BACTERIAL VACCINES DEFICIENT IN THE 2-C-METHYL-D-ERYTHRITOL-4-PHOSPHATE PATHWAY AND METHODS OF PREPARATION AND USE THEREOF
20170216420 · 2017-08-03
Inventors
Cpc classification
C12N15/74
CHEMISTRY; METALLURGY
Y02A50/30
GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
International classification
Abstract
The present invention relates to the preparation and use in primates of whole organismvaccines in which the MEP pathway is disrupted such that synthesis of HMBPP by the bacterial cells is substantially blocked. The data provided demonstrates that, when bacteria or other vaccine vectors that comprise an active MEP pathway are used in vaccine methods, the γδ T cell response dominates, potentially clearing the vaccine strain via γδ T cell-mediated killing of vector infected antigen presenting cells and reducing its utility as a stimulator of a productive adaptive immune response, specifically priming or boosting of CD4.sup.+ and CD8.sup.+ αβ T cell responses, specific for listerial-encoded antigens. By disrupting the MEP pathway, activation and expansion of γδ T cells is limited in the recipient primate, resulting in resulting in an increase in the magnitude and duration of inflammation and in the magnitude and duration of antigen presentation by the cellular vaccine.
Claims
1. A method of inducing an αβ T-cell response to at least one polypeptide antigen in a primate, said method comprising: expressing the at least one polypeptide antigen from a cell administered to the primate, wherein the at least one polypeptide antigen is heterologous to the cell, and wherein the cell comprises a functionally deleted MEP pathway resulting in substantially blocked HMBPP production by the cell.
2. The method of claim 1 wherein the cell is a bacterium that optionally comprises a functional mevalonate pathway whereby the bacterium produces IPP in an amount sufficient for bacterial growth.
3. The method of claim 2 wherein the bacterium comprises a disruption in one or more genes which encode a protein selected from the group consisting of DOXP synthase, DOXP reductoisomerase, CDP-ME synthase, CDP-MW kinase, MEcPP synthase, and HMB-PP synthase.
4. The method of claim 3, wherein the bacterium genus is selected from the group consisting of Listeria, Neisseria, Mycobacterium, Francisella, Bacillus, Salmonella, Shigella, Yersinia, Brucella, Legionella, Rickettsia, and Chlamydia.
5. The method of claim 4, wherein the bacterium is Listeria monocytogenes.
6. The method of claim 5, wherein the bacterium comprises a disruption in HMB-PP synthase.
7. The method of claim 1, wherein the cell comprises a nucleic acid sequence encoding said at least one polypeptide antigen integrated into the genome of said cell operably linked to control sequences which cause the expression of the at least one polypeptide antigen by the cell.
8. The method of claim 7, wherein the cell is a Listeria monocytogenes which is an actA deletion mutant or an actA insertion mutant, an inlB deletion mutant or an inlB insertion mutant or a ΔactA/ΔinlB mutant comprising both an actA deletion or an actA insertion and an inlB deletion or an inlB insertion.
9. The method of claim 1, wherein the cell is a Listeria monocytogenes deleted of prfA on the bacterial chromosome and harbors an extra-chromosomal plasmid encoding PrfA.
10. The method of claim 7, wherein said nucleic acid sequence has been integrated into a virulence gene of said bacterium, and the integration of said nucleic acid sequence disrupts expression of the virulence gene or disrupts a coding sequence of the virulence gene.
11. The method of claim 10, wherein the virulence gene is actA or inlB.
12. The method of claim 1, wherein the cell is an attenuated Listeria monocytogenes.
13. The method of claim 12, wherein the bacterium is Lm ΔactA/ΔinlB.
14. The method of claim 13, wherein the bacterium further comprises a genetic mutation that attentuates the ability of the bacterium to repair nucleic acid.
15. The method of claim 14, wherein the genetic mutation is in one or more genes selected from phrB, uvrA, uvrB, uvrC, uvrD and recA.
16. The method of claim 12, wherein the bacterium is a Listeria monocytogenes prfA mutant, the genome of which encodes a prfA protein which is constitutively active.
17. The method of claim 12, wherein the bacterium is a killed but metabolically active Listeria monocytogenes.
18. The method of claim 17, wherein the bacterium is a Listeria monocytogenes prfA mutant, the genome of which encodes a prfA protein which is constitutively active.
19. The method of claim 7, wherein the nucleic acid sequence is codon optimized for expression by the cell according to the cell's preferred codon usage.
20. The method of claim 7, wherein said cell is a bacterium administered by one or more routes of administration selected from the group consisting of orally, intramuscularly, intravenously, intradermally, and subcutaneously to said subject.
21. The method of claim 1, wherein said at least one polypeptide antigen is expressed as a fusion protein comprising a secretory signal sequence.
22. The method of claim 21, wherein the secretory signal sequence is a Listeria monocytogenes ActA signal sequence.
23. The method of claim 1, wherein the at least one polypeptide antigens is a (are) cancer antigen(s).
24. The method of claim 1, wherein said composition, when delivered to said subject, induces an increase in the serum concentration of one or more proteins selected from the group consisting of IL-12p70, IFN-γ, IL-6, TNF a, and MCP-1 at 24 hours following said delivery; and induces a CD4+ and/or CD8+ antigen-specific T cell response against the at least one polypeptide antigens.
25. The method of claim 1, wherein the cell is administered according to an administration protocol which induces both αβ and γδ T cell populations in a subject.
26. The method of claim 25, wherein the cell is administered as a boost vaccine following administrayion of a prime vaccine which induces αβ cell populations but not γδ T cell populations.
27. A composition comprising: a cell comprising a nucleic acid encoding at least one polypeptide antigen heterologous to the cell, the nucleic acid operably linked to one or more relgulatory sequences for expression of the at least one polypeptide antigen by the cell; and a functionally deleted MEP pathway resulting in substantially blocked HMBPP production by the cell.
28-48. (canceled)
49. A pharmaceutical composition comprising: the composition of claim 27; and a pharmaceutically acceptable excipient.
Description
BRIEF DESCRIPTION OF THE FIGURES
[0022]
[0023]
[0024]
[0025]
[0026]
[0027]
[0028]
DETAILED DESCRIPTION OF THE INVENTION
[0029] The present invention relates to the preparation and use in primates of bacterial vaccines in which the MEP pathyway is disrupted such that synthesis of HMBPP by the bacterial cells is substantially blocked. The present invention can provide bacterial vaccine strains with advantageous therapeutic profiles for use treatment or prevention of diseases. While described hereinafter in detail with regard to Listeria monocytogenes, the skilled artisan will understand that the methods and compositions described herein are generally applicable to bacterial species, and in particular to facultative intracellular bacterial species.
[0030] Listeria monocytogenes (Lm) is a facultative intracellular bacterium characterized by its ability to induce a profound innate immune response through activation of multiple sensors, including TLRs, NODs and STING, leading to a robust and highly functional CD4 and CD8 T cell immunity specific for vaccine-encoded Ags. Lm is a food-borne bacterium with increased pathogenicity among immune compromised individuals, including patients with cancer or other viral-induced immune deficiencies, pregnant women, the elderly and infants. Live-attenuated recombinant Lm vaccine platforms engineered to encode a designated antigen(s) relevant to a selected targeted pathogenic agent or malignancy have formed the basis for several human clinical trials.
[0031] T cells are subdivided into two major populations distinguished by their surface expression of αβ and γδ T cell receptors (TCR). Both αβ and γδ T cells arise from common multipotent double negative (DN) precursors in the thymus, which can be further separated into four DN subsets based on CD44 and CD25 expression. The T cells undergo extensive DNA rearrangements at the β, γ and δ TCR loci aiming to express functional TCR chains and make a selection between two developmental programs during the DN3 stage, thus generating two distinct characteristics and functions of T cell subsets. Cells with the αβ TCR generally express CD4 or CD8 lineage markers and mostly fall into helper or cytotoxiceffector and memory subsets. Genetically defined live-attenuated Lm ΔactAΔinlB, which is deleted of two virulence genes and is attenuated >3 logs in the mouse listeriosis model, retains its immunologic potency and has been shown to induce robust CD4 and CD8 T cell immunity in both mouse models of human disease as well as in humans, and has been shown to be safe and well-tolerated in clinical settings among patients with various solid tumor malignancies.
[0032] There are several other approaches to attenuate wild-type Listeria monocytogenes that may also be adopted for use in humans to prevent or treat infections and diverse malignancies. Non-limiting examples of said approaches include, for example, deletion or mutation of ActA (Lm ΔactA), or deletion of the Lm master transcription regulator PrfA (Lm ΔprfA) required for activation of expression of virulence genes required for intracellular growth, and complementing the deletion by expression of PrfA from an extra-bacterial chromosomal plasmid element. Heterologous antigen expression cassettes can also be incorporated into this plasmid element, in addition to the PrfA-encoding sequences. It will be apparent to those skilled in the art that the various methods of attenuations provided here as non-limiting examples can be combined.
[0033] In contrast to the CD4 and CD8 T cell lineages seen in these clinical trials, γδ T cells, and in particular Vγ9/Vδ2 T cells, are unique to humans and primates and represent a normal constituent of the leukocyte population in peripheral blood (0.5-5%). This T cell population expands dramatically in many acute infections and may exceed all other lymphocytes within a few days, e.g. in tuberculosis, salmonellosis, ehrlichiosis, brucellosis, tularemia, listeriosis, toxoplasmosis, and malaria. Vγ9/Vδ2 T cells recognize the small microbial compound (E)-4-hydroxy-3-methyl-but-2-enyl pyrophosphate (HMB-PP), a natural intermediate of the non-mevalonate pathway of isopentenyl pyrophosphate (IPP) biosynthesis.[11] HMB-PP is an essential metabolite in most pathogenic bacteria including Mycobacterium tuberculosis and malaria parasites, but is absent from the human host. Bacterial species that lack the non-mevalonate pathway and synthesize IPP via the classical mevalonate pathway instead, such as Streptococcus, Staphylococcus, and Borrelia, are unable to produce HMB-PP and do not specifically activate Vγ9/Vδ2 T cells.
[0034] As demonstrated below, γδ T cells unexpectedly dominate the T cell response observed in certain clinical trials of Listerial vaccines. γδ T cells exhibit varying degrees of cytolytic activity to various kinds of malignancies, and exhibit broad cytotoxic activity against a wide variety of tumor cells, in which they utilize death receptor/ligand (e.g. Fas/Fas-ligand)-dependent and perforin/granzyme- or granulysin-dependent pathways. For this reason, γδ T cells have been proposed as a useful tool for cancer immunotherapy. However, in the context of bacterial vaccine platforms, this γδ T cell response has a negative effect by causing the vaccine platform to be cleared from the host, thereby limiting its effectiveness as a vaccine.
[0035] It is to be understood that the invention is not limited in its application to the details of construction and to the arrangements of the components set forth in the following description or illustrated in the drawings. The invention is capable of embodiments in addition to those described and of being practiced and carried out in various ways. Also, it is to be understood that the phraseology and terminology employed herein, as well as the abstract, are for the purpose of description and should not be regarded as limiting.
[0036] As such, those skilled in the art will appreciate that the conception upon which this disclosure is based may readily be utilized as a basis for the designing of other structures, methods and systems for carrying out the several purposes of the present invention. It is important, therefore, that the claims be regarded as including such equivalent constructions insofar as they do not depart from the spirit and scope of the present invention.
1. Definitions
[0037] Abbreviations used to indicate a mutation in a gene, or a mutation in a bacterium comprising the gene, are as follows. By way of example, the abbreviation “L. monocytogenes ΔactA” means that part, or all, of the actA gene was deleted. The delta symbol (Δ) means deletion. An abbreviation including a superscripted minus sign (Listeria ActA.sup.−) means that the actA gene was mutated, e.g., by way of a deletion, point mutation, or frameshift mutation, but not limited to these types of mutations.
[0038] “Administration” as it applies to a human, primate, mammal, mammalian subject, animal, veterinary subject, placebo subject, research subject, experimental subject, cell, tissue, organ, or biological fluid, refers without limitation to contact of an exogenous ligand, reagent, placebo, small molecule, pharmaceutical agent, therapeutic agent, diagnostic agent, or composition to the subject, cell, tissue, organ, or biological fluid, and the like. “Administration” can refer, e.g., to therapeutic, pharmacokinetic, diagnostic, research, placebo, and experimental methods. Treatment of a cell encompasses contact of a reagent to the cell, as well as contact of a reagent to a fluid, where the fluid is in contact with the cell. “Administration” also encompasses in vitro and ex vivo treatments, e.g., of a cell, by a reagent, diagnostic, binding composition, or by another cell.
[0039] An “agonist,” as it relates to a ligand and receptor, comprises a molecule, combination of molecules, a complex, or a combination of reagents, that stimulates the receptor. For example, an agonist of granulocyte-macrophage colony stimulating factor (GM-CSF) can encompass GM-CSF, a mutein or derivative of GM-CSF, a peptide mimetic of GM-CSF, a small molecule that mimics the biological function of GM-CSF, or an antibody that stimulates GM-CSF receptor.
[0040] An “antagonist,” as it relates to a ligand and receptor, comprises a molecule, combination of molecules, or a complex, that inhibits, counteracts, downregulates, and/or desensitizes the receptor. “Antagonist” encompasses any reagent that inhibits a constitutive activity of the receptor. A constitutive activity is one that is manifest in the absence of a ligand/receptor interaction. “Antagonist” also encompasses any reagent that inhibits or prevents a stimulated (or regulated) activity of a receptor. By way of example, an antagonist of GM-CSF receptor includes, without implying any limitation, an antibody that binds to the ligand (GM-CSF) and prevents it from binding to the receptor, or an antibody that binds to the receptor and prevents the ligand from binding to the receptor, or where the antibody locks the receptor in an inactive conformation.
[0041] As used herein, an “analog” or “derivative” with reference to a peptide, polypeptide or protein refers to another peptide, polypeptide or protein that possesses a similar or identical function as the original peptide, polypeptide or protein, but does not necessarily comprise a similar or identical amino acid sequence or structure of the original peptide, polypeptide or protein. An analog preferably satisfies at least one of the following: (a) a proteinaceous agent having an amino acid sequence that is at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% or at least 99% identical to the original amino acid sequence (b) a proteinaceous agent encoded by a nucleotide sequence that hybridizes under stringent conditions to a nucleotide sequence encoding the original amino acid sequence; and (c) a proteinaceous agent encoded by a nucleotide sequence that is at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% or at least 99% identical to the nucleotide sequence encoding the original amino acid sequence.
[0042] “Antigen presenting cells” (APCs) are cells of the immune system used for presenting antigen to T cells. APCs include dendritic cells, monocytes, macrophages, marginal zone Kupffer cells, microglia, Langerhans cells, T cells, and B cells. Dendritic cells occur in at least two lineages. The first lineage encompasses pre-DC1, myeloid DC1, and mature DC1. The second lineage encompasses CD34.sup.+CD45RA.sup.− early progenitor multipotent cells, CD34.sup.+CD45RA.sup.+ cells, CD34.sup.+CD45RA.sup.+CD4.sup.+ IL-3Rα.sup.+ pro-DC2 cells, CD4.sup.+CD11c.sup.− plasmacytoid pre-DC2 cells, lymphoid human DC2 plasmacytoid-derived DC2s, and mature DC2s.
[0043] “Attenuation” and “attenuated” encompasses a bacterium, virus, parasite, infectious organism, prion, tumor cell, gene in the infectious organism, and the like, that is modified to reduce toxicity to a host. The host can be a human or animal host, or an organ, tissue, or cell. The bacterium, to give a non-limiting example, can be attenuated to reduce binding to a host cell, to reduce spread from one host cell to another host cell, to reduce extracellular growth, or to reduce intracellular growth in a host cell. Attenuation can be assessed by measuring, e.g., an indicum or indicia of toxicity, the LD.sub.50, the rate of clearance from an organ, or the competitive index (see, e.g., Auerbuch, et al. (2001) Infect. Immunity 69:5953-5957). Generally, an attenuation results an increase in the LD.sub.50 and/or an increase in the rate of clearance by at least 25%; more generally by at least 50%; most generally by at least 100% (2-fold); normally by at least 5-fold; more normally by at least 10-fold; most normally by at least 50-fold; often by at least 100-fold; more often by at least 500-fold; and most often by at least 1000-fold; usually by at least 5000-fold; more usually by at least 10,000-fold; and most usually by at least 50,000-fold; and most often by at least 100,000-fold.
