Complete protease inhibitor (Roche) and Phospho-STOP (Roche). The samples were run on NuPAGE Novex 4-12% Bis-Tris polyacrilamide gels and transferred to a PVDF membrane (Life Technologies). Blots were blocked in 5% milk powder, 0.5% BSA in PBS-Tween for 1 h, and then incubated for overnight at 4° C. with primary antibody. Bound primary antibody was detected by horseradish peroxidase conjugated secondary antibody followed by chemiluminescence (ECL Western Blot Substrate, Pierce). Antibodies are listed in Table 2.
EXAMPLE 11
Immunohistochemistry
(133) Animals were deeply anesthetized with a lethal dose of Xylazene/Ketamine and perfused transcardially with saline, then 4% paraformaldehyde. Spinal cords were sectioned 40 μm thick using a vibrating blade microtome (Leica microsystems). Sections were incubated for 2 h at room temperature in TBS+1% Triton-X+10% donkey serum. Samples were incubated for 72 h at 4° C. with primary antibodies, followed by 2 h incubation at RT with secondary antibodies. All images were captured on a Zeiss confocal microscope (Carl Zeiss Microscopy, Thornwood, NY, USA). Antibodies are listed in Table 2. For quantification of MNs and microglia, lumbar spinal cords were sectioned 40 μm thick from the end of thoracic level 14 to sacral level 1. For MN counts lumbar spinal cord sections were selected every 5.sup.th section from the first identifiable L1 section through L6 and sections were selected every 8.sup.th section for microglial quantification.
EXAMPLE 12
ELISAs
(134) TNFα Quantikine ELISA kit (R&D Systems) was used according to manufacturer instructions to quantify the TNFα concentration in co-culture medium. Nitric oxide levels in the co-culture medium were determined using the Total Nitric Oxide and Nitrate/Nitrite Parameter Kit (R&D Systems) according to manufacturer instructions. Co-culture medium was collected, centrifuged for 2 minutes at 200 g, and 50 μL of medium was added to each well for analysis. Phospho-p65 and Total p65 ELISA kits were used according to manufacturer instructions to quantify NF-κB activation in cell lysates (Cell Signaling). All conditions were tested in triplicate.
EXAMPLE 13
Statistical Analyses
(135) For all statistical tests Graph Pad Prism 6 software (La Jolla, Calif.) was used. Statistical analyses of mean differences between groups was performed by either Student's t-test or one-way ANOVA, followed by a Bonferroni post hoc analysis depending on the number of variables in each experiment. All p-values and n values are indicated in the Brief Description of the Drawings.
EXAMPLE 14
NF-κB Activation with Disease Progression in the SOD1-G93A Mouse
(136) In order to gain insight into NF-κB regulation in ALS, EMSA analysis was performed on whole spinal cord nuclear lysates from the SOD1-G93A mouse model. NF-κB DNA binding activity was found to be increased in end-stage ALS mice compared to wild-type littermates (
(137) In order to determine whether the increase in phospho-p65 levels observed at late-SYM stages is statistically different compared to the levels at ES, lumbar spinal cord lysates were analyzed from additional late-SYM (n=6) and ES SOD1-G93A mice (n=6). The experiments revealed that there is no statistical difference in NF-κB activation between late-SYM and ES (
EXAMPLE 15
NF-κB Inhibition in Astrocytes Does Not Confer Neuroprotection In Vitro or In Vivo
(138) To determine the relevance of NF-κB activation to astrocyte-mediated MN death in ALS, NF-κB inhibition was tested in an in vitro co-culture model of familial ALS. An embryonic stem cell line containing an Hb9-GFP reporter was utilized, which has been shown to recapitulate aspects of MN pathology and cell death when co-cultured with ALS glia (Di Giorgio et al., 2007; Haidet-Phillips et al., 2011; Nagai et al., 2007). Additionally, the Hb9-GFP reporter allows for purification of MNs by fluorescence activated cell sorting (FACS) and easy visualization of these MNs in co-culture with astroctyes (Wichterle et al., 2002). After 5 days in co-culture, the number of MNs present on SOD1-G93A astrocytes was statistically reduced by 49% compared to the MNs surviving on wild-type astrocytes (
(139) NF-κB inhibition was also tested in vivo using two independent, cell-type-specific approaches: viral-mediated gene delivery and transgenic cre-lox recombination. SOD1-G93A mice were injected with adeno-associated viral vector serotype 9 (AAV9) to deliver IκBαSR. Mice were injected at postnatal day 60 to preferentially target >50% astrocytes in the CNS (Foust et al., 2008; 2013). Overexpression of IκBα-SR in astrocytes utilizing AAV9 did not alter survival nor improve motor performance in the SOD1-G93A mice compared to non-injected controls (
(140) To transgenically inhibit NF-κB in astrocytes in SOD1-G93A mice, SOD1-G93A mice were mated to mice with conditional mutants of IKKβ (IKKβ.sup.f/f), which have exon 3 of the ikbkb (IKKβ) gene flanked by loxP sites (Li et al., 2003; Park et al., 2002). These mice were then crossed to a mouse strain expressing cre recombinase under the regulation of the astrocytic glial fibrillary acidic protein (GFAP) promoter, thus ablating IKKβ and downstream NF-κB activity specifically in astrocytes.
