Fatty acid decarboxylase and its uses
11236367 · 2022-02-01
Assignee
- Commissariat A L'energie Atomique Et Aux Energies Alternatives (Paris, FR)
- Centre National De La Recherche Scientifique (Paris, FR)
- UNIVERSITE D'AIX-MARSEILLE (Marseilles, FR)
Inventors
- Frederic Beisson (Aix en Provence, FR)
- Damien Sorigue (Manosque, FR)
- Bertrand Legeret (Aix en Provence, FR)
- Stephan Cuine (Manosque, FR)
- Stephanie Blangy (La Tour D'Aigues, FR)
- Gilles Peltier (Pierrevert, FR)
Cpc classification
C12N9/0071
CHEMISTRY; METALLURGY
C12P5/026
CHEMISTRY; METALLURGY
C12Y101/9901
CHEMISTRY; METALLURGY
International classification
Abstract
The present invention relates to the identification of a new class of fatty acid decarboxylases and its uses, in particular for producing alkanes/alkenes from fatty acids.
Claims
1. A method for producing alkanes and/or alkenes from fatty acids comprising contacting a polypeptide having fatty acid decarboxylase activity, comprising a sequence having at least 80% sequence identity with one of SEQ ID NOs: 1-3 or 5-8 with fatty acids having from 12 to 18 carbon atoms in length and in the presence of light having a wavelength between 300 and 540 nm, the polypeptide also comprising a FAD binding domain and the consensus sequence G-X-L-(X).sub.4-C-[D/E]-X-G-[A/G]-F-X-[K/R] (SEQ ID NO: 4), X being any amino acid, said fatty acids being optionally substituted with at least one hydroxyl group or methyl group.
2. The method according to claim 1, wherein the polypeptide comprises the consensus sequence G-X.sub.1-L-(X).sub.4-C-[D/E]-X.sub.2-G-[A/G]-F-X.sub.3-[K/R] (SEQ ID NO: 4), wherein X.sub.1 is selected from the group consisting of P, L and G; (X).sub.4 is [T/A]-[T/S/C]-[P/T/A]-[G/A]; X.sub.2 is selected from the group consisting of H, N and R; and X.sub.3 is selected from the group consisting of L, V A and F.
3. The method according to claim 1, wherein positions C372, R391, Y406, Q426, H512 and N515, corresponding to the amino acid numbering of SEQ ID NO: 1, are conserved.
4. The method according to claim 1, wherein the polypeptide having fatty acid decarboxylase activity comprises a region forming a hydrophobic tunnel in which the fatty acid can enter and wherein at least 40% of the amino acid residues between positions 388-428, corresponding to the amino acid numbering of SEQ ID NO: 1, are hydrophobic residues selected from the groups consisting of V, I, L, M, F, W, C, A and Y.
5. The method according to claim 1, wherein the polypeptide comprises SEQ ID NOs: 1, 2, 3, 5, 6, 7, or 8.
6. The method according to claim 1, wherein the polypeptide is algal.
7. The method according to claim 1, wherein the fatty acid is selected from saturated and unsaturated fatty acids having 12 to 18 carbon atoms in length substituted with at least one hydroxyl group or methyl group.
8. The method according to claim 1, wherein the light has a wavelength between 400 and 520 nm.
9. A method for producing alkanes and/or alkenes from fatty acids, wherein a recombinant host cell expressing a polypeptide having at least 80% identity with one of SEQ ID NOs: 1, 2, 3, 5, 6, 7 or 8, the polypeptide also comprising a FAD binding domain and the consensus sequence G-X-L-(X).sub.4-C-[D/E]-X-G-[A/G]-F-X-[K/R] (SEQ ID NO: 4), X being any amino acid, is cultured and alkanes and/or alkenes are recovered.
10. The method of claim 9, wherein the host cell further expresses a lipase.
11. The method of claim 1, wherein the polypeptide having fatty acid decarboxylase activity is from an algae species.
12. A method for producing alkanes and/or alkenes from fatty acids comprising contacting a polypeptide having fatty acid decarboxylase activity with fatty acids and light with a wavelength between 300 and 540 nm, wherein the polypeptide having fatty acid decarboxylase comprises a sequence having at least 85% identity with a sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, and SEQ ID NO: 8 and wherein the fatty acids and the corresponding decarboxylated alkanes and/or alkenes have from 12 to 18 carbon atoms in length, said fatty acids being optionally substituted with at least one hydroxyl group or methyl group.
13. The method of claim 12, wherein the fatty acids are selected from saturated and unsaturated fatty acids having 12 to 18 atom carbons in length substituted with at least one hydroxyl group or methyl group.
14. The method of claim 12, wherein the polypeptide having fatty acid decarboxylase comprises a sequence having at least 90% identity with a sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, and SEQ ID NO: 8.
