PHAGE INSENSITIVE STREPTOCOCCUS THERMOPHILUS
20170218468 · 2017-08-03
Inventors
- Roelof Hendrik Matthijs Kouwen (Echt, NL)
- Pim VAN HEE (Echt, NL)
- Douwe VAN SINDEREN (Carrigrohane, Cork, IE)
- Brian McDonnell (Cork, IE)
- Jennifer MAHONY (Cork, IE)
Cpc classification
A23C9/1238
HUMAN NECESSITIES
G16B30/00
PHYSICS
C12N15/01
CHEMISTRY; METALLURGY
A23C19/0323
HUMAN NECESSITIES
C12R2001/46
CHEMISTRY; METALLURGY
C12N1/04
CHEMISTRY; METALLURGY
International classification
A23C19/032
HUMAN NECESSITIES
A23C9/123
HUMAN NECESSITIES
C12N1/04
CHEMISTRY; METALLURGY
Abstract
Bacteriophage Insensitive Mutants (BIMs) of three Streptococcus thermophilus parent strains were generated and characterized for phage sensitivity, sedimentation rate, cell chain length, phage adsorption and CRISPR loci alterations. Several BIMs showed an altered sedimentation phenotype as well as an increase cell chain length, reduced phage sensitivity, reduced phage adsorption and 100% identity in three CRISPR loci. The results show that the derived BIMs have become phage-resistant through a mechanism other than CRISPR.
Claims
1. A method for the construction of a bacteriophage insensitive mutant of a microorganism parent strain suitable for food and feed fermentation comprising selecting one or more mutants which, compared to parent strain, has an increased sedimentation rate and/or an increased chain formation to provide the bacteriophage insensitive mutant.
2. A method according to claim 1, comprising: a. exposing the parent strain to a bacteriophage; b. optionally isolating single colonies of the bacteriophage insensitive mutant; c. selecting one or more bacteriophage insensitive mutants which, compared to parent strain suitable for food and feed fermentation, has: 1. an increased sedimentation rate and/or 2. an increased chain formation; and d. optionally isolating single colonies of the bacteriophage insensitive mutant.
3. Method according to claim 1, wherein the microorganism parent strain suitable for food and feed fermentation is a lactic acid bacterium, optionally a Streptococcus thermophilus optionally a bacteriophage sensitive Streptococcus thermophilus.
4. A method according to claim 3, wherein the one or more bacteriophage insensitive mutants which, compared to parent strain, has an increased sedimentation rate and/or an increased chain formation is further subjected to comparing CRISPR loci of the bacteriophage sensitive Streptococcus thermophilus parent strain with CRISPR loci of the bacteriophage insensitive mutant and selecting one or more bacteriophage insensitive mutants of which the CRISPR loci is identical to the CRISPR loci of the bacteriophage sensitive Streptococcus thermophilus parent strain.
5. A method according to claim 1, further comprising: e. culturing the one or more selected bacteriophage insensitive mutant in a culture medium, f. recovering the one or more bacteriophage insensitive mutant from the culture medium to provide a starter culture composition, and g. optionally, concentrating the one or more bacteriophage insensitive mutants or starter culture composition.
6. A method according to claim 1, further comprising adding a cryoprotectant to the one or more bacteriophage insensitive mutants.
7. A method according to claim 1, further comprising freeze drying or freezing the one or more bacteriophage insensitive mutants.
8. A bacteriophage insensitive mutant of a microorganism parent strain, obtainable by the method of claim 1, and wherein the bacteriophage insensitive mutant has an increased sedimentation rate and/or an increased chain formation compared to the microorganism parent strain.
9. A bacteriophage insensitive mutant according to claim 8, having a phage adsorption percentage of 60% or less, optionally 55% or less, optionally 50% or less compared to the phage adsorption of the parent strain.
10. A bacteriophage insensitive mutant according claim 8, having a reduced susceptibility to one or more phages comprising a nucleotide sequence selected from the group consisting of SEQ ID NO 1, SEQ ID NO 2, SEQ ID NO 3, SEQ ID NO 4 and SEQ ID NO 5.
11. A bacteriophage insensitive mutant according to claim 8, as deposited in deposit CBS136256, CBS136255 or CBS138555, or bacteriophage insensitive mutant derived from deposit CBS136256, CBS136255 or CBS138555.
12. Starter culture composition suitable for inoculation of a medium to be fermented on an industrial scale comprising a bacteriophage insensitive mutant according to claim 8.
13. Starter culture composition according to claim 12, wherein the starter culture composition is frozen, freeze dried, or in liquid form.
14. Container comprising a bacteriophage insensitive mutant according to claim 8, or a starter culture composition thereof.
15. Process for the production of a dairy product optionally a fermented milk product or cheese comprising adding a bacteriophage insensitive mutant of a bacteriophage sensitive Streptococcus thermophilus parent strain as defined in claim 8, or a starter culture composition thereof, to a medium to be fermented.
16. Use of the bacteriophage insensitive mutant of a bacteriophage sensitive Streptococcus thermophilus parent strain as defined in claim 8 in a process for the production of a dairy product, such as a fermented milk or cheese.
17. A starter culture composition according to claim 13 used in a process for the production of a dairy product, optionally a fermented milk or cheese.