(141) Confirmation that cre expression was restricted to GFAP-expressing astrocytes in the spinal cord was completed by crossing GFAP-cre mice to a Rosa26 line that expresses tdTomato (RFP) in all cre-expressing cells (
EXAMPLE 16
NF-κB Activation Occurs Predominately in Microglia
(142) To evaluate whether astrocytes are the main or only cells contributing to the increase in lumbar NF-κB activation, SOD1-G93A mice were crossed to an NF-κB-GFP reporter mouse strain that expresses GFP under the control of NF-κB cis elements (Magness et al., 2004). Since robust NF-κB activation in SOD1-G93A was evident at late stages of disease in lumbar spinal cord protein, lumbar spinal cord sections were analyzed from late-symptomatic SOD1; NF-κB-GFP mice for GFP expression. A population of bright GFP+ cells was observed and was identified as microglia by overlapping Iba-1 staining (
EXAMPLE 17
Time Course of NF-κB Activation
(143) To determine the time course of NF-κB activation in microglia as disease progressed, immunohistochemistry was performed of SOD1; NF-κB-GFP lumbar spinal cord sections at pre-symptomatic, onset, symptomatic, late-symptomatic, and at end-stage. GFP+ cells were observed at disease onset with an increase in the number and GFP intensity as disease progressed. Furthermore, the majority of GFP+ cells co-localized with a marker for microglia (tomato lectin) suggesting NF-κB activation coincides with microglial activation and gliosis (
EXAMPLE 18
Adult SOD1-G93A Microglia are Toxic to Motor Neurons In Vitro
(144) To further study the mechanisms by which microglia mediate motor neuron death in ALS and the possible contribution of NF-κB activation in this process, an in vitro co-culture model of ALS was established. Elegant studies have demonstrated that mutant SOD1 microglia isolated from neonatal mice induce approximately an 18% decrease in motor neuron survival compared to wild-type microglia (Xiao et al., 2007). Since motor neuron toxicity in this model is modest, it is possible that these young cells were not recapitulating important aspects of the adult-onset neurodegenerative disease. Therefore, a co-culture utilizing primary adult microglia isolated from symptomatic ALS mice was established. A previously described method that combines density separation and culture selection was used (Moussaud and Draheim, 2010). Briefly, brains from SOD1-G93A mice and wild-type littermates were mechanically and enzymatically dissociated and subjected to a percoll gradient to obtain a mixed population of glial cells. Once the glial cells were plated and reached confluency, microglia detached from the plate, floated into the medium and could be collected. Immunocytochemical characterization of the adult microglia obtained by this method showed over 90% of the microglia obtained by this method are positive for Iba-1, CD11b, and F4/80 and negative for GFAP, ChAT, and NG2 (
(145) To determine the capacity for SOD1-G93A adult microglia to induce motor neuron death, WT Hb9::GFP+ motor neurons were co-cultured with WT or SOD1-G93A microglia. After 72 hours a 50% statistical decrease was observed in motor neurons when co-cultured with SOD1-G93A microglia compared to microglia isolated from WT littermates (
(146) To confirm that this motor neuron death was specific to the causative SOD1 mutation, an shRNA was expressed targeting the human SOD1 transgene in the SOD1-G93A microglia by lentivirus. ELISA results showed that the shRNA reduced mutant protein by 75% (
EXAMPLE 19
Adult SOD1-G93A Microglia Induce Motor Neuron Death in an NF-κB Dependent Mechanism In Vitro
(147) To examine whether NF-κB activation in microglia is involved in motor neuron death in the in vitro co-culture model of ALS, two independent approaches were employed to abolish NF-κB activation in microglia. First, DN-iκBα (also referred to as iκβα-SR) was overexpressed via adenovirus (Vector Biolabs, Philadelphia, Pa.) in SOD1-G93A and wild-type microglia. During initial studies using an adenovirus expressing RFP, an MOI of 25 resulted in highly efficient transduction of microglia. The sequence of DN-iκBα (SEQ ID NO: 2) is below.