15. The method of claim 12, wherein the polypeptide having fatty acid decarboxylase activity comprises a sequence having at least 95% sequence identity with a sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 5 and SEQ ID NO: 6.
16. The method of claim 9, wherein the polypeptide having fatty acid decarboxylase comprises a sequence having at least 80% identity with a sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 5, and SEQ ID NO: 6 and wherein the recovered alkanes and/or alkenes have 12 to 18 carbon atoms in length, are optionally substituted with at least one hydroxyl group or methyl group, and optionally have an unsaturation.
17. The method of claim 1, wherein the polypeptide has a sequence having at least 80% identity with a sequence selected from SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 5, and SEQ ID NO: 6.
18. The method of claim 1, wherein the polypeptide has a sequence having at least 80% identity with a sequence selected from SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3.
Description
BRIEF DESCRIPTION OF THE FIGURES
(1)
(2) Upper panel: portion of the chromatogram corresponding to the labeled pentadecane product; control: homogenate pre-heated at 95° C. for 30 minutes. Lower panel: mass spectrum of the labeled pentadecane.
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
(12)
(13)
(14)
(15)
(16)
(17)
(18)
(19)
(20)
(21)
BRIEF DESCRIPTION OF THE SEQUENCE LISTING
(22) TABLE-US-00001 SEQ ID No Description 1 Amino acid sequence of GMC protein from Chlorella variabilis NC64A without the putative chloroplast transit peptide 2 Amino acid sequence of GMC protein from Chlorella variabilis NC64A with the putative chloroplast transit peptide 3 Amino acid sequence of a GMC protein from Chlorella variabilis NC64A without the putative chloroplast transit peptide but with a histidine tag, thioredoxin and a TEV (Tobacco Etch Virus) cleavage site at the N terminal end 4 consensus sequence 5 Amino acid sequence of GMC protein from Chlamydomonas reinhardtii without the putative chloroplast transit peptide 6 Amino acid sequence of GMC protein from Chlamydomonas reinhardtii with the putative chloroplast transit peptide 7 Amino acid sequence of GMC protein from Phaeodactylum tricornutum without the putative chloroplast transit peptide 8 Amino acid sequence of GMC protein from Phaeodactylum tricornutum with the putative chloroplast transit peptide 9 Amino acid sequence of GMC protein from Coccomyxa subellipsoidea without the putative chloroplast transit peptide 10 Amino acid sequence of GMC protein from Volvox carteri without the putative chloroplast transit peptide 11 Amino acid sequence of GMC protein from Ectocarpus siliculosus without the putative chloroplast transit peptide 12 Amino acid sequence of GMC protein from Emiliania huxleyi without the putative chloroplast transit peptide 13 Amino acid sequence of GMC protein from Aureococcus anophagefferens without the putative chloroplast transit peptide 14 Amino acid sequence of GMC protein from Nannochloropsis gaditana without the putative chloroplast transit peptide 15 Nucleic acid sequence encoding SEQ ID No 1 16 Nucleic acid sequence encoding SEQ ID No 5 17 Nucleic acid sequence encoding SEQ ID No 7 18 Nucleic acid sequence encoding SEQ ID No 9 19 Nucleic acid sequence encoding SEQ ID No 10 20 Nucleic acid sequence encoding SEQ ID No 11 21 Nucleic acid sequence encoding SEQ ID No 12 22 Nucleic acid sequence encoding SEQ ID No 13 23 Nucleic acid sequence encoding SEQ ID No 14
Examples
(23) Here, the inventors identified in the model microalga Chlorella variabilis NC64A an enzyme catalyzing the synthesis of alka(e)nes. The enzyme was partially purified using deuterium-labeled palmitic acid as a substrate and solid phase microextraction to capture the pentadecane product. A candidate protein belonging to the Glucose-Methanol-Choline oxidoreductase family was identified by proteomic analysis of three independent partial purifications. Heterologous expression of this Chlorella candidate gene in Escherichia coli resulted in the production of linear hydrocarbons from 13 to 17 carbons, showing that a single enzyme is sufficient to produce fuel-like alka(e)nes. The Chlorella alkane synthase is 69 kDa chloroplast-predicted protein using FAD as a cofactor. In vitro assays show that it can use C12 to C22 fatty acids to form alka(e)nes. The activity of this enzyme was found to be strictly dependent on presence of photons from 400 to 540 nm but could also work from 300 to 400 nm. These results thus expand the current knowledge on the catalytic repertoire of the Glucose-Methanol-Choline oxidoreductase family and open a new avenue for the renewable and light-driven production of alka(e)nes in microorganisms.
