MRNA TARGETING MOLECULE COMPRISING N-ACETYLGALACTOSAMINE BINDING POLYPEPTIDE AND PREPARATION METHOD THEREFOR
20220265859 · 2022-08-25
Inventors
Cpc classification
A61K47/65
HUMAN NECESSITIES
A61K48/0058
HUMAN NECESSITIES
A61K47/549
HUMAN NECESSITIES
C12N15/87
CHEMISTRY; METALLURGY
A61K47/64
HUMAN NECESSITIES
International classification
A61K48/00
HUMAN NECESSITIES
A61K47/64
HUMAN NECESSITIES
A61K47/65
HUMAN NECESSITIES
A61P1/16
HUMAN NECESSITIES
Abstract
Disclosed herein are an mRNA targeting molecule comprising an N-acetylgalactosamine binding polypeptide and a preparation method therefor. A plasmid vector containing a DNA fragment formed by sequentially connecting a promoter, a target gene, a specific protease cleavage sequence, and a polynulcleotide sequence encoding a GBD capable of binding to N-acetylgalactosamine, is transcribed to obtain an mRNA, which is connected to a DNA-puromycin linker under the action of a T4 ligase. The resulting connection product is subjected to protein translation, followed by cleavage using a specific protease to obtain an mRNA-puromycin-GBD complex, which then binds to a GBD protein sequence under the action of an N-acetylgalactosamine transferase to form an mRNA-puromycin-GBD-GalNAc complex, thereby modifying the mRNA with GalNAc, thus achieving the purpose of precise administration in a process of mRNA drug delivery and increasing the efficacy of the mRNA drug molecule.
Claims
1.-16. (canceled)
17. A DNA fragment, the DNA fragment comprising a target sequence and a polynulcleotide sequence encoding a N-acetylgalactosamine (GalNAc) binding domain (GBD) capable of binding to GalNAc.
18. The DNA fragment of claim 17, wherein the GBD comprises one or more Serines, Threonines, or any combination thereof.
19. The DNA fragment of claim 18, wherein the one or more Serines, Threonines, or any combination thereof are separated by glycines.
20. The DNA fragment of claim 17, wherein the GBD comprises a sequence as set forth in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, or SEQ ID NO: 5.
21. The DNA fragment of claim 17, wherein the DNA fragment further comprises a second polynucleotide sequence encoding specific protease cleavage sequence, flanked by the target sequence and the first polynucleotide sequence.
22. The DNA fragment of claim 21, wherein the specific protease cleavage sequence comprises one or more of T2A, P2A, E2A, F2A, TEV, VLP1 or SUMO specific protease cleavage sequences.
23. The DNA fragment of claim 22, wherein the specific protease cleavage sequence comprises a sequence as set forth in SEQ ID NO: 9 or SEQ ID NO: 10.
24. The DNA fragment of claim 17, wherein the DNA fragment further comprises a promoter, and optionally wherein the promoter is T3, T7, or SP6.
25. The DNA fragment of claim 24, wherein the promoter comprises a sequence as set forth in SEQ ID NO: 11.
26. The DNA fragment of claim 17, wherein the DNA fragment is expressed in a pCDNA3.1 plasmid vector.
27. A polynucleotide-puromycin molecule, wherein the polynucleotide-puromycin molecule comprises a transcription product of the DNA fragment of claim 17, subsequently with a DNA-puromycin linker and a puromycin.
28. The polynucleotide-puromycin molecule of claim 27, wherein the transcription production product comprises a 5′ cap, a transcription product of the target gene sequence, a transcription product of the specific protease cleavage sequence, and a transcription product of the GBD.
29. The polynucleotide-puromycin molecule of claim 27, wherein the DNA-puromycin linker comprises a sequence as set forth in SEQ ID NO. 8.
30. A polynucleotide-polypeptide molecule, wherein the polynucleotide-polypeptide molecule comprises a transcription product of the DNA fragment of claim 17 subsequently with a DNA-puromycin linker, a puromycin, and a translation product of the DNA fragment of claim 17 in a reverse order.
31. The polynucleotide-polypeptide molecule of claim 30, wherein the polynucleotide-polypeptide molecule comprises a 5′ cap, a transcription product of the target gene sequence, a transcription product of the specific protease cleavage sequence, a transcription product of the GBD, the DNA-puromycin linker, the puromycin, the GBD, the specific protease cleavage sequence, and the translation product of the target gene sequence.