Description
FIGURE LEGENDS
[0052]
[0053]
[0054]
[0055]
[0056]
[0057]
[0058]
[0059]
[0060]
MATERIALS AND METHODS
1. Bacterial Growth Conditions
[0061] Streptococcus thermophilus strains were routinely grown from 10% glycerol stocks, 20% Reconstituted Skimmed Milk (RSM) stocks or from single colonies overnight at 42° C. in M17 Broth (Oxoid, U.K.) supplemented with 0.5% lactose (LM17) or on plates using LM17 containing 10 g/L technical agar (Merck, Germany). In phage enumeration assays, adapted from D. Lillehaug, 1997 (Journal of applied microbiology 83, (1), 85-90—“An improved plaque assay for poor plaque-producing temperate lactococcal bacteriophages”), LM17 broth was supplemented with 0.25% glycine (Oxoid, U.K.), 10 mM CaCl.sub.2 (Oxoid, U.K.) and either 10 g/L (solid agar base) or 4 g/L (semi-solid overlay) technical agar. The semi-solid agar was sterilised by autoclaving at 121° C. for 15 minutes whereas the solid agar was boiled for 7 minutes in a microwave.
2. Isolation and Selection of (Bacterio)Phages
[0062] Whey samples from dairy plants producing fermented milk products were obtained and analysed for the presence of phages against S. thermophilus ST802, S. thermophilus ST23 and S. thermophilus 100-E using the spot assay described below under “(Bacterio)phage assays”. Single plaques were isolated by twice single plaque purification on semi-solid overlays. Phages were then propagated as follows: 10 ml LM17 broth was inoculated with 2 ml of an overnight grown culture of the host strain (S. thermophilus ST802, S. thermophilus ST23 or S. thermophilus 100-E) and allowed to grow for 1.5-2.0 hours. Then, a single plaque was added to the growing culture, mixed well and incubated at 42° C. for a further 2-4 hours or at 30° C. overnight. The lysed culture was centrifuged and the supernatant filtered (0.45 μm). The filtered supernatant was used as the phage stock for subsequent assays. Table 1 summarizes the phages that were obtained.
S. thermophilus ST802=DS67009 (CBS136256) was deposited on 2 Oct. 2013 with the Centraal Bureau for Schimmelcultures, Uppsalalaan 8, 3508 AD in Utrecht, The Netherlands.
S. thermophilus ST23=DS64987 (CBS136255) was deposited on 2 Oct. 2013 with the Centraal Bureau for Schimmelcultures, Uppsalalaan 8, 3508 AD in Utrecht, The Netherlands.
S. thermophilus 100-E=DS64990 (CBS138555) was deposited on 15 Jul. 2014 with the Centraal Bureau for Schimmelcultures, Uppsalalaan 8, 3508 AD in Utrecht, The Netherlands.
TABLE-US-00001 TABLE 1 A list of strains and phages used in this study. SEQ ID Parent strain Phage No. Source S. thermophilus ST802 φST802-D1B-L 1 DSM, The Netherlands S. thermophilus ST802 φST802-D3A-S 2 DSM, The Netherlands S. thermophilus ST802 φST802-D3A-L 3 DSM, The Netherlands S. thermophilus ST23 φST23-D1A-L — DSM, The Netherlands S. thermophilus ST23 φST23-D2A-L — DSM, The Netherlands S. thermophilus 100-E φ100-E-D1A-L 4 DSM, The Netherlands S. thermophilus 100-E φ100-E-D2A-L 5 DSM, The Netherlands
3. Generation of BIMs (Bacteriophage Insensitive Mutants)
[0063] Spontaneous BIMs of the parent strains mentioned in Table 1 were generated using one of two methods.
3.1 BIMs of Streptococcus thermophilus ST802
[0064] BIMs of S. thermophilus ST802 were isolated by one of two methods.
(1) BIMs against phage ST802-D1B-L were generated by adding 400 μl fresh overnight culture of S. thermophilus ST802 and 10 μl of neat phage lysate (phage ST802-D1B-L isolated from a single plaque; titre approx. 1×10.sup.8 pfu/ml) to 4 ml of soft LM17 agar, followed by spreading this suspension on solid agar. Colonies, representing potential BIMs, growing in the top layer were twice single colony purified and subjected to phage assays and CRISPR sequencing as described below. Two BIMs were thus obtained and characterized (see below): S. thermophilus BIMST802-D1B-L-3, S. thermophilus BIMST802-D1B-L-6.
(2) A third BIM of S. thermophilus ST802, namely BIMST802-D3AS/L-1A was isolated using a method as described below (to isolate S. thermophilus BIMST23-4) with the addition of 20 overnight passages in 10% RSM and a 1% lysate containing a mixture of phages φD3A-S and φD3A-L (titre approx. 1×10.sup.8 pfu/ml).
3.2 BIMs of Streptococcus thermophilus ST23
[0065] BIMs of S. thermophilus ST23 were isolated by inoculating 1 ml of 10% (w/v) RSM with 1% of an overnight culture of S. thermophilus ST23 and 1% of a particular phage lysate (phages ST23 D1A-L and D2A-L, each produced from a single plaque; titer approx. 1×10.sup.8 pfu/ml). The milk with the added culture and phage was then incubated at 42° C. overnight or until clotting was observed. Potential BIMs were selected on LM17 agar, twice single colony purified and subjected to phage assays and CRISPR sequencing as described below. BIMST23-D1A-L-4 was generated in this manner.