(24) Results
(25) Partial Purification of an Alkane Synthase Activity from Chlorella variabilis NC64A
(26) The inventors have shown that various microalgae, including Chlorella variabilis NC64A, had the capacity to synthesize C15-C17 alkanes and alkenes. In the same work, they have also shown that deuterated palmitic acids added exogenously to Chlorella cultures can be converted into alkanes and alkenes. In order to identify the enzymatic pathway of alkane synthesis in microalgae, they have chosen a traditional purification approach based on the use of deuterium-labeled palmitic acid as substrate.
(27) The first step was to confirm that an enzyme activity can be measured in a Chlorella cell homogenate. Deuterated palmitic acid was added to a cell homogenate and incubated overnight in a sealed vial. The expected pentadecane product was extracted by solid phase micro-extraction (SPME) and analyzed by gas chromatography coupled to mass spectrometry (GC-MS). A peak at 12.03 minutes corresponding to labelled pentadecane could be detected on intact cells but was absent on pre-heated control homogenate (
(28) This experiment thus showed that Chlorella homogenate has an alkane synthesis enzyme activity. Because the alkane synthesis pathways identified in most organisms have an aldehyde intermediate, the inventors performed the same experiment using labelled C16 aldehyde but labelled pentadecane could not be detected.
(29) The labelled palmitic acid was thus used to assay activity in all the purification procedure (
(30) Some preliminary tests were then performed before purifying further the activity. Several co-factors such ferredoxine, ferredoxine reductase, NADP, NADPH and ATP were added in different combinations on the solubilized microsomal fraction. None of them were found to increase the activity and they were not added to the assays on purified fractions. The inventors also observed that in three days, the solubilized microsomal fraction activity stored at 4° C. decreased by 90%, indicating that the whole purification process had to be performed within a few days.
(31) The partial purification of the solubilized activity involved a first step of gel filtration with a preparative column Superdex 200 and then two anion exchange columns, a fast flow Q and a final more resolutive mono Q. Most fractions were assayed for alkane synthase activity using the assay previously described. Protein content of the most active fractions was analyzed by electrophoresis on an acrylamide gel under denaturing conditions (
(32) Three independent partial purifications were performed. Fractions with the highest activity after the final purification step were sent for proteomic analysis. By taking a cut off of 2 peptides counts at least, only ten proteins were common between the three purifications (
(33) The Chlorella Alkane Synthase is a Member of the GMC Oxidoreductase Family
(34) The gene encoding the Chlorella GMC oxidoreductase was not completely covered by publicly available ESTs. A cDNA around 2 kb was cloned using a total RNA extract from Chlorella. It encoded a 69 kDa protein (
(35) BlastP searches using the Chlorella GMC oxidoreductase or other biochemically characterized GMC oxidoreductases from other species were performed in public databases to retrieve a variety of GMC oxidoreductase protein sequences. Multiple alignment of algal sequences indicated that some Chlorella residues such as C372, R391, Y406, Q426, H512 and N515 were highly conserved in other algae (
(36) The Chlorella Alkane Synthase is a Light-Driven Photoenzyme Acting on a Variety of Fatty Acids
(37) In order to characterize further its activity, the Chlorella GMC oxidoreductase was expressed in Escherichia coli as a His-tagged protein and purified on a nickel column (
(38) In order to determine the co-product of the reaction, the inventors used palmitic acid labelled with .sup.13C on the carboxylic group. They observed the production of .sup.13CO.sub.2 demonstrating that the enzyme releases CO.sub.2 as a co-product, i.e. is a fatty acid decarboxylase. (
(39) To characterize further alkane synthase activity, substituted fatty acids were used as substrate. Phytanic acid (3,7,11,15-tetramethylhexadecanoic acid) was found to be converted into branched alkanes, indicating that the alkane synthase is active on terpenoic acids (
(40) In vitro, the alkane synthase cannot use TAGs (triacylglycerol) directly as substrate (
(41)
(42) To determine if the alkane synthase was a light-driven enzyme (photoenzyme) or a light-activated enzyme, the production of CO.sub.2 was monitored during the reaction. The activity of the enzyme is driven by the presence of photons and stops immediately when light is turned off. (
(43) Substrate Concentration Modify Enzyme Fluorescence.