32. A polynucleotide-polypeptide molecule, wherein the polynucleotide-polypeptide molecule comprises a transcription product of the DNA fragment of claim 17, subsequently with a DNA-puromycin linker, a puromycin, and the GBD.
33. The polynucleotide-polypeptide molecule of claim 32, wherein polynucleotide-polypeptide molecule comprises a 5′ cap, a transcription product of the target gene sequence, a transcription product of the specific protease cleavage sequence, a transcription product of the GBD, the DNA-puromycin linker, the puromycin, and the GBD.
34. A molecule with N-acetylgalactosamine (GalNAc), the molecule comprising a transcription product of the DNA fragment of claim 17, subsequently with a DNA-puromycin linker, a puromycin, and the GBD, wherein one or more GalNAcs bind to the GBD.
35. The molecule with GalNAc of claim 34, wherein polynucleotide-polypeptide molecule comprises a 5′ cap, a transcription product of the target gene sequence, a transcription product of the specific protease cleavage sequence, a transcription product of the GBD, the DNA-puromycin linker, the puromycin, and the GBD, wherein one or more GalNAcs bind to the GBD.
36. The molecule with GalNAc of claim 34, wherein the GBD comprises one Serines or Threonines, and wherein one GalNAc conjugates with the GBD.
37. The molecule with GalNAc of claim 34, wherein the GBD comprises two Serines, two Threonines or one Serine and one Threonine, and wherein two GalNacs conjugate with the GBD.
38. The molecule with GalNAc of claim 34, wherein the GBD comprises three Serines, three Threonines or Serine and Threonine in total of three, and wherein three GalNacs conjugate with the GBD.
39. A method of preparing a molecule, the method comprising a. Obtaining the DNA fragment of claim 21; b. In vitro transcribing the DNA fragment of claim 21, thereby obtaining a transcription product of the DNA fragment of claim 21; c. Ligating a puromycin to the transcription product from step b, thereby obtaining a polynucleotide-puromycin molecule; and d. In vitro translating the polynucleotide-puromycin molecule from step c.
40. The method of claim 39, wherein the method further comprises cleaving the product obtained in step d.
41. The method of claim 39, wherein the method further comprises conjugating one or more GalNAcs.
42. The method of claim 41, wherein the conjugating is catalyzed by a N-acetylgalactosamine transferase.
43. A kit, the kit comprising the DNA fragment of claim 21.
44. The kit of claim 43, wherein the kit further comprises one or more reagents: a T4 ligase, reagents for in-vitro transcription, reagents for in-vitro translation, a protease that recognizes the specific protease cleavage sequence, a N-acetylgalactosamine transferase, or one or more GalNacs.
45. A method of delivering a target gene sequence to a target cell, the method comprising applying the molecule with GalNAc of claim 34 to the target cell, and wherein the target cell expresses a ligand of GalNAc.
46. The method of claim 45, wherein the target cell is a liver cell.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0030]
[0031]
[0032]
[0033]
[0034]
DETAILED DESCRIPTION OF THE INVENTION
[0035] In order to better understand the present invention, the specific embodiments of the present invention will be further described in detail below in conjunction with the accompanying drawings.
[0036] A DNA fragment for constructing an mRNA targeting molecule comprising an N-acetylgalactosamine binding polypeptide, the DNA fragment comprises a promoter, a target gene, a specific protease cleavage sequence, and a polynulcleotide sequence encoding a GBD capable of binding to N-acetylgalactosamine, that are sequentially connected.
[0037] Further, the GBD sequence is one or a combination of more than one of SEQ ID NOs.1-5.
[0038] The target gene sequence is set forth in SEQ ID NO. 6 or 7.
[0039] The specific protease cleavage sequence is one or more of T2A, P2A, E2A, F2A, TEV, VLP1 and SUMO specific protease cleavage sequences with the GBD sequence.
[0040] The promoter is T3, T7 or SP6 promoter.
[0041] Based on the DNA fragment constructed above, the present invention discloses an mRNA targeting molecule comprising an N-acetylgalactosamine binding polypeptide, which comprises an mRNA molecule obtained by in vitro transcription using a plasmid containing the above DNA fragment. The sequence of the mRNA molecule sequentially comprises a 5′ cap, a target gene sequence, a specific protease cleavage sequence and a polypeptide GBD protein; the polypeptide GBD protein is obtained by ribosomal translation of the GBD sequence; and the GBD sequence end of the mRNA molecule is connected to the GBD protein through puromycin, and the GBD protein is connected to N-acetylgalactosamine through an enzymatic reaction.