3.3 BIMs of Streptococcus thermophilus 100-E
[0066] BIMs of S. thermophilus 100-E against phage 100-E-D1A-L were isolated as described for BIMs BIMST802-D1B-L-3 and BIMST802-D1B-L-6 (section 3.1 (1) above). Two BIMs were selected for further characterization (see Example 3 below), and were designated BIM100-E-D1A-L-7 (CRISPR BIM) and BIM100-E-D1A-L-5 (non-CRISPR BIM).
4. (Bacterio)Phage Assays
[0067] Spot assays were performed by seeding the LM17 semi-solid agar overlay with 400 μl fresh overnight culture and applying 5-10 μl of phage lysate in a grid format, as described by Dupont et al. 2005 (Journal of Applied Microbiology 98, (4), 1001-1009. “Detection of lactococcal 936-species bacteriophages in whey by magnetic capture hybridization PCR targeting a variable region of receptor-binding protein genes). Plates were then allowed to dry and incubated anaerobically overnight at 42° C. A clear zone indicating lysis of the bacterial lawn by the applied phage was recorded as ‘+’, whereas absence of lysis was recorded as ‘−’.
[0068] For phage enumeration, plaque assays were performed by adding 500 μl culture and 10 μl of neat or appropriately diluted phage suspension/lysate to 4 ml soft agar, followed by plating on LM17 agar plates as described above with subsequent overnight incubation at 42° C. Efficiency of plaquing (EOP) was calculated by dividing the obtained titre of a given phage on the test strain by the titre of the same phage on the parent strain.
5. Sedimentation Assays
[0069] S. thermophilus strains were routinely grown from 10% glycerol stocks, 20% Reconstituted Skimmed Milk (RSM) stocks or from single colonies overnight at 42° C. in LM17 broth (as described in section 1 of the MATERIALS AND METHODS). The parent strains and BIMs were treated identically and after overnight incubation at 42° C., visual assessment of the cultures was performed to observe the growth characteristic of the cultures in broth. Only if the cultures were consistently observed to sediment to the base of the tube or along the wall of the tube was the phenotype considered relevant. In all cases, the parent strain was observed to sediment to a markedly reduced degree after overnight growth. In order to measure the increase in pellet weight (and hence relative amount of sedimentation), overnight cultures of each parent and derived BIM were prepared in LM17 as described above and the supernatant carefully removed. The remaining pellet was suspended in 250 μl sdH.sub.2O and transferred to a fresh Eppendorf tube. The mixture was then made up to a volume of 500 μl using sdH.sub.2O and transferred to a section of pre-weighed blotting paper. The paper was then dried at 75° C. for 15 minutes and weighed again, with the increase in dry weight of the blotting paper taken as the pellet weight for each sample. The increase in the weight of the pellet of each derived BIM relative to the parent was then calculated. In this and all cases, the unpaired student t-test was used to determine significant differences between the parent and derived BIMs datasets.
6. Adsorption Assays
[0070] Determination of phage adsorption to parent strains and BIMs was determined as adapted from Garvey et al. 1996 (Applied environmental microbiology 62, (2), 676-679 “The Lactococcal plasmid pNP40 encodes a third bacteriophage resistance mechanism, one which affects phage DNA penetration”): 10 ml LM17 broth was inoculated with the appropriate strain from an overnight culture and grown at 42° C. until the OD.sub.600 nm reached at least 0.5 but did not surpass 0.53. 700 μl of culture was transferred to a micro centrifuge tube and centrifuged at 2000 (for strains ST802 and ST23, and their derivatives) or 5000 (for strain 100-E and derivatives)×g for 10 minutes to pellet the cells. The cells were resuspended in 700 μl of ¼ strength Ringers solution (Merck, Germany) and an equal volume of the appropriate phage lysate at a titre of approximately 1×10.sup.5 pfu/ml was added to the tube or to 700 μl buffer control. The mixture was incubated at 42° C. for 12 minutes, centrifuged at 15,000×g for 3 minutes and 500 μl of residual phage was immediately removed. The phage preparations were stored at 4° C. until plaque assays were performed on the parent strain, as described above. Calculation of adsorption levels (as a percentage of total number of phages present) was performed as follows: ([Control phage titre−Free phage titre in supernatant]/Control phage titre)×100%.
7. Staining & Visualisation of Cells to Determine Chain Length
[0071] Morphological assessment and comparison of the parent strains and derived BIMs was performed via wet mount. A drop of fresh overnight culture was placed on a glass slide and a cover slip immediately placed on top of the sample. Each sample was then visualised under 100× magnification using a light microscope (Leica DM1000, Germany). Images were captured using a mounted Leica DFC290HD camera and processed using Leica Application Suite software. The percentage increase in chain length or cells per chain (CPC) of derived BIMs relative to the parent strains was calculated firstly by determining the average number of individual cells per chain in all samples by counting at least 25 chains. The average increase in length was then expressed as a percentage using the following formula: (CPC.sub.mutant−CPC.sub.parent)/CPC.sub.parent×100%).
8. PCR Screening & CRISPR Locus Sequencing
[0072] All BIMs generated were subjected to PCR profiling to confirm their relatedness to the parent strains from which they were derived. This was performed on single colonies of each parent strain and BIM using the ‘(GTG)5’ primer (Gevers D., Huys G. and Swing J., 2001, Applicability of rep-PCR fingerprinting for identification of Lactobacillus species FEMS Microb. Letters 205, 31-36 (see Table 2)). The PCR conditions were as follows: 95° C.×10 min, followed by 30 cycles of 95° C.×15 s, 40° C.×30 s and 72° C. for 8 min with a final extension step of 72° C. for 16 min.