(44) Based on the light dependence of the enzyme we suspect that enzyme fluorescence could change during the activity of the enzyme with or without substrate. To this aim, we made fluorescence spectrum and kinetics (
(45) The GMC Oxidoreductases from Chlamydomonas and Phaeodactylum are Also Alkane Synthases
(46) To investigate the possibility that other algal GMC oxidoreductases also have a fatty acid decarboxylase activity and are thus alkane synthases, the GMC oxidoreductases of another Chlorophyceae (Chlamydomonas reinhardtii) and a diatom (Phaeodactylum tricornutum) were expressed in Escherichia coli and total fatty acids and hydrocarbons of the bacterial cells were analyzed by GC-MS-FID. The Chlamydomonas enzyme caused the formation in E. coli cells of pentadecane and heptadecane as well as their monounsaturated analogs (
(47) Co-Expressing a Lipase with a GMC Oxidoreductase Boost Alkane Synthesis in E. coli
(48) Free fatty acid pools are usually small in living cells because free fatty acids are deleterious to membrane structure. In order to see if the production of alkanes and alkenes could be boosted in E. coli by increasing the amount of free fatty acids available, a bacterial lipase (Uniprot P04635) was coexpressed with the Chlorella or the Chlamydomonas alkane synthase (
(49) Discussion
(50) Alkanes and alkenes are interesting compounds for biofuel production and alkenes are particularly interesting for chemical industry. In this work, using partial purification and proteomic analysis, the inventors were able to identify a microalgal alkane synthase from Chlorella. It is a member of the GMC oxidoreductase family. When expressed in E. coli, this protein alone is able to yield alkanes and alkenes. The main interest of this enzyme is its apparent capacity to catalyze a formal decarboxylation of free fatty acids to form saturated hydrocarbons and the fact that it is a photoenzyme. Mechanism and possibly cofactor requirements are expected to be different from the bacterial cytochrome P450 alkane synthase. The Chlorella GMC oxidoreductases thus extend the pool of alkane-synthetizing enzymes and offers new possibilities for biotechnological applications.
(51) The Algal Group of GMC Oxidoreductases
(52) The GMC oxidoreductase family was first described in 1992. Comparison of protein sequence from glucose dehydrogenase, choline dehydrogenase, glucose oxidase and methanol oxidase from various organisms (respectively: Drosophila melanogaster, Escherichia coli, Aspergillus niger, and Hansenula polymorpha) showed low similarity but conserved motifs. These enzymes contain a flavoenzyme site and a canonical ADP-binding βαβ fold close to their amino termini. Structural studies confirm that these proteins are composed of an N-terminal FAD-binding domain, and a C-terminal substrate-binding domain. The FAD-binding domain forms the alpha-beta fold typical of dinucleotide binding proteins, while the substrate-binding domain consists of a beta sheet surrounded by alpha helices. The general topology of these proteins is conserved, though inserted structural elements occur in both choline dehydrogenase and alcohol dehydrogenase.
(53) Members of the GMC oxidoreductase family catalyze diverse reactions, mostly oxidation of alcohols to aldehydes. This family includes glucose and methanol oxidases, fatty alcohol oxidase, choline dehydrogenase. But the family also includes a lyase from almond acting on hydroxymandelonitrile, which shows that the family harbors very diverse catalytic mechanisms. Strict dependence of the activity on light is likely to be mediated by the FAD cofactor found to be associated with the recombinant enzyme. Presence of FAD was consistent with the fact that the Chlorella enzyme has a FAD binding domain like all GMC oxidoreductases (
(54) Interestingly, all the microalgal species that have been shown to produce long or very long chain alka(e)nes have a homolog to the Chlorella GMC oxidoreductase, but the only species that has no detectable alka(e)nes (Ostreococcus tauri) has no GMC homolog. It seems thus very likely that the members of the algal group of GMC oxidoreductases are all alkane synthases. This idea is supported by the demonstration that the GMC oxidases from Chlamydomonas reinhardtii and Phaeodactylum tricornutum bear a fatty acid decarboxylase activity (
(55) Possible Biotechnological Applications of the Microalgal Alkane Synthase
(56) The discovery of a microalgal pathway for alkane synthesis is of biotechnological interest because microalgae are promising platform for lipid production but harvest of biomass, extraction of oil and conversion to biodiesel is very costly. Production in microalgae of fuel-like volatile alkanes that could be easily recovered from the culture medium might thus circumvent these issues.
(57) In vitro, the Chlorella enzyme is able to act on a variety of fatty acids, including medium chains (
(58) As alkane synthase is a photoenzyme, light can be used to finely modulate alkane production in vitro and in vivo. First, presence or absence of photons from 320-540 can be used to select the moment of the alkane production. Second, light intensity can be used to increase or decrease the rate of alkane synthesis. Experiments were performed here under continuous light but it is possible that other conditions such flashes could be interesting for hydrocarbons synthesis.
(59) Finally, products (alkanes and alkenes), coproduct (CO.sub.2), and enzyme fluorescence can be used to estimate the concentration of free fatty acids in a sample (or total fatty acids if used in combination with a lipase).
(60) Materials & Methods
(61) Strains and Culture Conditions
(62) Chlamydomonas reinhardtii wild-type strains CC124 (nit1 nit2; mt−) and CC125 (nit1 nit2; 415 mt+) were used. Chlorella variabilis NC64A was from the laboratory of J. L. Van Etten (University of Nebraska). All strains were grown routinely in conical flasks in incubation shakers at 25° C. (Infors HT) under air enriched with 2% (v/v) CO.sub.2, with agitation at 140 rpm and light intensity at 120 μmol photons m.sup.−2s.sup.−1 for Chlamydomonas and 70 for Chlorella. Chlamydomonas and Chlorella were cultivated in Tris-Acetate-Phosphate (TAP) medium and minimal medium. Cells were routinely counted using a Multisizer™ 3 (Coulter).