[0042] The mRNA tissue-specific delivery material targeting N-acetylgalactosamine is prepared by the following steps:
[0043] step S1, as shown in
[0044] step S2, performing in vitro transcription using the plasmid DNA of step S1 as a template, an mRNA sequence generated by the in vitro transcription comprising a 5′ cap, a target gene sequence, and a specific protease cleavage sequence with a GBD sequence; and
[0045] the specific protease cleavage sequence is one or more of T2A, P2A, E2A, F2A, TEV, VLP1 and SUMO;
[0046] step S3, under the action of T4 ligase, binding the mRNA molecule to a DNA-puromycin linker to form an mRNA-puromycin complex;
[0047] step S4, in vitro translating the mRNA-puromycin complex obtained in step S3, wherein the mRNA-puromycin complex is translated by a ribosome into a fusion protein sequence of gene function protein-specific protease cleavage sequence-GBD;
[0048] step S5, at the end of translation, connecting the puromycin to the tail of the antibody through the A-site of the ribosome to form an mRNA-puromycin-GBD-specific protease cleavage sequence-gene function protein complex;
[0049] step S6, cleaving the product obtained in step S5 by a specific protease, wherein under the action of 2A peptide self-cleavage or TEV, VLP1, and SUMO specific proteases, the part of the specific protease cleavage sequence-gene function protein in the mRNA-puromycin-GBD-specific protease cleavage sequence-gene function protein complex is cleaved to obtain an mRNA-puromycin-GBD complex; and
[0050] step S7, under the action of N-acetylgalactosamine transferase, specifically binding N-acetylgalactosamine to the GBD protein sequence to form an mRNA-puromycin-GBD-GalNAc complex.
[0051] Wherein, the sequence of the DNA-puromycin linker is set forth in SEQ ID NO. 8; and the GBD sequence is set forth in SEQ ID NOs. 1-5.
[0052] Further, in step S1, the plasmid vector is modified from pCDNA3.1.
[0053] In the preparation of an mRNA drug for specific drug delivery using the mRNA targeting molecule comprising an N-acetylgalactosamine binding polypeptide described above, a GalNAc-mediated mRNA liver cell delivery system is formed. In this system, N-acetylgalactosamine is connected to the 3′ end, and by specifically binding to the asialoglycoprotein receptor on a surface of liver cells through the N-acetylgalactosamine, endocytosis is induced, which allows an mRNA to enter the cell for expression, as shown in
[0054] There are multiple design schemes for the GBD in the GBD-GalNAc sequence based on different designs. According to the needs, a GBD bond with only one GalNAc, a GBD bond with two GalNAcs, a GBD bond with three GalNAcs or a GBD bond with n GalNAcs can be generated. Further preferably, the use of the triple GalNAc-mRNA conjugate has the highest transfection efficiency for liver cells, and the comparison results are shown in
[0055] Specific operation procedures:
[0056] Cell Transfection
[0057] About 24 hours after seeding 293T cells (purchased from the Cell Bank of the Chinese Academy of Sciences), the status of the cells in a 6-well plate was observed, until the confluence reached 88%-92%. In the biological safety cabinet, 90% (volume percentage) DMEM+10% (volume percentage) FBS medium was prepared. 30 minutes before transfection, the medium in the plate was discarded, and 1 mL of fresh medium, that is, 90% (volume percentage) DMEM+10% (volume percentage) FBS medium was added to each well.
[0058] Preparation of the transfection system: 200 μL opti-MEM was taken, and 10 μg of the test product (including mRNA-GalNAc1, mRNA-GalNAc2, mRNA-GalNAc3, mRNA/lipo2000, mRNA/lipo3000, mRNA/LNP, mRNA/TransIT, mRNA/lipo RNAiMAX, and mRNA/In vivo-jetPEI, at a concentration of 2 μg/μL, 5 μL) or a negative control of vector-free GFP-mRNA was added. The prepared transfection system was directly and evenly added dropwise into the cultured cells, followed by shaking well on all sides to make the transfection system evenly distributed on the cells. The medium was changed 6 hours after transfection, the old medium was aspirated, and each well was replaced with 2 mL of fresh medium (90% DMEM+10% FBS). The fluorescence intensity was measured under a fluorescence microscope 36 hours after transfection. The experimental results are shown in
[0059] The present invention will be further exemplified below through specific examples, and the examples are only used to explain the present invention, instead of limiting the scope of the present invention.
