METHOD FOR DETECTING OR QUANTIFYING SMN1 GENE

20220267852 · 2022-08-25

Assignee

Inventors

Cpc classification

International classification

Abstract

An object of the invention is to provide a primer for detecting and quantifying homozygous deletion of the SMN1 gene, the deletion of which causes SMA, using a dried blood spot in a filter paper and a method related to specific detection/quantification of the SMN1 gene using the primer. The invention is a method for detecting the SMN1 gene in a dried blood spot in a filter paper by real-time PCR, including the steps of (A) to (D) below: (A) a step of adding the dried blood spot in a filter paper to a PCR reaction tube; (B) a step of adding a PCR reagent to the PCR reaction tube, wherein the PCR reagent contains at least a primer designed in a manner that the reactivity to the SMN2 gene is less than 1% of that to the SMN1 gene, a polymerase, dNTPs and an intercalator or a fluorescently labeled probe; (C) a step of performing PCR reaction in the tube containing the PCR reagent and the dried blood spot in a filter paper; and (D) a step of sequentially and optically detecting a target nucleic acid in the SMN1 gene amplified by the PCR reaction.

Claims

1. A method for detecting the SMN1 gene in a dried blood spot in a filter paper by real-time PCR, including the steps of (A) to (D) below: (A) a step of adding the dried blood spot in a filter paper to a PCR reaction tube; (B) a step of adding a PCR reagent to the PCR reaction tube, wherein the PCR reagent contains at least a primer designed in a manner that the reactivity to the SMN2 gene is less than 1% of that to the SMN1 gene, a polymerase, dNTPs and an intercalator or a fluorescently labeled probe; (C) a step of performing PCR reaction in the tube containing the PCR reagent and the dried blood spot in a filter paper; and (D) a step of sequentially and optically detecting a target nucleic acid in the SMN1 gene amplified by the PCR reaction.

2. The detection method according to claim 1, wherein the primer designed in a manner that the reactivity to the SMN2 gene is less than 1% of that to the SMN1 gene is one or more primers selected from the group consisting of the forward primer of (1) and the reverse primer of (2) below: (1) a forward primer having any of the nucleotide sequences of SEQ ID NOs: 1 to 9; and (2) a reverse primer having any of the nucleotide sequences of SEQ ID NOs: 16 to 21.

3. The detection method according to claim 1, wherein the dried blood spot in a filter paper is a circular punched piece with a diameter of 1.2 mm to 2.0 mm or a punched piece containing whole blood in an amount of 0.95 v/v % to 6.6 v/v % based on the total amount of the reaction solution.

4. A primer for specifically detecting the SMN1 gene which is one or more primers selected from the group consisting of the forward primer of (1) and the reverse primer of (2) below: (1) a forward primer having any of the nucleotide sequences of SEQ ID NOs: 1 to 9; and (2) a reverse primer having any of the nucleotide sequences of SEQ ID NOs: 16 to 21.

5. A method for weakening the reactivity to the SMN2 gene in a method for detecting the SMN1 gene in a dried blood spot in a filter paper by real-time PCR which uses one or more primers selected from the group consisting of the forward primer of (1) and the reverse primer of (2) below: (1) a forward primer having any of the nucleotide sequences of SEQ ID NOs: 1 to 9; and (2) a reverse primer having any of the nucleotide sequences of SEQ ID NOs: 16 to 21.

6. The detection method according to claim 2, wherein the dried blood spot in a filter paper is a circular punched piece with a diameter of 1.2 mm to 2.0 mm or a punched piece containing whole blood in an amount of 0.95 v/v % to 6.6 v/v % based on the total amount of the reaction solution.

Description

BRIEF DESCRIPTION OF DRAWINGS

[0035] FIG. 1 The amplification reaction curves of the PCR reagent containing SMN1 standards for a calibration curve are shown.

[0036] FIG. 2 The parts of the amplification reaction curves of the PCR reagent for SMN2 cross test at 25 to 40 cycles are shown.

