COMPOSITIONS AND METHODS OF TREATMENT FOR BREAST CANCER INVOLVING A NOVEL CAPER?-MLL1 COMPLEX
20220265769 · 2022-08-25
Assignee
Inventors
Cpc classification
C07K2319/10
CHEMISTRY; METALLURGY
International classification
Abstract
The present invention relates to epigenetic therapies for the treatment of cancer. In particular embodiments, the present invention relates to CAPERα (Coactivator of AP1 and Estrogen Receptor) RRM3 domain-derived cell penetrating peptides that decrease breast cancer growth and survival yet are nontoxic to normal cells. In addition, the present invention relates to nucleic acid molecules encoding such therapeutic peptides, and vectors and host cells comprising such nucleic acid molecules. The invention further relates to methods of producing the therapeutic peptides of the invention, and to methods of using these therapeutic peptides in the treatment of disease.
Claims
1. A method of treating cancer comprising administering a therapeutically effective amount of an RRM3-derived peptide of Coactivator of AP1 and Estrogen Receptor (CAPERα) to a subject in need thereof.
2. The method of claim 1, wherein the cancer is breast cancer.
3. The method of claim 2, wherein the breast cancer is estrogen receptor positive (ER+).
4. The method of claim 2, wherein the breast cancer is human epidermal growth factor receptor 2 positive (HER+).
5. The method of claim 2, wherein the breast cancer is triple-negative breast cancer (TNBC).
6. The method of any of claims 1-5, wherein administration of the RRM3-derived peptide of CAPERα disrupts the CAPERα/mixed lineage leukemia 1 (MLL1) (CAP/MLL1) complex.
7. The method of any of claims 1-6, wherein administration of the RRM3-derived peptide of CAPERα regulates chromatin marks.
8. The method of any of claims 1-7, wherein administration of the RRM3-derived peptide of CAPERα regulates transcription one or more of the following genes: BCL2L1, BCL6, JUNB, CCND1, FOXA1, FOXM1, ESR1, MYC, and GATA3.
9. The method of any of claims 1-7, wherein administration of the RRM3-derived peptide of CAPERα regulates transcription of one or more of the genes listed in Table 1.
10. The method of any of claims 1-7, wherein administration of the RRM3-derived peptide of CAPERα regulates transcription of one or more of the genes listed in Table 2.
11. The method of any of claims 1-7, wherein administration of the RRM3-derived peptide of CAPERα regulates transcription of breast cancer pioneer genes.
12. The method of any of claims 1-11, wherein administration of the RRM3-derived peptide of CAPERα prevents MLL1 occupancy in the CAP/MLL1 complex.
13. The method of any of claims 1-12, wherein administration of the RRM3-derived peptide of CAPERα inhibits the catalytic activity of the CAP/MLL1 complex.
14. The method of any of claims 1-13, wherein administration of the RRM3-derived peptide of CAPERα inhibits CAP/MLL1 complex binding to chromatin bearing one or more of the following MYC, Rb, E2F1, STAT1/3, ARNT, and GABPB1/2.
15. The method of any of claims 1-14, wherein administration of the RRM3-derived peptide of CAPERα disrupts binding to the CAP/MLL1 complex by ASH2L.
16. The method of any of claims 1-15, wherein administration of the RRM3-derived peptide of CAPERα decreases association of MLL1, ASH2L, RbBP5, and/or WDR5 with genomic promoters.
17. The method of any of claims 1-16, wherein administration of the RRM3-derived peptide of CAPERα inhibits histone 3, lysine 4 (H3K4) trimethylation of target genes.
18. The method of any of claims 1-17, wherein administration of the RRM3-derived peptide of CAPERα inhibits histone 3, lysine 9 (H3K9) acetylation of target genes.
19. The method of any of claims 1-18, wherein administration of the RRM3-derived peptide of CAPERα increases expression of one or more of the following proteins: NFKβ, TNF, and interferon.
20. The method of any of claims 1-19, wherein administration of the RRM3-derived peptide of CAPERα upregulates the transcription of one or more of the following genes: CASPASE gene 2, CASPASE gene 3, CASPASE gene 4, CASPASE gene 6, CASPASE gene 8, CASPASE gene 9, KMT2B, KMT2C, KMT2D, SETD1A, vREL, and SETD1B.
21. The method of any of claims 1-20, wherein the RRM3-derived peptide of CAPERα is nontoxic to noncancerous cells.
22. The method of any of claims 1-21, wherein administration of the RRM3-derived peptide of CAPERα results in decreases proliferation of cancer cells by about 30%.
23. The method of any of claims 1-22, wherein administration of the RRM3-derived peptide of CAPERα results in increases cell death by about 20%.
24. The method of any of claims 1-23, wherein the RRM3-derived peptide of CAPERα does not include the 5′ β-sheet of the RRM3 domain of CAPERα.
25. The method of any of claims 1-24, wherein the RRM3-derived peptide of CAPERα does not include the 5′ α-helix of the RRM3 domain of CAPERα.
26. The method of any of claims 1-23, wherein the RRM3-derived peptide of CAPERα comprises the amino acid sequence of SEQ ID NO: 1.
27. The method of any of claims 1-23, wherein the RRM3-derived peptide of CAPERα comprises the amino acid sequence of SEQ ID NO: 2.
28. The method of any of claims 1-23, wherein the RRM3-derived peptide of CAPERα comprises the amino acid sequence of SEQ ID NO: 3.
29. The method of any of claims 1-23, wherein the RRM3-derived peptide of CAPERα comprises the amino acid sequence of SEQ ID NO: 4.
30. The method of any of claims 1-23, wherein the RRM3-derived peptide of CAPERα comprises the amino acid sequence of SEQ ID NO: 5.
31. The method of any of claims 1-23, wherein the RRM3-derived peptide of CAPERα comprises the amino acid sequence of SEQ ID NO: 6.
32. The method of any of claims 1-23, wherein the RRM3-derived peptide of CAPERα comprises the amino acid sequence of SEQ ID NO: 7.
33. The method of any of claims 1-23, wherein the RRM3-derived peptide of CAPERα comprises the amino acid sequence of SEQ ID NO: 8.
34. The method of any of claims 1-23, wherein the RRM3-derived peptide of CAPERα comprises the amino acid sequence of SEQ ID NO: 9.
35. The method any of claims 1-23, wherein the RRM3-derived peptide of CAPERα comprises the amino acid sequence of SEQ ID NO: 10.
36. The method of any of claims 1-23, wherein the RRM3-derived peptide of CAPERα comprises the amino acid sequence of SEQ ID NO: 11.
37. The method of any of claims 1-36, wherein the RRM3-derived peptide of CAPERα is conjugated with the Penetratin cell penetrating peptide.
38. The method of claim 37, wherein the Penetratin cell penetrating peptide comprises the amino acid sequence of SEQ ID NO: 12.
39. The method of any of claims 1-38, wherein the RRM3-derived peptide of CAPERα is conjugated to a poly-histidine peptide.
40. The method of any of claims 1-39, wherein the RRM3-derived peptide of CAPERα is pegylated.
41. The method of any of claims 1-40, wherein the RRM3-derived peptide of CAPERα is myristoylated.
42. An RRM3-derived peptide of CAPERα conjugated to a protein transduction domain.
43. The RRM3-derived peptide of CAPERα of claim 42, wherein the RRM3-derived peptide of CAPERα does not include the 5′ n-sheet of the RRM3 domain of CAPERα.
44. The RRM3-derived peptide of CAPERα of any of claims 42-43, wherein the RRM3-derived peptide of CAPERα does not include the 5′ α-helix of the RRM3 domain of CAPERα.
45. The RRM3-derived peptide of CAPERα of claim 42, wherein the RRM3-derived peptide of CAPERα comprises the amino acid sequence of SEQ ID NO: 1.
46. The RRM3-derived peptide of CAPERα of claim 42, wherein the RRM3-derived peptide of CAPERα comprises the amino acid sequence of SEQ ID NO: 2.
47. The RRM3-derived peptide of CAPERα of claim 42, wherein the RRM3-derived peptide of CAPERα comprises the amino acid sequence of SEQ ID NO: 3.
48. The RRM3-derived peptide of CAPERα of claim 42, wherein the RRM3-derived peptide of CAPERα comprises the amino acid sequence of SEQ ID NO: 4.
49. The RRM3-derived peptide of CAPERα of claim 42, wherein the RRM3-derived peptide of CAPERα comprises the amino acid sequence of SEQ ID NO: 5.
50. The RRM3-derived peptide of CAPERα of claim 42, wherein the RRM3-derived peptide of CAPERα comprises the amino acid sequence of SEQ ID NO: 6.
51. The RRM3-derived peptide of CAPERα of claim 42, wherein the RRM3-derived peptide of CAPERα comprises the amino acid sequence of SEQ ID NO: 7.
52. The RRM3-derived peptide of CAPERα of claim 42, wherein the RRM3-derived peptide of CAPERα comprises the amino acid sequence of SEQ ID NO: 8.
53. The RRM3-derived peptide of CAPERα of claim 42, wherein the RRM3-derived peptide of CAPERα comprises the amino acid sequence of SEQ ID NO: 9.
54. The RRM3-derived peptide of CAPERα of claim 42, wherein the RRM3-derived peptide of CAPERα comprises the amino acid sequence of SEQ ID NO: 10.
55. The RRM3-derived peptide of CAPERα of claim 42, wherein the RRM3-derived peptide of CAPERα comprises the amino acid sequence of SEQ ID NO: 11.
56. The RRM3-derived peptide of CAPERα of any of claims 42-55, wherein the RRM3-derived peptide of CAPERα is conjugated with the Penetratin cell penetrating peptide.
57. The RRM3-derived peptide of CAPERα of claim 56, wherein the Penetratin cell penetrating peptide comprises the amino acid sequence of SEQ ID NO: 12.
58. The RRM3-derived peptide of CAPERα of any of claims 42-57, wherein the RRM3-derived peptide of CAPERα is conjugated to a poly-histidine peptide.
59. The RRM3-derived peptide of CAPERα of any of claims 42-58, wherein the RRM3-derived peptide of CAPERα is pegylated.
60. The RRM3-derived peptide of CAPERα of any of claims 42-59, wherein the RRM3-derived peptide of CAPERα is myristoylated.
Description
BRIEF DESCRIPTION OF THE DRAWING FIGURES
[0017]
[0018]
[0019]
[0020]
[0021]
[0022]
[0023]
[0024]
[0025]
[0026]
[0027]
[0028]
[0029]
[0030]
[0031]
[0032]
[0033]
[0034]
[0035]
[0036]
[0037]
[0038]
[0039]
[0040]
[0041]
[0042]
[0043]
[0044]
[0045]
[0046]
[0047]
[0048]
[0049]
[0050]
[0051]
[0052]
[0053]
[0054]
[0055]
[0056]
[0057]
[0058]
[0059]
DETAILED DESCRIPTION OF THE INVENTION
[0060] The present inventors are the first to explain the molecular mechanisms and interacting proteins for CAPERα in multiple breast cancer subtypes and demonstrate critical differences in its function in breast cancer and normal breast epithelial cells. The present inventors discovered a novel epigenetic regulatory complex between CAPERα and MLL1 (CAP/MLL1) in breast cancer; this complex does not exist in normal breast cells. The present inventors uncovered inherent DNA binding activity in CAPERα and show that binding and H3K4 trimethylation (H3K4me3) of target chromatin by MLL1 requires CAPERα occupancy in multiple breast cancer cell types. Consistent with this, RNA- and ChIP-Seq experiments show decreased global H3K4me3 marks and dysregulation of thousands of CAP/MLL1 direct transcriptional targets after CAPERα knockdown including master regulators such as MYC, GATA3 and FOXA1. Of therapeutic relevance, disruption of the CAP/MLL1 complex with dominant-negative cell penetrating peptides derived from the RRM3 domain of CAPERα normalized proliferation and gene expression of breast cancer cells yet had no effect on normal cells. These findings reveal a novel epigenetic regulator of the transcriptional signatures of breast cancer cells, the molecular mechanisms underpinning CAPERα and MLL1 function in breast cancer, and new avenues for cancer cell-specific epigenetic therapies based on CAP/MLL1 complex disruption
[0061] As discussed above, CAP/MLL1 is a critical complex that functions near the top of the transcriptional regulatory hierarchy in breast cancer cells. It controls chromatin structure and transcriptional signatures upstream of abnormal proliferation and other cancer hallmarks in multiple breast cancer subtypes. As discussed in further detail below, a key finding by the inventors is that the complex is not present in primary mammary epithelial cells (and numerous other normal tissues) such that CAPERα knock-down (kd) or complex disruption has no effect in these cells. DNA-binding and protein-protein interaction studies conducted by the inventors reveal new and distinct functions of individual CAPERα functional domains in CAP/MLL1 complex formation, stability, and DNA-binding, and elucidate a new transcription regulation function at the level of chromatin structure distinct from CAPERα's previously known coactivator and splicing regulator functions. Dominant-negative CAPERα RRM3-derived CPPs disrupt the complex and normalize proliferation and gene expression of multiple subtypes of breast cancer cells.