(148) TABLE-US-00003 SEQ ID NO: 2 atgtttcagccggcgggccatggccaggattgggcgatggaaggcccgcg cgatggcctgaaaaaagaacgcctggtggatgatcgccatgatgcgggcc tggatgcgatgaaagatgaagaatatgaacagatggtgaaagaactgcgc gaaattcgcctgcagccgcaggaagcgccgctggcggcggaaccgtggaa acagcagctgaccgaagatggcgatagctttctgcatctggcgattattc atgaagaaaaaccgctgaccatggaagtgattggccaggtgaaaggcgat ctggcgtttctgaactttcagaacaacctgcagcagaccccgctgcatct ggcggtgattaccaaccagccgggcattgcggaagcgctgctgaaagcgg gctgcgatccggaactgcgcgattttcgcggcaacaccccgctgcatctg gcgtgcgaacagggctgcctggcgagcgtggcggtgctgacccagacctg caccccgcagcatctgcatagcgtgctgcaggcgaccaactataacggcc atacctgcctgcatctggcgagcattcatggctatctggcgattgtggaa catctggtgaccctgggcgcggatgtgaacgcgcaggaaccgtgcaacgg ccgcaccgcgctgcatctggcggtggatctgcagaacccggatctggtga gcctgctgctgaaatgcggcgcggatgtgaaccgcgtgacctatcagggc tatagcccgtatcagctgacctggggccgcccgagcacccgcattcagca gcagctgggccagctgaccctggaaaacctgcagatgctgccggaaagcg aagatgaagaaagctatgataccgaaagcgaatttaccgaagatgaactg ccgtatgatgattgcgtgtttggcggccagcgcctgaccctg
A genetic approach was also used by isolating microglia from SOD1-G93A; IKKβf/f mice and infecting the microglia in vitro with an adenovirus expressing cre recombinase to remove IKKβf/f in microglia post-isolation. After 12 hours, no difference was observed in motor neuron survival or axon length of the motor neurons co-cultured with SOD1-G93A microglia compared to WT controls (
(149) To examine the extent of NF-κB inhibition, nitric oxide (NO) and TNF-α levels were measured in the co-culture medium, both products of NF-κB activation and markers of pro-inflammatory microglia (Ghosh and Karin, 2002). TNF-α levels decreased by 45% and by 64% when NF-κB was inhibited in SOD1-G93A microglia using Ad-DN-iκBαand Ad-cre, respectively (
EXAMPLE 20
SOD1-G93A Microglia Induce Motor Neuron Death in an NF-κB Dependent Mechanism In Vivo
(150) Since it was established that (1) NF-κB activation during the disease course in SOD1-G93A mice occurs predominantly in microglia (
(151) Wild-type and SOD1 CSF-1R-cre+ mice homozygous for IKKβf/f displayed serious immune dysfunction such as enlarged spleens, eye infections, and missing or very brittle teeth which have been previously reported in mice with myeloid cells devoid of NF-κB (Ruocco et al., 2005; Vallabhapurapu and Karin, 2009). These mice could not be maintained in the colony long enough to evaluate survival, thus, mice heterozygous for the flox'ed IKKβ allele (IKKβF/wt) were analyzed. To determine the efficiency of IKKβ knockdown in heterozygous mice, immunohistochemistry was performed for IKKβ in lumbar spinal cord sections from SOD1-G93A; IKKβf/wt; CSF-1R-cre+ and cre− mice. SOD1-G93A; IKKβf/wt; CSF-1R-cre+ showed a decrease in IKKβ staining compared to cre negative controls (
(152) To determine the impact of NF-κB inhibition on astrogliosis and microgliosis, lumbar spinal cord sections were examined by immunohistochemistry for intensity of GFAP and Iba-1, respectively. No difference in gliosis could be detected between end-stage SOD1-G93A; IKKβf/wt; CSF-1R-cre+ and cre− mice. However, considering SOD1-G93A; IKKβf/wt; CSF-1R-cre+ have endured disease for an additional 3 weeks compared to controls, it is possible that differences in gliosis achieved earlier in disease are lost at end-stage. Indeed, the SOD1-G93A; IKKβf/wt; CSF-1R-cre+ mice were sacrificed at the same age as the cre− littermate control reached end-point, a significant decrease in Iba-1 (25%) and GFAP signal intensity (31%) was observed indicating microgliosis and astrogliosis are decreased in CSF-1R-cre+ mice compared to age-matched controls (