[0073] BIMs generated were purified and the CRISPR loci amplified by PCR and sequenced to determine acquisitions or alterations to the spacer content of the BIMs. CRISPR-1, CRISPR-2 and CRISPR-3 repeat/spacer arrays for each strain were amplified individually using a single colony of the appropriate strain as template material for the PCR and primers described previously by Horvath et al. 2008 (Journal of Bacteriology 190 (4): 1401-1412 “Diversity, activity, and evolution of CRISPR loci in Streptococcus thermophilus.”)
[0074] The PCR conditions were as follows: 95° C.×10 min, followed by 30 cycles of 95° C.×15 s, 55° C.×15 s and 72° C. for either 2 min 45 s (CRISPR-1) or 1 min (CRISPR-2 and CRISPR-3) with a final extension step of 72° C. for 10 min.
[0075] The PCR generated products were visualised on a 1% agarose (Fisher Scientific, USA) gel and purified using a PCR purification spin kit (Genomed, Germany). Sequencing was performed by MWG Biotech (Eurofins, Germany), firstly using the primers used to amplify the loci, then internally using synthetic primers based on a unique spacer of each repeat/spacer array in order to complete the sequencing of the CRISPR loci, where required. CRISPRs were assembled using the Seqman program (DNAstar) and CRISPR arrays were visualised using the online CRISPR finder program (http://crispr.u-psud.fr).
TABLE-US-00002 TABLE 2 PCR primers used in this study Primer SEQ name Sequence (5′-3′) ID NO Reference Target yc70 TGCTGAGACAACCTAGTCTCTC 6 Horvath et CRISPR 1 al. (2008) CR1-rev TAAACAGAGCCTCCCTATCC 7 Horvath et CRISPR 1 al. (2008) ST802CR1- CCCGGCGTATATACTGGC 8 This study CRISPR 1 gfwd ST802CR1- GCTGACTGGACCAAATGC 9 This study CRISPR 1 g2fwd ST23CR1- GAGCAAGCAGAGGGTAGC 10 This study CRISPR 1 g3fwd 100ECR1- CCTGTCATCTCTGGGAGT 11 This study CRISPR 1 g4fwd 100ECR1- CGGTGTTCTATATCGAGGTC 12 This study CRISPR 1 g5fwd CR1-grev TTTCACTTCCTGAACCCC 13 This study CRISPR 1 CR2-fwd TTAGCCCCTACCATAGTGCTG 14 Horvath et CRISPR 2 al. (2008) CR2-rev TTAGTCTAACACTTTCTGGAAGC 15 Horvath et CRISPR 2 al. (2008) CR3-fwd CTGAGATTAATAGTGCGATTACG 16 Horvath et CRISPR 3 al. (2008) CR3-rev GCTGGATATTCGTATAACATGTC 17 Horvath et CRISPR 3 al. (2008) 100ECR3- CAATCCGTAGCCACACCT 18 This study CRISPR 3 gfwd (GTG)5 GTGGTGGTGGTGGTG 19 Gevers D., Strain Huys G. specific and Swing fingerprint J. (2001)
10. Acidification Assay
[0076] An acidification experiment was performed using a CINAC pH measurement system. For this purpose, overnight cultures of strains were generated in triplicate using 2 mL of 10% RSM with 20 μL of stock solution of the strains in 50 mL tubes with subsequent incubation at 42° C. The next day fresh 9.5% Campina QC-Milkbase was added to a final volume of 20 ml, mixed and the entire 20 mL was added to a milk bottle containing 180 mL 9.5% Campina QC-Milkbase, followed by overnight incubation at 42° C. pH was measured online (every 2 minutes) using a pH probe (Mettler Toledo HA405-DXK-08).
11. Demonstration of Non-CRISPR BIM Robustness
[0077] In order to demonstrate the relative robustness of non-CRISPR BIMs relative to CRISPR BIMs of 100-E, a phage plaque measurement and propagation experiment was performed. Firstly, the 100-E parent strain and both BIM100-E-D1A-L-5 and BIM100-E-D1A-L-7 were exposed a second time by standard plaque assay (as described in the MATERIALS AND METHODS) to the phage that was initially used in the challenge. While a high level of resistance to this phage was observed for both BIMs, phage escape mutants were also observed in the overlay agar (Table 13). Wild type and escape mutant plaques were measured using a digital callipers (Workzone, U.K.) on subsequent identical experiments, the results of which are shown in Table 17. A representative image illustrating the differences in plaque sizes on the respective strains is shown in
[0078] Single plaques each of wild-type phage (exposed to 100-E parent), CRISPR-escape mutant (CEM; exposed to BIM100-E-D1A-L-7) and non-CRISPR escape mutant (NCEM; exposed to BIM100-E-D1A-L-5) were then propagated on their respective host strains. This was performed as described in the MATERIALS AND METHODS, with the following modifications to increase efficiency of propagation: a 1% inoculum of each strain was added to 10 ml of pre-warmed LM17 broth (supplemented with 10 mM CaCl.sub.2 (Oxoid)) at 37° C. A single plaque of the appropriate phage was picked using a sterile pipette tip and immediately added to the tube. The propagation was allowed to proceed for 4 hours at 37° C. before filtration (0.45 μm) and plaque assay on the appropriate strain, the results of which are presented in Table 18.