[0062] As discussed in further detail below, genome-wide studies conducted by the inventors revealed that the vast repertoire of CAP/MLL1-regulated genes and pathways is critical for obtaining and/or maintaining cancer hallmarks in breast cancer cells. In addition to directly regulating many cell cycle, oncogenes, tumor suppressors and housekeeping genes, the inventors found that disruption of CAP/MLL1 profoundly alters the metabolic and inflammatory transcriptomes of breast cancer cells and activates proapoptotic cascades, all of which contribute to decreased proliferation and viability. This metabolic response and enrichment of GABPA/B and Myc motifs in the ChIP-Seq data are concordant with work by Kang and colleagues showing that CAPERα has a highly conserved role integrating energy homeostasis and mitochondrial function in hepatocytes via ERRα-GABPA and NFKβ/Myc pathways (Kang Y K, et al., PLoS Genet. 11(4):e1005116 (2015)); many of the CAPERα regulated genes reported by Kang et. al. are also direct targets of CAP/MLL1 in breast cancer cells.
[0063] As discussed in further detail below, the inventors found a novel molecular function for CAPERα as a transcription factor with DNA-binding activity critical to recruit MLL1 and other COMPASS epigenetic regulators to chromatin of target promoters. Despite previous studies showing context-dependent co-activator or -repressor function with DNA-binding cofactors (ESR1, AP1, TBX3, REL) (Kumar P P, et al., eLife. e02805 (2014); Dutta J, et al., J Virol. 82(21):10792-802 (2008); Jung D J, et al., J Biol Chem. 277(2):1229-34 (2002)) the inventors found that CAPERα does not interact with ESR1 in breast cancer cells rather, CAP/MLL1 regulates pioneer factor expression upstream of estrogen receptor signaling in ER+ T47D cells and also functions in hormone receptor negative breast cancer subtypes.
[0064] As discussed in further detail below, the inventors were the first to obtain important insight into how molecular functions of CAPERα are mediated by different domains. DNA binding is mediated by RRM2. RRM1 is necessary for interaction with WDR5, the RNA binding pocket for the MLL1 core complex. RRM3 mediates interaction with MLL1, ASH2L and RbBP5 and only RRM3 decreases breast cancer cell proliferation/survival and cell cycle gene expression by disrupting CAP/MLL1 in a dominant-negative manner.
[0065] Cellular fractionation studies provided insight into why the CAP/MLL1 complex can form in breast cancer cells (where all components are present in the nucleus) but not in PMEs (where CAPERα and WDR5 are restricted to the cytoplasm).
[0066] Several groups had reported anti-cancer strategies targeting CAPERα or MLL1 (Grembecka J, et al., Nature chemical biology. 8(3):277-84 (2012); Senisterra G, et al., Biochem J. 449(1):151-9 (2013); Wang E, et al., Cancer Cell. 35(3):369-84 e7 (2019); Thomas R, et al., Cancer Cell. 35(3):337-9 (2019)). However, both proteins are ubiquitously expressed and have important roles in most normal cells. In fact, the inventors determined that Caperα is required for survival of numerous progenitor populations in the developing embryo and complete ablation of Caperα in mice causes early embryonic lethality. Because the CAP/MLL1 complex is not present in the normal cells tested, it presents a unique, cancer cell-specific therapeutic target such that RRM3-derived cell penetrating peptides disrupt the complex and inhibit proliferation and survival of multiple subtypes of breast cancer cells but have no effect on normal mammary epithelial cells. The inventors have also undertaken the next step of preclinical testing of these peptides using mouse models of breast cancer and patient-derived tumor xenografts to assess their interference with tumor formation, progression and metastasis in vivo. These results serve for the strategy of CAP/MLL1 disruption with cell-penetrating dominant-negatives as efficacious, selective, and nontoxic for new cancer therapy.
Definitions
[0067] Unless defined otherwise, all technical and scientific terms used herein generally have the same meaning as commonly understood by one of ordinary skill in the art. Generally, the nomenclature used herein and the laboratory procedures in cell culture, molecular genetics, nucleic acid chemistry and hybridization described below are those well-known and commonly employed in the art. Standard techniques and procedures are generally performed according to conventional methods in the art and various general references (see generally, Sambrook et al. Molecular Cloning: A Laboratory Manual, 2nd ed. (1989) Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., which is incorporated herein by reference), which are provided throughout this document.
RRM3-Derived Peptides
[0068] The RRM3-derived peptides of the invention comprise polypeptides and fragments thereof. As used herein, term “polypeptide” is intended to encompass a singular “polypeptide” as well as plural “polypeptides,” and refers to a molecule composed of monomers (amino acids) linearly linked by amide bonds (also known as peptide bonds). The term “polypeptide” refers to any chain or chains of two or more amino acids, and does not refer to a specific length of the product. Thus, peptides, dipeptides, tripeptides, oligopeptides, “protein,” “amino acid chain,” or any other term used to refer to a chain or chains of two or more amino acids, are included within the definition of “polypeptide,” and the term “polypeptide” may be used instead of, or interchangeably with any of these terms. The term “polypeptide” is also intended to refer to the products of post-expression modifications of the polypeptide, including without limitation glycosylation, acetylation, phosphorylation, amidation, derivatization by known protecting/blocking groups, proteolytic cleavage, or modification by non-naturally occurring amino acids. A polypeptide may be derived from a natural biological source or produced by recombinant technology, but is not necessarily translated from a designated nucleic acid sequence. It may be generated in any manner, including by chemical synthesis.
[0069] A polypeptide of the invention may be of a size of about 3 or more, 5 or more, 10 or more, 20 or more, 25 or more, 50 or more, 75 or more, 100 or more, 200 or more amino acids. Polypeptides may have a defined three-dimensional structure, although they do not necessarily have such structure. Polypeptides with a defined three-dimensional structure are referred to as folded, and polypeptides which do not possess a defined three-dimensional structure, but rather can adopt a large number of different conformations, and are referred to as unfolded.
[0070] By an “isolated” polypeptide or a variant, or derivative thereof is intended a polypeptide that is not in its natural milieu. No particular level of purification is required. For example, an isolated polypeptide can be removed from its native or natural environment. Recombinantly produced polypeptides and proteins expressed in host cells are considered isolated for purposed of the invention, as are native or recombinant polypeptides which have been separated, fractionated, or partially or substantially purified by any suitable technique.
[0071] Also included as polypeptides of the present invention are derivatives, analogs, or variants of the foregoing polypeptides, and any combination thereof. The terms “variant,” “derivative” and “analog” when referring to polypeptides of the present invention include any polypeptides that retain at least some of the biological, antigenic, or immunogenic properties of the corresponding native polypeptide. Variants of polypeptides of the present invention include polypeptides with altered amino acid sequences due to amino acid substitutions, deletions, or insertions. Variants may occur naturally or be non-naturally occurring. Non-naturally occurring variants may be produced using art-known mutagenesis techniques. Variant polypeptides may comprise conservative or non-conservative amino acid substitutions, deletions or additions. Derivatives of polypeptides of the present invention, are polypeptides which have been altered so as to exhibit additional features not found on the native polypeptide. Examples include fusion proteins. Variant polypeptides may also be referred to herein as “polypeptide analogs.” As used herein a “derivative” of a polypeptide refers to a subject polypeptide having one or more residues chemically derivatized by reaction of a functional side group. Also included as “derivatives” are those peptides which contain one or more naturally occurring amino acid derivatives of the twenty standard amino acids. For example, 4-hydroxyproline may be substituted for proline; 5-hydroxylysine may be substituted for lysine; 3-methylhistidine may be substituted for histidine; homoserine may be substituted for serine; and ornithine may be substituted for lysine.
[0072] Alternatively, recombinant variants encoding these same or similar polypeptides can be synthesized or selected by making use of the “redundancy” in the genetic code. Various codon substitutions, such as the silent changes which produce various restriction sites, may be introduced to optimize cloning into a plasmid or viral vector or expression in a particular prokaryotic or eukaryotic system. Mutations in the polynucleotide sequence maybe reflected in the polypeptide or domains of other peptides added to the polypeptide to modify the properties of any part of the polypeptide, to change characteristics such as ligand-binding affinities, interchain affinities, or degradation/turnover rate.
[0073] Preferably, amino acid “substitutions” are the result of replacing one amino acid with another amino acid having similar structural and/or chemical properties, i.e., conservative amino acid replacements. “Conservative” amino acid substitutions may be made on the basis of similarity in polarity, charge, solubility, hydrophobicity, hydrophilicity, and/or the amphipathic nature of the residues involved. For example, nonpolar (hydrophobic) amino acids include alanine, leucine, isoleucine, valine, proline, phenylalanine, tryptophan, and methionine; polar neutral amino acids include glycine, serine, threonine, cysteine, tyrosine, asparagine, and glutamine; positively charged (basic) amino, acids include arginine, lysine, and histidine; and negatively charged (acidic) amino acids include aspartic acid and glutamic acid. “Insertions” or “deletions” are preferably in the range of about 1 to about 20 amino acids, more preferably 1 to 10 amino acids. The variation allowed may be experimentally determined by systematically making insertions, deletions, or substitutions of amino acids in a polypeptide molecule using recombinant DNA techniques and assaying the resulting recombinant variants for activity.
[0074] By a polypeptide having an amino acid sequence at least, for example, 95% “identical” to a query amino acid sequence of the present invention, it is intended that the amino acid sequence of the subject polypeptide is identical to the query sequence except that the subject polypeptide sequence may include up to five amino acid alterations per each 100 amino acids of the query amino acid sequence. In other words, to obtain a polypeptide having an amino acid sequence at least 95% identical to a query amino acid sequence, up to 5% of the amino acid residues in the subject sequence may be inserted, deleted, or substituted with another amino acid. These alterations of the reference sequence may occur at the amino or carboxy terminal positions of the reference amino acid sequence or anywhere between those terminal positions, interspersed either individually among residues in the reference sequence or in one or more contiguous groups within the references sequence.
[0075] As a practical matter, whether any particular polypeptide is at least 80%, 85%, 90%, 95%, 96,%, 97%, 98%, or 99% identical to a reference polypeptide can be determined conventionally using known computer programs. A preferred method for determining the best overall match between a query sequence (a sequence of the present invention) and a subject sequence, also referred to as a global sequence alignment, can be determined using the FASTDB computer program based on the algorithm of Brutlag et al., Comp. Appl. Biosci. 6:237-245 (1990). In a sequence alignment the query and subject sequences are either both nucleotide sequences or both amino acid sequences. The result of said global sequence alignment is in percent identity. Preferred parameters used in a FASTDB amino acid alignment are: Matrix=PAM 0, k-tuple=2, Mismatch Penalty=1, Joining Penalty=20, Randomization Group Length=0, Cutoff Score=1, Window Size=sequence length, Gap Penalty=5, Gap Size Penalty-0.05, Window Size=500 or the length of the subject amino acid sequence, whichever is shorter.
[0076] If the subject sequence is shorter than the query sequence due to N- or C-terminal deletions, not because of internal deletions, a manual correction must be made to the results. This is because the FASTDB program does not account for N- and C-terminal truncations of the subject sequence when calculating global percent identity. For subject sequences truncated at the N- and C-termini; relative to the query sequence, the percent identity is corrected by calculating the number of residues of the query sequence that are N- and C-terminal of the subject sequence, which are not matched/aligned with a corresponding subject residue, as a percent of the total bases of the query sequence. Whether a residue is matched/aligned is determined by results of the FASTDB sequence alignment. This percentage is then subtracted from the percent identity, calculated by the above FASTDB program using the specified parameters, to arrive at a final percent identity score. This final percent identity score is what is used for the purposes of the present invention. Only residues to the N- and C-termini of the subject sequence, which are not matched/aligned with the query sequence, are considered for the purposes of manually adjusting the percent identity score. That is, only query residue positions outside the farthest N- and C-terminal residues of the subject sequence.
[0077] For example, a 90 amino acid residue subject sequence is aligned with a 100 residue query sequence to determine percent identity. The deletion occurs at the N-terminus of the subject sequence and therefore, the FASTDB alignment does not show a matching/alignment of the first 10 residues at the N-terminus. The 10 unpaired residues represent 10% of the sequence (number of residues at the N- and C-termini not matched/total number of residues in the query sequence) so 10% is subtracted from the percent identity score calculated by the FASTDB program. If the remaining 90 residues were perfectly matched the final percent identity would be 90%. In another example, a 90 residue subject sequence is compared with a 100 residue query sequence. This time the deletions are internal deletions so there are no residues at the N- or C-termini of the subject sequence which are not matched/aligned with the query. In this case, the percent identity calculated by FASTDB is not manually corrected. Once again, only residue positions outside the N- and C-terminal ends of the subject sequence, as displayed in the FASTDB alignment, which are not matched/aligned with the query sequence are manually corrected for: No other manual corrections are to be made for the purposes of the present invention.