[0044] “Attenuated gene” encompasses a gene that mediates toxicity, pathology, or virulence, to a host, growth within the host, or survival within the host, where the gene is mutated in a way that mitigates, reduces, or eliminates the toxicity, pathology, or virulence. The reduction or elimination can be assessed by comparing the virulence or toxicity mediated by the mutated gene with that mediated by the non-mutated (or parent) gene. “Mutated gene” encompasses deletions, point mutations, and frameshift mutations in regulatory regions of the gene, coding regions of the gene, non-coding regions of the gene, or any combination thereof.
[0045] “Conservatively modified variants” applies to both amino acid and nucleic acid sequences. With respect to particular nucleic acid sequences, a conservatively modified variant refers to nucleic acids encoding identical amino acid sequences, or amino acid sequences that have one or more conservative substitutions. An example of a conservative substitution is the exchange of an amino acid in one of the following groups for another amino acid of the same group (U.S. Pat. No. 5,767,063 issued to Lee, et al.; Kyte and Doolittle (1982) J. Mol. Biol. 157:105-132).
(1) Hydrophobic: Norleucine, Ile, Val, Leu, Phe, Cys, Met;
[0046] (2) Neutral hydrophilic: Cys, Ser, Thr;
(3) Acidic: Asp, Glu;
(4) Basic: Asn, Gln, His, Lys, Arg;
[0047] (5) Residues that influence chain orientation: Gly, Pro;
(6) Aromatic: Trp, Tyr, Phe; and
[0048] (7) Small amino acids: Gly, Ala, Ser.
[0049] “Effective amount” encompasses, without limitation, an amount that can ameliorate, reverse, mitigate, prevent, or diagnose a symptom or sign of a medical condition or disorder. Unless dictated otherwise, explicitly or by context, an “effective amount” is not limited to a minimal amount sufficient to ameliorate a condition.
[0050] An “extracellular fluid” encompasses, e.g., serum, plasma, blood, interstitial fluid, cerebrospinal fluid, secreted fluids, lymph, bile, sweat, fecal matter, and urine. An “extracelluar fluid” can comprise a colloid or a suspension, e.g., whole blood or coagulated blood.
[0051] The term “fragments” in the context of polypeptides include a peptide or polypeptide comprising an amino acid sequence of at least 5 contiguous amino acid residues, at least 10 contiguous amino acid residues, at least 15 contiguous amino acid residues, at least 20 contiguous amino acid residues, at least 25 contiguous amino acid residues, at least 40 contiguous amino acid residues, at least 50 contiguous amino acid residues, at least 60 contiguous amino residues, at least 70 contiguous amino acid residues, at least 80 contiguous amino acid residues, at least 90 contiguous amino acid residues, at least 100 contiguous amino acid residues, at least 125 contiguous amino acid residues, at least 150 contiguous amino acid residues, at least 175 contiguous amino acid residues, at least 200 contiguous amino acid residues, or at least 250 contiguous amino acid residues of the amino acid sequence of a larger polypeptide.
[0052] “Gene” refers to a nucleic acid sequence encoding an oligopeptide or polypeptide. The oligopeptide or polypeptide can be biologically active, antigenically active, biologically inactive, or antigenically inactive, and the like. The term gene encompasses, e.g., the sum of the open reading frames (ORFs) encoding a specific oligopeptide or polypeptide; the sum of the ORFs plus the nucleic acids encoding introns; the sum of the ORFs and the operably linked promoter(s); the sum of the ORFS and the operably linked promoter(s) and any introns; the sum of the ORFS and the operably linked promoter(s), intron(s), and promoter(s), and other regulatory elements, such as enhancer(s). In certain embodiments, “gene” encompasses any sequences required in cis for regulating expression of the gene. The term gene can also refer to a nucleic acid that encodes a peptide encompassing an antigen or an antigenically active fragment of a peptide, oligopeptide, polypeptide, or protein. The term gene does not necessarily imply that the encoded peptide or protein has any biological activity, or even that the peptide or protein is antigenically active. A nucleic acid sequence encoding a non-expressable sequence is generally considered a pseudogene. The term gene also encompasses nucleic acid sequences encoding a ribonucleic acid such as rRNA, tRNA, or a ribozyme.
[0053] “Growth” of a bacterium such as Listeria encompasses, without limitation, functions of bacterial physiology and genes relating to colonization, replication, increase in protein content, and/or increase in lipid content. Unless specified otherwise explicitly or by context, growth of a Listeria encompasses growth of the bacterium outside a host cell, and also growth inside a host cell, and, possibly, intracellular spread to neighboring cells. Growth related genes include, without implying any limitation, those that mediate energy production (e.g., glycolysis, Krebs cycle, cytochromes), anabolism and/or catabolism of amino acids, sugars, lipids, minerals, purines, and pyrimidines, nutrient transport, transcription, translation, and/or replication. In some embodiments, “growth” of a Listeria bacterium refers to intracellular growth of the Listeria bacterium, that is, growth inside a host cell such as a mammalian cell. While intracellular growth of a Listeria bacterium can be measured by light microscopy or colony forming unit (CFU) assays, growth is not to be limited by any technique of measurement. Biochemical parameters such as the quantity of a Listerial antigen, Listerial nucleic acid sequence, or lipid specific to the Listeria bacterium, can be used to assess growth. In some embodiments, a gene that mediates growth is one that specifically mediates intracellular growth. In some embodiments, a gene that specifically mediates intracellular growth encompasses, but is not limited to, a gene where inactivation of the gene reduces the rate of intracellular growth but does not detectably, substantially, or appreciably, reduce the rate of extracellular growth (e.g., growth in broth), or a gene where inactivation of the gene reduces the rate of intracellular growth to a greater extent than it reduces the rate of extracellular growth. To provide a non-limiting example, in some embodiments, a gene where inactivation reduces the rate of intracellular growth to a greater extent than extracellular growth encompasses the situation where inactivation reduces intracellular growth to less than 50% the normal or maximal value, but reduces extracellular growth to only 1-5%, 5-10%, or 10-15% the maximal value. The invention, in certain aspects, encompasses a Listeria attenuated in intracellular growth but not attenuated in extracellular growth, a Listeria not attenuated in intracellular growth and not attenuated in extracellular growth, as well as a Listeria not attenuated in intracellular growth but attenuated in extracellular growth.
[0054] A composition that is “labeled” is detectable, either directly or indirectly, by spectroscopic, photochemical, biochemical, immunochemical, isotopic, or chemical methods. For example, useful labels include .sup.32P, .sup.33P, .sup.35S, .sup.14C, .sup.3H, .sup.125I stable isotopes, epitope tags, fluorescent dyes, electron-dense reagents, substrates, or enzymes, e.g., as used in enzyme-linked immunoassays, or fluorettes (see, e.g., Rozinov and Nolan (1998) Chem. Biol. 5:713-728).
[0055] “Ligand” refers to a small molecule, peptide, polypeptide, or membrane associated or membrane-bound molecule, that is an agonist or antagonist of a receptor. “Ligand” also encompasses a binding agent that is not an agonist or antagonist, and has no agonist or antagonist properties. By convention, where a ligand is membrane-bound on a first cell, the receptor usually occurs on a second cell. The second cell may have the same identity (the same name), or it may have a different identity (a different name), as the first cell. A ligand or receptor may be entirely intracellular, that is, it may reside in the cytosol, nucleus, or in some other intracellular compartment. The ligand or receptor may change its location, e.g., from an intracellular compartment to the outer face of the plasma membrane. The complex of a ligand and receptor is termed a “ligand receptor complex.” Where a ligand and receptor are involved in a signaling pathway, the ligand occurs at an upstream position and the receptor occurs at a downstream position of the signaling pathway.
[0056] “Nucleic acid” refers to deoxyribonucleotides or ribonucleotides and polymers thereof in either single stranded, double-stranded form, or multi-stranded form. Non-limiting examples of a nucleic acid are a, e.g., cDNA, mRNA, oligonucleotide, and polynucleotide. A particular nucleic acid sequence can also implicitly encompasses “allelic variants” and “splice variants.”
[0057] “Operably linked” in the context of a promoter and a nucleic acid encoding a mRNA means that the promoter can be used to initiate transcription of that nucleic acid.
[0058] The terms “percent sequence identity” and “% sequence identity” refer to the percentage of sequence similarity found by a comparison or alignment of two or more amino acid or nucleic acid sequences. Percent identity can be determined by a direct comparison of the sequence information between two molecules by aligning the sequences, counting the exact number of matches between the two aligned sequences, dividing by the length of the shorter sequence, and multiplying the result by 100. An algorithm for calculating percent identity is the Smith-Waterman homology search algorithm (see, e.g., Kann and Goldstein (2002) Proteins 48:367-376; Arslan, et al. (2001) Bioinformatics 17:327-337).
[0059] By “purified” and “isolated” is meant, when referring to a polypeptide, that the polypeptide is present in the substantial absence of the other biological macromolecules with which it is associated in nature. The term “purified” as used herein means that an identified polypeptide often accounts for at least 50%, more often accounts for at least 60%, typically accounts for at least 70%, more typically accounts for at least 75%, most typically accounts for at least 80%, usually accounts for at least 85%, more usually accounts for at least 90%, most usually accounts for at least 95%, and conventionally accounts for at least 98% by weight, or greater, of the polypeptides present. The weights of water, buffers, salts, detergents, reductants, protease inhibitors, stabilizers (including an added protein such as albumin), and excipients, and molecules having a molecular weight of less than 1000, are generally not used in the determination of polypeptide purity. See, e.g., discussion of purity in U.S. Pat. No. 6,090,611 issued to Covacci, et al.
[0060] “Peptide” refers to a short sequence of amino acids, where the amino acids are connected to each other by peptide bonds. A peptide may occur free or bound to another moiety, such as a macromolecule, lipid, oligo- or polysaccharide, and/or a polypeptide. Where a peptide is incorporated into a polypeptide chain, the term “peptide” may still be used to refer specifically to the short sequence of amino acids. A “peptide” may be connected to another moiety by way of a peptide bond or some other type of linkage. A peptide is at least two amino acids in length and generally less than about 25 amino acids in length, where the maximal length is a function of custom or context. The terms “peptide” and “oligopeptide” may be used interchangeably.
[0061] “Protein” generally refers to the sequence of amino acids comprising a polypeptide chain. Protein may also refer to a three dimensional structure of the polypeptide. “Denatured protein” refers to a partially denatured polypeptide, having some residual three dimensional structure or, alternatively, to an essentially random three dimensional structure, i.e., totally denatured. The invention encompasses reagents of, and methods using, polypeptide variants, e.g., involving glycosylation, phosphorylation, sulfation, disulfide bond formation, deamidation, isomerization, cleavage points in signal or leader sequence processing, covalent and non-covalently bound cofactors, oxidized variants, and the like. The formation of disulfide linked proteins is described (see, e.g., Woycechowsky and Raines (2000) Curr. Opin. Chem. Biol. 4:533-539; Creighton, et al. (1995) Trends Biotechnol. 13:18-23).
[0062] “Recombinant” when used with reference, e.g., to a nucleic acid, cell, animal, virus, plasmid, vector, or the like, indicates modification by the introduction of an exogenous, non-native nucleic acid, alteration of a native nucleic acid, or by derivation in whole or in part from a recombinant nucleic acid, cell, virus, plasmid, or vector. Recombinant protein refers to a protein derived, e.g., from a recombinant nucleic acid, virus, plasmid, vector, or the like. “Recombinant bacterium” encompasses a bacterium where the genome is engineered by recombinant methods, e.g., by way of a mutation, deletion, insertion, and/or a rearrangement. “Recombinant bacterium” also encompasses a bacterium modified to include a recombinant extra-genomic nucleic acid, e.g., a plasmid or a second chromosome, or a bacterium where an existing extra-genomic nucleic acid is altered.
[0063] “Sample” refers to a sample from a human, animal, placebo, or research sample, e.g., a cell, tissue, organ, fluid, gas, aerosol, slurry, colloid, or coagulated material. The “sample” may be tested in vivo, e.g., without removal from the human or animal, or it may be tested in vitro. The sample may be tested after processing, e.g., by histological methods. “Sample” also refers, e.g., to a cell comprising a fluid or tissue sample or a cell separated from a fluid or tissue sample. “Sample” may also refer to a cell, tissue, organ, or fluid that is freshly taken from a human or animal, or to a cell, tissue, organ, or fluid that is processed or stored.
[0064] A “selectable marker” encompasses a nucleic acid that allows one to select for or against a cell that contains the selectable marker. Examples of selectable markers include, without limitation, e.g.: (1) A nucleic acid encoding a product providing resistance to an otherwise toxic compound (e.g., an antibiotic), or encoding susceptibility to an otherwise harmless compound (e.g., sucrose); (2) A nucleic acid encoding a product that is otherwise lacking in the recipient cell (e.g., tRNA genes, auxotrophic markers); (3) A nucleic acid encoding a product that suppresses an activity of a gene product; (4) A nucleic acid that encodes a product that can be readily identified (e.g., phenotypic markers such as beta-galactosidase, green fluorescent protein (GFP), cell surface proteins, an epitope tag, a FLAG tag); (5) A nucleic acid that can be identified by hybridization techniques, for example, PCR or molecular beacons.
[0065] “Specifically” or “selectively” binds, when referring to a ligand/receptor, nucleic acid/complementary nucleic acid, antibody/antigen, or other binding pair (e.g., a cytokine to a cytokine receptor) indicates a binding reaction which is determinative of the presence of the protein in a heterogeneous population of proteins and other biologics. Thus, under designated conditions, a specified ligand binds to a particular receptor and does not bind in a significant amount to other proteins present in the sample. Specific binding can also mean, e.g., that the binding compound, nucleic acid ligand, antibody, or binding composition derived from the antigen-binding site of an antibody, of the contemplated method binds to its target with an affinity that is often at least 25% greater, more often at least 50% greater, most often at least 100% (2-fold) greater, normally at least ten times greater, more normally at least 20-times greater, and most normally at least 100-times greater than the affinity with any other binding compound.
[0066] In a typical embodiment an antibody will have an affinity that is greater than about 10.sup.9 liters/mol, as determined, e.g., by Scatchard analysis (Munsen, et al. (1980) Analyt. Biochem. 107:220-239). It is recognized by the skilled artisan that some binding compounds can specifically bind to more than one target, e.g., an antibody specifically binds to its antigen, to lectins by way of the antibody's oligosaccharide, and/or to an Fc receptor by way of the antibody's Fc region.
[0067] “Spread” of a bacterium encompasses “cell to cell spread,” that is, transmission of the bacterium from a first host cell to a second host cell, as mediated, for example, by a vesicle. Functions relating to spread include, but are not limited to, e.g., formation of an actin tail, formation of a pseudopod-like extension, and formation of a double-membraned vacuole.
[0068] The term “subject” as used herein refers to a human or non-human organism. Thus, the methods and compositions described herein are applicable to both human and veterinary disease. In certain embodiments, subjects are “patients,” i.e., living humans that are receiving medical care for a disease or condition. This includes persons with no defined illness who are being investigated for signs of pathology.
[0069] The “target site” of a recombinase is the nucleic acid sequence or region that is recognized, bound, and/or acted upon by the recombinase (see, e.g., U.S. Pat. No. 6,379,943 issued to Graham, et al.; Smith and Thorpe (2002) Mol. Microbiol. 44:299-307; Groth and Calos (2004) J. Mol. Biol. 335:667-678; Nunes-Duby, et al. (1998) Nucleic Acids Res. 26:391-406).
[0070] “Therapeutically effective amount” is defined as an amount of a reagent or pharmaceutical composition that is sufficient to induce a desired immune response specific for encoded heterologous antigens, show a patient benefit, i.e., to cause a decrease, prevention, or amelioration of the symptoms of the condition being treated. When the agent or pharmaceutical composition comprises a diagnostic agent, a “diagnostically effective amount” is defined as an amount that is sufficient to produce a signal, image, or other diagnostic parameter. Effective amounts of the pharmaceutical formulation will vary according to factors such as the degree of susceptibility of the individual, the age, gender, and weight of the individual, and idiosyncratic responses of the individual (see, e.g., U.S. Pat. No. 5,888,530 issued to Netti, et al.).