(63) Purification of Native Alkane Synthase
(64) A Fast Protein Liquid Chromatography system (AKTApurifier 900, GE Healthcare) was used. The alkane synthase activity assay is described in next section. Chlorella cells (200.10.sup.9) were centrifuged for one hour at 6000 g and cell pellets were frozen in liquid nitrogen and stored for one hour at minus 80° C. Cells were resuspended in lysis buffer containing 20 mM Tris (pH 8.0), 100 mM NaCl and 1 mM EDTA (buffer A) and disrupted using a Cell Disruption (Constant) at 2 kbar pressure. Homogenate was centrifuged twice for 40 min at 50 000 g. Supernatant was collected and centrifuged for 90 min at 105 000 g. The resulting microsomal pellet was resuspended overnight at 4° C. under agitation in a buffer A added with 2.7 mM Triton X100. Ultracentrifugation was performed at 105 000 g for 90 min and the supernatant was loaded on a gel filtration column. Most active fractions were pooled, concentrated using a 30 kDa Amicon® ultracentrifugal filter and buffer was changed by dilution to a 20 mM Tris (pH 8.0), 50 mM NaCl, 1 mM EDTA, 0.05% (w/v) Triton X100 buffer (buffer B). The second purification step involved an anion exchange column (HiTrap Q FF, GE Healthcare). Proteins were eluted using a gradient (0-100%) of a buffer 20 mM Tris (pH 8.0), 1 M NaCl, 1 mM EDTA and 0.05% (w/v) Triton X100 (buffer C). Most active fractions were pooled, concentrated using a 30 kDa an Amicon® ultracentrifugal filter and buffer was changed by dilution to buffer B. The third purification step involved a strong anion exchange column (Mono Q GI, GE Healthcare). Proteins were eluted using a gradient of buffer C. Most active fractions were kept for proteomic analysis.
(65) Activity Assay for Protein Purification
(66) Enzymatic assays were performed in transparent glass vials sealed using caps with septum. Reaction mixtures contained 500 μL of each purification fraction, 200 μM of perdeuterated palmitic acid (10 mM stock solution in ethanol) and 45 nmol hexadecane as internal standard (4.5 mM stock solution in chloroform). Vials were agitated at 120 rpm overnight at 25° C. under a white light (intensity 120 μmol photons m.sup.−2s.sup.−1). Reaction was stopped by the addition of 10 μL NaOH 10 M through the septum using a syringe. Hydrocarbons produced were analyzed by incubating in the headspace of the vial a solid phase microextraction (SPME) fiber (DVB PDMS fused silica, 65 μm double-polar, Supelco) mounted on a holder. After 15 min incubation at room temperature the SPME fiber was immediately inserted into the injector of the GC-MS and desorbed at 250° C. GC-MS analysis was carried out as described below.
(67) Proteomic Analysis
(68) Protein preparation, in-gel digestion and nanoLC-MS/MS analyses were performed as previously described. In brief, proteins solubilized in Laemmli buffer were stacked on top of a 4-12% (w/v) NuPAGE gel (Invitrogen) and stained by R-250 Coomassie Blue (BioRad). Gel bands were then excised and proteins in-gel digested using trypsin (Promega). Resulting peptides were analysed by nanoliquid chromatography coupled to tandem mass spectrometry (Ultimate 3000 coupled to LTQ-Orbitrap Velos Pro, Thermo Scientific) using a 120 min gradient. Peptides and proteins were identified through concomitant searches against Uniprot (Chlorella variabilis taxonomy, September 2016 version), classical contaminants (homemade) and the corresponding reversed databases using Mascot (version 2.5.1). The Proline software was used to filter the results (conservation of rank 1 peptides, peptide identification FDR <1% as calculated on peptide scores by employing the reverse databasestrategy, peptide length ≥7, and minimum of 1 specific peptide per identified protein group) before performing a compilation, grouping and comparison of the protein groups from the different samples. Only proteins identified with a minimal specific spectral count of 2 were taken into account for further comparison.
(69) Protein Analysis and Western Blots
(70) Protein extracts were added with LDS NuPAGE loading dye 1× final, boiled for 10 min at 95° C., resolved using reducing 10% (w/v) SDS-PAGE with MOPS running buffer and stained with silver nitrate. For detection of His-tagged proteins, polypeptides resolved by SDS-PAGE were transferred onto a nitrocellulose membrane using a semi-dry blotting system, and His-tags were revealed using rabbit anti-His antibodies, horseradish peroxidase-conjugated anti-rabbit antibodies and ECL substrate (Amersham Biosciences).