[0078] Polypeptides of the invention include those that are at least about 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the amino acid sequences of SEQ ID Nos: 1-11 and 13-46, including functional fragments or variants thereof. The invention encompasses polypeptides comprising the amino acid sequences of any of SEQ ID Nos: 1-11 and 13-46, with conservative amino acid substitutions. Other embodiments of the invention include RRM3-derived peptides wherein the RRM3-derived peptide of CAPERα does not include the 5′ β-sheet of the RRM3 domain of CAPERα. In another embodiment, the RRM3-derived peptide of CAPERα does not include the 5′ α-helix of the RRM3 domain of CAPERα.
[0079] In some embodiments, the polypeptide of the invention is conjugated to a protein transduction domain. In some embodiments, the polypeptide of the invention is conjugated to a cell penetrating peptide. In specific embodiments, the cell penetrating peptide is Penetratin. In further embodiments, the cell penetrating peptide amino acid sequence is SEQ ID NO: 12, or variants thereof. In other embodiments, the polypeptide of the invention is conjugated to a tag, e.g., polyhistidine, myc, FLAG, GST, V5, myc, etc. In other embodiments, the polypeptide of the invention is conjugated to polymers, e.g., PEG and other polyethers. In other embodiments, the polypeptide of the invention is conjugated to lipids, e.g., myristoylation, acetylation, palmitoylation, etc.
[0080] The polypeptides of the invention may be encoded by a single polynucleotide. RRM3-derived peptides of the present invention and fragments thereof are generally encoded by polynucleotides. The term “polynucleotide” is intended to encompass a singular nucleic acid as well as plural nucleic acids, and refers to an isolated nucleic acid molecule or construct, e.g., messenger RNA (mRNA), virally-derived RNA, or plasmid DNA (pDNA). A polynucleotide may comprise a conventional phosphodiester bond or a non-conventional bond (e.g., an amide bond, such as found in peptide nucleic acids (PNA)). The term “nucleic acid” refers to any one or more nucleic acid segments, e.g., DNA or RNA fragments, present in a polynucleotide. By “isolated” nucleic acid or polynucleotide is intended a nucleic acid molecule, DNA or RNA, which has been removed from its native environment. For example, a recombinant polynucleotide encoding a therapeutic polypeptide contained in a vector is considered isolated for the purposes of the present invention. Further examples of an isolated polynucleotide include recombinant polynucleotides maintained in heterologous host cells or purified (partially or substantially) polynucleotides in solution. Isolated RNA molecules include in vivo or in vitro RNA transcripts of the present invention, as well as positive and negative strand forms, and double-stranded forms, of pestivirus vectors disclosed herein.
[0081] Isolated polynucleotides or nucleic acids according to the present invention further include such molecules produced synthetically. In addition, a polynucleotide or a nucleic acid may be or may include a regulatory element such as a promoter, ribosome binding site, or a transcription terminator.
[0082] As used herein, a “coding region” is a portion of nucleic acid which consists of codons translated into amino acids. Although a “stop codon” (TAG, TGA, or TAA) is not translated into an amino acid, it may be considered to be part of a coding region, if present, but any flanking sequences, for example promoters, ribosome binding sites, transcriptional terminators, introns, 5′ and 3′ non-translated regions, and the like, are not part of a coding region. Two or more coding regions of the present invention can be present in a single polynucleotide construct, e.g., on a single vector. Furthermore, any vector may contain a single coding region, or may comprise two or more coding regions, e.g., a vector of the present invention may encode one or more polyproteins. In addition, a vector, polynucleotide, or nucleic acid of the invention may encode heterologous coding regions, either fused or unfused to a first or second nucleic acid encoding the RRM3-derived peptide of the invention, or variant or derivative thereof. Heterologous coding regions include without limitation specialized elements or motifs, such as a secretory signal peptide or a heterologous functional domain.
[0083] In certain embodiments, the polynucleotide or nucleic acid is DNA. In the case of DNA, a polynucleotide comprising a nucleic acid, which encodes a polypeptide normally may include a promoter and/or other transcription or translation control elements operably associated with one or more coding regions. An operable association is when a coding region for a gene product, e.g., a polypeptide, is associated with one or more regulatory sequences in such a way as to place expression of the gene product under the influence or control of the regulatory sequence(s). Two DNA fragments (such as a polypeptide coding region and a promoter associated therewith) are “operably associated” if induction of promoter function results in the transcription of mRNA encoding the desired gene product and if the nature of the linkage between the two DNA fragments does not interfere with the ability of the expression regulatory sequences to direct the expression of the gene product or interfere with the ability of the DNA template to be transcribed. Thus, a promoter region would be operably associated with a nucleic acid encoding a polypeptide if the promoter was capable of effecting transcription of that nucleic acid. The promoter may be a cell-specific promoter that directs substantial transcription of the DNA only in predetermined cells. Other transcription control elements, besides a promoter, for example enhancers, operators, repressors, and transcription termination signals, can be operably associated with the polynucleotide to direct cell-specific transcription. Suitable promoters and other transcription control regions are disclosed herein.
[0084] A variety of transcription control regions are known to those skilled in the art. These include, without limitation, transcription control regions, which function in vertebrate cells, such as, but not limited to, promoter and enhancer segments from cytomegaloviruses (e.g., the immediate early promoter, in conjunction with intron-A), simian virus 40 (e.g., the early promoter), and retroviruses (such as, e.g., Rous sarcoma virus). Other transcription control regions include those derived from vertebrate genes such as actin, heat shock protein, bovine growth hormone and rabbit B-globin, as well as other sequences capable of controlling gene expression in eukaryotic cells. Additional suitable transcription control regions include tissue-specific promoters and enhancers as well as lymphokine-inducible promoters (e.g., promoters inducible by interferons or interleukins).
[0085] Similarly, a variety of translation control elements are known to those of ordinary skill in the art. These include, but are not limited to ribosome binding sites, translation initiation and termination codons, and elements derived from viral systems (particularly an internal ribosome entry site, or IRES, also referred to as a CITE sequence).
[0086] In other embodiments, a polynucleotide of the present invention is RNA, for example, in the form of messenger RNA (mRNA). RNA of the present invention may be single stranded or double stranded.
[0087] Polynucleotide and nucleic acid coding regions of the present invention may be associated with additional coding regions which encode secretory or signal peptides, which direct the secretion of a polypeptide encoded by a polynucleotide of the present invention. According to the signal hypothesis, proteins secreted by mammalian cells have a signal peptide or secretory leader sequence which is cleaved from the mature protein once export of the growing protein chain across the rough endoplasmic reticulum has been initiated. Those of ordinary skill in the art are aware that polypeptides secreted by vertebrate cells generally have a signal peptide fused to the N-terminus of the polypeptide, which is cleaved from the complete or “full length” polypeptide to produce a secreted or “mature” form of the polypeptide. In certain embodiments, the native signal peptide is used, or a functional derivative of that sequence that retains the ability to direct the secretion of the polypeptide that is operably associated with it. Alternatively, a heterologous mammalian signal peptide, or a functional derivative thereof, may be used. For example, the wild-type leader sequence may be substituted with the leader sequence of human tissue plasminogen activator (TPA) or mouse β-glucuronidase.
[0088] The term “expression cassette” refers to a polynucleotide generated recombinantly or synthetically, with a series of specified nucleic acid elements that permit transcription of a particular nucleic acid in a target cell. The recombinant expression cassette can be incorporated into a plasmid, chromosome, mitochondrial DNA, plastid DNA, virus, or nucleic acid fragment. Typically, the recombinant expression cassette portion of an expression vector includes, among other sequences, a nucleic acid sequence to be transcribed and a promoter. In one embodiment, the expression cassette of the invention comprises polynucleotide sequences that encode RRM3-derived peptides of the invention or fragments thereof.
[0089] The term “expression vector” is synonymous with “expression construct” and refers to a DNA molecule that is used to introduce and direct the expression of a specific gene to which it is operably associated into a target cell. The expression vector of the present invention comprises an expression cassette. Expression vectors allow transcription of large amounts of stable mRNA. Once the expression vector is inside the target cell, the ribonucleic acid molecule or protein that is encoded by the gene is produced by the cellular transcription and/or translation machinery. In one embodiment, the expression vector of the invention comprises an expression cassette comprises polynucleotide sequences that encode RRM3-derived peptides of the invention or fragments thereof.
[0090] The term “artificial” refers to a synthetic, or non-host cell derived composition, e.g., a chemically-synthesized oligonucleotide.
[0091] By a nucleic acid or polynucleotide having a nucleotide sequence at least, for example, 95% “identical” to a reference nucleotide sequence of the present invention, it is intended that the nucleotide sequence of the polynucleotide is identical to the reference sequence except that the polynucleotide sequence may include up to five point mutations per each 100 nucleotides of the reference nucleotide sequence. In other words, to obtain a polynucleotide having a nucleotide sequence at least 95% identical to a reference nucleotide sequence, up to 5% of the nucleotides in the reference sequence may be deleted or substituted with another nucleotide, or a number of nucleotides up to 5% of the total nucleotides in the reference sequence may be inserted into the reference sequence.
[0092] As a practical matter, whether any particular nucleic acid molecule or polypeptide is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to a nucleotide sequence or polypeptide sequence of the present invention can be determined conventionally using known computer programs. A preferred method for determining the best overall match between a query sequence (a sequence of the present invention) and a subject sequence, also referred to as a global sequence alignment, can be determined using the FASTDB computer program based on the algorithm of Brutlag et al., Comp. Appl. Biosci. 6:237-245 (1990). In a sequence alignment the query and subject sequences are both DNA sequences. An RNA sequence can be compared by converting U's to T's. The result of said global sequence alignment is in percent identity. Preferred parameters used in a FASTDB alignment of DNA sequences to calculate percent identity are: Matrix=Unitary, k-tuple=4, Mismatch Penalty=1, Joining Penalty-30, Randomization Group Length=0, Cutoff Score=1, Gap Penalty=5, Gap Size Penalty=0.05, Window Size=500 or the length of the subject nucleotide sequences, whichever is shorter.
[0093] If the subject sequence is shorter than the query sequence because of 5′ or 3′ deletions, not because of internal deletions, a manual correction must be made to the results. This is because the FASTDB program does not account for 5′ and 3′ truncations of the subject sequence when calculating percent identity. For subject sequences truncated at the 5′ or 3′ ends, relative to the query sequence, the percent identity is corrected by calculating the number of bases of the query sequence that are 5′ and 3′ of the subject sequence, which are not matched/aligned, as a percent of the total bases of the query sequence. Whether a nucleotide is matched/aligned is determined by results of the FASTDB sequence alignment. This percentage is then subtracted from the percent identity, calculated by the above FASTDB program using the specified parameters, to arrive at a final percent identity score. This corrected score is what is used for the purposes of the present invention. Only bases outside the 5′ and 3′ bases of the subject sequence, as displayed by the FASTDB alignment, which are not matched/aligned with the query sequence, are calculated for the purposes of manually adjusting the percent identity score.
[0094] For example, a 90 base subject sequence is aligned to a 100 base query sequence to determine percent identity. The deletions occur at the 5′ end of the subject sequence and therefore, the FASTDB alignment does not show a matched/alignment of the first 10 bases at 5′ end. The 10 unpaired bases represent 10% of the sequence (number of bases at the 5′ and 3′ ends not matched/total number of bases in the query sequence) so 10% is subtracted from the percent identity score calculated by the FASTDB program. If the remaining 90 bases were perfectly matched the final percent identity would be 90%. In another example, a 90 base subject sequence is compared with a 100 base query sequence. This time the deletions are internal deletions so that there are no bases on the 5′ or 3′ of the subject sequence which are not matched/aligned with the query. In this case the percent identity calculated by FASTDB is not manually corrected. Once again, only bases 5′ and 3′ of the subject sequence which are not matched/aligned with the query sequence are manually corrected for. No other manual corrections are to be made for the purposes of the present invention.
[0095] The invention also encompasses an isolated nucleic acid encoding an RRM3-derived peptide of the invention or fragment thereof, wherein the nucleic acid comprises a sequence that encodes the amino acid sequence of any of SEQ ID Nos: 1-11 and 13-46. A further embodiment includes an isolated nucleic acid that encodes the amino acid sequence of any of SEQ ID Nos: 1-11 and 13-46, with conservative amino acid substitutions. The polynucleotides may be expressed as a single polynucleotide that encodes the entire RRM3-derived peptide.