[0071] “Treatment” or “treating” (with respect to a condition or a disease) is an approach for obtaining beneficial or desired results including and preferably clinical results. For purposes of this invention, beneficial or desired results with respect to a disease include, but are not limited to, one or more of the following: improving a condition associated with a disease, curing a disease, lessening severity of a disease, delaying progression of a disease, alleviating one or more symptoms associated with a disease, increasing the quality of life of one suffering from a disease, and/or prolonging survival. Likewise, for purposes of this invention, beneficial or desired results with respect to a condition include, but are not limited to, one or more of the following: improving a condition, curing a condition, lessening severity of a condition, delaying progression of a condition, alleviating one or more symptoms associated with a condition, increasing the quality of life of one suffering from a condition, and/or prolonging survival.
[0072] “Vaccine” encompasses preventative vaccines. Vaccine also encompasses therapeutic vaccines, e.g., a vaccine administered to a mammal that comprises a condition or disorder associated with the antigen or epitope provided by the vaccine. A number of bacterial species have been developed for use as vaccines and can be used in the present invention, including, but not limited to, Shigella flexneri, Escherichia coli, Listeria monocytogenes, Yersinia enterocolitica, Salmonella typhimurium, Salmonella typhi or mycobacterium species. This list is not meant to be limiting. See, e.g., WO04/006837; WO07/103225; and WO07/117371, each of which is hereby incorporated by reference in its entirety, including all tables, figures, and claims. The bacterial vector used in the vaccine composition may be a facultative, intracellular bacterial vector. The bacterium may be used to deliver a polypeptide described herein to antigen-presenting cells in the host organism. As described herein, L. monocytogenes provides a preferred vaccine platform for expression of the antigens of the present invention.
2. Functional Deletion of Genes of the MEP Pathway
[0073] Preferred genes to target for functional deletion include those that encode a protein selected from the group consisting of DOXP synthase, DOXP reductoisomerase, CDP-ME synthase, CDP-MW kinase, MEcPP synthase, and HMB-PP synthase. A description of the MEP pathway, containing a listing of the corresponding Listeria genes, including entry number in the Pasteur L. monocytogenes and L. innocua ListiList database, is provided in
[0074] The term “functional deletion” as used herein with respect to a particular enzymatic activity refers to a level of enzymatic activity that is 10% or less of that measured in a comparable wild type bacterial cell of the same species. The mutations described herein for functional deletion of one or more genes in the MEP pathway may be any mutation, such as one or more nucleic acid deletions, insertions or substitutions. The mutations may be any deletion, insertion or substitution of the loci or genes that results in a reduction or absence of expression from the loci or genes, or a reduction or absence of activity of a polypeptide encoded by the loci or genes. The mutations may be in the coding or non-coding regions of the loci or genes. Such reduced enzymatic activities can be the result of lower enzyme concentration, lower specific activity of an enzyme, or a combination thereof.
[0075] Many different methods can be used to make bacteria having reduced enzymatic activity. For example, several methods for disrupting gene functions are well-known in the art and may be used in the practice of the invention. Such methods include, but are not limited to, gene replacement by homologous recombination, antisense technologies, and RNA interference. To delete or inactivate a target gene, for example, a method involving homologous recombination may be used. That is, a cyclic recombinant plasmid obtained by cloning a DNA fragment containing a part of the target gene in an appropriate plasmid can be transfected into the cells of a parent microorganism, so that the target gene on the genome of the parent microorganism is split by homologous recombination in some region of the target gene, thereby inactivating the target gene. Alternatively, it is also possible to substitute a target gene on the genome with a deleted or inactivated gene fragment, by constructing a target gene inactivated through mutation such as base substitution or base insertion, or a linear DNA fragment containing the upstream and downstream regions of the target gene but not containing the target gene, and introducing the resultant sequences into the cells of a parent microorganism, to thereby cause double crossover homologous recombination at two sites exterior to the mutation site within the target gene on the genome of the parent microorganism, or on the upstream side and downstream side of the target gene.
[0076] Alternatively, one or more enzymes within the MEP pathway may be targeted chemically in order to functionally delete the enzymatic activity of interest. By way of example, fosmidomycin is an antibiotic that specifically inhibits DOXP reductoisomerase.
3. Heterologous Antigen Expression
[0077] The ability of L. monocytogenes to serve as a vaccine vector has been reviewed in Wesikirch, et al., Immunol. Rev. 158:159-169 (1997). A number of desirable features of the natural biology of L. monocytogenes make it an attractive platform for application to a therapeutic vaccine. The central rationale is that the intracellular lifecycle of L. monocytogenes enables effective stimulation of CD4+ and CD8+ T cell immunity. Multiple pathogen associated molecular pattern (PAMP) receptors including TLRs (TLR2, TLR5, TLR9) nucleotide-binding oligomerization domains (NOD), and Stimulator of Interferon Genes (STING) are triggered in response to interaction with L. monocytogenes macromolecules upon infection, resulting in the pan-activation of innate immune effectors and release of Th-1 polarizing cytokines, exerting a profound impact on the development of a CD4+ and CD8+ T cell response against the expressed antigens.
[0078] Strains of L. monocytogenes have recently been developed as effective intracellular delivery vehicles of heterologous proteins providing delivery of antigens to the immune system to induce an immune response to clinical conditions that do not permit injection of the disease-causing agent, such as cancer and HIV. See, e.g., U.S. Pat. No. 6,051,237; Gunn et al., J. Immunol., 167:6471-6479 (2001); Liau, et al., Cancer Research, 62: 2287-2293 (2002); Le, et. al., Clinical Cancer Research 18: 1-11 (2011); U.S. Pat. No. 6,099,848; WO 99/25376; WO 96/14087; and U.S. Pat. No. 5,830,702), each of which is hereby incorporated by reference in its entirety, including all tables, figures, and claims. A recombinant L. monocytogenes vaccine expressing an lymphocytic choriomeningitis virus (LCMV) antigen has also been shown to induce protective cell-mediated immunity to the antigen (Shen et al., Proc. Natl. Acad. Sci. USA, 92: 3987-3991 (1995).
[0079] In certain embodiments, the L. monocytogenes used in the vaccine compositions of the present invention is RIID strain which further comprises an attenuating mutation in actA and/or inlB, and preferably a deletion of all or a portion of actA and inlB (referred to herein as “Lm ΔactA/ΔinlB”), and contains recombinant DNA encoding for the expression of the one or more antigen(s) of interest. The antigen(s) are preferably under the control of bacterial expression sequences and are stably integrated into the L. monocytogenes genome.
[0080] The invention also contemplates a Listeria attenuated in at least one regulatory factor, e.g., a promoter or a transcription factor. The following concerns promoters. ActA expression is regulated by two different promoters (Vazwuez-Boland, et al. (1992) Infect. Immun. 60:219-230). Together, InlA and InlB expression is regulated by five promoters (Lingnau, et al. (1995) Infect. Immun. 63:3896-3903). The transcription factor prfA is required for transcription of a number of L. monocytogenes genes, e.g., hly, plcA, ActA, mpl, prfA, and iap. PrfA's regulatory properties are mediated by, e.g., the PrfA-dependent promoter (PinlC) and the PrfA-box. The present invention, in certain embodiments, provides a nucleic acid encoding inactivated, mutated, or deleted in at least one of ActA promoter, inlB promoter, PrfA, PinlC, PrfA box, and the like (see, e.g., Lalic Mullthaler, et al. (2001) Mol. Microbiol. 42:111-120; Shetron-Rama, et al. (2003) Mol. Microbiol. 48:1537-1551; Luo, et al. (2004) Mol. Microbiol. 52:39-52). PrfA can be made constitutively active by a Gly145Ser mutation, Gly155Ser mutation, or Glu77Lys mutation (see, e.g., Mueller and Freitag (2005) Infect. Immun. 73:1917-1926; Wong and Freitag (2004) J. Bacteriol. 186:6265-6276; Ripio, et al. (1997) J. Bacteriol. 179:1533-1540).
[0081] Examples of target antigens that may find use in the invention are listed in the following table. The target antigen may also be a fragment or fusion polypeptide comprising an immunologically active portion of the antigens listed in the table. This list is not meant to be limiting.
TABLE-US-00001 TABLE 1 Antigens Antigen Reference Tumor antigens Mesothelin GenBank Acc. No. NM_005823; U40434; NM_013404; BC003512 (see also, e.g., Hassan, et al. (2004) Clin. Cancer Res. 10: 3937-3942; Muminova, et al. (2004) BMC Cancer 4: 19; Iacobuzio-Donahue, et al. (2003) Cancer Res. 63: 8614-8622). Wilms' tumor-1 WT-1 isoform A (GenBank Acc. Nos. NM_000378; NP_000369). associated protein WT-1 isoform B (GenBank Acc. Nos. NM_024424; NP_077742). (Wt-1), including WT-1 isoform C (GenBank Acc. Nos. NM_024425; NP_077743). isoform A; isoform B; WT-1 isoform D (GenBank Acc. Nos. NM_024426; NP_077744). isoform C; isoform D. Stratum corneum GenBank Acc. No. NM_005046; NM_139277; AF332583. See chymotryptic enzyme also, e.g., Bondurant, et al. (2005) Clin. Cancer Res. 11: 3446- (SCCE), and variants 3454; Santin, et al. (2004) Gynecol. Oncol. 94: 283-288; thereof. Shigemasa, et al. (2001) Int. J. Gynecol. Cancer 11: 454-461; Sepehr, et al. (2001) Oncogene 20: 7368-7374. MHC class I See, e.g., Groh, et al. (2005) Proc. Natl. Acad. Sci. USA chain-related protein A 102: 6461-6466; GenBank Acc. Nos. NM_000247; BC_016929; (MICA); MHC class I AY750850; chain-related protein A NM_005931. (MICB). Gastrin and peptides Harris, et al. (2004) Cancer Res. 64: 5624-5631; Gilliam, et al. derived from gastrin; (2004) Eur. J. Surg. Oncol. 30: 536-543; Laheru and Jaffee (2005) gastrin/CCK-2 receptor Nature Reviews Cancer 5: 459-467. (also known as CCK-B). Glypican-3 (an antigen GenBank Acc. No. NM_004484. Nakatsura, et al. (2003) of, e.g., hepatocellular Biochem. Biophys. Res. Commun. 306: 16-25; Capurro, et al. carcinoma and (2003) Gasteroenterol. 125: 89-97; Nakatsura, et al. (2004) Clin. melanoma). Cancer Res. 10: 6612-6621). Coactosin-like protein. Nakatsura, et al. (2002) Eur. J. Immunol. 32: 826-836; Laheru and Jaffee (2005) Nature Reviews Cancer 5: 459-467. Prostate stem cell GenBank Acc. No. AF043498; AR026974; AR302232 (see also, antigen (PSCA). e.g., Argani, et al. (2001) Cancer Res. 61: 4320-4324; Christiansen, et al. (2003) Prostate 55: 9-19; Fuessel, et al. (2003) 23: 221-228). Prostate acid Small, et al. (2000) J. Clin. Oncol. 18: 3894-3903; Altwein and phosphatase (PAP); Luboldt (1999) Urol. Int. 63: 62-71; Chan, et al. (1999) Prostate prostate-specific 41: 99-109; Ito, et al. (2005) Cancer 103: 242-250; Schmittgen, et antigen (PSA); PSM; al. (2003) Int. J. Cancer 107: 323-329; Millon, et al. (1999) Eur. PSMA. Urol. 36: 278-285. Six-transmembrane See, e.g., Machlenkin, et al. (2005) Cancer Res. 65: 6435-6442; epithelial antigen of GenBank Acc. No. NM_018234; NM_001008410; NM_182915; prostate (STEAP). NM_024636; NM_012449; BC011802. Prostate carcinoma See, e.g., Machlenkin, et al. (2005) Cancer Res. 65: 6435-6442; tumor antigen-1 GenBank Acc. No. L78132. (PCTA-1). Prostate See, e.g., Machlenkin, et al. (2005) Cancer Res. 65: 6435-6442). tumor-inducing gene-1 (PTI-1). Prostate-specific gene See, e.g., Machlenkin, et al. (2005) Cancer Res. 65: 6435-6442). with homology to G protein-coupled receptor. Prostase (an antrogen See, e.g., Machlenkin, et al. (2005) Cancer Res. 65: 6435-6442; regulated serine GenBank Acc. No. BC096178; BC096176; BC096175. protease). Proteinase 3. GenBank Acc. No. X55668. Cancer-testis antigens, GenBank Acc. No. NM_001327 (NY-ESO-1) (see also, e.g., Li, et e.g., NY-ESO-1; SCP- al. (2005) Clin. Cancer Res. 11: 1809-1814; Chen, et al. (2004) 1; SSX-1; SSX-2; SSX- Proc. Natl. Acad. Sci. USA. 101(25): 9363-9368; Kubuschok, et 4; GAGE, CT7; CT8; al. (2004) Int. J. Cancer. 109: 568-575; Scanlan, et al. (2004) CT10; MAGE-1; Cancer Immun. 4: 1; Scanlan, et al. (2002) Cancer Res. 62: 4041- MAGE-2; MAGE-3; 4047; Scanlan, et al. (2000) Cancer Lett. 150: 155-164; Dalerba, et MAGE-4; MAGE-6; al. (2001) Int. J. Cancer 93: 85-90; Ries, et al. (2005) Int. J. Oncol. LAGE-1. 