Example 1
[0060] Provided herein is an mRNA targeting molecule comprising an N-acetylgalactosamine binding polypeptide, which is a novel mRNA drug capable of specific binding to liver cells. Wherein, the GalNAc modification of the mRNA molecule was bound to the GBD protein sequence of the mRNA-puromycin-GBD molecule by an N-acetylgalactosamine transferase, to form an mRNA-puromycin-GBD-GalNAc molecule. Puromycin was connected to the GBD polypeptide sequence; the mRNA molecule was obtained by in vitro transcription using a plasmid containing the above DNA fragment, the sequence of the mRNA molecule sequentially comprised a 5′ cap, a target gene sequence, a specific protease cleavage sequence, and a polynulcleotide sequence encoding a GBD capable of binding to N-acetylgalactosamine, and the GBD polypeptide was obtained by ribosomal translation of the GBD sequence. The mRNA targeting molecule was prepared by the following steps:
[0061] step S1, on the basis that the liver cell was the tissue to which the mRNA is delivered, selecting the green fluorescent protein mWasabi as the target gene, and designing a fragment of polypeptide sequence (GBD) capable of binding to N-acetylgalactosamine (GalNAc). The combination of the promoter sequence, the target gene sequence, the specific protease cleavage sequence, and the GBD sequence was cloned into the pCDNA3.1 plasmid vector to obtain the plasmid DNA.
[0062] In this example, the GBD sequence was one or a combination of more than one of SEQ ID NOs. 1-5.
TABLE-US-00003 SEQ ID No. 1 GGCGGCGGCGGCAGCGGCGGCGGCGGCAGCGGCGGCGGCGGCAGC SEQ ID No. 2 GGCGGCGGCAGCGGCGGCGGCAGCGGCGGCGGCAGC SEQ ID No. 3 GGCGGCAGCGGCGGCAGCGGCGGCAGC SEQ ID No. 4 GGCAGCGGCAGCGGCAGC SEQ ID No. 5 AGCAGCAGC
[0063] In this example, the GBD as set forth in SEQ ID No. 2 was used.
[0064] The target gene sequence was set forth in SEQ ID NO. 6.
TABLE-US-00004 SEQ ID No. 6 GTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATC CTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTG TCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTG AAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCC TCGTGACCACCCTGACCTACGGCGTGCAGTGCTTCAGCCGCTACCC CGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAA GGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACT ACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGA ACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACA TCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTA TATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCAAG ATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACT ACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCG ACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCA ACGAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGC CGGGATCACTCTCGGCATGGACGAGCTGTACAAGAAGCTTAGCCAT GGCTTCCCGCCGGCGGTGGCGGCGCAGGATGATGGCACGCTGCCCA TGTCTTGTGCCCAGGAGAGCGGGATGGACCGTCACCCTGCAGCCTG TGCTTCTGCTAGGATCAATGTG
[0065] The specific protease cleavage sequence was one or more of T2A, P2A, E2A, F2A, TEV, VLP1 and SUMO specific protease cleavage sequences with a GBD sequence. In this example, the specific protease cleavage sequence used was Glu-Asn-Leu-Tyr-Phe-Gln-(Gly/Ser), as set forth in SEQ ID No. 9 and SEQ ID No. 10.
[0066] The promoter was T3, T7 or SP6 promoter. In this example, the T7 promoter was used, and the sequence was set forth in SEQ ID No. 11:
TABLE-US-00005 SEQ ID No. 11: TAATACGACTCACTATAGG
[0067] The DNA sequence of the DNA-puromycin linker was set forth in SEQ ID No. 8;
TABLE-US-00006 SEQ ID No. 8: AAAAAAAAAAAAAAAAAAAAAAAAAAACC
[0068] step S2, performing in vitro transcription using the plasmid DNA of step S1 as a template, an mRNA sequence generated by the in vitro transcription comprising a 5′ cap, a gene sequence, and one or more sequences of T2A, P2A, E2A, F2A, TEV, VLP1 and SUMO specific protease cleavage sequences with a GBD sequence.