Host Cells
[0096] As used herein, the term “host cell” refers to any kind of cellular system which can be engineered to generate the RRM3-derived peptides of the invention or fragments thereof. In one embodiment, the host cell is engineered to allow the production of an RRM3-derived peptide fragment. Host cells include cultured cells, e.g., mammalian cultured cells, such as CHO cells, HEK, BHK cells, NSO cells, Sp2/0 cells, YO myeloma cells, P3X63 mouse myeloma cells, PER cells, PER.C6 cells or hybridoma cells, yeast cells, insect cells, bacterial cells and plant cells, to name only a few, but also cells comprised within a transgenic animal, transgenic plant or cultured plant or animal tissue. In one embodiment, the host cell of the invention comprises an expression vector comprising polynucleotide sequences that encode RRM3-derived peptides of the invention or fragments thereof. Host cells of the invention may be eukaryotic or prokaryotic.
Purification of RRM3-Derived Peptides and Fragments Thereof
[0097] The RRM3-derived peptides of the invention or fragments thereof can be purified by art-known techniques such as high performance liquid chromatography, ion exchange chromatography, gel electrophoresis, affinity chromatography, size exclusion chromatography, and the like. The actual conditions used to purify a particular protein will depend, in part, on factors such as net charge, hydrophobicity, hydrophilicity, etc., and will be apparent to those having skill in the art.
[0098] For affinity chromatography purification, any antibody which specifically binds the RRM3-derived peptide may be used. For the production of antibodies, various host animals, including, but not limited to rabbits, mice, rats, etc., may be immunized by injection with a RRM3-derived peptide of the invention or a fragment thereof. The RRM3-derived peptide may be attached to a suitable carrier, such as bovine serum albumin (BSA), by means of a side chain functional group or linkers attached to a side chain functional group. Various adjuvants may be used to increase the immunological response, depending on the host species, including but not limited to, Freund's (complete and incomplete), mineral gels such as aluminum hydroxide, surface active substances such as lysolecithin, pluronic polyols, polyanions, peptides, oil emulsions, keyhold limpet hemocyanin, dinitrophenol, and potentially useful human adjuvants such as BCG (bacilli Calmette-Guerin) and Corynebacterium parvum. Accordingly, one embodiment includes a method for producing the RRM3-derived peptides of the invention by culturing a host cell comprising an expression vector comprising polynucleotide sequences that encode RRM3-derived peptides of the invention or fragments thereof under conditions suitable for the expression of the same.
Methods of Using RRM3-Derived Peptides
[0099] The RRM3-derived peptides of the invention are useful for disrupting CAP/MLL1 complexes and gene expression in cancer cells, thereby influencing cancer cell proliferation and cell death. The RRM3-derived peptide of the invention is also useful as a diagnostic reagent. The suitability of using an RRM3-derived peptide for cancer treatment can be determined by the disruption of CAP/MLL1 complexes in cancer cells obtained from patient biopsies.
[0100] In some embodiments, an effective amount of the RRM3-derived peptides of the invention are administered to a cell. In other embodiments, a therapeutically effective amount of the RRM3-derived peptide of the invention is administered to an individual for the treatment of disease. The term “effective amount” as used herein is defined as the amount of the RRM3-derived peptide of the invention that is necessary to result in a physiological change in the cell or tissue to which it is administered. The term “therapeutically effective amount” as used herein is defined as the amount of the RRM3-derived peptide of the invention that eliminates, decreases, delays, minimizes or prevents adverse effects of a disease.
[0101] The RRM3-derived peptides of the invention may be administered to a subject per se or in the form of a pharmaceutical composition. In one embodiment, the disease is a proliferative disorder, such as cancer. Non-limiting examples of proliferative disorders such as cancers include breast cancer, brain cancer, lung cancer, bladder cancer, prostate cancer, fibrosarcoma, ovarian cancer, thyroid cancer, liver cancer, leukemia, and colorectal cancer. In a specific embodiment, the breast cancer is estrogen receptor positive (ER+). In a further embodiment, the breast cancer is human epidermal growth factor receptor 2 positive (HER+). In yet a further embodiment, the breast cancer is triple-negative breast cancer (TNBC). In particular embodiments, the RRM3-derived peptide of CAPERα is nontoxic to noncancerous cells. Other cell proliferation disorders that can be treated using an RRM3-derived peptide of the present invention include, but are not limited to neoplasms located in the: breast, brain, lungs, bladder, prostate, bone, ovary, thyroid, liver, and skin. Also included are pre-cancerous conditions or lesions and cancer metastases. Similarly, other cell proliferation disorders can also be treated by the RRM3-derived peptides of the present invention. A skilled artisan readily recognizes that in some cases the RRM3-derived peptides may not provide a cure but may only provide partial benefit. In some embodiments, a physiological change having some benefit is also considered therapeutically beneficial. Thus, in some embodiments, an amount of RRM3-derived peptide that provides a physiological change is considered an “effective amount” or a “therapeutically effective amount.”
[0102] In some embodiments of the invention, the administration of a therapeutically effective amount of the RRM3-derived peptide of CAPERα disrupts the CAPERα/mixed lineage leukemia 1 (MLL1) (CAP/MLL1) complex. In some embodiments, the administration of a therapeutically effective amount of the RRM3-derived peptide of CAPERα reduces in vivo interaction between CAPERα and MLL1 by about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100%. In some embodiments, the administration of a therapeutically effective amount of the RRM3-derived peptide of CAPERα regulates chromatin marks. In other embodiments, the administration of a therapeutically effective amount of the RRM3-derived peptide of CAPERα prevents MLL1 occupancy in the CAP/MLL1 complex.
[0103] In other embodiments, the administration of a therapeutically effective amount of the RRM3-derived peptide of CAPERα inhibits the catalytic activity of the CAP/MLL1 complex. In some embodiments, the administration of a therapeutically effective amount of the RRM3-derived peptide of CAPERα inhibits the catalytic activity of the CAP/MLL1 complex by about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100%.
[0104] In other embodiments, the RRM3-derived peptide of CAPERα disrupts binding to the CAP/MLL1 complex by ASH2L. In some embodiments, the administration of a therapeutically effective amount of the RRM3-derived peptide of CAPERα reduces in vivo interaction between the CAP/MLL1 complex and ASH2L by about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100%.
[0105] In other embodiments, the RRM3-derived peptide of CAPERα inhibits histone 3, lysine 4 (H3K4) trimethylation of target genes. In some embodiments, the administration of a therapeutically effective amount of the RRM3-derived peptide of CAPERα inhibits H3K4 trimethylation of target genes by about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100%.
[0106] In other embodiments, the RRM3-derived peptide of CAPERα inhibits histone 3, lysine 9 (H3K9) acetylation of target genes. In some embodiments, the administration of a therapeutically effective amount of the RRM3-derived peptide of CAPERα inhibits H3K9 acetylation of target genes by about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100%.
[0107] In other embodiments, the RRM3-derived peptide of CAPERα increases expression of one or more of the following proteins: NFKβ, TNF, and interferon. In some embodiments, the administration of a therapeutically effective amount of the RRM3-derived peptide of CAPERα increases expression of one or more of NFKβ, TNF, and/or interferon by about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100%.
[0108] In some embodiments, the RRM3-derived peptide of CAPERα results in decreases proliferation of cancer cells by about 30%. In some embodiments, the administration of a therapeutically effective amount of the RRM3-derived peptide of CAPERα decreases cancer cell proliferation by about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100%.
[0109] In other embodiments, the RRM3-derived peptide of CAPERα results in increases cell death by about 20%. In some embodiments, the administration of a therapeutically effective amount of the RRM3-derived peptide of CAPERα increases cell death by about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100%.
[0110] In some embodiments, the RRM3-derived peptide of CAPERα regulates transcription one or more of the following genes: BCL2L1, BCL6, JUNB, CCND1, FOXA1, FOXM1, ESR1, MYC, and GATA3. In other embodiments, the RRM3-derived peptide of CAPERα regulates transcription of one or more of the genes listed in Table 1. In yet further embodiments, the RRM3-derived peptide of CAPERα regulates transcription of one or more of the genes listed in Table 2. In yet further embodiments, the RRM3-derived peptide of CAPERα regulates transcription of breast cancer pioneer genes. In some embodiments, the RRM3-derived peptide of CAPERα upregulates the transcription of one or more of the following genes: CASPASE gene 2, CASPASE gene 3, CASPASE gene 4, CASPASE gene 6, CASPASE gene 8, CASPASE gene 9, KMT2B, KMT2C, KMT2D, SETD1A, vREL, and SETD1B.
TABLE-US-00001 Lengthy table referenced here US20220265769A1-20220825-T00001 Please refer to the end of the specification for access instructions.
TABLE-US-00002 Lengthy table referenced here US20220265769A1-20220825-T00002 Please refer to the end of the specification for access instructions.
TABLE-US-00003 Lengthy table referenced here US20220265769A1-20220825-T00003 Please refer to the end of the specification for access instructions.
[0111] In some embodiments, the RRM3-derived peptide of CAPERα inhibits CAP/MLL1 complex binding to chromatin bearing one or more of the following MYC, Rb, E2F1, STAT1/3, ARNT, and GABPB1/2. In some embodiments, the administration of a therapeutically effective amount of the RRM3-derived peptide of CAPERα inhibits CAP/MLL1 complex binding to chromatin bearing one or more of the following MYC, Rb, E2F1, STAT1/3, ARNT, and GABPB1/2, by about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100%.
[0112] In other embodiments, the RRM3-derived peptide of CAPERα decreases association of MLL1, ASH2L, RbBP5, and/or WDR5 with genomic promoters. In some embodiments, the administration of a therapeutically effective amount of the RRM3-derived peptide of CAPERα decreases association of MLL1, ASH2L, RbBP5, and/or WDR5 with genomic promoters, by about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100%.
[0113] The subject, patient, or individual in need of treatment is typically a mammal, more specifically a human.
Compositions, Formulations, Dosages, and Routes of Administration
[0114] Pharmaceutical compositions of the present invention comprise an effective amount of one or more RRM3-derived peptides dissolved or dispersed in a pharmaceutically acceptable carrier. The phrases “pharmaceutical or pharmacologically acceptable” refers to molecular entities and compositions that do not produce an adverse, allergic or other untoward reaction when administered to an animal, such as, for example, a human, as appropriate. The preparation of a pharmaceutical composition that contains at least one RRM3-derived peptide and optionally an additional active ingredient will be known to those of skill in the art in light of the present disclosure, as exemplified by Remington's Pharmaceutical Sciences, 18th Ed. Mack Printing Company, 1990, incorporated herein by reference. Moreover, for animal (e.g., human) administration, it will be understood that preparations should meet sterility, pyrogenicity, general safety and purity standards as required by FDA Office of Biological Standards or corresponding authorities in other countries.
[0115] As used herein, “pharmaceutically acceptable carrier” includes any and all solvents, buffers, dispersion media, coatings, surfactants, antioxidants, preservatives (e.g., antibacterial agents, antifungal agents), isotonic agents, absorption delaying agents, salts, preservatives, drugs, drug stabilizers, gels, binders, excipients, disintegration agents, lubricants, sweetening agents, flavoring agents, dyes, such like materials and combinations thereof, as would be known to one of ordinary skill in the art (see, e.g., Remington's Pharmaceutical Sciences, 18th Ed. Mack Printing Company, 1990, pp. 1289-1329, incorporated herein by reference). Except insofar as any conventional carrier is incompatible with the active ingredient, its use in the therapeutic or pharmaceutical compositions is contemplated.
[0116] The RRM3-derived peptides may comprise different types of carriers depending on whether it is to be administered in solid, liquid or aerosol form, and whether it need to be sterile for such routes of administration as injection. The present invention can be administered intravenously, intradermally, intraarterially, intraperitoneally, intralesionally, intracranially, intraarticularly, intraprostatically, intrasplenically, intrarenally, intrapleurally, intratracheally, intranasally, intravitreally, intravaginally, intrarectally, topically, intratumorally, intramuscularly, intraperitoneally, subcutaneously, subconjunctivally, intravesicularlly, mucosally, intrapericardially, intraumbilically, intraocularally, orally, topically, locally, inhalation (e.g. aerosol inhalation), injection, infusion, continuous infusion, localized perfusion bathing target cells directly, via a catheter, via a lavage, in cremes, in lipid compositions (e.g., liposomes), or by other method or any combination of the forgoing as would be known to one of ordinary skill in the art (see, e.g., Remington's Pharmaceutical Sciences, 18th Ed. Mack Printing Company, 1990, incorporated herein by reference). Parenteral administration, in particular intravenous injection, is most commonly used for administering polypeptide molecules such as the RRM3-derived peptides of the invention.