26: 817-824. MAGE-A1, Otte, et al. (2001) Cancer Res. 61: 6682-6687; Lee, et al. (2003) MAGE-A2; Proc. Natl. Acad. Sci. USA 100: 2651-2656; Sarcevic, et al. (2003) MAGE-A3; Oncology 64: 443-449; Lin, et al. (2004) Clin. Cancer Res. MAGE-A4; 10: 5708-5716. MAGE-A6; MAGE-A9; MAGE-A10; MAGE-A12; GAGE-3/6; NT-SAR-35; BAGE; CA125. GAGE-1; GAGE-2; De Backer, et al. (1999) Cancer Res. 59: 3157-3165; Scarcella, et GAGE-3; GAGE-4; al. (1999) Clin. Cancer Res. 5: 335-341. GAGE-5; GAGE-6; GAGE-7; GAGE-8; GAGE-65; GAGE-11; GAGE-13; GAGE-7B. HIP1R; LMNA; Scanlan, et al. (2002) Cancer Res. 62: 4041-4047. KIAA1416; Seb4D; KNSL6; TRIP4; MBD2; HCAC5; MAGEA3. DAM family of genes, Fleishhauer, et al. (1998) Cancer Res. 58: 2969-2972. e.g., DAM-1; DAM-6. RCAS1. Enjoji, et al. (2004) Dig. Dis. Sci. 49: 1654-1656. RU2. Van Den Eynde, et al. (1999) J. Exp. Med. 190: 1793-1800. CAMEL. Slager, et al. (2004) J. Immunol. 172: 5095-5102; Slager, et al. (2004) Cancer Gene Ther. 11: 227-236. Colon cancer Scanlan, et al. (2002) Cancer Res. 62: 4041-4047. associated antigens, e.g., NY-CO-8; NY-CO-9; NY-CO-13; NY-CO-16; NY-CO-20; NY-CO-38; NY-CO-45; NY-CO-9/HDAC5; NY-CO-41/MBD2; NY-CO-42/TRIP4; NY-CO-95/KIAA1416; KNSL6; seb4D. N-Acetylglucosaminyl- Dosaka-Akita, et al. (2004) Clin. Cancer Res. 10: 1773-1779. tranferase V (GnT-V). Elongation factor 2 Renkvist, et al. (2001) Cancer Immunol Immunother. 50: 3-15. mutated (ELF2M). HOM-MEL-40/SSX2 Neumann, et al. (2004) Int. J. Cancer 112: 661-668; Scanlan, et al. (2000) Cancer Lett. 150: 155-164. BRDT. Scanlan, et al. (2000) Cancer Lett. 150: 155-164. SAGE; HAGE. Sasaki, et al. (2003) Eur. J. Surg. Oncol. 29: 900-903. RAGE. See, e.g., Li, et al. (2004) Am. J. Pathol. 164: 1389-1397; Shirasawa, et al. (2004) Genes to Cells 9: 165-174. MUM-1 (melanoma Gueguen, et al. (1998) J. Immunol. 160: 6188-6194; Hirose, et al. ubiquitous mutated); (2005) Int. J. Hematol. 81: 48-57; Baurain, et al. (2000) J. MUM-2; MUM-2 Arg- Immunol. 164: 6057-6066; Chiari, et al. (1999) Cancer Res. Gly mutation; MUM-3. 59: 5785-5792. LDLR/FUT fusion Wang, et al. (1999) J. Exp. Med. 189: 1659-1667. protein antigen of melanoma. NY-REN series of renal Scanlan, et al. (2002) Cancer Res. 62: 4041-4047; Scanlan, et al. cancer antigens. (1999) Cancer Res. 83: 456-464. NY-BR series of breast Scanlan, et al. (2002) Cancer Res. 62: 4041-4047; Scanlan, et al. cancer antigens, e.g., (2001) Cancer Immunity 1: 4. NY-BR-62; NY- BR-75; NY-BR-85; NY-BR-62; NY-BR-85. BRCA-1; BRCA-2. Stolier, et al. (2004) Breast J. 10: 475-480; Nicoletto, et al. (2001) Cancer Treat Rev. 27: 295-304. DEK/CAN fusion Von Lindern, et al. (1992) Mol. Cell. Biol. 12: 1687-1697. protein. Ras, e.g., wild type ras, GenBank Acc. Nos. P01112; P01116; M54969; M54968; P01111; ras with mutations at P01112; K00654. See also, e.g., GenBank Acc. Nos. M26261; codon 12, 13, 59, or 61, M34904; K01519; K01520; BC006499; NM_006270; e.g., mutations G12C; NM_002890; NM_004985; NM_033360; NM_176795; G12D; G12R; G12S; NM_005343. G12V; G13D; A59T; Q61H. K-RAS; H-RAS; N-RAS. BRAF (an isoform of Tannapfel, et al. (2005) Am. J. Clin. Pathol. 123: 256-2601; Tsao RAF). and Sober (2005) Dermatol. Clin. 23: 323-333. Melanoma antigens, GenBank Acc. No. NM_206956; NM_206955; NM_206954; including HST-2 NM_206953; NM_006115; NM_005367; NM_004988; melanoma cell AY148486; U10340; U10339; M77481. See, e g., Suzuki, et al. antigens. (1999) J. Immunol. 163: 2783-2791. Survivin GenBank Acc. No. AB028869; U75285 (see also, e.g., Tsuruma, et al. (2004) J. Translational Med. 2: 19 (11 pages); Pisarev, et al. (2003) Clin. Cancer Res. 9: 6523-6533; Siegel, et al. (2003) Br. J. Haematol. 122: 911-914; Andersen, et al. (2002) Histol. Histopathol. 17: 669-675). MDM-2 NM_002392; NM_006878 (see also, e.g., Mayo, et al. (1997) Cancer Res. 57: 5013-5016; Demidenko and Blagosklonny (2004) Cancer Res. 64: 3653-3660). Methyl-CpG-binding Muller, et al. (2003) Br. J. Cancer 89: 1934-1939; Fang, et al. proteins (MeCP2; (2004) World J. Gastreenterol. 10: 3394-3398. MBD2). NA88-A. Moreau-Aubry, et al. (2000) J. Exp. Med. 191: 1617-1624. Histone deacetylases Waltregny, et al. (2004) Eur. J. Histochem. 48: 273-290; Scanlan, (HDAC), e.g., HDAC5. et al. (2002) Cancer Res. 62: 4041-4047. Cyclophilin B (Cyp-B). Tamura, et al. (2001) Jpn. J. Cancer Res. 92: 762-767. CA 15-3; CA 27.29. Clinton, et al. (2003) Biomed. Sci. Instrum. 39: 408-414. Heat shock protein Faure, et al. (2004) Int. J. Cancer 108: 863-870. Hsp70. GAGE/PAGE family, Brinkmann, et al. (1999) Cancer Res. 59: 1445-1448. e.g., PAGE-1; PAGE-2; PAGE-3; PAGE-4; XAGE-1; XAGE-2; XAGE-3. MAGE-A, B, C, and D Lucas, et al. (2000) Int. J. Cancer 87: 55-60; Scanlan, et al. (2001) families. MAGE-B5; Cancer Immun. 1: 4. MAGE-B6; MAGE-C2; MAGE-C3; MAGE-3; MAGE-6. Kinesin 2; TATA Scanlan, et al. (2001) Cancer Immun. 30: 1-4. element modulatory factor 1; tumor protein D53; NY Alpha-fetoprotein Grimm, et al. (2000) Gastroenterol. 119: 1104-1112. (AFP) SART1; SART2; Kumamuru, et al. (2004) Int. J. Cancer 108: 686-695; Sasatomi, et SART3; ART4. al. (2002) Cancer 94: 1636-1641; Matsumoto, et al. (1998) Jpn. J. Cancer Res. 89: 1292-1295; Tanaka, et al. (2000) Jpn. J. Cancer Res. 91: 1177-1184. Preferentially expressed Matsushita, et al. (2003) Leuk. Lymphoma 44: 439-444; antigen of melanoma Oberthuer, et al. (2004) Clin. Cancer Res. 10: 4307-4313. (PRAME). Carcinoembryonic GenBank Acc. No. M29540; E03352; X98311; M17303 (see also, antigen (CEA), e.g., Zaremba (1997) Cancer Res. 57: 4570-4577; Sarobe, et al. CAP1-6D enhancer (2004) Curr. Cancer Drug Targets 4: 443-454; Tsang, et al. (1997) agonist peptide. Clin. Cancer Res. 3: 2439-2449; Fong, et al. (2001) Proc. Natl. Acad. Sci. USA 98: 8809-8814). HER-2/neu. Disis, et al. (2004) J. Clin. Immunol. 24: 571-578; Disis and Cheever (1997) Adv. Cancer Res. 71: 343-371. Cdk4; cdk6; p16 Ghazizadeh, et al. (2005) Respiration 72: 68-73; Ericson, et al. (INK4); Rb protein. (2003) Mol. Cancer Res. 1: 654-664. TEL; AML1; Stams, et al. (2005) Clin. Cancer Res. 11: 2974-2980. TEL/AML1. Telomerase (TERT). Nair, et al. (2000) Nat. Med. 6: 1011-1017. 707-AP. Takahashi, et al. (1997) Clin. Cancer Res. 3: 1363-1370. Annexin, e.g., Zimmerman, et al. (2004) Virchows Arch. 445: 368-374. Annexin II. BCR/ABL; BCR/ABL Cobaldda, et al. (2000) Blood 95: 1007-1013; Hakansson, et al. p210; BCR/ABL p190; (2004) Leukemia 18: 538-547; Schwartz, et al. (2003) Semin. CML-66; CML-28. Hematol. 40: 87-96; Lim, et al. (1999) Int. J. Mol. Med. 4: 665-667. BCL2; BLC6; Iqbal, et al. (2004) Am. J. Pathol. 165: 159-166. CD10 protein. CDC27 (this is a Wang, et al. (1999) Science 284: 1351-1354. melanoma antigen). Sperm protein 17 Arora, et al. (2005) Mol. Carcinog. 42: 97-108. (SP17); 14-3-3-zeta; MEMD; KIAA0471; TC21. Tyrosinase-related GenBank Acc. No. NM_001922. (see also, e.g., Bronte, et al. proteins 1 and 2 (TRP-1 (2000) Cancer Res. 60: 253-258). and TRP-2). Gp100/pmel-17. GenBank Acc. Nos. AH003567; U31798; U31799; U31807; U31799 (see also, e.g., Bronte, et al. (2000) Cancer Res. 60: 253-258). TARP. See, e.g., Clifton, et al. (2004) Proc. Natl. Acad. Sci. USA 101: 10166-10171; Virok, et al. (2005) Infection Immunity 73: 1939-1946. Tyrosinase-related GenBank Acc. No. NM_001922. (see also, e.g., Bronte, et al. proteins 1 and 2 (TRP-1 (2000) Cancer Res. 60: 253-258). and TRP-2). Melanocortin 1 receptor Salazar-Onfray, et al. (1997) Cancer Res. 57: 4348-4355; (MC1R); MAGE-3; Reynolds, et al. (1998) J. Immunol. 161: 6970-6976; Chang, et al. gp100; tyrosinase; (2002) Clin. Cancer Res. 8: 1021-1032. dopachrome tautomerase (TRP-2); MART-1. MUC-1; MUC-2. See, e.g., Davies, et al. (1994) Cancer Lett. 82: 179-184; Gambus, et al. (1995) Int. J. Cancer 60: 146-148; McCool, et al. (1999) Biochem. J. 341: 593-600. Spas-1. U.S. Published Pat. Appl. No. 20020150588 of Allison, et al. CASP-8; FLICE; Mandruzzato, et al. (1997) J. Exp. Med. 186: 785-793. MACH. CEACAM6; CAP-1. Duxbury, et al. (2004) Biochem. Biophys. Res. Commun. 317: 837-843; Morse, et al. (1999) Clin. Cancer Res. 5: 1331-1338. HMGB1 (a DNA Brezniceanu, et al. (2003) FASEB J. 17: 1295-1297. binding protein and cytokine). ETV6/AML1. Codrington, et al. (2000) Br. J. Haematol. 111: 1071-1079. Mutant and wild type Clements, et al. (2003) Clin. Colorectal Cancer 3: 113-120; forms of adenomatous Gulmann, et al. (2003) Appl. Immunohistochem. Mol. Morphol. polyposis coli (APC); 11: 230-237; Jungck, et al. (2004) Int. J. Colorectal. Dis. 19: 438- beta-catenin; c-met; 445; Wang, et al. (2004) J. Surg. Res. 120: 242-248; Abutaily, et p53; E-cadherin; al. (2003) J. Pathol. 201: 355-362; Liang, et al. (2004) Br. J. Surg. cyclooxygenase-2 91: 355-361; Shirakawa, et al. (2004) Clin. Cancer Res. 10: 4342- (COX-2). 4348. Renal cell carcinoma Mulders, et al. (2003) Urol. Clin. North Am. 30: 455-465; antigen bound by mAB Steffens, et al. (1999) Anticancer Res. 19: 1197-1200. G250. EphA2 See, e.g., U.S. Patent Publication No. 2005/0281783 A1; Genbank Accession No. NM_004431 (human); Genbank Accession No. NM_010139 (Mouse); Genbank Accession No. AB038986 (Chicken, partial sequence); GenBank Accession Nos. NP_004422, AAH37166, and AAA53375 (human); GenBank Accession Nos. NP_034269 (mouse), AAH06954 (mouse), XP_345597 (rat), and BAB63910 (chicken). EGFRvIII See, e.g., WO/2012/068360 Francisella tularensis antigens Francisella tularensis Complete genome of subspecies Schu S4 (GenBank Acc. No. A and B. AJ749949); of subspecies Schu 4 (GenBank Acc. No. NC_006570). Outer membrane protein (43 kDa) Bevanger, et al. (1988) J. Clin. Microbiol. 27: 922-926; Porsch-Ozcurumez, et al. (2004) Clin. Diagnostic. Lab. Immunol. 11: 1008-1015). Antigenic components of F. tularensis include, e.g., 80 antigens, including 10 kDa and 60 kDa chaperonins (Havlasova, et al. (2002) Proteomics 2: 857-86), nucleoside diphosphate kinase, isocitrate dehydrogenase, RNA-binding protein Hfq, the chaperone ClpB (Havlasova, et al. (2005) Proteomics 5: 2090-2103). See also, e.g., Oyston and Quarry (2005) Antonie Van Leeuwenhoek 87: 277- 281; Isherwood, et al. (2005) Adv. Drug Deliv. Rev. 57: 1403- 1414; Biagini, et al. (2005) Anal. Bioanal. Chem. 382: 1027-1034. Malarial antigens Circumsporozoite See, e.g., Haddad, et al. (2004) Infection Immunity 72: 1594-1602; protein (CSP); SSP2; Hoffman, et al. (1997) Vaccine 15: 842-845; Oliveira-Ferreira and HEP17; Exp-1 Daniel-Ribeiro (2001) Mem. Inst. Oswaldo Cruz, Rio de Janeiro orthologs found in 96: 221-227. CSP (see, e.g., GenBank Acc. No. AB121024). SSP2 P. falciparum; and (see, e.g., GenBank Acc. No. AF249739). LSA-1 (see, e.g., LSA-1. GenBank Acc. No. Z30319). Ring-infected See, e.g., Stirnadel, et al. (2000) Int. J. Epidemiol. 29: 579-586; erythrocyte survace Krzych, et al. (1995) J. Immunol. 155: 4072-4077. See also, Good, protein (RESA); et al. (2004) Immunol. Rev. 201: 254-267; Good, et al. (2004) merozoite surface Ann. Rev. Immunol. 23: 69-99. MSP2 (see, e.g., GenBank Acc. protein 2 (MSP2); No. X96399; X96397). MSP1 (see, e.g., GenBank Acc. No. Spf66; merozoite X03371). RESA (see, e.g., GenBank Acc. No. X05181; X05182). surface protein 1(MSP1); 195A; BVp42. Apical membrane See, e.g. , Gupta, et al. (2005) Protein Expr. Purif. 41: 186-198. antigen 1 (AMA1). AMA1 (see, e.g., GenBank Acc. No. A′13; AJ494905; AJ490565). Viruses and viral antigens Hepatitis A GenBank Acc. Nos., e.g., NC_001489; AY644670; X83302; K02990; M14707. Hepatitis B Complete genome (see, e.g., GenBank Acc. Nos. AB214516; NC_003977; AB205192; AB205191; AB205190; AJ748098; AB198079; AB198078; AB198076; AB074756). Hepatitis C Complete genome (see, e.g., GenBank Acc. Nos. NC_004102; AJ238800; AJ238799; AJ132997; AJ132996; AJ000009; D84263). Hepatitis D GenBank Acc. Nos, e.g. NC_001653; AB118847; AY261457. Human papillomavirus, See, e.g., Trimble, et al. (2003) Vaccine 21: 4036-4042; Kim, et al. including all 200+ (2004) Gene Ther. 11: 1011-1018; Simon, et al. (2003) Eur. J. subtypes (classed in Obstet. Gynecol. Reprod. Biol. 109: 219-223; Jung, et al. (2004) J. 16 groups), such as the Microbiol. 42: 255-266; Damasus-Awatai and Freeman-Wang high risk subtypes 16, (2003) Curr. Opin. Obstet. Gynecol. 15: 473-477; Jansen and Shaw 18, 30, 31, 33, 45. (2004) Annu. Rev. Med. 55: 319-331; Roden and Wu (2003) Expert Rev. Vaccines 2: 495-516; de Villiers, et al. (2004) Virology 324: 17-24; Hussain and Paterson (2005) Cancer Immunol. Immunother. 54: 577-586; Molijn, et al. (2005) J. Clin. Virol. 32 (Suppl. 1) S43-S51. GenBank Acc. Nos. AY686584; AY686583; AY686582; NC_006169; NC_006168; NC_006164; NC_001355; NC_001349; NC_005351; NC_001596). Human T-cell See, e.g., Capdepont, et al. (2005) AIDS Res. Hum. Retrovirus lymphotropic virus 21: 28-42; Bhigjee, et al. (1999) AIDS Res. Hum. Restrovirus (HTLV) types I and II, 15: 1229-1233; Vandamme, et al. (1998) J. Virol. 72: 4327-4340; including the Vallejo, et al. (1996) J. Acquir. Immune Defic. Syndr. Hum. HTLV type I subtypes Retrovirol. 