EXAMPLE 21
NF-κB Regulates SOD1-G93A Microglial Conversion to a Pro-Inflammatory, Neurotoxic Phenotype
(153) It was considered that the survival increase observed in SOD1-G93A; IKKβf/wt; CSF-1R-cre+ might be due to a dampened pro-inflammatory microglial response, so microglia were characterized for known markers of microglial activation such as CD68, iNOS, and CD86 (Kigerl et al., 2009). As disease progresses, it has been observed that SOD1-G93A mice exhibit a robust induction in CD68-positive microglia that is greatest at end-stage (data not shown) (Beers et al., 2011b). A marked reduction in the number of CD68 positive microglia in SOD1-G93A; IKKβf/wt; CSF-1R-cre+ mice compared to SOD1 cre-negative controls was observed (
EXAMPLE 22
NF-κB Activation Selectively in Microglia Induces Motor Neuron Death In Vitro
(154) It was considered that if NF-κB activation is the mechanism by which SOD1-G93A microglia induce motor neuron death, constitutively activating NF-κB in wild-type microglia would be sufficient to induce motor neuron death. Microglia were isolated from Rosa26-StopFloxIKKβCA mice containing inducible constitutively active IKKβ(IKKβCA) upon expression of cre recombinase. Post-isolation, microglia from these mice were infected with an adenovirus expressing cre recombinase (Ad-cre) to induce transcription of constitutively active IKKβ (microglia termed IKKβCA) or Ad-RFP as control (microglia termed WT). After 12 hours in co-culture with WT or IKKβCA microglia, no difference was observed in motor neuron axon length or survival (
EXAMPLE 23
NF-κB Regulates Microglial Activation to a Pro-inflammatory, Neurotoxic Phenotype
(155) Constitutively active IKKβ(IKKβCA) was selectively expressed in myeloid cells in vivo, to induce an inflammatory state in wild-type microglia similar to that observed in ALS mice. Mice expressing CSF-1R-cre were crossed to Rosa26-Stop.sup.FloxIKKβCA mice (termed IKKβCA). IKKβCA mice exhibited an 8.2 fold increase in phospho-p65 in lumbar spinal cord protein compared to cre-negative littermates (
(156) To determine whether microglia in IKKβCA mice express activation markers, similar to those described above for activated (M1) microglia from SOD1-G93A mice, microglia from the IKKβCA and cre-negative littermates were analyzed for expression of CD68, iNOS, and CD86. A striking upregulation of CD68 and CD86 was observed in microglia from 4 month and 8 month-old IKKβCA mice (
EXAMPLE 24
Reduction of Mutant SOD1 in Astrocytes in Combination with NF-κB Reduction in Microglia in SOD1-G93A Mice