[0117] The actual dosage amount of a composition of the present invention administered to a subject can be determined by physical and physiological factors such as body weight, severity of condition, the type of disease being treated, previous or concurrent therapeutic interventions, idiopathy of the patient and on the route of administration. The practitioner responsible for administration will, in any event, determine the concentration of active ingredient(s) in a composition and appropriate dose(s) for the individual subject.
[0118] In certain embodiments, pharmaceutical compositions may comprise, for example, at least about 0.1% of the RRM3-derived peptide of the invention. In other embodiments, the RRM3-derived peptides may comprise between about 2% to about 75% of the weight of the unit, or between about 25% to about 60%, for example, and any range derivable therein. In other non-limiting examples, a dose may also comprise from about 1 microgram/kg/body weight, about 5 microgram/kg/body weight, about 10 microgram/kg/body weight, about 50 microgram/kg/body weight, about 100 microgram/kg/body weight, about 200 microgram/kg/body weight, about 350 microgram/kg/body weight, about 500 microgram/kg/body weight, about 1 milligram/kg/body weight, about 5 milligram/kg/body weight, about 10 milligram/kg/body weight, about 50 milligram/kg/body weight, about 100 milligram/kg/body weight, about 200 milligram/kg/body weight, about 350 milligram/kg/body weight, about 500 milligram/kg/body weight, to about 1000 mg/kg/body weight or more per administration, and any range derivable therein. In non-limiting examples of a derivable range from the numbers listed herein, a range of about 5 mg/kg/body weight to about 100 mg/kg/body weight, about 5 microgram/kg/body weight to about 500 milligram/kg/body weight, etc., can be administered, based on the numbers described above.
[0119] In any case, the composition may comprise various antioxidants to retard oxidation of one or more component. Additionally, the prevention of the action of microorganisms can be brought about by preservatives such as various antibacterial and antifungal agents, including but not limited to parabens (e.g., methylparabens, propylparabens), chlorobutanol, phenol, sorbic acid, thimerosal or combinations thereof.
[0120] The RRM3-derived peptides may be formulated into a composition in a free base, neutral or salt form. Pharmaceutically acceptable salts, include the acid addition salts, e.g., those formed with the free amino groups of a proteinaceous composition, or which are formed with inorganic acids such as for example, hydrochloric or phosphoric acids, or such organic acids as acetic, oxalic, tartaric or mandelic acid. Salts formed with the free carboxyl groups can also be derived from inorganic bases such as for example, sodium, potassium, ammonium, calcium or ferric hydroxides; or such organic bases as isopropylamine, trimethylamine, histidine or procaine.
[0121] In embodiments where the composition is in a liquid form, a carrier can be a solvent or dispersion medium comprising but not limited to, water, ethanol, polyol (e.g., glycerol, propylene glycol, liquid polyethylene glycol, etc), lipids (e.g., triglycerides, vegetable oils, liposomes) and combinations thereof. The proper fluidity can be maintained, for example, by the use of a coating, such as lecithin; by the maintenance of the required particle size by dispersion in carriers such as, for example liquid polyol or lipids; by the use of surfactants such as, for example hydroxypropylcellulose; or combinations thereof such methods. In many cases, it will be preferable to include isotonic agents, such as, for example, sugars, sodium chloride or combinations thereof, and/or buffering agents to maintain physiologically acceptable pH values.
[0122] In other embodiments, one may use eye drops, nasal solutions or sprays, aerosols or inhalants in the present invention. Such compositions are generally designed to be compatible with the target tissue type. In a non-limiting example, nasal solutions are usually aqueous solutions designed to be administered to the nasal passages in drops or sprays. Nasal solutions are prepared so that they are similar in many respects to nasal secretions, so that normal ciliary action is maintained. Thus, in some embodiments the aqueous nasal solutions usually are isotonic or slightly buffered to maintain a pH of about 5.5 to about 6.5. In addition, antimicrobial preservatives, similar to those used in ophthalmic preparations, drugs, or appropriate drug stabilizers, if required, may be included in the formulation. For example, various commercial nasal preparations are known and include drugs such as antibiotics or antihistamines.
[0123] In certain embodiments, the RRM3-derived peptide is prepared for administration by such routes as oral ingestion. In these embodiments, the solid composition may comprise, for example, solutions, suspensions, emulsions, tablets, pills, capsules (e.g., hard or soft shelled gelatin capsules), sustained release formulations, buccal compositions, troches, elixirs, suspensions, syrups, wafers, or combinations thereof. Oral compositions may be incorporated directly with the food of the diet. Preferred carriers for oral administration comprise inert diluents, assimilable edible carriers or combinations thereof. In other aspects of the invention, the oral composition may be prepared as a syrup or elixir. A syrup or elixir, and may comprise, for example, at least one active agent, a sweetening agent, a preservative, a flavoring agent, a dye, a preservative, or combinations thereof.
[0124] In certain embodiments, an oral composition may comprise one or more binders, excipients, disintegration agents, lubricants, flavoring agents, and combinations thereof. In certain embodiments, a composition may comprise one or more of the following: a binder, such as, for example, gum tragacanth, acacia, cornstarch, gelatin or combinations thereof; an excipient, such as, for example, dicalcium phosphate, mannitol, lactose, starch, magnesium stearate, sodium saccharine, cellulose, magnesium carbonate or combinations thereof; a disintegrating agent, such as, for example, corn starch, potato starch, alginic acid or combinations thereof; a lubricant, such as, for example, magnesium stearate; a sweetening agent, such as, for example, sucrose, lactose, saccharin or combinations thereof; a flavoring agent, such as, for example peppermint, oil of wintergreen, cherry flavoring, orange flavoring, etc.; or combinations thereof the foregoing. When the dosage unit form is a capsule, it may contain, in addition to materials of the above type, carriers such as a liquid carrier. Various other materials may be present as coatings or to otherwise modify the physical form of the dosage unit. For instance, tablets, pills, or capsules may be coated with shellac, sugar or both.
[0125] Additional formulations which are suitable for other modes of administration include suppositories. Suppositories are solid dosage forms of various weights and shapes, usually medicated, for insertion into the rectum, vagina or urethra. After insertion, suppositories soften, melt or dissolve in the cavity fluids. In general, for suppositories, traditional carriers may include, for example, polyalkylene glycols, triglycerides or combinations thereof. In certain embodiments, suppositories may be formed from mixtures containing, for example, the active ingredient in the range of about 0.5% to about 10%, and preferably about 1% to about 2%.
[0126] Sterile injectable solutions are prepared by incorporating the RRM3-derived peptides of the invention in the required amount in the appropriate solvent with various of the other ingredients enumerated above, as required, followed by filtered sterilization. Generally, dispersions are prepared by incorporating the various sterilized active ingredients into a sterile vehicle which contains the basic dispersion medium and/or the other ingredients. In the case of sterile powders for the preparation of sterile injectable solutions, suspensions or emulsion, the preferred methods of preparation are vacuum-drying or freeze-drying techniques which yield a powder of the active ingredient plus any additional desired ingredient from a previously sterile-filtered liquid medium thereof. The liquid medium should be suitably buffered if necessary and the liquid diluent first rendered isotonic prior to injection with sufficient saline or glucose. The preparation of highly concentrated compositions for direct injection is also contemplated, where the use of DMSO as solvent is envisioned to result in extremely rapid penetration, delivering high concentrations of the active agents to a small area.
[0127] The composition must be stable under the conditions of manufacture and storage, and preserved against the contaminating action of microorganisms, such as bacteria and fungi. It will be appreciated that endotoxin contamination should be kept minimally at a safe level, for example, less than 0.5 ng/mg protein.
[0128] In particular embodiments, prolonged absorption of an injectable composition can be brought about by the use in the compositions of agents delaying absorption, such as, for example, aluminum monostearate, gelatin or combinations thereof.
[0129] Pharmaceutical compositions comprising the RRM3-derived peptides of the invention may be manufactured by means of conventional mixing, dissolving, granulating, dragee-making, levigating, emulsifying, encapsulating, entrapping or lyophilizing processes. Pharmaceutical compositions may be formulated in conventional manner using one or more physiologically acceptable carriers, diluents, excipients or auxiliaries which facilitate processing of the proteins into preparations that can be used pharmaceutically. Proper formulation is dependent upon the route of administration chosen.
[0130] For topical administration the RRM3-derived peptides of the invention may be formulated as solutions, gels, ointments, creams, suspensions, etc. as are well-known in the art.
[0131] Systemic formulations include those designed for administration by injection, e.g. subcutaneous, intravenous, intramuscular, intrathecal or intraperitoneal injection, as well as those designed for transdermal, transmucosal, inhalation, oral or pulmonary administration.
[0132] For injection, the RRM3-derived peptides of the invention may be formulated in aqueous solutions, preferably in physiologically compatible buffers such as Hanks' solution, Ringer's solution, or physiological saline buffer. The solution may contain formulatory agents such as suspending, stabilizing and/or dispersing agents.
[0133] Alternatively, the RRM3-derived peptides may be in powder form for constitution with a suitable vehicle, e.g., sterile pyrogen-free water, before use.
[0134] For transmucosal administration, penetrants appropriate to the barrier to be permeated are used in the formulation. Such penetrants are generally known in the art.
[0135] For oral administration, the RRM3-derived peptides can be readily formulated by combining the RRM3-derived peptides with pharmaceutically acceptable carriers well known in the art. Such carriers enable the RRM3-derived peptides of the invention to be formulated as tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspensions and the like, for oral ingestion by a patient to be treated. For oral solid formulations such as, for example, powders, capsules and tablets, suitable excipients include fillers such as sugars, e.g. lactose, sucrose, mannitol and sorbitol; cellulose preparations such as maize starch, wheat starch, rice starch, potato starch, gelatin, gum tragacanth, methyl cellulose, hydroxypropylmethyl-cellulose, sodium carboxymethylcellulose, and/or polyvinylpyrrolidone (PVP); granulating agents; and binding agents. If desired, disintegrating agents may be added, such as the cross-linked polyvinylpyrrolidone, agar, or alginic acid or a salt thereof such as sodium alginate.
[0136] If desired, solid dosage forms may be sugar-coated or enteric-coated using standard techniques.
[0137] For oral liquid preparations such as, for example, suspensions, elixirs and solutions, suitable carriers, excipients or diluents include water, glycols, oils, alcohols, etc. Additionally, flavoring agents, preservatives, coloring agents and the like may be added.
[0138] For buccal administration, the RRM3-derived peptides may take the form of tablets, lozenges, etc. formulated in conventional manner.
[0139] For administration by inhalation, the RRM3-derived peptides for use according to the invention are conveniently delivered in the form of an aerosol spray from pressurized packs or a nebulizer, with the use of a suitable propellant, e.g., dichlorodifluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, carbon dioxide or other suitable gas. In the case of a pressurized aerosol the dosage unit may be determined by providing a valve to deliver a metered amount. Capsules and cartridges of gelatin for use in an inhaler or insufflator may be formulated containing a powder mix of the RRM3-derived peptide and a suitable powder base such as lactose or starch.
[0140] The RRM3-derived peptides may also be formulated in rectal or vaginal compositions such as suppositories or retention enemas, e.g., containing conventional suppository bases such as cocoa butter or other glycerides.
[0141] In addition to the formulations described previously, the RRM3-derived peptides may also be formulated as a depot preparation. Such long acting formulations may be administered by implantation (for example subcutaneously or intramuscularly) or by intramuscular injection. Thus, for example, the RRM3-derived peptides may be formulated with suitable polymeric or hydrophobic materials (for example as an emulsion in an acceptable oil) or ion exchange resins, or as sparingly soluble derivatives, for example, as a sparingly soluble salt.
[0142] Alternatively, other pharmaceutical delivery systems may be employed. Liposomes and emulsions are well known examples of delivery vehicles that may be used to deliver RRM3-derived peptides of the invention. Certain organic solvents such as dimethylsulfoxide also may be employed, although usually at the cost of greater toxicity. Additionally, the RRM3-derived peptides may be delivered using a sustained-release system, such as semipermeable matrices of solid polymers containing the therapeutic agent. Various of sustained-release materials have been established and are well known by those skilled in the art. Sustained-release capsules may, depending on their chemical nature, release the RRM3-derived peptides for a few weeks up to over 100 days. Depending on the chemical nature and the biological stability of the RRM3-derived peptides, additional strategies for RRM3-derived peptides stabilization may be employed.
[0143] As the RRM3-derived peptides of the invention may contain charged side chains or termini, they may be included in any of the above-described formulations as the free acids or bases or as pharmaceutically acceptable salts. Pharmaceutically acceptable salts are those salts which substantially retain the biologic activity of the free bases and which are prepared by reaction with inorganic acids. Pharmaceutical salts tend to be more soluble in aqueous and other protic solvents than are the corresponding free base forms.