DESCRIPTION OF EMBODIMENTS

SMN1 Gene-Specific Primer

[0037] The SMN1 gene-specific primer of the invention is a primer designed in a manner that the primer specifically amplifies the SMN1 gene and does not easily amplify the SMN2 gene. That is, the primer is a primer designed in a manner that the reactivity to the SMN2 gene is less than 1% of that to the SAM gene. The reactivity is determined as follows. Assuming that the reactivity is 100% when the Cq values are the same in the case where the copy numbers of the SMN1 gene and the SMN2 gene per reaction are the same, the reactivity is 10% when the Cq values are the same in the case where the copy number of the SMN2 gene per reaction is 10 times higher than that of the SMN1 gene, and the reactivity is 1% when the Cq values are the same in the case where the copy number is 100 times higher. Here, when the Cq value of the SMN1 gene is smaller, the reactivity is determined to be less than 1%. In the Examples described below, of the combinations of the conditions for the primers and the amplification elongation temperature, when the ΔCq value which was obtained by subtracting the Cq value of the SMN2 gene 10,000 copy/reaction from the Cq value of the SAM gene 100 copy/reaction was less than −0.1, the reactivity was determined to be less than 1%.

[0038] It has been also found that, when PCR reaction is performed using the primer of the invention, the reactivity to the SMN2 gene further weakens in the case where a dried blood spot in a filter paper is used as an analyte.

[0039] The forward primer which is specific to the SMN1 gene of the invention may be specifically a primer having any of the nucleotide sequences of SEQ ID NO 9. The forward primers are designed to contain C at the sixth position of exon 7 of the SMN1 gene at the 3′ end. The forward primers have a length of 22 to 30 bases in succession from C at the sixth position toward the 5′ end. The successive bases are preferably identical to the corresponding nucleotide sequence in the SMN1 gene, but a primer having a difference by one or some bases which do not hinder the amplification of the target nucleic acid is also included in the scope of the primer of the invention.

[0040] The reverse primer which is specific to the SMN1 gene of the invention may be a primer having any of the nucleotide sequences of SEQ ID NOs: 16 to 21. The reverse primers are designed to contain the complementary sequence to the sixth position of exon 7 of the SMN1 gene at the 3′ end of the reverse primers and have a length of 20 to 25 bases. The successive bases are preferably identical to the corresponding complementary strand of the SMN1 gene, but a primer having a difference by one or some bases which do not hinder the amplification of the target nucleic acid is also included in the scope of the primer of the invention.

[0041] As the primer of the invention, either of the forward primer which is specific to the SMN1 gene and the reverse primer which is specific to the SMN1 gene may be used, and the reverse primer and the forward primer used as a set are desirably 20 bp or more apart in the case of real-time PCR considering the necessity for designing a fluorescently labeled probe in the region between the primers.

[0042] The reverse primer used with the forward primer which is specific to the SMN1 gene of the invention as a set may be the reverse primer which is specific to the SMN1 gene of the invention, or a primer containing a complementary sequence to a nucleotide sequence which is identical to a part of the exon 7 or intron 7 region as long as the forward and reverse primers are 20 bp or more apart.

[0043] The forward primer used with the reverse primer which is specific to the SMN1 gene of the invention as a set may be the forward primer which is specific to the SMN1 gene of the invention or a primer containing a nucleotide sequence which is identical to a part of the intron 6 region.

[0044] When PCR is performed using the forward primer which is specific to the SMN1 gene or the reverse primer which is specific to the SMN1 gene of the invention, nucleic acid containing C at the sixth position of exon 7 of the SMN1 gene is amplified. On the other hand, because the sixth position of exon 7 of the corresponding nucleic acid of the SMN2 gene is T, which is not recognized by the 3′ end of the forward primer which is specific to the SMN1 gene or the reverse primer which is specific to the SMN1 gene of the invention, the amplification reaction by the polymerase is not caused easily.

[0045] Moreover, when a dried blood spot in a filter paper is used as an analyte, the amplification reaction of the SMN2 gene becomes further difficult, and specific detection of the SMN1 gene is thus enabled.