(157) To evaluate the efficiency of reducing SOD1 in astrocytes in mice with suppressed NF-κB activation in microglia, SOD1; IKKβflox/wt; CSF1R-cre-positive and SOD1; IKKβflox/wt; CSF1R-cre-negative mice were injected intravenously with AAV9-SOD1-shRNA (shRNA sequence is SEQ ID NO: 1) at postnatal day 21. Along with the SOD1-shRNA, the AAV9 vector encodes green fluorescent protein (GFP) and allowed visualization of AAV9 transduction. Shown by immunohistochemistry, wide transduction of astrocytes in the lumbar spinal cord was observed. GFP co-localization with microglial marker Iba-1 was not observed, therefore it is unlikely microglia were transduced. By immunoblot analysis, mutant SOD1 levels were reduced by 60% in whole-lumbar spinal cord homogenate. Similarly, SOD1; IKKβflox/wt; CSF1R-cre+ mice exhibited a 50% reduction in phospho-p65 and IKKβ demonstrating reduction in NF-κB signaling. The cell types predominantly targeted with NF-κB suppression and mutant SOD1 reduction are listed in Table 3. SOD1; IKKβflox/wt; CSF1R-cre− mice that were not injected with virus were the control group. Only microglia were targeted in SOD1; IKKβflox/wt; CSF1R-cre+ mice. Astrocytes were the predominant cell targeted in mice injected at p21 with AAV9-SOD1-shRNA. However about 10% of motor neurons were transduced in the spinal cord with the p21 intravascular injection. Both microglia and astrocytes were targeted in SOD1; IKKβflox/wt; CSF1R-cre+ mice injected at p21 with AAV9-SOD1-shRNA.
(158) Targeting both NF-κB activation in microglia and reducing SOD1 in astrocytes extended median survival to 168 days compared to 136 days in untreated, control mice (
(159) While there was no difference in mean mass between CSF1R-cre− p21 injected mice and CSF1R-cre+ p21 injected mice, animal mass was sustained with survival in the cre+ littermates (
(160) Disease progression was prolonged in SOD1-G93A; IKKβflox/wt; CSF1Rcre+ uninjected mice, CSF1R-cre− p21 injected mice and CSF1R-cre+ p21 injected mice (
(161) Motor performance measured by accelerating rotarod (
(162) TABLE-US-00004 TABLE 3 Cell types targeted in combinatorial approach. SOD1-G93A; IKKβ.sup.flox/wt AAV9 Cell types targeted CSF1R- SOD1-shRNA Motor cre injection Microglia Astrocytes Neurons − uninjected — — — + uninjected 100% — — − p21 — 60% 10% + p21 100% 60% 10% − p1 — 30% 60% + p1 100% 30% 60%
(163) SOD1-G93A; IKKβflox/flox; CSF1R-cre+ and SOD1-G93A; IKKβflox/flox; CSF1R-cre− mice were generated and separated into 3 groups: Uninjected, injected at p21, and injected at p1. Uninjected CSF1R-cre− mice were the untreated group without any cell being targeted. CSF1R-cre+ mice had NF-κB signaling reduced in 100% of microglia. CSF1R-cre−; p21 injected mice, had full NF-κB activity in microglia and had reduced SOD1 levels of astrocytes. CSF1R-cre+; p21 injected mice, had reduced microglial NF-κB signaling and reduced levels of SOD1 in astrocytes. CSF1R-cre−; p1 injected mice had full NF-κB signaling and reduced levels of SOD1 in motor neurons and some astrocytes. CSF1R-cre+; p1 injected mice had reduced NF-κB signaling in microglia and reduced levels of SOD1 in motor neurons and some astrocytes.
EXAMPLE 25
Electrophoretic Mobility Shift Assays (EMSA) and Nuclear Western Blot
(164) EMSA and supershift analyses were performed on whole spinal cord nuclear lysates as previously described (Dahlman & Guttridge, 2012). Nuclear westerns were performed using the same nuclear lysates as used for the EMSAs. The antibodies against p65, p60, c-Rel, and RelB are listed in Table 2.