(71) Cloning of Alkane Synthase cDNA and Purification of Recombinant Alkane Synthase
(72) Total RNAs were extracted from Chlorella cells by a phenol-chloroform method and cDNAswere synthesized using SuperScript® III reverse transcriptase. The cDNA encoding the GMC oxidoreductase was amplified using primers designed in putative 5′ and 3′UTRs Primer forward: ATGGCGTCAATTACATCGCG (SEQ ID No 24); Primer reverse: TCATGCTGCCACTGTCGC (SEQ ID No 25), cloned into a TOPO XL plasmid and sequenced. The sequence corresponding to residues 62-654 of the Alkane synthase was amplified from a synthetic gene codon-optimized for E. coli expression using a primer forward 5′-CTG TAC TTC CAA TCA GCC AGC GCA GTT GAA GAT ATT C-3′ (SEQ ID No 27) and a reverse primer: 5′-TAT CCA CCT TTA CTG TTA TCA TGC TGC AAC GGT TGC CGG TG-3′ (SEQ ID No 28). and cloned into pLIC07 vector, which introduced downstream of the ATG start codon a cassette coding for a 6 His-tagged thioredoxin and a tobacco etch virus (TEV) protease-cleavage site. The recombinant alkane synthase was produced in BL21-CodonPlus (DE3)-RIL E. coli cells cultured in TB medium at 37° C. up to OD 0.9. At this stage, the temperature was decreased to 17° C. and the cells were grown for an additional 18 h. The cells were harvested by centrifugation (4000 g for 10 min) and the pellet was frozen. Cell pellet was resuspended in lysis buffer during 30 min at 4° C. (10 mL of lysis buffer for one liter of cells at OD=1). Lysis buffer contained 300 mM NaCl, 50 mM Tris pH 8.0, 10 mM imidazol, 5% (w/v) glycerol, 0.25 mg mL.sup.−1 lysozyme, 20 mM MgSO.sub.4, 10 μg mL.sup.−1 DNase, and antiproteases. After resuspension, cells were lysed by sonication and centrifuged for 30 min at 8000 g. Supernatant was collected and enzyme was purified by FPLC. First purification was made on a nickel column and protein was eluted by a step gradient using 50% (v/v) of a second buffer containing 300 mM NaCl, 50 mM Tris pH 8.0, 500 mM imidazole 5% (w/v) glycerol. Tobacco etch virus protease (at 1 mg per 10 mg total protein) was used to cut off the His tag and the thioredoxin. A dialysis was performed overnight in the presence of TEV to change the buffer to a buffer containing 300 mM NaCl, 50 mM Tris pH 8.0, 10 mM imidazol, 5% (w/v) glycerol. A second FPLC chromatography using a nickel column was made to separate the protein from the His-tagged thioredoxin. The last purification step was a gel filtration column (Superdex200 26/600 mm GE Healthcare). Buffer used for this step contained 150 mM NaCl, 10 mM Tris pH 8.0, 5% (w/v) glycerol. The protein was concentrated using ultracentrifugal filters 50 kDa Amicon® and stored at −80° C. after adding 20% (w/v) glycerol.
(73) Expression of Chlorella variabilis, Chlamydomonas reinhardtii and Phaeodactylum tricornutum GMC Oxidoreductase in E. coli.
(74) Chlamydomonas reinhardtii and Phaeodactylum tricornutum Alkane synthase was amplified from a synthetic gene codon-optimized for E. coli using for Chlamydomonas reinhardtii a primer forward 5′-TAC TTC CAA TCA ATG ATG CTG GGT CCG AAA ACC-3′ (SEQ ID No 29) and a primer reverse, 5′-TAT CCA CCT TTA CTG TTC TAC TAA ACT GCA ACC GGC TGA CG-3′ (SEQ ID No 30). For Phaeodactylum tricornutum, forward primer 5′-TAC TTC CAA TCA ATG AAA AAA AGC CTG CGT AGC-3′ (SEQ ID No 31), reverse primer 5′-TAT CCA CCT TTA CTG TTC TAC TAT GCG CTT GCG GTG-3′ (SEQ ID No 32). Genes were cloned into pLIC07 vector, which introduced downstream of the ATG start codon a cassette coding for a 6 His-tagged thioredoxin and a tobacco etch virus (TEV) protease-cleavage site. E. coli strain expressing the GMC oxidase from Chlorella variabilis NC64A, Chlamydomonas reinhardtii or Phaeodactylum triconutum were grown at 37° C. with agitation at 180 rpm and light at 100 μmole.photon.m.sup.−2.Math.s.sup.−1. When OD reached 0.6, 500 μM of isopropyl β-D-1-thiogalactopyranoside was added. Cells were then grown for 24 hours at 37° C., harvested, transmethylated using methanol added with 5% sulfuric acid and hydrocarbons were extracted with hexane and analyzed by GC-MS as previously described.