[0079] A ‘second round’) (2° propagation was then performed in order to confirm the non-CRISPR BIM robustness over a series of cycles. The escape mutant lysates generated from the plaque propagations (described above) were diluted to approximately 10.sup.4 pfu/ml. A 1% inoculum of the appropriate strain was added from a fresh overnight culture to pre-warmed LM17 broth at 42° C. and allowed to grow for 1 hour. CaCl.sub.2 (Oxoid) was added to a final concentration of 10 mM. 1% of the appropriate phage lysate was added and the propagation proceeded for 4 hours at 42° C. before filtration (0.45 μm) and plaque assay (as described above) on the appropriate strain, the results of which are shown in Table 18.
EXAMPLES
Example 1
Bacteriophage Insensitive Mutants (BIMs) of S. thermophilus ST802
1.1 Phage Sensitivity
[0080] Bacteriophages against S. thermophilus ST802 were isolated as described in the MATERIALS AND METHODS. BIMs against phage φST802-D1B-L or against φST802-D3A-S and φST802-D3A-L were isolated, purified (by picking a single colony and growing in LM17 broth overnight at 42° C.), and subjected to spot assays. The BIM phenotype and stability was confirmed by plaque assays as described in the MATERIALS AND METHODS, the results of which are displayed in Table 3.
TABLE-US-00003 TABLE 3 Relative efficiencies of plaquing (EOP) of phages of Streptococcus thermophilus strain ST802 and derived BIMs. φST802- Strain/BIM φST802-D1B-L φST802-D3A-S D3A-L ST802 (parent) 1 1 1 BIMST802-D1B-L-3 ≦1 × 10.sup.−6 ≦1 × 10.sup.−6 ≦1 × 10.sup.−6 BIMST802-D1B-L-6 ≦1 × 10.sup.−6 ≦1 × 10.sup.−6 ≦1 × 10.sup.−6 BIMST802- ≦1 × 10.sup.−6 ≦1 × 10.sup.−6 ≦1 × 10.sup.−6 D3A-S/L-1a Note 1: ≦denotes the limit of detection i.e. no plaques were detected when the derived BIM was challenged with a phage lysate containing 1 × 10.sup.6 pfu/ml phages. Note 2: In derived BIM nomenclature, D1B-L or D3A-SL denotes the phage(s) against which the BIM was generated.
1.2 CRISPR Sequencing
[0081] The loci of CRISPR-1, CRISPR-2 and CRISPR-3 of S. thermophilus ST802 and its BIMs were sequenced as described in paragraph 8 of the Materials and Methods. Table 4 shows that the sizes of the CRISPR-1, CRISPR-2 and CRISPR-3 (2545 bp, 258 bp and 827 bp, respectively) for BIMST802-D1B-L-3 and BIMST802-D1B-L-6, as well as the spacer number and content were identical in the parent and BIMs. No CRISPR locus could be detected using CRISPR-4 repeat GTTTTTCCCGCACACGCGGGGGTGATCC (SEQ ID No. 20) as a consensus signature, nor by using the online CRISPR finder program (http://crispr.u-psud.fr).
[0082] The result shows that phage insensitivity was conferred to BIMST802-D1B-L-3 and BIMST802-D1B-L-6 by a mechanism other than CRISPR-1, CRISPR-2 or CRISPR-3. The adsorption results as well as the sedimentation results suggest that these BIMs carry mutations and/or adaptations in the cell envelope and/or phage receptor binding site. In the case of BIMST802-D3A-S/L-1a, the addition of three new spacers at the leader end of the CRISPR-1 locus and two at the leader end of the CRISPR-3 locus indicate that phage insensitivity was conferred by the CRISPR mechanism.
TABLE-US-00004 TABLE 4 Summary of CRISPR in S. thermophilus strain ST802 and derived BIMs # Strain CRISPR Size Direct repeat spacers Terminal repeat ST802 (parent) 1 2543 bp 5′-GTTTTTGTACTC 38 5′-GTTTTTGTACTC BIMST802-D1B-L-3 1 2543 bp TCAAGATTTAAGT 38 TCAAGATTTAAGTA BIMST802-D1B-L-6 1 2543 bp AACTGTACAAC-3′ 38 ACTGTACAGT-3′ BIMST802-D3A-S/ 1 2741 bp (SEQ ID NO 21) 41 (SEQ ID NO 22) L-1a ST802 (parent) 2 258 bp 5′-GATATAAACCTA 3 5′-GATATAAACCTA BIMST802-D1B-L-3 2 258 bp ATTACCTCGAGAG 3 ATTACCTCGAGAG BIMST802-D1B-L-6 2 258 bp GGGACGGAAAC-3 3 GGGACTITTIT-3′ BIMST802-D3A-S/ 2 258 bp (SEQ ID NO 23) 3 (SEQ ID NO 24) L-1a ST802 (parent) 3 827 bp 5′-GTTTTAGAGCTG 12 Same as direct BIM51802-D1B-L-3 3 827 bp TGTTGTTTCGAATG 12 repeat BIM51802-D1B-L-6 3 827 bp GTTCCAAAAC-3′ 12 BIM51802-D3A-S/ 3 959 bp (SEQ ID NO 25) L-1a 14
1.3 PCR Profiling
[0083] PCR profiling using the (GTG)5 primer and method described above was performed on all BIMs and their parent strains to confirm their relatedness to the parent strain from which they were derived. The results were visualised on a 1% agarose gel (shown in
1.4 Mutant Phenotype
[0084] All BIMs showed similar acidification activities compared to the parent (data not shown). While the proposed CRISPR-mediated BIM of ST802 did not appear to sediment compared to the parent (
TABLE-US-00005 TABLE 5 Pellet weights of parent and BIMs of S. thermophilus strain ST802. Pellet weight Mean pellet weight Strain (g) increase in g (%) p-value ST802 parent .0024 ± .0005 N/A N/A BIMST802-D1B-L-3 .0077 ± .0019 0.0053 (220%) 0.02 BIMST802-D1B-L-6 .0099 ± .0030 0.0075 (312%) 0.02 ST802 D3A-SL-1A .0047 ± .0004 .0023 (96%) 0.007
TABLE-US-00006 TABLE 6 Relative cells per chain (CPC) of parent and BIMs of S. thermophilus strain ST802. % CPC increase versus Strain CPC parent p-value ST802 parent 3.4 ± 2.2 N/A N/A BIMST802-D1B-L-3 8.9 ± 5.9 161% 5.9 × 10.sup.−8 BIMST802-D1B-L-6 12.8 ± 12.2 276% 3.2 × 10.sup.−6 ST802 D3A-SL-1A 4.1 ± 3.6 20% 0.27
1.5 Adsorption of Phages
[0085] Adsorption assays were performed to determine the level of adsorption of phages to both the parent strains and the derived BIMs, the results of which are shown in Table 7. Each of the infecting phages adsorb efficiently to the parent strain (adsorption levels are ≈80%). In contrast, phage adsorption to two of the BIMs is markedly reduced which indicates that in two out of three cases the BIMs confer resistance through an adsorption blocking mechanism.