13: 384-391. HTLV type I (see, e.g., GenBank Acc. Cosmopolitan, Central Nos. AY563954; AY563953. HTLV type II (see, e.g., GenBank African, and Acc. Nos. L03561; Y13051; AF139382). Austro-Melanesian, and the HTLV type II subtypes Iia, Iib, Iic, and Iid. Coronaviridae, See, e.g., Brian and Baric (2005) Curr. Top. Microbiol. Immunol. including 287: 1-30; Gonzalez, et al. (2003) Arch. Virol. 148: 2207-2235; Coronaviruses, such as Smits, et al. (2003) J. Virol. 77: 9567-9577; Jamieson, et al. (1998) SARS-coronavirus J. Infect. Dis. 178: 1263-1269 (GenBank Acc. Nos. AY348314; (SARS-CoV), and NC_004718; AY394850). Toroviruses. Rubella virus. GenBank Acc. Nos. NC_001545; AF435866. Mumps virus, including See, e.g., Orvell, eta l. (2002) J. Gen. Virol. 83: 2489-2496. See, the genotypes A, C, D, e.g., GenBank Acc. Nos. AY681495; NC_002200; AY685921; G, H, and I. AF201473. Coxsackie virus A See, e.g., Brown, et al. (2003) J. Virol. 77: 8973-8984. GenBank including the serotypes Acc. Nos. AY421768; AY790926: X67706. 1, 11, 13, 15, 17, 18, 19, 20, 21, 22, and 24 (also known as Human enterovirus C; HEV-C). Coxsackie virus B, See, e.g., Ahn, et al. (2005) J. Med. Virol. 75: 290-294; Patel, et al. including subtypes 1-6. (2004) J. Virol. Methods 120: 167-172; Rezig, et al. (2004) J. Med. Virol. 72: 268-274. GenBank Acc. No. X05690. Human enteroviruses See, e.g., Oberste, et al. (2004) J. Virol. 78: 855-867. Human including, e.g., human enterovirus A (GenBank Acc. Nos. NC_001612); human enterovirus A (HEV-A, enterovirus B (NC_001472); human enterovirus C (NC_001428); CAV2 to CAV8, human enterovirus D (NC_001430). Simian enterovirus A CAV10, CAV12, (GenBank Acc. No. NC_003988). CAV14, CAV16, and EV71) and also including HEV-B (CAV9, CBV1 to CBV6, E1 to E7, E9, E11 to E21, E24 to E27, E29 to E33, and EV69 and E73), as well as HEV. Polioviruses including See, e.g., He, et al. (2003) J. Virol. 77: 4827-4835; Hahsido, et al. PV1, PV2, and PV3. (1999) Microbiol. Immunol. 43: 73-77. GenBank Acc. No. AJ132961 (type 1); AY278550 (type 2); X04468 (type 3). Viral encephalitides See, e.g., Hoke (2005) Mil. Med. 170: 92-105; Estrada-Franco, et viruses, including al. (2004) Emerg. Infect. Dis. 10: 2113-2121; Das, et al. (2004) equine encephalitis, Antiviral Res. 64: 85-92; Aguilar, et al. (2004) Emerg. Infect. Dis. Venezuelan equine 10: 880-888; Weaver, et al. (2004) Arch. Virol. Suppl. 18: 43-64; encephalitis (VEE) Weaver, et al. (2004) Annu. Rev. Entomol. 49: 141-174. Eastern (including subtypes IA, equine encephalitis (GenBank Acc. No. NC_003899; AY722102); IB, IC, ID, IIIC, IIID), Western equine encephalitis (NC_003908). Eastern equine encephalitis (EEE), Western equine encephalitis (WEE), St. Louis encephalitis, Murray Valley (Australian) encephalitis, Japanese encephalitis, and tick-born encephalitis. Human herpesviruses, See, e.g., Studahl, et al. (2000) Scand. J. Infect. Dis. 32: 237-248; including Padilla, et al. (2003) J. Med. Virol. 70 (Suppl. 1) S103-S110; cytomegalovirus Jainkittivong and Langlais (1998) Oral Surg. Oral Med. 85: 399- (CMV), Epstein-Barr 403. GenBank Nos. NC_001806 (herpesvirus 1); NC_001798 virus (EBV), human (herpesvirus 2); X04370 and NC_001348 (herpesvirus 3); herpesvirus-1 (HHV-1), NC_001345 (herpesvirus 4); NC_001347 (herpesvirus 5); X83413 HHV-2, HHV-3, and NC_000898 (herpesvirus 6); NC_001716 (herpesvirus 7). HHV-4, HHV-5, Human herpesviruses types 6 and 7 (HHV-6; HHV-7) are HHV-6, HHV-7, disclosed by, e.g., Padilla, et al. (2003) J. Med. Virol. 70 (Suppl. HHV-8, herpes B virus, 1)S103-S110. Human herpesvirus 8 (HHV-8), including subtypes herpes simplex virus A-E, are disclosed in, e.g., Treurnicht, et al. (2002) J. Med. Virul. types 1 and 2 (HSV-1, 66: 235-240. HSV-2), and varicella zoster virus (VZV). HIV-1 including group See, e.g., Smith, et al. (1998) J. Med. Virol. 56: 264-268. See also, M (including subtypes e.g., GenBank Acc. Nos. DQ054367; NC_001802; AY968312; A to J) and group O DQ011180; DQ011179; DQ011178; DQ011177; AY588971; (including any AY588970; AY781127; AY781126; AY970950; AY970949; distinguishable AY970948; X61240; AJ006287; AJ508597; and AJ508596. subtypes) (HIV-2, including subtypes A-E. Epstein-Barr virus See, e.g., Peh, et al. (2002) Pathology 34: 446-450. (EBV), including Epstein-Barr virus strain B95-8 (GenBank Acc. No. V01555). subtypes A and B. Reovirus, including See, e.g., Barthold, et al. (1993) Lab. Anim. Sci. 43: 425-430; serotypes and strains 1, Roner, et al. (1995) Proc. Natl. Acad. Sci. USA 92: 12362-12366; 2, and 3, type 1 Lang, Kedl, et al. (1995) J. Virol. 69: 552-559. GenBank Acc. No. type 2 Jones, and type 3 K02739 (sigma-3 gene surface protein). Dearing. Cytomegalovirus See, e.g., Chern, et al. (1998) J. Infect. Dis. 178: 1149-1153; Vilas (CMV) subtypes Boas, et al. (2003) J. Med. Virol. 71: 404-407; Trincado, et al. include CMV subtypes (2000) J. Med. Virol. 61: 481-487. GenBank Acc. No. X17403. I-VII. Rhinovirus, including Human rhinovirus 2 (GenBank Acc. No. X02316); Human all serotypes. rhinovirus B (GenBank Acc. No. NC_001490); Human rhinovirus 89 (GenBank Acc. No. NC_001617); Human rhinovirus 39 (GenBank Acc. No. AY751783). Adenovirus, including AY803294; NC_004001; AC_000019; AC_000018; AC_000017; all serotypes. AC_000015; AC_000008; AC_000007; AC_000006; AC_000005; AY737798; AY737797; NC_003266; NC_002067; AY594256; AY594254; AY875648; AJ854486; AY163756; AY594255; AY594253; NC_001460; NC_001405; AY598970; AY458656; AY487947; NC_001454; AF534906; AY45969; AY128640; L19443; AY339865; AF532578. Filoviruses, including See, e.g., Geisbert and Jahrling (1995) Virus Res. 39: 129-150; Marburg virus and Hutchinson, et al. (2001) J. Med. Virol. 65: 561-566. Marburg Ebola virus, and strains virus (see, e.g., GenBank Acc. No. NC_001608). Ebola virus (see, such as Ebola-Sudan e.g., (EBO-S), Ebola-Zaire GenBank Acc. Nos. NC_006432; AY769362; NC_002549; (EBO-Z), and AF272001; AF086833). Ebola-Reston (EBO-R). Arenaviruses, including Junin virus, segment S (GenBank Acc. No. NC_005081); Junin lymphocytic virus, segment L (GenBank Acc. No. NC_005080). choriomeningitis (LCM) virus, Lassa virus, Junin virus, and Machupo virus. Rabies virus. See, e.g., GenBank Acc. Nos. NC_001542; AY956319; AY705373; AF499686; AB128149; AB085828; AB009663. Arboviruses, including Dengue virus type 1 (see, e.g., GenBank Acc. Nos. AB195673; West Nile virus, AY762084). Dengue virus type 2 (see, e.g., GenBank Acc. Nos. Dengue viruses 1 to 4, NC_001474; AY702040; AY702039; AY702037). Dengue virus Colorado tick fever type 3 (see, e.g., GenBank Acc. Nos. AY923865; AT858043). virus, Sindbis virus, Dengue virus type 4 (see, e.g., GenBank Acc. Nos. AY947539; Togaviraidae, AY947539; AF326573). Sindbis virus (see, e.g., GenBank Acc. Flaviviridae, Nos. NC_001547; AF429428; J02363; AF103728). West Nile Bunyaviridae, virus (see, e.g., GenBank Acc. Nos. NC_001563; AY603654). Reoviridae, Rhabdoviridae, Orthomyxoviridae, and the like. Poxvirus including Viriola virus (see, e.g., GenBank Acc. Nos. NC_001611; Y16780; orthopoxvirus (variola X72086; X69198). virus, monkeypox virus, vaccinia virus, cowpox virus), yatapoxvirus (tanapox virus, Yaba monkey tumor virus), parapoxvirus, and molluscipoxvirus. Yellow fever. See, e.g., GenBank Acc. No. NC_002031; AY640589; X03700. Hantaviruses, including See, e.g., Elgh, et al. (1997) J. Clin. Microbiol. 35: 1122-1130; serotypes Hantaan Sjolander, et al. (2002) Epidemiol. Infect. 128: 99-103; Zeier, et al. (HTN), Seoul (SEO), (2005) Virus Genes 30: 157-180. GenBank Acc. No. NC_005222 Dobrava (DOB), Sin and NC_005219 (Hantavirus). See also, e.g., GenBank Acc. Nos. Nombre (SN), Puumala NC_005218; NC_005222; NC_005219. (PUU), and Dobrava-like Saaremaa (SAAV). Flaviviruses, including See, e.g., Mukhopadhyay, et al. (2005) Nature Rev. Microbiol. Dengue virus, Japanese 3: 13-22. GenBank Acc. Nos NC_001474 and AY702040 encephalitis virus, West (Dengue). GenBank Acc. Nos. NC_001563 and AY603654. Nile virus, and yellow fever virus. Measles virus. See, e.g., GenBank Acc. Nos. AB040874 and AY486084. Human Human parainfluenza virus 2 (see, e.g., GenBank Acc. Nos. parainfluenzaviruses AB176531; NC003443). Human parainfluenza virus 3 (see, e.g., (HPV), including HPV GenBank Acc. No. NC_001796). types 1-56. Influenza virus, Influenza nucleocapsid (see, e.g., GenBank Acc. No. AY626145). including influenza Influenza hemagglutinin (see, e.g., GenBank Acc. Nos. virus types A, B, and C. AY627885; AY555153). Influenza neuraminidase (see, e.g., GenBank Acc. Nos. AY555151; AY577316). Influenza matrix protein 2 (see, e.g., GenBank Acc. Nos. AY626144(. Influenza basic protein 1 (see, e.g., GenBank Acc. No. AY627897). Influenza polymerase acid protein (see, e.g., GenBank Acc. No. AY627896). Influenza nucleoprotein (see, e.g., GenBank Acc. Nno. AY627895). Influenza A virus Hemagglutinin of H1N1 (GenBank Acc. No. S67220). Influenza subtypes, e.g., swine A virus matrix protein (GenBank Acc. No. AY700216). Influenza viruses (SIV): H1N1 virus A H5H1 nucleoprotein (GenBank Acc. No. AY646426). influenzaA and swine H1N1 haemagglutinin (GenBank Acc. No. D00837). See also, influenza virus. GenBank Acc. Nos. BD006058; BD006055; BD006052. See also, e.g., Wentworth, et al. (1994) J. Virol. 68: 2051-2058; Wells, et al. (1991) J.A.M.A. 265: 478-481. Respiratory syncytial Respiratory syncytial virus (RSV) (see, e.g., GenBank Acc. Nos. virus (RSV), including AY353550; NC_001803; NC001781). subgroup A and subgroup B. Rotaviruses, including Human rotavirus C segment 8 (GenBank Acc. No. AJ549087); human rotaviruses A to Human rotavirus G9 strain outer capsid protein (see, e.g., E, bovine rotavirus, GenBank Acc. No. DQ056300); Human rotavirus B strain non- rhesus monkey structural protein 4 (see, e.g., GenBank Acc. No. AY548957); rotavirus, and human rotavirus A strain major inner capsid protein (see, e.g., human-RVV GenBank Acc. No. AY601554). reassortments. Polyomavirus, See, e.g., Engels, et al. (2004) J. Infect. Dis. 190: 2065-2069; including simian Vilchez and Butel (2004) Clin. Microbiol. Rev. 17: 495-508; virus 40 (SV40), JC Shivapurkar, et al. (2004) Cancer Res. 64: 3757-3760; Carbone, et virus (JCV) and BK al. (2003) Oncogene 2: 5173-5180; Barbanti-Brodano, et al. (2004) virus (BKV). Virology 318: 1-9) (SV40 complete genome in, e.g., GenBank Acc. Nos. NC_001669; AF168994; AY271817; AY271816; AY120890; AF345344; AF332562). Coltiviruses, including Attoui, et al. (1998) J. Gen. Virol. 79: 2481-2489. Segments of Colorado tick fever Eyach virus (see, e.g., GenBank Acc. Nos. AF282475; AF282472; virus, Eyach virus. AF282473; AF282478; AF282476; NC_003707; NC_003702; NC_003703; NC_003704; NC_003705; NC_003696; NC_003697; NC_003698; NC_003699; NC_003701; NC_003706; NC_003700; AF282471; AF282477). Calciviruses, including Snow Mountain virus (see, e.g., GenBank Acc. No. AY134748). the genogroups Norwalk, Snow Mountain group (SMA), and Saaporo. Parvoviridae, including See, e.g., Brown (2004) Dev. Biol. (Basel) 118: 71-77; Alvarez- dependovirus, Lafuente, et al. (2005) Ann. Rheum. Dis. 64: 780-782; Ziyaeyan, parvovirus (including et al. (2005) Jpn. J. Infect. Dis. 58: 95-97; Kaufman, et al. (2005) parvovirus B19), and Virology 332: 189-198. erythrovirus.
[0082] Other organisms for which suitable antigens are known in the art include, but are not limited to, Chlamydia trachomatis, Streptococcus pyogenes (Group A Strep), Streptococcus agalactia (Group B Strep), Streptococcus pneumonia, Staphylococcus aureus, Escherichia coli, Haemophilus influenzae, Neisseria meningitidis, Neisseria gonorrheae, Vibrio cholerae, Salmonella species (including typhi, typhimurium), enterica (including Helicobactor pylori Shigella flexneri and other Group D shigella species), Burkholderia mallei, Burkholderia pseudomallei, Klebsiella pneumonia, Clostridium species (including C. difficile), Vibrio parahaemolyticus and V. vulnificus. This list is not meant to be limiting.
[0083] In certain embodiments, antigen sequence(s) may be expressed as a single polypeptide fused to an amino-terminal portion of the L. monocytogenes ActA protein which permits expression and secretion of a fusion protein from the bacterium within the vaccinated host. In these embodiments, the antigenic construct may be a polynucleotide comprising a promoter operably linked to a nucleic acid sequence encoding a fusion protein, wherein the fusion protein comprises (a) modified ActA and (b) one or more antigenic epitopes to be expressed as a fusion protein following the modified ActA sequence.
[0084] By “modified ActA” is meant a contiguous portion of the L. monocytogenes ActA protein which comprises at least the ActA signal sequence, but does not comprise the entirety of the ActA sequence, or that has at least about 80% sequence identity, at least about 85% sequence identity, at least about 90% sequence identity, at least about 95% sequence identity, or at least about 98% sequence identity to such an ActA sequence. In some embodiments, the promoter is ActA promoter from WO07/103225; and WO07/117371, each of which is incorporated by reference in its entirety herein.