[0144] The RRM3-derived peptides of the invention will generally be used in an amount effective to achieve the intended purpose. For use to treat or prevent a disease condition, the RRM3-derived peptides of the invention, or pharmaceutical compositions thereof, are administered or applied in a therapeutically effective amount. A therapeutically effective amount is an amount effective to ameliorate or prevent the symptoms, or prolong the survival of, the patient being treated. Determination of a therapeutically effective amount is well within the capabilities of those skilled in the art, especially in light of the detailed disclosure provided herein.
[0145] For systemic administration, a therapeutically effective dose can be estimated initially from in vitro assays. For example, a dose can be formulated in animal models to achieve a circulating concentration range that includes the IC.sub.50 as determined in cell culture. Such information can be used to more accurately determine useful doses in humans.
[0146] Initial dosages can also be estimated from in vivo data, e.g., animal models, using techniques that are well known in the art. One having ordinary skill in the art could readily optimize administration to humans based on animal data.
[0147] Dosage amount and interval may be adjusted individually to provide plasma levels of the RRM3-derived peptides which are sufficient to maintain therapeutic effect. Usual patient dosages for administration by injection range from about 0.1 to 50 mg/kg/day, typically from about 0.5 to 1 mg/kg/day. Therapeutically effective serum levels may be achieved by administering multiple doses each day.
[0148] In cases of local administration or selective uptake, the effective local concentration of the RRM3-derived peptides may not be related to plasma concentration. One having skill in the art will be able to optimize therapeutically effective local dosages without undue experimentation.
[0149] The amount of RRM3-derived peptide administered will, of course, be dependent on the subject being treated, on the subject's weight, the severity of the affliction, the manner of administration and the judgment of the prescribing physician.
[0150] The therapy may be repeated intermittently while symptoms detectable or even when they are not detectable. The therapy may be provided alone or in combination with other drugs. In the case of autoimmune disorders, the drugs that may be used in combination with RRM3-derived peptides of the invention include, but are not limited to, steroid and non-steroid anti-inflammatory agents.
Toxicity
[0151] A therapeutically effective dose of the RRM3-derived peptides described herein will generally provide therapeutic benefit without causing substantial toxicity. Toxicity of the RRM3-derived peptides can be determined by standard pharmaceutical procedures in cell cultures or experimental animals, e.g., by determining the LD.sub.50 (the dose lethal to 50% of the population) or the LD.sub.100 (the dose lethal to 100% of the population). The dose ratio between toxic and therapeutic effect is the therapeutic index. In one embodiment, the RRM3-derived peptide exhibits a high therapeutic index. The data obtained from these cell culture assays and animal studies can be used in formulating a dosage range that is not toxic, for example, for use in human. The dosage of the RRM3-derived peptides described herein lies preferably within a range of circulating concentrations that include the effective dose with little or no toxicity. The dosage may vary within this range depending upon the dosage form employed and the route of administration utilized. The exact formulation, route of administration and dosage can be chosen by the individual physician in view of the patient's condition. (See, e.g., Fingl et al., 1975, In: The Pharmacological Basis of Therapeutics, Ch. 1, p. 1) (incorporated herein by reference in its entirety.
Other Agents and Treatments
[0152] It is contemplated that other agents may be used in combination with the present invention to improve the therapeutic efficacy of treatment. These additional agents include immunomodulatory agents, agents that affect the upregulation of cell surface receptors and GAP junctions, cytostatic and differentiation agents, inhibitors of cell adhesion, or agents that increase the sensitivity of the hyperproliferative cells to apoptotic inducers. Immunomodulatory agents include tumor necrosis factor; interferon alpha, beta, and gamma; IL-2 and other cytokines; F42K and other cytokine analogs; or MIP-1, MIP-1β, MCP-1, RANTES, and other chemokines. It is further contemplated that the upregulation of cell surface receptors or their ligands such as Fas/Fas ligand, DR4 or DR5/TRAIL would potentiate the apoptotic inducing abilities of the present invention by establishment of an autocrine or paracrine effect on hyperproliferative cells. Increases in intercellular signaling by elevating the number of GAP junctions would increase the anti-hyperproliferative effects on the neighboring hyperproliferative cell population. In other embodiments, cytostatic or differentiation agents can be used in combination with the present invention to improve the anti-hyperproliferative efficacy of the treatments. Inhibitors of cell adhesion are contemplated to improve the efficacy of the present invention. Examples of cell adhesion inhibitors are focal adhesion kinase (FAKs) inhibitors and Lovastatin. It is further contemplated that other agents that increase the sensitivity of a hyperproliferative cell to apoptosis, such as the antibody C225, could be used in combination with the present invention to improve the treatment efficacy.
[0153] Hormonal therapy may also be used in conjunction with the present invention or in combination with any other cancer therapy previously described. The use of hormones may be employed in the treatment of certain cancers such as breast, prostate, ovarian, or cervical cancer to lower the level or block the effects of certain hormones such as testosterone or estrogen. This treatment is often used in combination with at least one other cancer therapy as a treatment option or to reduce the risk of metastases.
[0154] The RRM3-derived peptides of the invention may also be administered in conjunction with chemotherapy, radiation therapy or other immunotherapies. Anti-cancer agents for such combination therapy may, e.g., be selected from the groups of microtubule disruptors (e.g. vinca alkaloids such as vinblastine or vincristine, taxanes such as docetaxel or paclitaxel, epothilones such as ixabepilone), antimetabolites (e.g. anti-folates such as methotrexate or aminopterin, anti-purines such as fludarabine, 6-mercaptopurine or 6-thioguanine, anti-pyrimidines such as 5-fluorouracil, capecitabine or gemcitabine, hydroxyurea), topoisomerase inhibitors (e.g. camptothecin, irinotecan, topotecan, or podophyllotoxins such as etoposide), DNA intercalators (e.g. doxorubicin, daunorubicin, actinomycin, bleomycin), alkylating agents (e.g. cyclophosphamide, chlorambucil, nitrosureas such as carmustine or nimustine, streptozocin, busulfan, cisplatin, oxaliplatin, triethylenemelamine, dacarbazine), hormonal therapies (e.g. glucocorticoids, aromatase inhibitors such as tamoxifene, antiandrogens such as flutamide, gonadotropin-releasing hormone (GnRH) analogs such as leuprolide), antibiotics, kinase inhibitors (e.g. erlotinib, gefitinib, imatinib), receptor antagonists (e.g. antibodies targeting cell surface receptors known to promote carcinogenesis and tumor growth), enzyme inhibitors (e.g. cyclin-dependent kinase (CDK) inhibitors), amino acid-depleting enzymes (e.g. asparaginase), leucovorin, retinoids, activators of tumor cell apoptosis, and antiangiogenic agents.
[0155] The following are examples of methods and compositions of the invention. It is understood that various embodiments may be practiced, given the general description provided above.
EXAMPLES
Example 1
[0156] The following methods and reagents were used in conducting the investigations described in Examples 2-12.
[0157] Cell Culture: Cell lines were obtained from ATCC and cultured as recommended. Protein extraction and immunoprecipitations (IPs): IP's were performed as previously described (Kumar P P, et al., eLife. e02805 (2014)). Input lanes contain 5% of protein lysate used for IP; 25% of IP'd material was loaded and subjected to immunoblotting.
[0158] Cell Lines: T47D, MCF7, HCC1428, ZR7530, MDA-MB361, MDA-MB453, HCC1954, HCC2157, MDA-MB468, DU4475, MDA-MB231, HCC1395, HCC38, PHF, PME, MCF10A, HEK293, HeLa, Jurkat, HUV-EC-C, UMUC3, HCT116 were purchased from ATCC. All cells were cultured and maintained as per the ATCC recommended protocols.
[0159] Human tissue samples and lysates: Normal human tissue lysates were obtained from Novus biologicals. Brain (NB820-59177), ovary (NB820-59243), liver (NB820-59232), small intestine (NB820-59255), bone marrow (NB820-59283), colon (NB820-59205) and lung (NB820-59239). Buffer composition of all the tissue lysates are similar to the Dignam buffer employed for all other lysates/IPs. Deidentified human breast tumor tissues were collected from the Geisinger Clinic surgical oncology biobank in accordance with IRB regulations. The tissues were flash frozen in liquid nitrogen following surgery and stored in −80° C. until immunoprecipitation.
[0160] Cell transfection: For overexpression of myc-tagged constructs, HEK293 cells were transfected with indicated vectors using lipofectamine-3000 reagent (ThermoFisher, L3000001) as per the manufacture's procedure. Transfections of siRNAs in T47D, MDA-MB231, PMEs, PHFs, and Jurkat cells were performed by using Neon transfection system (MPK10025). For the overexpression of vector or RRM3 domain in T47D, X-tremeGENE HP DNA transfection reagent (Roche) was used and the transfection was carried out as per the manufacturer's recommendations. siRNAs were used at the concentration of 100 nM in all the knockdown experiments.
[0161] Protein extraction and immunoprecipitations: IP's were performed as per the manufacturer's protocol (ThermoFisher, Dynabeads Co-Immunoprecipitation Kit: 14321D). Briefly, lysates were prepared with Dignam buffer and cleared lysates were incubated for 4 hours at 4° C. with specific antibodies followed by incubation with the pre-equilibrated Dynabeads Protein G (Invitrogen) for 2 hours at 4° C. with. Immunoprecipitated beads were washed three times with lysis buffer and resuspended in 6×SDS-loading buffer. Immunoprecipitated proteins were subjected to SDS-PAGE analysis followed by immunoblotting with specific antibodies. Note: Immunoprecipitation antibodies are listed at top and immunoblot antibodies listed at left for figures.
[0162] Antibodies: CAPERα (A300-291A) Bethyl laboratories, R-IgG (Santa Cruz (SC)-2027), m-IgG (Santa Cruz, SC-2025), Flag (Sigma, F3165), myc-tag (Santa Cruz, SC-40), Actin (Santa Cruz, SC-47778), H3K9me3 (Cell Signaling, 9754), H3K4me3 (Cell Signaling, 9751; active motif 39159), H3K27me3 (Cell Signaling, 9733), H3K9ace (Cell Signaling, 9649), H3K36me (Cell Signaling, 4909), H3 (Cell Signaling, 9715), H3K27ace (Abram (ab) 4729), H3K9ace (ab176916), Tubulin (CP-06, Calbiochem), rabbit polyclonal Ki67 (Vectorlabs), TBX3(A303-098A) Bethyl laboratories, Ezh2 (Cell Signaling, 5246), MLL1 (Active Motif, 61296), MLL2 (Novus Biologicals, NBP1-89123), EZH2 (Cell Signaling, 5246), WDR5 (Santa Cruz, SC-393080; Active Motif 61485), RbBP5 (Novus biologicals 600-252), ERα (Santa Cruz, SC-7207), HCF1 (ab 137618), Lamin A/C (Santa Cruz, E-1), HDAC1 (Cell Signaling, 2062), HNRNPC1/C2 (Santa Cruz, SC-32308), HNRNPU (Santa Cruz, SC-32315), PABP (Santa Cruz, SC-166027), SAP 155 (Santa Cruz, SC-514655), U2AF65 (Santa Cruz, SC-53942), DDX3 (Santa Cruz, SC-365768), HNRNPA1 (Santa Cruz, SC-32301), DDX17 (Santa Cruz, SC-130650), HNRNPD (Abram, ab61193), DDX21 (Santa Cruz, SC-376953). The WDR5 and ASH2L antibody were gifts from Danny Reinberg.
[0163] Plasmids: Wild type and truncations of CAPERα were generated by PCR amplification and then cloned into the pcDNA4/myc-His vector. Individual domains were cloned into PGEX-6P-1 vector. GST-tagged domains were cloned in pcDNA4/myc-His vector. GST-tagged RRM3 microdeletion constructs were synthesized by IDTDNA technologies as a g-block fragments and cloned in pCDNA4/myc-His vector. Cassettes for generating CPPs peptides were designed as g-blocks by IDTDNA technologies and cloned in to pGEX-6P-1. Correct sequence of all plasmids was confirmed.
[0164] Purification of GST-CAPERα proteins: GST-tagged RBM39 full length (FL) and deletion constructs were expressed in BL-21 DE3 cells and induced by 0.25 mM IPTG. Columns of GST and GST-RBM39 FL and deletions were prepared as per the manufacture's protocol (GE17075601). Bound proteins were eluted with one volume of elution buffer (50 mM Tris-HCl, 10 mM reduced Glutathione, pH 8.0) and analyzed by SDS-PAGE. Purified proteins were visualized by Coomassie brilliant blue stain. For the CPPs, the GST tag was removed by PreScission protease (GE Healthcare).