TABLE-US-00007 TABLE 7 Adsorption of phages to parent and BIMs of S. thermophilus strain ST802. Long chain Strain formation? φST802-D1B-L φST802-D3A-S φST802-D3A-L ST802 (parent) No 89 ± 3% 89 ± 9% 94 ± 2% BIMST802-D1B-L-3 Yes 32 ± 10% 47 ± 15% 25 ± 17% p-value 0.0013 0.014 0.0009 BIMST802-D1B-L-6 Yes 6 ± 1% 29 ± 25% 15 ± 5% p-value 3.12 × 10.sup.−6 0.029 3.22 × 10.sup.−5 BIMST802-D3A-S/L- No 100 ± 0% 99 ± 0% 99 ± 0% 1a p-value 0.006 0.12 0.030
Example 2
Bacteriophage Insensitive Mutants of S. thermophilus ST23
2.1. Phage Sensitivity
[0086] Bacteriophages against S. thermophilus ST23 were isolated as described in the MATERIALS AND METHODS. A BIM against phage φST23-D1A-L was isolated, purified (by picking a single colony and growing in LM17 broth overnight at 42° C.) and subjected to spot assays and confirmatory plaque assays as described in the MATERIALS AND METHODS, the results of which are shown in Table 8.
TABLE-US-00008 TABLE 8 Relative efficiencies of plaquing (EOP) of phages of Streptococcus thermophilus strain ST23 and derived BIM. Strain φST23-D1A-L φST23-D2A-L ST23 (parent) 1 1 BIMST23-D1A-L-4 ≦1 × 10.sup.−9 1 × 10.sup.−3* Note: ≦denotes the limit of detection i.e. no plaques were detected when the derived BIM was challenged with a phage lysate containing 1 × 10.sup.9 pfu/ml phages. *A reduction in plaque size (by approximately 50%) and an increase in plaque haziness was also observed.
2.2 CRISPR Sequencing
[0087] PCR-generated CRISPR-1, CRISPR-2 and CRISPR-3 size profiles (1952 bp, 843 bp and 1289 bp respectively) of ST23 and its derivatives indicated that no additions were made to the arrays and this result was confirmed by sequencing: both spacer number and content were identical to those of the parent—see Table 9. No CRISPR locus could be detected using CRISPR-4 repeat GTTTTTCCCGCACACGCGGGGGTGATCC (SEQ ID No. 20) as a consensus signature, nor by using the online CRISPR finder program (http://crispr.u-psud.fr).
TABLE-US-00009 TABLE 9 Summary of CRISPR in S. thermophilus strain ST23 and derived BIMs # Strain CRISPR Size Direct repeat spacers Terminal repeat ST23 (parent) 1 1952 bp 5′-GTTTTTGTACTCT 29 5′-GTTTTTGTACTC BIMST23-D1A-L-4 1 1952 bp CAAGATTTAAGTA 29 TCAAGATTTAAGT ACTTACAAC-3′ AACTGTACAGT-3′ ST23 (parent) 2 843 bp 5′-GATATAAACCTAA 11 5′-GATATAAACCTA BIMST23-D1A-L-4 2 843 bp TTACCTCGAGAGG 11 ATTACCTCGAGAG GGACGGAAAC-3′ GGGACTTTTTT-3′ ST23 (parent) 3 1289 bp 5′-GTITTAGAGCTGT 19 As direct repeat BIMST23-D1A-L-4 3 1289 bp GTTGTTTCGAATG 19 As direct repeat GTTCCAAAAC-3′
[0088] The result in Example 2 shows that phage resistance was conferred to BIMST23-D1A-L-4 by a mechanism other than CRISPR. The adsorption results (section 2.5) suggest mutations and/or adaptations in the cell wall and/or phage receptor binding site.