[0085] By way of example, the modified ActA may comprise at least the first 59 amino acids of ActA, or a sequence having at least about 80% sequence identity, at least about 85% sequence identity, at least about 90% sequence identity, at least about 95% sequence identity, or at least about 98% sequence identity to at least the first 59 amino acids of ActA. In some embodiments, the modified ActA comprises at least the first 100 amino acids of ActA, or a sequence having at least about 80% sequence identity, at least about 85% sequence identity, at least about 90% sequence identity, at least about 95% sequence identity, or at least about 98% sequence identity to the first 100 amino acids of ActA. In other words, in some embodiments, the modified ActA sequence corresponds to an N-terminal fragment of ActA (including the ActA signal sequence) that is truncated at residue 100 or thereafter. ActA-N100 has the following sequence (SEQ ID NO: 3):
TABLE-US-00002 VGLNRFMRAM MVVFITANCI TINPDIIFAA TDSEDSSLNT DEWEEEKTEE 50 QPSEVNTGPR YETAREVSSR DIEELEKSNK VKNTNKADLI AMLKAKAEKG 100
[0086] In this sequence, the first residue is depicted as a valine; the polypeptide is synthesized by Listeria with a methionine in this position. Thus, ActA-N100 may also have the following sequence (SEQ ID NO:4):
TABLE-US-00003 MGLNRFMRAM MVVFITANCI TINPDIIFAA TDSEDSSLNT DEWEEEKTEE 50 QPSEVNTGPR YETAREVSSR DIEELEKSNK VKNTNKADLI AMLKAKAEKG 100
[0087] ActA-N100 may also comprise one or more additional residues lying between the C-terminal residue of the modified ActA and the antigen sequence. In the following sequences, ActA-N100 is extended by two residues added by inclusion of a BamH1 site (SEQ ID NO: 5):
TABLE-US-00004 VGLNRFMRAM MVVFITANCI TINPDIIFAA TDSEDSSLNT DEWEEEKTEE 50 QPSEVNTGPR YETAREVSSR DIEELEKSNK VKNTNKADLI AMLKAKAEKG 100 GS
which when synthesized with a first residue methionine has the sequence (SEQ ID NO: 6):
TABLE-US-00005 MGLNRFMRAM MVVFITANCI TINPDIIFAA TDSEDSSLNT DEWEEEKTEE 50 QPSEVNTGPR YETAREVSSR DIEELEKSNK VKNTNKADLI AMLKAKAEKG 100 GS.
[0088] Alternatively, antigen sequence(s) are preferably expressed as a single polypeptide fused to a modified amino-terminal portion of the L. monocytogenes LLO protein which permits expression and secretion of a fusion protein from the bacterium within the vaccinated host. In these embodiments, the antigenic construct may be a polynucleotide comprising a promoter operably linked to a nucleic acid sequence encoding a fusion protein, wherein the fusion protein comprises (a) modified LLO and (b) one or more antigenic epitopes to be expressed as a fusion protein following the modified LLO sequence. The LLO signal sequence is MKKIMLVFIT LILVSLPIAQ QTEAK. In some embodiments, the promoter is hly promoter.
[0089] In some embodiments, the modified LLO comprises a modified form of about the first 441 amino acids of LLO, referred to herein as LLO-N441. LLO-N441 has the following sequence:
TABLE-US-00006 10 20 30 40 50 60 MKKIMLVFIT LILVSLPIAQ QTEAKDASAF NKENSISSMA PPASPPASPK TPIEKKHADE 70 80 90 100 110 120 IDKYIQGLDY NKNNVLVYHG DAVTNVPPRK GYKDGNEYIV VEKKKKSINQ NNADIQVVNA 130 140 150 160 170 180 ISSLTYPGAL VKANSELVEN QPDVLPVKRD SLTLSIDLPG MTNQDNKIVV KNATKSNVNN 190 200 210 220 230 240 AVNTLVERWN EKYAQAYPNV SAKIDYDDEM AYSESQLIAK FGTAFKAVNN SLNVNFGAIS 250 260 270 280 290 300 EGKMQEEVIS FKQIYYNVNV NEPTRPSRFF GKAVTKEQLQ ALGVNAENPP AYISSVAYGR 310 320 330 340 350 360 QVYLKLSTNS HSTKVKAAFD AAVSGKSVSG DVELTNIIKN SSFKAVIYGG SAKDEVQIID 370 380 390 400 410 420 GNLGDLRDIL KKGATFNRET PGVPIAYTTN FLKDNELAVI KNNSEYIETT SKAYTDGKIN 430 440 IDHSGGYVAQ FNISWDEVNY D
[0090] As sequences encoded by one organism are not necessarily codon optimized for optimal expression in a chosen vaccine platform bacterial strain, the present invention also provides nucleic acids that are altered by codon optimized for expressing by a bacterium such as L. monocytogenes.
[0091] In various embodiments, at least one percent of any non-optimal codons are changed to provide optimal codons, more normally at least five percent are changed, most normally at least ten percent are changed, often at least 20% are changed, more often at least 30% are changed, most often at least 40%, usually at least 50% are changed, more usually at least 60% are changed, most usually at least 70% are changed, optimally at least 80% are changed, more optimally at least 90% are changed, most optimally at least 95% are changed, and conventionally 100% of any non-optimal codons are codon-optimized for Listeria expression (Table 2).
TABLE-US-00007 TABLE 2 Optimal codons for expression in Listeria. Amino Acid A R N D C Q E G H I Optimal GCA CGU AAU GAU UGU CAA GAA GGU CAU AUU Listeria codon Amino Acid L K M F P S T W Y V Optimal UUA AAA AUG UUU CCA AGU ACA UGG UAU GUU Listeria codon
[0092] The invention supplies a number of Listeria species and strains for making or engineering an attenuated bacterium of the present invention. The Listeria of the present invention is not to be limited by the species and strains disclosed in Table 3.
TABLE-US-00008 TABLE 3 Strains of Listeria suitable for use in the present invention, e.g., as a vaccine or as a source of nucleic acids. L. monocytogenes 10403S wild type. Bishop and Hinrichs (1987) J. Immunol. 139: 2005-2009; Lauer, et al. (2002) J. Bact. 184: 4177-4186. L. monocytogenes DP-L4056 (phage cured). Lauer, et al. (2002) J. Bact. 184: 4177-4186. The prophage-cured 10403S strain is designated DP-L4056. L. monocytogenes DP-L4027, which is Lauer, et al. (2002) J. Bact. 184: 4177-4186; DP-L2161, phage cured, deleted in hly gene. Jones and Portnoy (1994) Infect. Immunity 65: 5608-5613. L. monocytogenes DP-L4029, which is DP- Lauer, et al. (2002) J. Bact. 184: 4177-4186; L3078, phage cured, deleted in ActA. Skoble, et al. (2000) J. Cell Biol. 150: 527- 538. L. monocytogenes DP-L4042 (delta PEST) Brockstedt, et al. (2004) Proc. Natl. Acad. Sci. USA 101: 13832-13837; supporting information. L. monocytogenes DP-L4097 (LLO-S44A). Brockstedt, et al. (2004) Proc. Natl. Acad. Sci. USA 101: 13832-13837; supporting information. L. monocytogenes DP-L4364 (delta lplA; Brockstedt, et al. (2004) Proc. Natl. Acad. lipoate protein ligase). Sci. USA 101: 13832-13837; supporting information. L. monocytogenes DP-L4405 (delta inlA). Brockstedt, et al. (2004) Proc. Natl. Acad. Sci. USA 101: 13832-13837; supporting information. L. monocytogenes DP-L4406 (delta in1B). Brockstedt, et al. (2004) Proc. Natl. Acad. Sci. USA 101: 13832-13837; supporting information. L. monocytogenes CS-L0001 (delta ActA-delta Brockstedt, et al. (2004) Proc. Natl. Acad. inlB ). Sci. USA 101: 13832-13837; supporting information. L. monocytogenes CS-L0002 (delta ActA-delta Brockstedt, et al. (2004) Proc. Natl. Acad. lplA). Sci. USA 101: 13832-13837; supporting information. L. monocytogenes CS-L0003 (L461T-delta Brockstedt, et al. (2004) Proc. Natl. Acad. lplA). Sci. USA 101: 13832-13837; supporting information. L. monocytogenes DP-L4038 (delta ActA-LLO Brockstedt, et al. (2004) Proc. Natl. Acad. L461T). Sci. USA 101: 13832-13837; supporting information. L. monocytogenes DP-L4384 (S44A-LLO Brockstedt, et al. (2004) Proc. Natl. Acad. L461T). Sci. USA 101: 13832-13837; supporting information. L. monocytogenes. Mutation in lipoate protein O'Riordan, et al. (2003) Science 302: 462- ligase (LplA1). 464. L. monocytogenes DP-L4017 (10403S U.S. Provisional Pat. Appl. Ser. No. hly (L461T) point mutation in hemolysin gene. 60/490,089 filed Jul. 24, 2003. L. monocytogenes EGD. GenBank Acc. No. AL591824. L. monocytogenes EGD-e. GenBank Acc. No. NC_003210. ATCC Acc. No. BAA-679. L. monocytogenes strain EGD, complete GenBank Acc. No. AL591975 genome, segment 3/12 L. monocytogenes. ATCC Nos. 13932; 15313; 19111-19120; 43248-43251; 51772-51782. L. monocytogenes DP-L4029 deleted in uvrAB. U.S. Provisional Pat. Appl. Ser. No. 60/541,515 filed Feb. 2, 2004; U.S. Provisional Pat. Appl. Ser. No. 60/490,080 filed Jul. 24, 2003. L. monocytogenes DP-L4029 deleted in uvrAB U.S. Provisional Pat. Appl. Ser. No. treated with a psoralen. 60/541,515 filed Feb. 2, 2004. L. monocytogenes delta actA delta inlB delta Brockstedt (2005) Nature Medicine and uvrAB KBMA patent L. monocytogenes delta actA delta inlB delta Brockstedt (2005) Nature Medicine and uvrAB treated with psoralen KBMA patent L. monocytogenes delta actA delta inlB delta Lauer et al, (2008) Infect. Immun. And WO uvrAB prfA(G155S) 2009/143085 L. monocytogenes delta actA delta inlB delta Lauer et al, (2008) Infect. Immun. And WO uvrAB prfA(G155S) treated with psoralen 2009/143085 L. monocytogenes ActA-/inlB-double mutant. Deposited with ATCC on Oct. 3, 2003. Acc. No. PTA-5562. L. monocytogenes lplA mutant or hly mutant. U.S. Pat. Applic. No. 20040013690 of Portnoy, et al. L. monocytogenes DAL/DAT double mutant. U.S. Pat. Applic. No. 20050048081 of Frankel and Portnoy. L. monocytogenes str. 4b F2365. GenBank Acc. No. NC_002973. Listeria ivanovii ATCC No. 49954 Listeria innocua Clip11262. GenBank Acc. No. NC_003212; AL592022. Listeria innocua, a naturally occurring Johnson, et al. (2004) Appl. Environ. hemolytic strain containing the PrfA-regulated Microbiol. 70: 4256-4266. virulence gene cluster. Listeria seeligeri. Howard, et al. (1992) Appl. Eviron. Microbiol. 58: 709-712. Listeria innocua with L. monocytogenes Johnson, et al. (2004) Appl. Environ. pathogenicity island genes. Microbiol. 70: 4256-4266. Listeria innocua with L. monocytogenes See, e.g., Lingnau, et al. (1995) Infection internalin A gene, e.g., as a plasmid or as a Immunity 63: 3896-3903; Gaillard, et al. genomic nucleic acid. (1991) Cell 65: 1127-1141). The present invention encompasses reagents and methods that comprise the above Listerial strains, as well as these strains that are modified, e.g., by a plasmid and/or by genomic integration, to contain a nucleic acid encoding one of, or any combination of, the following genes: hly (LLO; listeriolysin); iap (p60); inlA; inlB; inlC; dal (alanine racemase); daaA (dat; D-amino acid aminotransferase); plcA; plcB; ActA; or any nucleic acid that mediates growth, spread, breakdown of a single walled vesicle, breakdown of a double walled vesicle, binding to a host cell, uptake by a host cell. The present invention is not to be limited by the particular strains disclosed above.
4. Therapeutic Compositions
[0093] The vaccine compositions described herein can be administered to a host, either alone or in combination with a pharmaceutically acceptable excipient, in an amount sufficient to induce an appropriate immune response. The immune response can comprise, without limitation, specific immune response, non-specific immune response, both specific and non-specific response, innate response, primary immune response, adaptive immunity, secondary immune response, memory immune response, immune cell activation, immune cell proliferation, immune cell differentiation, and cytokine expression. The vaccines of the present invention can be stored, e.g., frozen, lyophilized, as a suspension, as a cell paste, or complexed with a solid matrix or gel matrix.
[0094] In certain embodiments, after the subject has been administered an effective dose of a first vaccine to prime the immune response, a second vaccine is administered. This is referred to in the art as a “prime-boost” regimen. In such a regimen, the compositions and methods of the present invention may be used as the “prime” delivery, as the “boost” delivery, or as both a “prime” and a “boost.” Any number of “boost” immunizations can be delivered in order to maintain the magnitude or effectiveness of a vaccine-induced immune response.
[0095] In certain embodiments it may be desirable to induce both αβ and γδ T cell populations in a subject. A prime-boost strategy can be taken to accomplish this objective. According to this immunization regimen, a subject is administered a first vaccine as a prime to induce αβ T cell populations, but not γδ T cell populations. The subject can then be administered a series of doses to induce both αβ T cell populations and γδ T cell populations. It should be recognized that the vaccines used in the prime-boost immunization regimen can each be administered more than one time. As a non-limiting example, priming of αβ T cell populations can be accomplished with two prime vaccinations, followed by boosting with a vaccine to induce both αβ T cell populations and γδ T cells.
[0096] It should be understood, however, that each of the prime and boost need not utilize the methods and compositions of the present invention. Rather, the present invention contemplates the use of other vaccine modalities together with the bacterial vaccine methods and compositions of the present invention. The following are examples of suitable mixed prime-boost regimens: a DNA (e.g., plasmid) vaccine prime/bacterial vaccine boost; a viral vaccine prime/bacterial vaccine boost; a protein vaccine prime/bacterial vaccine boost; a DNA prime/bacterial vaccine boost plus protein vaccine boost; a bacterial vaccine prime/DNA vaccine boost; a bacterial vaccine prime/viral vaccine boost; a bacterial vaccine prime/protein vaccine boost; a bacterial vaccine prime/bacterial vaccine boost plus protein vaccine boost; etc. This list is not meant to be limiting
[0097] The prime vaccine and boost vaccine may be administered by the same route or by different routes. The term “different routes” encompasses, but is not limited to, different sites on the body, for example, a site that is oral, non-oral, enteral, parenteral, rectal, intranode (lymph node), intravenous, arterial, subcutaneous, intradermal, intramuscular, intratumor, peritumor, infusion, mucosal, nasal, in the cerebrospinal space or cerebrospinal fluid, and so on, as well as by different modes, for example, oral, intravenous, and intramuscular.
[0098] An effective amount of a prime or boost vaccine may be given in one dose, but is not restricted to one dose. Thus, the administration can be two, three, four, five, six, seven, eight, nine, ten, eleven, twelve, thirteen, fourteen, fifteen, sixteen, seventeen, eighteen, nineteen, twenty, or more, administrations of the vaccine. Where there is more than one administration of a vaccine or vaccines in the present methods, the administrations can be spaced by time intervals of one minute, two minutes, three, four, five, six, seven, eight, nine, ten, or more minutes, by intervals of about one hour, two hours, three, four, five, six, seven, eight, nine, ten, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 hours, and so on. In the context of hours, the term “about” means plus or minus any time interval within 30 minutes. The administrations can also be spaced by time intervals of one day, two days, three days, four days, five days, six days, seven days, eight days, nine days, ten days, 11 days, 12 days, 13 days, 14 days, 15 days, 16 days, 17 days, 18 days, 19 days, 20 days, 21 days, and combinations thereof. The invention is not limited to dosing intervals that are spaced equally in time, but encompass doses at non-equal intervals, such as a priming schedule consisting of administration at 1 day, 4 days, 7 days, and 25 days, just to provide a non-limiting example.