[0069] step S3, under the action of T4 ligase, binding the mRNA molecule to the DNA-puromycin linker to form an mRNA-puromycin complex;
[0070] step S4, in vitro translating the mRNA-puromycin complex obtained in step S3, wherein the mRNA-puromycin complex was translated by a ribosome into a fusion protein sequence of gene function protein-specific protease cleavage polypeptide sequence-GBD polypeptide;
[0071] step S5, at the end of translation, connecting the puromycin to the tail of the antibody through the A-site of the ribosome to form an mRNA-puromycin-GBD-specific protease cleavage sequence-gene function protein complex;
[0072] step S6, cleaving the product obtained in step S5 by a specific protease, wherein under the action of 2A peptide self-cleavage or TEV, VLP1, and SUMO specific proteases, the part of the specific protease cleavage sequence-gene function protein in the mRNA-puromycin-GBD-specific protease cleavage sequence-gene function protein complex was cleaved to obtain an mRNA-puromycin-GBD polypeptide complex; and
[0073] step S7, under the action of N-acetylgalactosamine transferase, specifically binding the N-acetylgalactosamine to the GBD protein sequence to form an mRNA-puromycin-GBD-GalNAc complex.
[0074] The mRNA-puromycin-GBD-GalNAc complex can be used to specifically bind to the ASGPR receptor on a surface of liver cells to achieve specific liver delivery of an mRNA.
[0075] The above mRNA targeting molecule comprising an N-acetylgalactosamine binding polypeptide was used to prepare an mRNA drug for specific drug delivery. Accordingly, a GalNAc-mediated mRNA liver cell delivery system was formed, with its 3′ end connected to N-acetylgalactosamine. By specifically binding to the asialoglycoprotein receptor on a surface of liver cells through the N-acetylgalactosamine, endocytosis is induced, which allows an mRNA to enter the cell for expression. Comparative experiments showed that, as shown in
[0076] Specific operation procedures:
[0077] Cell Transfection
[0078] About 24 hours after seeding 293T cells (purchased from the Cell Bank of the Chinese Academy of Sciences), the status of the cells in a 6-well plate was observed, until the confluence reached 88%-92%. In the biological safety cabinet, 90% (volume percentage) DMEM+10% (volume percentage) FBS medium was prepared. 30 minutes before transfection, the medium in the plate was discarded, and 1 mL of fresh medium, that is, 90% (volume percentage) DMEM+10% (volume percentage) FBS medium was added to each well.
[0079] Preparation of the transfection system: 200 μL opti-MEM was taken, and 10 μg of the test product (GFP mRNA-GalNAc and GFP mRNA/LNP, at a concentration of 2 μg/μL, 5 μL) or a negative control of vector-free GFP-mRNA (at a concentration of 2 μg/μL, 5 μL) was added. The prepared transfection system was directly and evenly added dropwise into the cultured cells, followed by shaking well on all sides to make the transfection system evenly distributed on the cells. The medium was changed 6 hours after transfection, the old medium was aspirated, and each well was replaced with 2 mL of fresh medium (90% DMEM+10% FBS). The fluorescence intensity was measured under a fluorescence microscope 36 hours after transfection. The experimental results were shown in
Example 2
[0080] Provided herein is an mRNA targeting molecule comprising an N-acetylgalactosamine binding polypeptide, which was prepared by the following steps:
[0081] step S1, on the basis that the liver cell was the tissue to which the mRNA is delivered, selecting the luciferase (Luc) as the target gene, and designing a fragment of polypeptide sequence (GBD) capable of binding to N-acetylgalactosamine (GalNAc), and cloning a combination of the relevant cloning elements into the pCDNA3.1 plasmid vector, wherein, the DNA fragment in the plasmid DNA included a promoter, a target gene, a specific protease cleavage sequence, and a polynulcleotide sequence encoding a GBD capable of binding to N-acetylgalactosamine, that were sequentially connected.
[0082] In this example, the GBD as set forth in SEQ ID No. 2 was used as the GBD sequence.
[0083] The target gene sequence was set forth in SEQ ID NO. 7.