2.3 PCR Profiling
[0089] PCR profiling using the (GTG)5 primer and method described above was performed on all BIMs and their parents to confirm their relatedness to the parent strains from which they were derived. The results were visualised on a 1% agarose gel (shown in
2.4 Mutant Phenotype
[0090] S. thermophilus BIMST23-D1A-L-4 was shown to exhibit similar acidification activities compared to the parent (data not shown). Furthermore, BIMST23-D1A-L-4 also aggregates and forms longer cell chains than the parent, as shown in
TABLE-US-00010 TABLE 10 Pellet weights of parent and BIM of S. thermophilus strain ST23. Pellet weight Mean pellet weight Strain/BIM (g) increase in g (%) p-value ST23 0.0036 ± 0.0001 N/A N/A BIMST23-D1A-L-4 0.0044 ± 0.0002 0.0008 (22%) 0.009
TABLE-US-00011 TABLE 11 Relative cells per chain (CPC) of BIM of S. thermophilus strain ST23. % CPC increase versus Strain CPC parent p-value ST23 parent 2.8 ± 0.4 N/A N/A BIMST23-D1A-L-4 5.6 ± 1.1 100 1.6 × 10.sup.−10
2.5 Adsorption of Phages
[0091] Adsorption assays were performed to determine the level of adsorption of phages to both the parent strains and the derived BIM, the results of which are shown in Table 7. Each of the infecting phages adsorb optimally to the parent strain (adsorption levels are ≈80%). In contrast, phage adsorption to the BIM is markedly reduced and indicates that the BIM confers resistance through an adsorption blocking mechanism.
TABLE-US-00012 TABLE 12 Adsorption of phages to parent and BIM of S. thermophilus strain ST23. Long chain Strain formation φST23-D1A-L φST23-D2A-L ST23 (parent) No 94 ± 4% 97 ± 1% BIMST23-D1A-L-4 Yes 18 ± 12% 32 ± 2% p-value 0.0005 1.5 × 10.sup.−7
Example 3
Bacteriophage Insensitive Mutants of S. thermophilus 100-E
3.1 Phage Sensitivity
[0092] Bacteriophages against S. thermophilus 100-E were isolated as described in the MATERIALS AND METHODS section. BIMs against phage φ100-E-D1A-L were isolated, purified (by picking a single colony and growing in LM17 broth overnight at 42° C.) and subjected to spot assays and confirmatory plaque assays as described in the MATERIALS AND METHODS, the results of which are shown in Table 13. BIM100-E-D1A-L-7 showed a high level of resistance to the phage that was used in the challenge only, while BIM100-E-D1A-L-5 appeared insensitive to this phage as well as a distinct phage (phage 100-E-D2A-L; Table 13).
TABLE-US-00013 TABLE 13 Relative efficiencies of plaquing (EOP) of phages of Streptococcus thermophilus strain 100-E and derived BIMs. Strain φ100-E-D1A-L φ100-E-D2A-L 100-E (parent) 1 1 BIM100-E-D1A-L-7 9.7 × 10.sup.−7 0.6 BIM100-E-D1A-L-5 2.9 × 10.sup.−6 ≦1.2 × 10.sup.−7
3.2 CRISPR Sequencing
[0093] PCR-generated CRISPR-1, CRISPR-2 and CRISPR-3 size profiles (2409/2476 bp, 115 bp and 1358 bp respectively) of 100-E and its derivative BIMs indicated that no additions were made to the arrays of BIM100-E-D1A-L-5. This result was confirmed by sequencing: both spacer number and content were identical to those of the parent—see Table 14. In the case of BIM100-E-D1A-L-7, the addition of a spacer at the leader end of the CRISPR1 locus indicates that the observed phage resistance was conferred by the CRISPR mechanism_No CRISPR locus could be detected using CRISPR-4 repeat GTTTTTCCCGCACACGCGGGGGTGATCC (SEQ ID No. 20) as a consensus signature, nor by using the online CRISPR finder program (http://crispr.u-psud.fr).
TABLE-US-00014 TABLE 14 Summary of CRISPR in S. thermophilus strain 100-E and derived BIMs Size Direct # Terminal Parent/BIM CRISPR (bp) repeat spacers repeat 100-E (parent) 1 2409 5′-GTT 36 5′-GTTTT BIM100-E-D1A-L5 2409 TTTGTA 36 TGTACTCT BIM100-E-D1A-L7 2476 CTCTCA 37 CAAGATTT AGATTT AAGTAACT AAGTAA GTACAG CTGTAC T-3′ AAC-3′ 100-E (parent) 2 115 5′-GAT 1 5′-GATAT BIM100-E-D1A-L5 ATAAAC AAACCTAA BIM100-E-D1A-L7 CTAATT TTACCTCG ACCTCG AGAGGGGA AGAGGG CTTTTT GACGGA T-3′ AAC-3′ 100-E (parent) 3 1358 5′-GTT 20 As BIM100-E-D1A-L5 TTAGAG direct BIM100-E-D1A-L7 CTGTGT repeat TGTTTC GAATGG T-3′
[0094] The result in Example 3 shows that phage resistance was conferred to BIM100-E-D1A-L5 by a mechanism other than CRISPR. The adsorption results (section 3.5) suggest that the observed phage resistance or insensitivity is due to an inability of the phage to efficiently recognize and bind to its host.