[0099] In certain embodiments, administration of the boost vaccination can be initiated at about 5 days after the prime vaccination is initiated; about 10 days after the prime vaccination is initiated; about 15 days; about 20 days; about 25 days; about 30 days; about 35 days; about 40 days; about 45 days; about 50 days; about 55 days; about 60 days; about 65 days; about 70 days; about 75 days; about 80 days, about 6 months, and about 1 year after administration of the prime vaccination is initiated. Preferably one or both of the prime and boost vaccination comprises delivery of a composition of the present invention.
[0100] A “pharmaceutically acceptable excipient” or “diagnostically acceptable excipient” includes but is not limited to, sterile distilled water, saline, phosphate buffered solutions, amino acid based buffers, or bicarbonate buffered solutions. An excipient selected and the amount of excipient used will depend upon the mode of administration. Administration may be oral, intravenous, subcutaneous, dermal, intradermal, intramuscular, mucosal, parenteral, intraorgan, intralesional, intranasal, inhalation, intraocular, intramuscular, intravascular, intranodal, by scarification, rectal, intraperitoneal, or any one or combination of a variety of well-known routes of administration. The administration can comprise an injection, infusion, or a combination thereof.
[0101] Administration of the vaccine of the present invention by a non-oral route can avoid tolerance. Methods are known in the art for administration intravenously, subcutaneously, intradermally, intramuscularly, intraperitoneally, orally, mucosally, by way of the urinary tract, by way of a genital tract, by way of the gastrointestinal tract, or by inhalation.
[0102] An effective amount for a particular patient may vary depending on factors such as the condition being treated, the overall health of the patient, the route and dose of administration and the severity of side effects. Guidance for methods of treatment and diagnosis is available (see, e.g., Maynard, et al. (1996) A Handbook of SOPs for Good Clinical Practice, Interpharm Press, Boca Raton, Fla.; Dent (2001) Good Laboratory and Good Clinical Practice, Urch Publ., London, UK).
[0103] The vaccines of the present invention can be administered in a dose, or dosages, where each dose comprises at least 100 bacterial cells/kg body weight or more; in certain embodiments 1000 bacterial cells/kg body weight or more; normally at least 10,000 cells; more normally at least 100,000 cells; most normally at least 1 million cells; often at least 10 million cells; more often at least 100 million cells; typically at least 1 billion cells; usually at least 10 billion cells; conventionally at least 100 billion cells; and sometimes at least 1 trillion cells/kg body weight. The present invention provides the above doses where the units of bacterial administration is colony forming units (CFU), the equivalent of CFU prior to psoralen treatment, or where the units are number of bacterial cells.
[0104] The vaccines of the present invention can be administered in a dose, or dosages, where each dose comprises between 10.sup.7 and 10.sup.8 bacteria per 70 kg body weight (or per 1.7 square meters surface area; or per 1.5 kg liver weight); 2×10.sup.7 and 2×10.sup.8 bacteria per 70 kg body weight (or per 1.7 square meters surface area; or per 1.5 kg liver weight); 5×10.sup.7 and 5×10.sup.8 bacteria per 70 kg body weight (or per 1.7 square meters surface area; or per 1.5 kg liver weight); 10.sup.8 and 10.sup.9 bacteria per 70 kg body weight (or per 1.7 square meters surface area; or per 1.5 kg liver weight); between 2.0×10.sup.8 and 2.0×10.sup.9 bacteria per 70 kg (or per 1.7 square meters surface area, or per 1.5 kg liver weight); between 5.0×10.sup.8 to 5.0×10.sup.9 bacteria per 70 kg (or per 1.7 square meters surface area, or per 1.5 kg liver weight); between 10.sup.9 and 10.sup.10 bacteria per 70 kg (or per 1.7 square meters surface area, or per 1.5 kg liver weight); between 2×10.sup.9 and 2×10.sup.10 bacteria per 70 kg (or per 1.7 square meters surface area, or per 1.5 kg liver weight); between 5×10.sup.9 and 5×10.sup.10 bacteria per 70 kg (or per 1.7 square meters surface area, or per 1.5 kg liver weight); between 10.sup.11 and 10.sup.12 bacteria per 70 kg (or per 1.7 square meters surface area, or per 1.5 kg liver weight); between 2×10.sup.11 and 2×10.sup.12 bacteria per 70 kg (or per 1.7 square meters surface area, or per 1.5 kg liver weight); between 5×10.sup.11 and 5×10.sup.12 bacteria per 70 kg (or per 1.7 square meters surface area, or per 1.5 kg liver weight); between 10.sup.12 and 10.sup.13 bacteria per 70 kg (or per 1.7 square meters surface area); between 2×10.sup.12 and 2×10.sup.13 bacteria per 70 kg (or per 1.7 square meters surface area, or per 1.5 kg liver weight); between 5×10.sup.12 and 5×10.sup.13 bacteria per 70 kg (or per 1.7 square meters surface area, or per 1.5 kg liver weight); between 10.sup.13 and 10.sup.14 bacteria per 70 kg (or per 1.7 square meters surface area, or per 1.5 kg liver weight); between 2×10.sup.13 and 2×10.sup.14 bacteria per 70 kg (or per 1.7 square meters surface area, or per 1.5 kg liver weight); 5×10.sup.13 and 5×10.sup.14 bacteria per 70 kg (or per 1.7 square meters surface area, or per 1.5 kg liver weight); between 10.sup.14 and 10.sup.15 bacteria per 70 kg (or per 1.7 square meters surface area, or per 1.5 kg liver weight); between 2×10.sup.14 and 2×10.sup.15 bacteria per 70 kg (or per 1.7 square meters surface area, or per 1.5 kg liver weight); and so on, wet weight.
[0105] Also provided is one or more of the above doses, where the dose is administered by way of one injection every day, one injection every two days, one injection every three days, one injection every four days, one injection every five days, one injection every six days, or one injection every seven days, where the injection schedule is maintained for, e.g., one day only, two days, three days, four days, five days, six days, seven days, two weeks, three weeks, four weeks, five weeks, or longer. The invention also embraces combinations of the above doses and schedules, e.g., a relatively large initial bacterial dose, followed by relatively small subsequent doses, or a relatively small initial dose followed by a large dose.
[0106] A dosing schedule of, for example, once/week, twice/week, three times/week, four times/week, five times/week, six times/week, seven times/week, once every two weeks, once every three weeks, once every four weeks, once every five weeks, and the like, is available for the invention. The dosing schedules encompass dosing for a total period of time of, for example, one week, two weeks, three weeks, four weeks, five weeks, six weeks, two months, three months, four months, five months, six months, seven months, eight months, nine months, ten months, eleven months, and twelve months.
[0107] Provided are cycles of the above dosing schedules. The cycle can be repeated about, e.g., every seven days; every 14 days; every 21 days; every 28 days; every 35 days; 42 days; every 49 days; every 56 days; every 63 days; every 70 days; and the like. An interval of non dosing can occur between a cycle, where the interval can be about, e.g., seven days; 14 days; 21 days; 28 days; 35 days; 42 days; 49 days; 56 days; 63 days; 70 days; and the like. In this context, the term “about” means plus or minus one day, plus or minus two days, plus or minus three days, plus or minus four days, plus or minus five days, plus or minus six days, or plus or minus seven days.
[0108] The present invention encompasses a method of administering a bacterial vaccine that is oral. Also provided is a method of administering a bacterial vaccine that is intravenous. Moreover, what is provided is a method of administering a bacterial vaccine that is oral, intramuscular, intravenous, intradermal and/or subcutaneous.
[0109] Methods for co-administration with an additional therapeutic agent are well known in the art (Hardman, et al. (eds.) (2001) Goodman and Gilman's The Pharmacological Basis of Therapeutics, 10th ed., McGraw-Hill, New York, N.Y.; Poole and Peterson (eds.) (2001) Pharmacotherapeutics for Advanced Practice: A Practical Approach, Lippincott, Williams & Wilkins, Phila., PA; Chabner and Longo (eds.) (2001) Cancer Chemotherapy and Biotherapy, Lippincott, Williams & Wilkins, Phila., PA).
[0110] Additional agents which are beneficial to raising a cytolytic T cell response may be used as well. Such agents are termed herein carriers. These include, without limitation, B7 costimulatory molecule, interleukin-2, interferon-γ, GM-CSF, CTLA-4 antagonists, PD-1 antagonists, LAG-3 antagonists, VISTA antagonists, OX-40/OX-40 ligand, CD40/CD40 ligand, sargramostim, levamisol, vaccinia virus, Bacille Calmette-Guerin (BCG), liposomes, alum, Freund's complete or incomplete adjuvant, detoxified endotoxins, mineral oils, surface active substances such as lipolecithin, pluronic polyols, polyanions, peptides, and oil or hydrocarbon emulsions. Carriers for inducing a T cell immune response which preferentially stimulate a cytolytic T cell response versus an antibody response are preferred, although those that stimulate both types of response can be used as well. In cases where the agent is a polypeptide, the polypeptide itself or a polynucleotide encoding the polypeptide can be administered. The carrier can be a cell, such as an antigen presenting cell (APC) or a dendritic cell. Antigen presenting cells include such cell types as macrophages, dendritic cells and B cells. Other professional antigen-presenting cells include monocytes, marginal zone Kupffer cells, microglia, Langerhans' cells, interdigitating dendritic cells, follicular dendritic cells, and T cells. Facultative antigen-presenting cells can also be used. Examples of facultative antigen-presenting cells include astrocytes, follicular cells, endothelium and fibroblasts. The carrier can be a bacterial cell that is transformed to express the polypeptide or to deliver a polynucleoteide which is subsequently expressed in cells of the vaccinated individual. Adjuvants, such as aluminum hydroxide or aluminum phosphate, can be added to increase the ability of the vaccine to trigger, enhance, or prolong an immune response. Additional materials, such as cytokines, chemokines, and bacterial nucleic acid sequences, like CpG, a toll-like receptor (TLR) 9 agonist as well as additional agonists for TLR 2, TLR 4, TLR 5, TLR 7, TLR 8, TLR9, including lipoprotein, LPS, monophosphoryl lipid A, lipoteichoic acid, imiquimod, resiquimod, and other like immune modulators such as cyclic dinucleotide STING agonists including c-di-GMP, c-di-AMP, c-di-IMP, and c-AMP-GMP, used separately or in combination with the described compositions are also potential adjuvants. Other representative examples of adjuvants include the synthetic adjuvant QS-21 comprising a homogeneous saponin purified from the bark of Quillaja saponaria and Corynebacterium parvum (McCune et al., Cancer, 1979; 43:1619). It will be understood that the adjuvant is subject to optimization. In other words, the skilled artisan can engage in routine experimentation to determine the best adjuvant to use.
[0111] An effective amount of a therapeutic agent is one that will decrease or ameliorate the symptoms normally by at least 10%, more normally by at least 20%, most normally by at least 30%, typically by at least 40%, more typically by at least 50%, most typically by at least 60%, often by at least 70%, more often by at least 80%, and most often by at least 90%, conventionally by at least 95%, more conventionally by at least 99%, and most conventionally by at least 99.9%.
[0112] The reagents and methods of the present invention provide a vaccine comprising only one vaccination; or comprising a first vaccination; or comprising at least one booster vaccination; at least two booster vaccinations; or at least three booster vaccinations. Guidance in parameters for booster vaccinations is available. See, e.g., Marth (1997) Biologicals 25:199-203; Ramsay, et al. (1997) Immunol. Cell Biol. 75:382-388; Gherardi, et al. (2001) Histol. Histopathol. 16:655-667; Leroux-Roels, et al. (2001) ActA Clin. Belg. 56:209-219; Greiner, et al. (2002) Cancer Res. 62:6944-6951; Smith, et al. (2003) J. Med. Virol. 70:Supp1.1:S38-541; Sepulveda-Amor, et al. (2002) Vaccine 20:2790-2795).
[0113] Formulations of therapeutic agents may be prepared for storage by mixing with physiologically acceptable carriers, excipients, or stabilizers in the form of, e.g., lyophilized powders, slurries, aqueous solutions or suspensions (see, e.g., Hardman, et al. (2001) Goodman and Gilman's The Pharmacological Basis of Therapeutics, McGraw-Hill, New York, N.Y.; Gennaro (2000) Remington: The Science and Practice of Pharmacy, Lippincott, Williams, and Wilkins, New York, N.Y.; Avis, et al. (eds.) (1993) Pharmaceutical Dosage Forms: Parenteral Medications, Marcel Dekker, NY; Lieberman, et al. (eds.) (1990) Pharmaceutical Dosage Forms: Tablets, Marcel Dekker, NY; Lieberman, et al. (eds.) (1990) Pharmaceutical Dosage Forms: Disperse Systems, Marcel Dekker, NY; Weiner and Kotkoskie (2000) Excipient Toxicity and Safety, Marcel Dekker, Inc., New York, N.Y.).
EXAMPLES
[0114] The following examples serve to illustrate the present invention. These examples are in no way intended to limit the scope of the invention.
Example 1. Construction of Lm Deletion Mutant Strains
[0115] To construct the deletion mutant for the dxs gene coding for the 1-deoxy-D-xylulose 5-phosphate synthase, both the upstream and downstream region of the coding sequence were amplified by using primers DXS1-DXS3 and DXS4-DXS2 (Table 4) respectively using as template chromosomal DNA from L. monocytogenes (Lm) DP-L4056.
[0116] After both fragments were purified using QIAquick PCR purification kit we performed splicing by overlap extension (SOE)-PCR using both fragments as template and primers DXS1 and DXS2 in the reaction. The amplified fragment was cloned into the pCR-Blunt vector (Invitrogen) and transformed into Escherichia coli TOP 10 competent cells (Invitrogen). Kanamycin resistant colonies were screened by colony-PCR and plasmid preparations from the positive clones were sequenced to confirm the identity of the amplified fragment.
[0117] A plasmid harboring the 1.2 Kbp fragment containing the up- and downstream region of the dxs gene was digested with SalI and BamHI enzymes (NEB) and the fragment subcloned into the pKSV107oriT vector previously digested with the same enzymes. A colony of E. coli SM10 harboring the desired construct was conjugated with the ΔactA Lm strain (DP-L4029). For this, cultures of the ΔactA Lm and the E. coli strain harboring the corresponding plasmid were grown overnight in brain-heart infusion (BHI) supplemented with 200 μg/ml Streptomycin and Luria-Bertani (LB) 100 μg/ml Ampicillin respectively. After this, cultures were diluted 1/100 in the same fresh media and incubated until an OD.sub.600nm of ˜0.8. Three milliliters of the E. coli culture and 1.5 ml of Lm were centrifuged for 5 min at 12,000 rpm, washed with media without antibiotic and centrifuged again. Both strains were placed together in the same tube and centrifuged again. The pellet containing both strains was resuspended in ˜30 μl of BHI, spotted onto a BHI agar plate and incubated 4 hs at 37 C. The mixture was resuspended in BHI and plated on BHI agar 10 μg/ml Chloramphenicol (Cm). Plates were incubated at 30° C. for 2 days. Colonies obtained were inoculated in BHI 10 μg/ml Cm and grown overnight at 42° C. with shaking (200 rpm). A dilution 1/100 of these cultures was performed in the same media and incubated overnight at 42 C. A new dilution (1/100) was made in BHI and tubes incubated at 30° C. for another 16 hrs.
[0118] Each culture was streaked for individual colonies on BHI agar media and isolated colonies obtained after 24 hrs of incubation at 30° C. were replica plated on BHI and BHI containing 10 μg/ml Cm. Colonies that showed Cm sensitivity were further analyzed by colony-PCR using primers DXS1 and DXS2. To confirm the deletion of the dxs gene, two new colony-PCR reactions were performed: one using primers DXS1 and DXS-int Rev and the second using primers DXS2 and DXS-int For. Colonies that showed a deletion of the dxs gene were grown in BHI Streptomycin for 16 hrs and stocks with glycerol (30%) prepared and keep at −80° C.
[0119] To construct a Δdxr mutant strain (a mutation in the gene encoding the 1-deoxy-D-xylulose 5-phosphate reductoisomerase), we followed the same allelic exchange protocol described above with the following modifications: the upstream and downstream regions of the coding sequence were amplified with primers DXR1-DXR3 and DXR2-DXR4 (Table 4) and the SOE-PCR was performed with primers DXR1 and DXR2. After obtaining putative Δdxr candidates, the colonies were analyzed by PCR using primers DXR1 and DXR2 as well as the following primers combinations DXR1-DXRint Rev and DXR2-DXRint For. Colonies that showed a deletion of the dxr gene were grown in BHI Streptomycin for 16 hrs and stocks with glycerol (30%) prepared and stored at −80° C.