TABLE-US-00007 SEQ ID No. 7 GTGAGCAAGGGCGAGGAGACCACAATGGGCGTAATCAAGCCC GACATGAAGATCAAGCTGAAGATGGAGGGCAACGTGAATGGCCAC GCCTTCGTGATCGAGGGCGAGGGCGAGGGCAAGCCCTACGACGGC ACCAACACCATCAACCTGGAGGTGAAGGAGGGAGCCCCCCTGCCC TTCTCCTACGACATTCTGACCACCGCGTTCAGTTACGGCAACAGGG CCTTCACCAAGTACCCCGACGACATCCCCAACTACTTCAAGCAGTC CTTCCCCGAGGGCTACTCTTGGGAGCGCACCATGACCTTCGAGGAC AAGGGCATCGTGAAGGTGAAGTCCGACATCTCCATGGAGGAGGAC TCCTTCATCTACGAGATACACCTCAAGGGCGAGAACTTCCCCCCCA ACGGCCCCGTGATGCAGAAGGAGACCACCGGCTGGGACGCCTCCA CCGAGAGGATGTACGTGCGCGACGGCGTGCTGAAGGGCGACGTCA AGATGAAGCTGCTGCTGGAGGGCGGCGGCCACCACCGCGTTGACT TCAAGACCATCTACAGGGCCAAGAAGGCGGTGAAGCTGCCCGACTA TCACTTTGTGGACCACCGCATCGAGATCCTGAACCACGACAAGGAC TACAACAAGGTGACCGTTTACGAGATCGCCGTGGCCCGCAACTCCA CCGACGGCATGGACGAGCTGTACAAG
[0084] In this example, the specific protease cleavage sequence used was Glu-Asn-Leu-Tyr-Phe-Gln-(Gly/Ser), as set forth in SEQ ID No. 9 and SEQ ID No. 10. The promoter was T3, T7 or SP6 promoter.
[0085] In this example, the T7 promoter was used, and the sequence was set forth in SEQ ID No. 11:
TABLE-US-00008 SEQ ID No. 11: TAATACGACTCACTATAGG
[0086] The DNA sequence in the DNA-puromycin linker was set forth in SEQ ID No. 8;
TABLE-US-00009 SEQ ID No. 8 AAAAAAAAAAAAAAAAAAAAAAAAAAACC
[0087] step S2, performing in vitro transcription using the plasmid DNA of step S1 as a template, an mRNA sequence generated by the in vitro transcription comprising a 5′ cap, a gene sequence, and one or more sequences of T2A, P2A, E2A, F2A, TEV, VLP1 and SUMO specific protease cleavage sequences with a GBD sequence.
[0088] step S3, under the action of T4 ligase, binding the mRNA molecule to the DNA-puromycin linker to form an mRNA-puromycin complex;
[0089] step S4, in vitro translating the mRNA-puromycin complex obtained in step S3, wherein the mRNA-puromycin complex was translated by a ribosome into a fusion protein sequence of gene functional protein-specific protease cleavage sequence-GBD.
[0090] step S5, at the end of translation, connecting the puromycin to the tail of the antibody through the A-site of the ribosome to form an mRNA-puromycin-GBD-specific protease cleavage sequence-gene function protein complex.
[0091] step S6, cleaving the product obtained in step S5 by a specific protease, wherein under the action of 2A peptide self-cleavage or TEV, VLP1, and SUMO specific proteases, the part of the specific protease cleavage sequence-gene function protein in the mRNA-puromycin-GBD-specific protease cleavage sequence-gene function protein complex was cleaved to obtain the mRNA-puromycin-GBD complex.
[0092] step S7, under the action of N-acetylgalactosamine transferase, specifically binding the N-acetylgalactosamine to the GBD protein sequence to form an mRNA-puromycin-GBD-GalNAc complex.
[0093] The above mRNA targeting molecule comprising an N-acetylgalactosamine binding polypeptide was used to prepare an mRNA drug for specific drug delivery. Accordingly, a GalNAc-mRNA delivery system was formed.
[0094] Specific operation procedures:
[0095] The luciferase modified Luc mRNA-GalNAc, Luc mRNA/LNP and Luc mRNA prepared in the above example were directly introduced into the systemic circulation of mice via tail vein administration, and the expression intensity of the modified mRNA in vivo was characterized via the in vivo biofluorescence signals.
[0096] Tail Vein Injection
[0097] Balb/c mice were fixed on the platform for tail vein injection, and 200 μg of the above three mRNA drugs (1 μg/m, 200 μL) were injected, respectively. Fluorescence imaging observation was performed 24 hours later.
[0098] Small Animal Imaging
[0099] D-fluorescein substrate was dissolved in a physiological saline to obtain a solution at a concentration of 15 mg/mL, and 100 μL of the solution was injected into the mice through the tail vein. 10 minutes later, the IVIS small animal imaging system was used to quantitatively analyze the signal intensity in the lung.
[0100] Comparative experiments showed that, as shown in
[0101] The foregoing description is only the preferred embodiments of the present invention. It should be noted that for those of ordinary skill in the art, several improvements and embellishments can be made without departing from the principle of the present invention, and these improvements and embellishments are also deemed to be within the scope of protection of the present invention.