3.3 PCR Profiling
[0095] PCR profiling using the (GTG)5 primer method described above was performed on both BIMs and their parent to confirm their relatedness to the parent strain from which they were derived. The results were visualized on a 1% agarose gel (
3.4 Mutant Phenotype
[0096] S. thermophilus 100-E and its derived BIMs were examined for sedimentation phenotypes as described in the MATERIALS AND METHODS. While the proposed CRISPR-mediated BIM of 100-E (BIM100-E-D1A-L-7) did not appear to sediment compared to the parent (
TABLE-US-00015 TABLE 15 Relative cells per chain (CPC) of BIMs of S. thermophilus strain 100-E. % CPC increase versus Strain CPC parent p-value 100-E parent 6.4 ± 3.9 N/A N/A BIM100-E-D1A-L-7 6.7 ± 4.5 4.5% 0.72 BIM100-E-D1A-L-5 16.8 ± 9.3 162.7% 1 × 10.sup.−11
3.5 Adsorption of Phages
[0097] Adsorption assays were performed to determine the level of adsorption of both phages to both the parent strains and the derived BIMs of 100-E, the results of which are shown in Table 16. Each of the infecting phages adsorb optimally to the parent strain (adsorption levels are 80%), and to the CRISPR BIM (BIM100-E-D1A-L-7) In contrast, phage 100-E-D1A-L adsorption to BIM100-E-D1A-L-5 is markedly reduced and indicates that the insensitivity of the BIM to this phage is conferred by an adsorption blocking mechanism.
TABLE-US-00016 TABLE 16 Adsorption of phages to parent and BIM of S. thermophilus strain 100-E. Long chain Strain formation? φ100-E-D1A-L φ100-E-D2A-L 100-E (parent) No 79.9 ± 13.6% 91.1 ± 1.0% BIM100-E-D1A-L-7 No 83.2 ± 1.8% 92.0 ± 2.2% p-value 0.76 0.62 BIM100-E-D1A-L-5 Yes 10.2 ± 8.2% 87.4 ± 3.9% p-value 0.0034 0.26
3.6 Non-CRISPR BIM Robustness
[0098] In order to demonstrate that non-CRISPR BIMs are more phage robust than CRISPR-mediated BIMs, four parameters were measured: 1) efficiency of plaquing of two phages on each BIM, 2) range of phage resistance (i.e. number of non-identical phages to which the BIM is resistant), 3) phage escape mutant plaque size and 4) phage escape mutant propagation ability.
[0099] Firstly, it is clear from the results shown in Table 13 that BIM100-E-D1A-L-5 (non-CRISPR) has an approximately equal and high level of resistance to phage 100-E-D1A-L as BIM100-E-D1A-L-7 (CRISPR), and has a broader range of resistance compared to BIM100-E-D1A-L-7, being resistant to both infecting phages of 100-E. The CRISPR-mediated resistance of BIM100-E-D1A-L-7 renders this BIM insensitive to one phage only (i.e. the phage that was used in the challenge to generate the BIM). This trend is also upheld for all four phages infecting 100-E in the DSM collection, with BIM100-E-D1A-L-7 being sensitive to three of four phages and BIM100-E-D1A-L-5 being resistant to all four phages (data not shown).
[0100] Secondly, as well as exhibiting a broader phage resistance/insensitivity, phage escape mutants capable of producing plaques on BIM100-E-D1A-L-5 (NCEMs) are less virulent than those obtained on BIM100-E-D1A-L-7 (CEMs), using plaque size and propagation ability as measures of virulence, as shown in table 17.
TABLE-US-00017 TABLE 17 Plaque sizes of wild type phage 100-E-D1A-L and escape mutants on S. thermophilus 100-E parent and derived BIMs. Strain Phage EOP Plaque size (mm) p value 100-E (parent) 100-E-D1A-L (wild type) 1 1.39 ± 0.35 (n = 10) BIM100-E-D1A-L-7 100-E-D1A-L (CEM) 9.7 × 10.sup.−7 1.35 ± 0.11 (n = 3) 0.85 BIM100-E-D1A-L-5 100-E-D1A-L (NCEM) 2.9 × 10.sup.−6 0.88 ± 0.19 (n = 5) 0.01
[0101] Table 17 above shows the plaque sizes of wild type phage 100-E-D1A-L and both NCEM and CEM phages. It is clear that CEMs approximately maintain the plaque size of the wild type phage, whereas NCEMs have a markedly reduced plaque size. This phenomenon is also illustrated in
TABLE-US-00018 TABLE 18 Relative EOP of wild type phage 100-E-D1A-L and escape mutants on S. thermophilus 100-E parent and derived BlMs. EOP (1° EOP (2° Strain Phage propagation) propagation) 100-E (parent) 100-E-D1A-L (wild type) 1 1 BIM100- 100-E-D1A-L (CEM) 3.2 0.5 E-D1A-L-7 BIM100- 100-E-D1A-L (NCEM) 1.2 × 10.sup.−4 6.0 × 10.sup.−7 E-D1A-L-5
[0102] Table 18 above details the relative EOP of the wild type phage on 100-E (parent) and phage escape mutants BIM100-E-D1A-L-5 and BIM100-E-D1A-L-7 on their respective hosts, over the course of two phage propagations (as outlined in the MATERIALS AND METHODS). It is clear that while the CEM phage could quickly overcome the CRISPR based resistance to propagate to wild type phage levels, the NCEM phage was unable to do so. In fact, while a relatively low level of propagation was achieved from a plaque in the first round, it appears that none was achieved in the second round, with the reduction in detected phage approximately reflecting the dilution factor in the second propagation. Taken together, these data clearly show the higher level of robustness of non-CRISPR BIMs against phage challenges relative to those utilising CRISPR.