[0165] GST pull-down assays: GST-tagged RBM39 full length or individual domains, and GST bound columns were incubated with 5 mg of T47D Dignam lysate at 40° C. overnight. Beads were washed 3 times Dignam buffer C and bound proteins were analyzed by western blotting with the respective antibody.
[0166] Myc pull-down assays: Myc pull-down was performed as per manufacturer's protocol (ThermoFisher: Pierce c-Myc-Tag IP/Co-IP Kit: 2360).
[0167] Electrophoretic mobility shift assays (EMSAs): GST and GST-RBM39 FL and individual domains were purified and incubated with synthetic oligos (IDTDNA technologies) or PCR amplified and purified DNA segments of RBM39-MLL1 targets promoter regions. Protein-DNA binding reactions were resolved by 0.8% agarose gel or 6% native polyacrylamide gel electrophoresis and stained with SYBR GOLD nucleic acid stain and documented using ChemiDoc XRS+ system.
[0168] Nuclear and cytoplasmic separations were performed as per the manufacturer's protocol (GenDEPOT: N2100-010).
[0169] Retroviral transduction and selection of stable cells were performed as per the published literature (Kumar et al., 2014) (http://delangelab.rockefeller.edu/assets/file/Retrovirusprotocol.pdf). RBM39 shRNAs were generated as per the published literature (Kumar, P. P., et al., eLife, e02805 (2014)) and MLL1 shRNA were prepared from published MLL1 specific siRNAs (Caslini, C., et al., Mol Cell Biol 29:4519-4526 (2009); Hsieh, J. J., et al., Cell 115:293-303 (2003); Yokoyama A, et al., Mol Cell Biol. 24(13):5639-492004).
TABLE-US-00004 MLL shRNA FP: (SEQ ID NO: 48) GATCCAAGAAGTCAGAGTGCGAAGTCTCAAGAGGACTTCGCACTCTGAC TTCTTTTTTTTGGA MLL shRNA RP: (SEQ ID NO: 49) AGCTTCCAAAAAAAAGAAGTCAGAGTGCGAAGTCCTCTTGAGACTTCGC ACTCTGACTTCTTG
[0170] Population doubling assay/3T5 growth curves: were performed as in (Lessnick, S. L., et al., Cancer Cell 1:393-401 (2002)). T47D and MCF10A cells were plated in a 10 cm dish and transduced with retrovirus. After 24 hrs, cells were incubated with specific mammalian antibiotic medium (puromycin or blasticidin) for an additional 24-72 hrs. On day 0 of the 3T5 growth curve, cells were trypsinized, counted and 500,000 cells then plated per 10 cm dish. This procedure was repeated every 3 days for 15 days. Population doublings were calculated by (log N1/log 2)−(log N0/log 2) N1=current cell count, N0=Initial cell count. Curves shown in
[0171] Crystal violet assay/optical density method of cell quantitation: 5×10.sup.5 cells were plated per well in 6-well tissue culture plates. At times indicated cells were washed with PBS and fixed for 10 minutes in a 10% formalin solution. Cells were then rinsed with distilled water and subsequently stained with 100 μl 0.1% crystal violet solution for 30 min. Stained cells were rinsed with water to remove the excess traces of the staining solution. Cell-associated crystal violet dye was extracted with 500 μl of 10% acetic acid. Aliquots were collected and optical density was measured at 590 nm wavelength. Each point on the curve shown represents 3 independent wells.
[0172] RNA isolation and reverse transcription-PCR analysis: Total RNA was prepared using the RNeasy RNA isolation kit (Qiagen) or NucleoSpin RNA II Kit (Clontech) and cDNA was synthesized with cDNA EcoDry Premix Double Primed (Clontech). Q-RT-PCR was performed with So FastEvagreen Supermix (Bio-Rad) as per manufacturer's protocol.
[0173] siRNA Sequences:
TABLE-US-00005 Control siRNA: S: (SEQ ID NO: 50) AAUUCUCCGAACGUGUCACGUUU AS: (SEQ ID NO: 51) ACGUGACACGUUCGGAGAAUUUU RBM39 siRNA 1: S: (SEQ ID NO: 52) GACAGAAAUUCAAGACGUUUU AS: (SEQ ID NO: 53) AACGUCUUGAAUUUCUGUCUU RBM39 siRNA 2: S: (SEQ ID NO: 54) GAAGCGAAGUAGAGACAGAUU AS: (SEQ ID NO: 55) UCUGUCUCUACUUCGCUUCUU RBM39 siRNA 3: S: (SEQ ID NO: 56) AAGAUUGGGUUGCCUCAUAUUUU AS: (SEQ ID NO: 57) AAUAUGAGGCAACCCAAUCUUUU siSMART Pool: SiGENOME Human RBM39 (9584) SiRNA SMART Pool, (Dharmacon, M-011965-00-0010). MLL1 siRNA 1: (SEQ ID NO: 58) AAGAAGUCAGAGUGCGAAGUC (Caslini et al., 2009) MLL1 siRNA 2: (SEQ ID NO: 59) GGACAAGAGTAGAGAGAGA (Wang, X., et al., J Cell Sci 125:4058-4066 (2012)) MLL siRNA mix from Santa Cruz (SC-38039) MLL CRISPR/Cas9 KO Plasmid (SC-401307) + MLL HDR Plasmid (Santa Cruz, SC-401307)-HDR
[0174] RT-PCR Primer Sequences:
TABLE-US-00006 CAPERα: (SEQ ID NO: 60) CGGAACAGGCGTTTAGAGAA, (SEQ ID NO: 61) TGGCACTGCTCAACTTGTTC MLL1: (SEQ ID NO: 62) CAGCTATCCTCTCAGATCCATC, (SEQ ID NO: 63) CCTTGTCTTTCCGGACTTTCTG CCNB1: (SEQ ID NO: 64) GGCTTTCTCTGATGTAATTCTTGC, (SEQ ID NO: 65) GTATTTTGGTCTGACTGCTTGC CDK1: (SEQ ID NO: 66) TGGATCTGAAGAAATACTTGGATTCTA, (SEQ ID NO: 67) CAATCCCCTGTAGGATTTGG CCNA2: (SEQ ID NO: 68) CTGCATTTGGCTGTGAACTAC, (SEQ ID NO: 69) ACAAACTCTGCTACTTCTGGG BCL6: (SEQ ID NO: 70) CTGCAGATGGAGCATGTTGT, (SEQ ID NO: 71) TCTTCACGAGGAGGCTTGAT JUNB: (SEQ ID NO: 72) GCATGAGGAAACGCATCGCTGCCTCCAAGT, (SEQ ID NO: 73) GCGACCAAGTCCTTCCCACTCGTGCACACT CCND1: (SEQ ID NO: 74) AAGGCGGAGGAGACCTGCGCG, (SEQ ID NO: 75) ATCGTGCGGCATTGCGGC GATA3: (SEQ ID NO: 76) TGTCTGCAGCCAGGAGAGC, (SEQ ID NO: 77) ATGCATCAAACAACTGTGGCCA HMGA2: (SEQ ID NO: 78) GTCCCTCTAAAGCAGCTCAAAA, (SEQ ID NO: 79) CTCCCTTCAAAAGATCCAACTG DUSP6: (SEQ ID NO: 80) CCTGAGGCCATTTCTTTCATAGA, (SEQ ID NO: 81) GTCACAGTGACTGAGCGGCTAAT SATB1: (SEQ ID NO: 82) GATCTATGAATAAGCCTTTGGAG, (SEQ ID NO: 83) TTTCGTCCTGGTATATTCGGT CBX8: (SEQ ID NO: 84) ACAAACCCATGTTTCGAAGG, (SEQ ID NO: 85) AGTGTCCAATGGTGGAGGAC SSRP1: (SEQ ID NO: 86) AGGATGAGCTGGCTAGAGAGAC, (SEQ ID NO: 87) CCCACCCCACCCCTGTACTAA LRP5: (SEQ ID NO: 88) GGGAGACGCCAAGACAGACAAGATCG, (SEQ ID NO: 89) GGTGAAGACCAAGAAGGCCTCAGG G2E3: (SEQ ID NO: 90) CCCTTGGTGTTTTGGAGAAA, (SEQ ID NO: 91) GAGTGTTTCTTATGGTGAAGTCCA ESR1: ((SEQ ID NO: 92) GGCCAAATTCAGATAATCGAC, (SEQ ID NO: 93) CCACTTCGTAGCATTTACGG HPRT: (SEQ ID NO: 94) GCTGGTGAAAAGGACCTCT, (SEQ ID NO: 95) CACAGGACTAGAACACCTGC PCNA: (SEQ ID NO: 96) CCATCCTCAAGAAGGTGTTGG, (SEQ ID NO: 97) GTGTCCCATATCCGCAATTTTAT BCL2l1: (SEQ ID NO: 98) AAACTGGGTCGCATTGTGG, (SEQ ID NO: 99) TCTCGGCTGCTGCATTGTTC TCF7: (SEQ ID NO: 100) TGCAGCTATACCCAGGCTGG, (SEQ ID NO: 101) CCTCGACCGCCTCTTCTTC MMP3: (SEQ ID NO: 102) CCTGCTTTGTCCTTTGATGC, (SEQ ID NO: 103) TGAGTCAATCCCTGGAAAGTC TERT: (SEQ ID NO: 104) CGGAAGAGTGTCTGGAGCAA, (SEQ ID NO: 105) GGATGAAGCGGAGTCTGGA ATM: (SEQ ID NO: 106) TGCTGACAATCATCACCAAGTTC, (SEQ ID NO: 107) TCTCCCTTCGTGTCCTGGAA RAB3A: (SEQ ID NO: 108) TGGGTTCGAGTTCTTTGAGG, (SEQ ID NO: 109) GTCCAACGACTCGGACATCT MAPK14: (SEQ ID NO: 110) TTCTGTTGATCCCACTTCACTGT, (SEQ ID NO: 111) ACACACATGCACACACACTAAC TGFβ1: (SEQ ID NO: 112) AAGGACCTCGGCTGGAAGTG, (SEQ ID NO: 113) CCCGGGTTATGCTGGTTGTA DUSP5: (SEQ ID NO: 114) GCTCGCTCAACGTCAACCTCAACTCGGTG, (SEQ ID NO: 115) AGTGGCGGCTGCCCTGGTCCAGCACCACC
[0175] Chromatin Immunoprecipitation (ChIP): Chromatin was prepared as per manufacturer's protocol (9003S, Cell Signaling).
[0176] siRNA knockdown: cells were transfected with control, CAPERα (Kumar et al., 2014) and MLL1 siRNAs (Caslini et al., 2009) using X-treme GENE HP DNA transfection reagent as per manufacturer's instructions. For RNA-sequencing, T47D cells were transfected with two CAPER specific siRNAs (Dowhan D H, et al., Mol Cell. 17(3):429-39 (2005)). For cell studies, a single siRNA was employed as in (Kumar et al., 2014).
[0177] Soft agar colony formation assay: To assay for anchorage-independent growth, 5×10.sup.5 control or CAPERα shRNA transduced T47D or MCF10A cells in 1.5 ml media with 0.35% agarose was applied on top of set 0.5% tissue culture grade agarose in 1.5 ml media in 6 well dishes. Cells were cultured for 14 days, dishes stained with 0.005% crystal violet, and colonies counted.
[0178] T47D mouse xenografts: All procedures were approved by the University of Utah IACUC. 10×10.sup.6 control or CAPERα shRNA transduced T47D cells were suspended in 25 μl Matrigel and implanted into the cleared right inguinal mammary fat pad of 3-week-old NOD/SCID mice as described (Wysocka J, et al., Cell. 121(6):859-72 (2005)). A subcutaneous estrogen pellet was also transplanted behind the shoulder blades. To determine tumor volume, the length and the width were determined by calipers. Tumor volume=½(length×width.sup.2).
[0179] Cell counts for CPP treatments: Cells were plated in 6-well dishes and incubated with 5 μM concentration of peptides. At days noted, cells were trypsinized and counted using a hemocytometer.