[0046] In this manner, when a dried blood spot in a filter paper is used as an analyte for PCR using at least one kind of the forward primer which is specific to the SMN1 gene and the reverse primer which is specific to the SMN1 gene of the invention, the effects can be exerted more. That is, because the region in exon 7 of the SMN1 gene can be amplified specifically and because the region in the SMN2 gene is hardly amplified, the SMN1 gene can be detected or quantified specifically. The amplified nucleic acid can be qualitatively or quantitatively analyzed by electrophoresis, real-time PCR or the like.

[0047] It has been demonstrated in the Examples described below that the reactivity to the SMN2 gene is less than 1% of that to the SMN1 gene when PCR is performed using the forward primer which is specific to the SMN1 gene or the reverse primer which is specific to the SMN1 gene of the invention.

PCR/Real-Time PCR

[0048] The real-time PCR method generally means a method for sequentially monitoring the process of generation of an amplification product in PCR. In the invention, detection by real-time PCR means detection of an amplified target nucleic acid in the SMN1 gene (also simply referred to as an amplification product below) by optical means after the PCR reaction. Here, the amplification product may be detected, for example, at the time of completion of the PCR reaction or after the completion or may be detected simultaneously during the PCR reaction step. In the case of simultaneous detection, the amplification product can be detected, for example, sequentially. The sequential detection (monitoring) may be, for example, continuous or noncontinuous (intermittent) detection.

[0049] The temperature changes of the steps in the PCR reaction may be automatically controlled using, for example, a thermal cycler or the like. The amplification product generated by the PCR reaction can be detected, for example, by detecting the fluorescence intensity generated from the amplification product. The fluorescence detection is not particularly restricted but is the conventionally known intercalator method, the TaqMan (registered trademark) probe method, the hybridization method, the cycling probe method or the like.

[0050] The fluorescence intensity can be detected, for example, with a fluorometer. Moreover, in general, an apparatus which has both a PCR reaction unit (for example, a thermal cycler) and an optical unit (for example, a fluorometer) is used. Specific examples include commercial SMartCycler (product name, manufactured by Takara Bio Inc.), LightCycler (product name, manufactured by Roche Diagnostics), ABI PRISM7000 (product name, manufactured by Applied Biosystems) and the like.

Quantification Method of Target Nucleic Acid

[0051] The method for quantifying the SMN1 gene of the invention is a method of generating an amplification product complementary to a target nucleic acid in the SMN1 gene in a sample, detecting the amplification product by optical means and quantifying the amplification product. By counting the PCR cycle number at which the amount of the amplification product has reached a certain amount, the target nucleic acid contained in the sample can be quantified in the method. Moreover, as in the Examples described below, the quantification can be conducted by calculating the copy number of 1 μL of whole blood in the sample from a calibration curve of the Cq values calculated from the standards.

PCR Reagent

[0052] The PCR reagent used in the invention contains at least a set of primers, a polymerase, dNTPs (deoxynucleoside triphosphates), an intercalator or a fluorescently labeled probe. The reagent also typically contains a buffer. The buffer is not particularly limited as long as the buffer has the function of inhibiting the activities of substances which inhibit the DNA amplification reaction, such as positively charged substances (certain kinds of protein and the like) and negatively charged substances (certain kinds of saccharide, dyes and the like), in the body fluid of a living thing. Examples of commercial buffers include Ampdirect, Ampdirect plus (both manufactured by Shimadzu Corporation) and the like. The amount of the PCR reagent used in the invention added to a reaction tube is 20 to 50 μL.