(75) Co-Expression in E. coli of a GMC Oxidoreductase and a Lipase
(76) E. coli strain transformed with a vector expressing the GMC oxidase from Chlorella variabilis NC64A (or Chlamydomonas reinhardtii) and/or a vector expressing the lipase from the bacterium Staphylococcus hyicus, were grown in TB medium at 37° C. Expression was induced with 1 mM of isopropyl β-D-1-thiogalactopyranoside (added with 0.2% arabinose for co-expression). Cells were then grown overnight at 25° C. at 100 μmole.photon.m.sup.−2.Math.s.sup.−1 and 6 h at 2000 μmole.photon.m.sup.−2.Math.s.sup.−1. Cells were harvested (4 ml at OD=5), transmethylated using methanol added with 5% sulfuric acid and hydrocarbons were analyzed by SPME and GC-MS as previously described.
(77) Enzymatic Assay with Purified Enzyme
(78) All assays were performed in transparent glass vials sealed using caps with septum. Optimum pH was determined using a Teorell Stenhagen universal buffer (33 mM citric acid monohydrate, 33 mM phosphoric acid, 100 mM NaOH, 16.7 mM of boric acid, pH 8.5 adjusted with 1N HCl). Other assays were performed in 100 mM Tris HCl pH 8.5, 100 mM NaCl. Reaction mixtures (500 μL) typically contained 160 nM purified enzyme (stock solution 2.5 mg ml.sup.−1) and 400 μM substrate (stock solution 10 mM in ethanol). In some assays, a lipase was used with the alkane synthase. In this case, substrate was a triacylglycerol. Generally, samples were shaken at 200 rpm during 15 min under LED-made white light at 2000 μmol
photons m.sup.−2s.sup.−1. After the incubations, samples were heated at 95° C. during 15 min to stop the enzymatic reaction. Samples were cooled down and internal standard (hexadecane) was added (45 nmol from a 4.5 mM stock solution in chloroform). NaOH was then added to the reaction mixture (10 μL from a stock solution of 10 M) and samples were vortexed for 5 min. Then 250 μL of hexane was added and samples were vortexed for 5 min to extract alkanes and alkenes. The hexane phase was collected by centrifugation and analyzed by GC-MS-FID. The analysis was done by direct injection of 100 μl of the headspace into a GC-MS. In
(79) Fluorescence of the Alkane Synthase
(80) Enzyme was analyzed by UV-Vis spectroscopy (Uvikon XS spectrophotometer from Secomam). Absorbance spectrum was measured on purified enzyme in a buffer containing 100 mM tris pH 8.5 and 100 mM NaCl. Fluorescence spectrum (500 to 700 nm) was measured on a Varian Cary Eclipse using an excitation flux at 450 nm with a 10 nm slit For kinetic, fluorescence was measured at 540 nm using an excitation flux at 450 nm with a 10 nm slit.
(81) Membrane Inlet Mass Spectrometry (MIMS)
(82) Online measurements of .sup.12CO.sub.2 (m/z=44) and .sup.13CO.sub.2 (m/z=45) were monitored using mass spectrometry (model Prima B, Thermo Scientific). The membrane inlet system consists of a thermo-regulated oxygen electrode chamber (Hansa Tech), which is connected to the vacuum line of the mass spectrometer via a gas-permeable thin Teflon membrane (0.001 inch thickness, YSI Inc.), which seals the bottom of the chamber. For analyses, 20 μL of purified enzyme at 2.5 mg mL.sup.−1 and 30 μL substrate at 10 mM in dimethylsulfoxide (.sup.13C-palmitic acid) was added to 1.45 mL of Tris/Acetate/Borate buffer 100 mM, pH 6.5 containing NaCl 100 mM, placed into the measuring chamber, thermo-regulated at 25° C., and stirred continuously. Gases dissolved in the medium diffuse through the Teflon membrane to the ion source of the mass spectrometer.
(83) Cultures in Photobioreactors
(84) Chlamydomonas reinhardtii CC124 (nit1 nit2; mt−) and Chlamydomonas reinhardtii overexpressing the alkane synthase gene were cultured in minimal medium (Harris, 1989) in one liter photobioreactors (BIOSTAT Aplus, Sartorius Stedim Biotech) operated as turbidostats. A.sub.880 was measured continuously using a biomass probe (Excellprobe, Exner) and cultures were maintained at constant A.sub.880 by injection of fresh medium. The pH was maintained at a constant value of 7 by injection of KOH (0.2 N) or HCl (0.2 N). The cultures were stirred using a metal propeller (250 rpm). The gas flow rate was adjusted to 0.5 L min.sup.−1. Air enriched with 2% (v/v) CO.sub.2 was generated using mass flow meters (EL flow, Bronkhorst). White light was supplied by eight fluorescent tubes (Osram Dulux L 18 W) placed radially around the photobioreactor. We used a blue filter (363 special medium blue, Lee filters, USA) and a red filter (113 magenta, Lee filters, USA) to provide respectively blue and red light. Both lights were at same intensity (35 μmol photons m.sup.−2s.sup.−1).