[0120] To construct the mutant strain for the ygbP gene encoding the 4-diphosphocytidyl-2-C-methyl-D-erythritol synthase the upstream and downstream regions of the coding sequenc are amplified with primers YGBP1-YGBP3 and YGBP4-YGBP2 respectively (Table 4). The SOE-PCR is performed with primers YGBP1 and YGBP2 and the same primers are used to confirm the mutation in the ΔactA Lm colonies obtained after the conjugation and the following steps described above. Primers YGBP1-YGBPint Rev and YGBP2-YGBPint For. Colonies that showed a deletion of the ygbP gene are grown in BHI Streptomycin for 16 hrs and stocks with glycerol (30%) prepared and stored at −80° C.
[0121] For the construction of the ΔychB mutant strain (a mutation in the gene encoding the 4-diphosphocytidyl-2-C-methyl-D-erythritol kinase), the protocol described above is followed with the following modifications: the upstream and downstream regions of the coding sequence are amplified with primers YCHB1-YCHB3 and YCHB2-YCHB4 (Table 4) and the SOE-PCR is performed with primers YCHB1 and YCHB2. After obtaining putative ΔychB candidates, the colonies are analyzed by PCR using primers YCHB1 and YCHB 2 as well as the following primers combinations YCHB1-YCHBint Rev and YCHB2-YCHBint For. Colonies that showed a deletion of the ychB gene were grown in BHI Streptomycin for 16 hrs and stocks with glycerol (30%) prepared and stored at −80° C.
[0122] To construct the mutant strain for the ygbB gene encoding the 2-C-methyl-D-erythritol 2,4-cyclopyrophosphate synthase, the upstream and downstream regions of the coding sequence are amplified with primers YGBB1-YGBB3 and YGBB4-YGBB2 respectively (Table 4). The SOE-PCR is performed with primers YGBB1 and YGBB2 and the same primers were used to confirm the mutation in the ΔactA Lm colonies obtained after the conjugation and the following steps described above. Primers YGBB1-YGBBint Rev and YGBB2-YGBBint For. Colonies that showed a deletion of the ygbB gene were grown in BHI Streptomycin for 16 hrs and stocks with glycerol (30%) prepared and stored at −80° C.
TABLE-US-00009 TABLE 4 Primer Sequence (5′ to 3′) DXS1 GGTCGACGATTACTCACGCTTGATGGGGC DXS2 GGATCCTTCCTTCTCCACCTGTAATAGGTG DXS3 TCATAGTCTCTTCGCCCTTAACTTAAGATCCAAATAAAAA CAACTCAC DXS4 GTGAGTTGTTTTTATTTGGATCTTAAGTTAAGGGCGAAGA GACTATGA DXSINT- GCGAGTGTGTTAGAATTTATAGAAG FOR DXSINT- CCCAAATAAATTTATCTTTTGGAC REV DXR1 GGTCGACTTGCAACTATTGCATTATATGAAG DXR2 GGATCCCATTGATGGAAAGAACTTCATCCC DXR3 CTATAAAAGTGTCTTTACATACGCACCTAGCAAAATAATT TTTTTCAT DXR4 ATGAAAAAAATTATTTTGCTAGGTGCGTATGTAAAGACAC TTTTATAG DXRINT- AAATAGGTGGAACAATGCCGACAG FOR DXRINT- GCTTCTAAGGTAACACGATCTCTC REV YGBP1 GGTCGACGTATCGGAATTAGTCGTCGTAACG YGBP2 GGATCCACATCCACGCCTTCATCCCAGTCC YGBP3 CTAATCATTTGCTATCCCTCCAAGAACCAACTCATAATTC ATGCTCAT YGBP4 ATGAGCATGAATTATGAGTTGGTTCTTGGAGGGATAGCAA ATGATTAG YGBPINT- CTGCCTATTTTACGAAAAGCGCATC FOR YGBPINT- ATTCTTTTACATGCTTTCTTTCC REV YGBB1 GGTCGACATGAGCATGAATTATGAGTTGG YGBB2 GGATCCCATATCGTTGAAAGTAATCGTTTC YGBB3 CAAGTAAGACAACGGCTAGACTTGATAACCTTGGCCAATT CTAATCAT YGBB4 ATGATTAGAATTGGCCAAGGTTATCAAGTCTAGCCGTTGT CTTACTTG YGBBINT- GCTGAAAAGCCAAAAATGGCGCC FOR YGBBINT- TGACCAATATCACCAGCACCAATTG REV YCHB1 GGTCGACGCTCAAAGAAGAAAAACGCTTTGG YCHB2 GGATCCGGCCTAAATATGCTTGTAGTTCTC YCHB3 GTATCGTTCTCGCCTTCACTCCATTGGTGCTGTAATGCTT ATTTTCAT YCHB4 ATGAAAATAAGCATTACAGCACCAATGGAGTGAAGGCGAG AACGATAC YCHBINT- GTTAGCGTTTGGTGCTGAGGCGG FOR YCHB INT- ACGATCTTCTGGAATAAAGTGCGC REV
[0123] To construct the deletion mutant for the gcpE gene coding for the (E)-4-hydroxy-3-methyl-but-2-enyl pyrophosphate (HMB-PP) synthase, we amplified both the upstream and downstream region of the coding sequence by using primers GcpE1-E3 and GcpE4-E2 (Table 5) respectively using as template chromosomal DNA from L. monocytogenes (Lm) DP-L4056.
[0124] After both fragments were purified using QIAquick PCR purification kit we performed splicing by overlap extension (SOE)-PCR using both fragments as template and primers GcpE1 and GcpE2 in the reaction. The amplified fragment was cloned into the pCR-Blunt vector (Invitrogen) and transformed into Escherichia coli TOP 10 competent cells (Invitrogen). Kanamycin resistant colonies were screened by colony-PCR and plasmid preparations from the positive clones were sequenced to confirm the identity of the amplified fragment.
[0125] A plasmid harboring the 1.2 Kbp fragment containing the up- and downstream region of the gcpE gene was digested with SalI and BamHI enzymes (NEB) and the fragment subcloned into the pKSV107oriT vector previously digested with the same enzymes. A colony of E. coli SM10 harboring the desire construct was conjugated with the ΔactA Lm strain (DP-L4029). For this, cultures of the ΔactA Lm and the E. coli strain harboring the corresponding plasmid were grown overnight in brain-heart infusion (BHI) supplemented with 200 μg/ml Streptomycin and Luria-Bertani (LB) 100 μg/ml Ampicillin respectively. After this, cultures were diluted 1/100 in the same fresh media and incubated until an OD.sub.600nm of ˜0.8. Three milliliters of the E. coli culture and 1.5 ml of Lm were centrifuged for 5 min at 12,000 rpm, washed with media without antibiotic and centrifuged again. Both strains were placed together in the same tube and centrifuged again. The pellet containing both strains was resuspended in ˜30 μl of BHI, spotted onto a BHI agar plate and incubated 4 hs at 37° C. The mixture was resuspended in BHI and plated on BHI agar 10 μg/ml Chloramphenicol (Cm). Plates were incubated at 30° C. for 2 days. Colonies obtained were inoculated in BHI 10 μg/ml Cm and grew overnight at 42° C. with shaking (200 rpm). A dilution 1/100 of these cultures was performed in the same media and incubated for another overnight at 42° C. A new dilution (1/100) was made in BHI and tubes incubated at 30° C. for another 16 hrs.
TABLE-US-00010 TABLE 5 Primers used Name 5′ to 3′ Sequence GcpE GGTCGACCCTATCTCGATTGATCAAGATGAAC 1 GcpE GGATCCGCTAGTTCAGGTGTCATAACTCGC 2 GcpE CGATTATCTAAGGCTTTCCAAATCTTGGACTGGGCGAGTG 3 TTTTCGCG GcpE CGCGAAAACACTCGCCCAGTCCAAGATTTGGAAAGCCTTA 4 GATAATCG GcpE- GCAAGTAGGGCAGGAGATAAGCAT int- Rev GcpE- ATTCACCGATTAGAAGAAGCTGG int- For
[0126] Each culture was streaked on BHI agar plates and isolated colonies obtained after 24 hrs of incubation at 30° C. were replica plated on BHI and BHI containing 10 μg/ml Cm. Colonies that showed Cm sensitivity were further analyzed by colony-PCR using primers GcpE1 and GcpE2. To confirm the deletion of the gcpE gene, two new colony-PCR reactions were performed: one using primers GcpE1 and GcpE-int Rev and the second using primers GcpE2 and GcpE-int For. Those colonies that showed a deletion of the gcpE gene were grown in BHI Streptomycin for 16 hrs and stocks with glycerol (30%) prepared and stored at −80° C.
Example 2. Analysis of T-Cell Populations Resulting from Human Administration of a Listerial Cancer Vaccine
[0127] A live-attenuated, strain of Listeria monocytogenes (Lm) encoding a mutant form of the tumor-associated antigens, epidermal growth factor receptor (EGFRvIII) and the cancer/testis antigen NY-ESO-1 (referred to as ADU-623) was used for immunization in human subjects with glioblastoma malignancy. Upon intravenous administration, live-attenuated Listeria monocytogenes encoding EGFRvIII-NY-ESO-1 vaccine is preferentially taken up by dendritic cells and expresses EGFRvIII and NY-ESO-1 in the cytosol of infected APCs. This promotes both a potent innate immune response and an adaptive immune response involving the recruitment and activation of T lymphocytes against EGFRvIII and NY-ESO-1-expressing tumor cells, which results in tumor cell lysis. Attenuation was achieved by deletion of the actA and inlB genes of the bacterial genome.
[0128] Inclusion Criteria:
[0129] Patients with a pathologic diagnosis of WHO Grade III or Grade IV astrocytic tumors that have completed standard of care or with radiographic evidence of progression following standard of care.
[0130] Tumor tissue blocks available to perform both EGFRvIII and NY-ESO-1 testing.
[0131] Eastern Cooperative Oncology Group (ECOG) performance status 0 or 1 or Karnofsky Performance Status (KPS) 70-100.
[0132] Age 18 years or above.
[0133] Have a life expectancy of more than 12 weeks
[0134] Laboratory values (performed within 5 days) within designated range.
[0135] For women and men of childbearing potential, an acceptable method of highly effective contraception
[0136] Ability to give informed consent and comply with the protocol.
[0137] Exclusion Criteria:
[0138] Have a known allergy to both penicillin and sulfa
[0139] Have artificial (prosthetic) joint(s), orthopedic screw(s), metal plate(s) or other exogenous implant(s) or device(s) that cannot be easily removed (i.e., prosthetic heart valves).
[0140] Have any evidence of hepatic cirrhosis or clinical or radiographic ascites.
[0141] Have radiographic or clinically significant pleural effusion.
[0142] Receipt of prophylactic vaccine within 28 days of study treatment.
[0143] Unable to avoid close contact with another individual known to be at high risk of listeriosis (e.g., newborn infant, pregnant woman, HIV-positive individual).
[0144] History of allergy to yeast or any other component of the ADU-623 vaccine (e.g., glycerol).
[0145] Have an immunodeficiency disease or immunocompromised state (e.g., use of immunosuppressive agents; chemotherapy or radiation therapy within 14 days of study treatment).
[0146] Have had major surgery or significant traumatic injury occurring within 28 days before treatment administration or anticipated surgery or procedure requiring general anesthesia during study participation (including 28 days after last dose of ADU-623).
[0147] Use of more than 4 grams per day of acetaminophen.
[0148] Have received an investigational product within 28 days of study treatment or planned to receive within 28 days after vaccine administration.
[0149] Have an unhealed surgical wound.
[0150] Have clinically significant heart disease (such as uncontrolled angina, myocardial infarction with the last 3 months, congestive heart failure of New York Heart Association III or IV).
[0151] Have valvular heart disease that requires antibiotic prophylaxis for prevention of endocarditis.
[0152] Have an intercurrent illness that is either life-threatening or of clinical significance such that it might limit compliance with study requirements including, but not limited to, ongoing or active infection, metabolic or neurological disease, peripheral vascular disease or psychiatric illness.
[0153] Have insufficient peripheral venous access to permit completion of the study dosing and compliance with study phlebotomy regimen.
[0154] Have received a diagnosis of HIV, HCV, or HBV (patients with hepatitis C antibody positive may be enrolled if they are confirmed with negative viral load at screening).
[0155] Have an active autoimmune disease or history of autoimmune disease requiring systemic steroids or other immunosuppressive treatment.
[0156] Other medical or psychiatric conditions that in the opinion of the Principal Investigator would preclude safe participation in protocol.
[0157] Pregnant or lactating women, as treatment has unknown effect on the embryo or child.
[0158] Patients requiring chronic corticosteroid use will be excluded as this may mask toxic effects related to the vaccine and may prevent the development of effective immune responses following vaccination.
[0159] Patients were treated intravenously with 3×10.sup.7 CFU of ADU-623 as indicated in
[0160] For identification of various T-cell subpopulations, the following antibodies were used for staining prior to flow cytometry:
TABLE-US-00011 Target antigen Fluorochrome Vendor Cat# Clone CD45 FITC BD 347463 2D1 CD3 Alexa 700 eBio 56-0038-42 UCHT1 CD4 PerCP-Cy5.5 BD 341654 SK3 CD8 APC-H7 BD 641409 SK1 CXCR3 PE-Cy7 BD 560831 1C6/CXCR3 TCR αβ BV510 BD 563625 T10B9.1A-31 TCR γδ BV421 BD 562560 B1 TCR Vγ9 PE BD 555733 B3 TCR Vδ2 APC Milteny 130-099-664 123R3 CD69 BV421 BD 562884 FN50 CD25 BV605 BD 562660 2A3 IFN-γ APC BD 554702 B27 TNF-α PE-Cy7 BD 557647 MAb11 rIL-2 PE BD 559334 MQ1-17H12
[0161] For HMB-PP or Listeria lysate stimulation of T-cells, 0.5×10.sup.6 PBLs were incubated with 50 ng/ml HMBPP in 100 μl final volume for 1 h at 37° C., 5% CO.sub.2 followed by an additional 5-h incubation in the presence of brefeldin A.
[0162] As depicted in
[0163] These data demonstrate that HMB-PP specific Vg9Vd2 T cells vastly outnumber LLO- and p60-specific ab T cells. Therefore, the clearance of the vaccine by these anti-bacterial cytolytic effector cells (Vg9Vd2 T cells) may limit the duration of infection, the magnitude of the inflammatory response, and the duration of antigen presentation to ab T cells.
[0164] One skilled in the art readily appreciates that the present invention is well adapted to carry out the objects and obtain the ends and advantages mentioned, as well as those inherent therein. The examples provided herein are representative of preferred embodiments, are exemplary, and are not intended as limitations on the scope of the invention.
[0165] It will be readily apparent to a person skilled in the art that varying substitutions and modifications may be made to the invention disclosed herein without departing from the scope and spirit of the invention.
[0166] All patents and publications mentioned in the specification are indicative of the levels of those of ordinary skill in the art to which the invention pertains. All patents and publications are herein incorporated by reference to the same extent as if each individual publication was specifically and individually indicated to be incorporated by reference.
[0167] The invention illustratively described herein suitably may be practiced in the absence of any element or elements, limitation or limitations which is not specifically disclosed herein. Thus, for example, in each instance herein any of the terms “comprising”, “consisting essentially of” and “consisting of” may be replaced with either of the other two terms. The terms and expressions which have been employed are used as terms of description and not of limitation, and there is no intention that in the use of such terms and expressions of excluding any equivalents of the features shown and described or portions thereof, but it is recognized that various modifications are possible within the scope of the invention claimed. Thus, it should be understood that although the present invention has been specifically disclosed by preferred embodiments and optional features, modification and variation of the concepts herein disclosed may be resorted to by those skilled in the art, and that such modifications and variations are considered to be within the scope of this invention as defined by the appended claims.
[0168] Other embodiments are set forth within the following claims.