[0180] Bioinformatic analyses of RNA and ChIP-Seq data. ChIP-seq Data Standards and Processing Pipeline from ENCODE were employed. Each sample was sequenced with approximately 25M 50 bp reads. Single-end reads were aligned to UCSC HG19 using Burrows-Wheeler Aligner (BWA) (v0.7.15) (Li H, et al., Bioinformatics. 25(14):1754-60 (2009)) and sorted using Samtools (v1.3.1) (Li H, et al., Bioinformatics. 25(16):2078-9 (2009)). Duplicate reads were removed using Picard (v2.9.0) to generate final sorted BAM files. Peaks were called using MACS2 (Zhang Y, et al., Genome Biol. 9(9):R137 (2008)). Overlapped peaks from different individual peaks were merged to generate the final set of ChIP-Seq peaks and investigate the co-occurrency of peaks in different CAPER and MLL samples. To understand the function of these peaks, peaks were annotated to different gene regions according to the following parameters: coding, intronic, 5′ or 3′ UTR, promoter (2 Kb upstream from a transcription start site), upstream (10 Kb upstream from a promoter), downstream (10 Kb downstream from a transcription stop), and intergenic regions. De novo and known motif were then searched for in the ChIP-Seq peaks using HOMER (Heinz S, et al., Mol Cell. 38(4):576-89 (2010)). GREAT (McLean C Y, et al., Nat Biotechnol. 28(5):495-501 (2010)) was used to characterize biological function of target genes including Gene Ontology (GO) (Ashburner M, et al., Nat Genet. 25(1):25-9 (2000)) and MSigDB pathway analysis as described in the results. The function of target genes was annotated based on established lists of housekeeping genes (Eisenberg E, et al., Trends in genetics: TIG. 29(10):569-74 (2013)), oncogenes, and tumor suppressors (Lever J, et al., Nat Methods. 16(6):505-7 (2019)).
[0181] For RNA-Seq, raw paired end reads from the FASTQ files were trimmed with Cutadapt https://cutadapt.readthedocs.io/en/stable/to remove the low-quality tails. Reads were aligned on UCSC HG19 using Tophat2 (v2.0.12) (Trapnell C, et al., Nat Protoc. 7(3):562-78 (2012)) guided by RefSeq gene annotation downloaded from UCSC 2/6/19. Cufflinks (v2.2.1) was used to estimate the expression abundances of genes and transcripts. Cuffdiff was used to identify differentially expressed genes (DEGs) between the two replicates of control versus CAPER knockdown, with default parameters and a q-value <0.05 as the significance threshold for all subsequent analyses. DEGs were annotated to the four functional categories mentioned above and investigated the significance of enriched up/downregulated genes by comparing the observed fraction of DEGs among each category against the fraction of DEGs among all genes. The p-value was calculated based on the hypergeometric distribution.
[0182] Generation of synthetic peptides from the RRM3 domain: RRM3-derived peptides were commercially synthesized by Abm at purity >80%. Peptides were dissolved in 1λPBS at 1 mg/ml and used at 5 μM in low serum (1%) RPMI media.
[0183] MLL1 CRISPR/Cas KO procedure: T47D cells were plated on 6-well plate in complete growth medium (RPMI with 10% FBS). Cells were transfected with MLL CRISPR/Cas9 KO and MLL HDR plasmid at the ratio of 1:1.2 μg. The Neon transfection system was used with a single pulse at 1,700 pulse voltage and 20 ms pulse width. Transfected cells were plated in complete medium for 24 hours followed by puromycin selection. MLL1 knockout efficiency was measured by RT-PCR to assay for transcript levels.
Example 2
CAPERα Depletion Reduces Tumorigenesis and Cancer Hallmarks in Breast Cancer Cells
[0184] It was previously reported that CAPERα is required to regulate cell proliferation and prevent senescence of primary human fibroblasts, suggesting that CAPERα has oncogenic potential (Kumar et al., 2014). There is evidence that CAPERα plays a role in breast and other cancers (Mercier I, et al., Cell Cycle. 13(8):1256-64 (2014); Mercier I, et al., Am J Pathol. 174(4):1172-90 (2009); Chai Y, et al., Tumour biology: the journal of the International Society for Oncodevelopmental Biology and Medicine. 35(7):6311-7 (2014); Sillars-Hardebol A H, et al., Cellular oncology. 35(4):293-300 (2012); Dutta J, et al., J Virol. 82(21):10792-802 (2008); Huang G, et al., Cancer. 118(8):2106-16 (2012); Dai L, et al., Experimental hematology & oncology. 2(1):15 (2013)). It was investigated herein that CAPERα influences tumorigenesis and invasion in vivo. Cells were xenografted from the T47D ER+, luminal-like breast cancer cell line, transduced with either control or CAPERα shRNA-expressing lentivirus, into the cleared right inguinal mammary fat pad of 3-4 week-old NOD/SCID mice as previously described (DeRose Y S, et al., Current protocols in pharmacology/editorial board, SJ Enna. Chapter 14 (2013)). Effective knockdown of CAPERα protein was verified (
[0185] Whether CAPERα regulated proliferation or survival of T47D and the triple-negative, basal-like breast cancer cell line MDA-MB231, as well as of the non-transformed MCF10A breast epithelial cell line and primary mammary epithelial cells (PMEs) was also investigated. CAPERα knock-down (kd) decreased proliferation of T47D and MDA-MB231 breast cancer cells assayed by crystal violet and population doublings, but did not have this effect in either MCF10A or PME cells (
Example 3
Loss of CAPERα Results in Global Changes in Activating Histone Marks
[0186] It was previously demonstrated that CAPERα kd in primary human fibroblasts resulted in altered H3K9 methylation and acetylation of promoter regions of target genes, repressing their transcription (Kumar et al., 2014). Whether decreasing CAPERα levels alters global histone epigenetic marks in breast cancer cells was investigated. The lysates from cells transfected with CAPERα or negative control siRNAs was analyzed. While the total amount of Histone-3 (H3) was unchanged, there was a dramatic decrease in the level of the activating H3K4me3 mark in both T47D and MDA-MB231 breast cancer lines (and in MDA-MB468, not shown) but not in PMEs (
Example 4
CAPERα Interacts with Histone Modifying Enzymes in a Cell-Specific Manner
[0187] The data presented herein indicate that CAPERα is involved in establishing or maintaining active epigenetic marks in breast cancer cells. Given the loss of H3K4me3 that was observed in CAPERα kd breast cancer cells, whether CAPERα interacts with MLL1 (i.e., whether MLL1 co-IPs with endogenous CAPERα (and the reciprocal) in T47 and MDA-MB231 breast cancer cells, but not in PMEs (
[0188] Importantly, co-IPs of lysates prepared from flash frozen human tissues showed no CAP/MLL1 interaction in normal breast, while CAPERα and MLL1 interacted in both ER+ and triple-negative breast cancers (
[0189] Whether MLL1 kd phenocopies CAPERα loss of function (
Example 5
CAPERα Interacts with Multiple Compass Complex Members in Breast Cancer Cells
[0190] Optimal MLL1 catalytic activity requires that it function within a core complex containing COMPASS proteins ASH2L, RbBP5 and WDR5 (Dou Y, et al., Nat Struct Mol Biol. 13(8):713-9 (2006)). Endogenous CAPERα, MLL1, ASH2L, RbBP5 and WDR5 reciprocally co-IP each other in T47D (
[0191] Myc- and GST-pull downs were used in HEK293 cells to assay for direct interactions. Overexpressed myc-tagged CAPERα co-IP′d endogenous MLL1 in heterologous cells (
[0192] CAPERα has three RRM domains, a transcriptional activation (AD), and estrogen receptor (ESR-ID) and JUN (JUN-ID) interaction domains (Uniprot,
[0193] Whether CAPERα depletion influences interaction of MLL1 core components was investigated. CAPERα kd disrupted the MLL1-ASH2L interaction (
[0194] Although CAPERα directly interacts with estrogen receptor in yeast (Jung D J, et al., J Biol Chem. 277(2):1229-34 (2002)) and MLL1 interacts with HCF-1 in leukemia cells (Yokoyama A, et al., Mol Cell Biol. 24(13):5639-49 (2004)), interaction between CAPERα and either of these factors in T47D, MDA-MB231 or PME cells was not detected (
Example 6
CAPERα is Required for MLL1 Occupancy and Regulation of Known MLL1 Target Genes
[0195] BCL2L1, BCL6, JUNB, CCND1 and GATA3 are known MLL1 direct targets in U937 cells (Guenther M G, et al., Genes Dev. 22(24):3403-8 (2008)). ChIP-PCR shows that CAPERα and MLL1 co-occupy the promoters of these genes in T47D cells (
Example 7
Genome-Wide Analysis of CAPERα and MLL1 Chromatin Occupancy in T47D Breast Cancer Cells
[0196] Decreased bulk H3K4me3 levels after CAPERα kd suggest that its requirement for MLL1 function is pervasive in breast cancer cells. High-throughput sequencing of CAPER and MLL1 bound chromatin IP′d from T47Ds identified 5,741 bound regions for CAPERα (associated with 7743 genes) and 11,037 for MLL1 (10,882 genes) (
[0197] Of the 137 cancer driver genes enumerated by Vogelstein (Vogelstein B, et al., Science. 339(6127):1546-58 (2013)), 47% are co-occupied by CAP/MLL1 (p<2.0×10-09). The number of housekeeping, tumor suppressors and oncogenes (Lever J, et al., Nat Methods. 16(6):505-7 (2019)) bound by CAP/MLL11 is significantly higher than random (p values of 2.6×10-110, 6.12×10-24 and 2.43×10-60, respectively).
[0198] All co-bound regions and promoters for overrepresented motifs to were searched to identify sequences that may facilitate CAP/MLL1 binding. The most enriched de novo motif identified by HOMER (Heinz S, et al., Mol Cell. 38(4):576-89 (2010)) (
[0199] The GREAT hierarchical tool allowed the identification of the most specific significantly enriched Gene Ontology (GO) Biologic Process (BP) terms. Then, the members of each term's geneset were manually examined and curated into functional categories (color key,
[0200] To investigate the functional relevance of CAP/MLL1 occupancy, genome-wide transcriptional profiling of T47D cells treated with control or CAPERα siRNAs was performed. 3,873 genes were differentially expressed at a significance of q<0.05 (
[0201] Notably CASPASE genes 2, 3, 4, 6, 8 and 9 were cobound/upregulated and enrichment of proapoptotic genes and pathways was detected by GREAT (
[0202] From a broader view, of the 10 canonical oncogenic signaling pathways curated by TCGA (Sanchez-Vega F, et al., Cell. 173(2):321-37 e10 (2018)), 3 had cobound tumor suppressors genes whose expression increased with CAPERα kd (Wnt, Notch and Hippo pathways) while the MYC, p53 and Cell cycle pathways had multiple cobound/downregulated oncogenes. Thus, loss of CAPERα reverts the molecular signature of breast cancer cells by changing expression of high-level, direct targets.
Example 8
The CAPERα/MLL1 Complex Coregulates Transcription of Novel Targets
[0203] To further validate the importance of the CAP/MLL1 complex in breast cancer cell epigenetics and transcriptional regulation, a sample of CAP/MLL1 target promoters (DUSP6, BCL6, CCND1, SATB1, CBX8, SSRP1, LRP5, G2E3, ESR1, BANF1) were selected and ChIP-PCR was used to assay chromatin occupancy by MLL1 core complex members: all members bound these promoters in T47D but not PME cells (
Example 9
CAPERα Directly Binds to DNA Via its RRM2 Domain
[0204] CAPERα was further investigated for its intrinsic DNA binding function. EMSAs with DNA oligos and purified GST-CAPERα protein revealed that CAPERα strongly binds GC rich single and double stranded probes, but not A/T or all C containing probes (
Example 10
CAPERα and MLL1 Complex Members are Overexpressed and Mislocalized in Breast Cancer Cells
[0205] A key question is what drives formation of the CAP/MLL1 complex in breast cancer and not normal breast cells. To begin to address this, the expression and subcellular localization of CAP/MLL1 complex members in PMEs and breast cancer cells was examined. RT-PCR demonstrates that transcript levels for complex members are markedly higher in breast cancer cells than PMEs (
Example 11
Direct Interaction of CAPERα and MLL1 is Necessary for Gene Activation and Breast Cancer Cell Proliferation
[0206] Since RRM3 mediates the CAP/MLL1 interaction (
[0207] Toward these objectives, empty or RRM3-expressing vectors (
[0208] Overall, the data indicate that CAPERα binds DNA and MLL1 complex members, to recruit the complex to target promoters. Further, these results clearly show that it is the CAP/MLL1 complex that is pivotal for the establishing H3K4me3 marks, activating target gene transcription and stimulating abnormal proliferation of cancer cells.
Example 12
RRM3 Cell Penetrating Peptide Disrupts Breast Cancer Cell Growth
[0209] Whether recombinant RRM3 conjugated with the Penetratin cell penetrating peptide (Dupont E, et al., Methods Mol Biol. 1324:29-37 (2015)) (
[0210] These results led to optimization of RRM3-derived peptides. As per UniProt, RRM3 spans amino acids (aa) 445-508 (SEQ ID NO: 34) and SWISS tool predicts 2 α helices and 4 β sheets that are conserved in vertebrate RRM-containing proteins (
TABLE-US-LTS-00001 LENGTHY TABLES The patent application contains a lengthy table section. A copy of the table is available in electronic form from the USPTO web site (). An electronic copy of the table will also be available from the USPTO upon request and payment of the fee set forth in 37 CFR 1.19(b)(3).