(85) Transmethylation
(86) To quantify hydrocarbons together with fatty acids, transmethylation of whole cells was used. Briefly, cell pellets (one hundred million cells for Chlamydomonas, two hundred million cells for Chlorella variabilis NC64A and 20 mL OD.sup.−1 unit of E. coli) were added with 2 mL of a solution containing methanol with 5% (v/v) sulfuric acid and 25 μg of triheptadecanoate (from a stock solution 2.5 mg mL.sup.−1 in chloroform) and 5 μg of 16:0-alkane (stock solution 1 mg mL.sup.−1 in chloroform) were included as internal standards. Samples were incubated at 85° C. for 90 min in sealed glass tubes. After cooling down, FAMEs and hydrocarbons were extracted by adding 250 μL hexane and 500 μL NaCl 0.9% (w/v). Samples were vortexed for 10 min and the organic phase was separated from the aqueous phase by centrifugation at 3000 g for 2 min. The hexane phase was recovered and 1 μl was injected in the GC-MS/FID.
(87) GC-MS Analyses
(88) Analyses by gas chromatography coupled to mass spectrometry (GC-MS), which were performed after solid phase microextraction (SPME), were carried out using the following setup. A Thermo-Fischer gas chromatography Focus series coupled to a Thermo-Fischer DSQII mass spectrometer (simple quadrupole) was used with a DB-5HT (Agilent) apolar capillary column (length 30 m, internal diameter 0.25 mm, film thickness 0.1 μm). Helium carrier gas was at 1 mL min.sup.−1. Oven temperature was programmed with an initial 2 min hold time at 50° C., then a ramp from 50° C. to 300° C. at 10° C. min.sup.−1, and a final 3 min hold time at 300° C. Samples were injected in splitless mode (2 min) at 250° C. The MS was run in full scan over 40-500 amu (electron impact ionization, 70 eV) and peaks were quantified based on total ion current using the internal standards. For co-substrate determination, a column HP-PLOT Q was used (0.32 mm diameter×30 m) and CO.sub.2, .sup.13CO.sub.2 and argon were analysed using an oven temperature of 40° C. and single ion monitoring (m/z 40, 44, 45).
(89) GC-MS/FID Analyses
(90) Analyses by gas chromatography coupled to mass spectrometry and flame ionization detection (GC-MS/FID) were performed only after transmethylation reactions in order to quantify fatty acids and hydrocarbons together. Analyses were carried out on an Agilent 7890A gas chromatographer coupled to an Agilent 5975C mass spectrometer (simplequadrupole). A Zebron 7HG-G007-11 (Phenomenex) polar capillary column (length 30 m, internal diameter 0.25 mm, film thickness 0.25 μm) was used. Hydrogen carrier gas was at 1 mL min.sup.−1. Oven temperature was programmed with an initial 2 min hold time at 60° C., a first ramp from 60° C. to 150° C. at 20° C. min.sup.−1 with a 5 min hold time at 150° C., then a second ramp from 150° C. to 240° C. at 6° C. min.sup.−1 and a final 3 min hold time at 240° C. Samples were injected in splitless mode (1 min) at 250° C. The MS was run in full scan over 40-350 amu (electron impact ionization at 70 eV) and peaks were quantified based on the FID signal using the internal standards.
(91) Phylogeny
(92) To build the phylogenetic tree, 56 amino acid sequences of GMC oxidoreductases from prokaryotes and eukaryotes were retrieved from Cyanobase (see Worldwide Web site: genome.kazusa.or.jp/cyanobase/), NCBI (see Worldwide Web site: ncbi.nlm.nih.gov/), Phytozome (see Worldwide Web site: phytozome.Jgi.doe.gov) or Cyanidioschyzon merolae see Worldwide Website: merolae.biol.s.u-tokyo.ac.jp/). Sequences were aligned with the MAFFT version 7 program. The resulting alignment was manually refined using SeaView version 4 and regions where homology was doubtful were removed from further analysis. A total of 266 amino acids positions were kept for the phylogenetic analysis. The tree was obtained using Neighbor-Joining (NJ), approaches in the Phylogenetic Inference Package Phylip version 3.69. The PROTDIST program was used to create distance matrices. The NEIGHBOR program was used for NJ analysis and the sequence input order was randomized (20 jumbles). The SEQBOOT and CONSENSE programs were used for bootstrap value calculations on 100 replications and consensus tree reconstructions, respectively. The phylogenetic trees were drawn with Dendroscope version 3.