Sample/Dried Blood Spot in a Filter Paper

[0053] The sample used in the invention is preferably blood in a filter paper that is obtained by blotting blood on the filter paper and then drying the blood, which is called a dried blood spot in a filter paper. The dried blood spot in a filter paper is taken out using a punching device as a paper piece having the shape of the punching hole (punched piece). Examples of the dried blood spot in a filter paper used include blood on a filter paper collected from the heel of a newborn during newborn mass screening or the like, blood on a filter paper collected during simultaneous optional screening and the like, but the dried blood spot in a filter paper is not limited to the examples. Regarding the size of the punched piece that is cut out from the dried blood spot in a filter paper, a punched piece having a certain size is desirable because the amount of the contained blood should be in an appropriated range. The punched piece having a certain size is desirably a circular punched piece with a diameter of 1.2 to 2.0 mm, further desirably a circular punched piece with a diameter of 1.5 mm to 1.8 mm. The whole blood amount contained in the punched piece based on the total amount of the PCR reaction solution is desirably 0.95 v/v % to 6.6 v/v %, further desirably 1.4 v/v % to 5.2 v/v %. Here, the whole blood amount is indicated as the proportion which is obtained by adding a circular punched piece with a diameter of 1.2 to 2.0 mm or a circular punched piece with a diameter of 1.5 mm to 1.8 mm to 20 to 50 μL of a PCR reaction solution and dissolving the blood and which is calculated based on the actual value (when 30 μL of whole blood was added to a filter paper before cutting out a punched piece and dried, the diameter of the created circular blood portion was 9.5 mm).

PCR Reaction Tube

[0054] The tube used in the invention is a tube for PCR reaction and has a structure into which a punched piece of the filter paper with blood can be smoothly inserted and which can be sealed with a cap. In a suitable shape, the opening at the upper part of the tube is a circle (for example, an inside diameter of around 2.5 mm to 10 mm), and the bottom is narrower than the opening at the upper part. An inverted cone shape or the like is preferable.

[0055] The volume of the tube may be a volume to which the PCR reaction reagent can be added and which can sufficiently hold the reaction solution even with the temperature changes during the PCR reaction, and the tube preferably has a volume of 0.1 mL to 0.3 mL, further preferably a volume of 0.15 mL to 0.25 mL, most preferably a volume of 0.2 mL.

[0056] The PCR reaction tube used in the invention is preferably a 96-well plate for PCR reaction in which 96 tubes are connected or one in an eight-tube strip in which eight tubes are connected, and as commercial products, those sold with a name 96-well PCR plate, PCR eight-tube strip or the like can be used. Commercial products include LightCycler (registered trademark) 480 Multiwell Plate 96 (Roche, Inc.), 96-Well PCR Plate, Flat Top, Low Profile, Natural, Polypropylene, UltraFlux (Scientific Specialties, Inc.), Eppendorf PCR plate 96, skirtless, 150 μL, colorless (Eppendorf), PCR plate 96-well simplate 0.1 mL natural (BM Equipment Co., Ltd.), LightCycler 8-Tube Strips (Roche, Inc.) and the like.

[0057] The material of such a reaction tube desirably causes little contamination of the reaction solution and is stiff so that the shape does not change even with the changes in the internal pressure due to the temperature changes during the PCR reaction, and the tube is made of polypropylene, for example.

Kit

[0058] The kit of the invention is a kit for specifically detecting the SMN1 gene by real-time PCR and includes one or more primers selected from the group consisting of the forward primer of (1) and the reverse primer of (2) below:

[0059] (1) a forward primer having any of the nucleotide sequences of SEQ ID NOs: 1 to 9; and

[0060] (2) a reverse primer having any of the nucleotide sequences of SEQ ID NOs: 16 to 21.

[0061] In addition, the kit can include a reverse primer or a forward primer which is used as a set with the primer. Moreover, the kit can also include a probe or a reagent or a container used for PCR or real-time PCR.

EXAMPLES

[0062] The present invention is explained in detail below by Examples, but the invention is not limited to the Examples below.

[0063] The present Examples are examples which compared the reactivities of the designed primers to the SMN1 gene and SMN2 gene sequences.

[Example 1] SMN1 Gene Quantification Systems Using SMN1 Gene-Specific Forward Primers

(a) Test Materials

[0064] (a-1) SMN1 Gene Amplification Forward Primers

[0065] Forward primers for the SMN1 gene amplification (Table 1; SEQ ID NOs: 1 to 9) and a common reverse primer (Table 1; SEQ ID NO: 10) were synthesized by Sigma-Aldrich Co. LLC and used.

TABLE-US-00001 TABLE 1 SMN1 Gene-Specific Forward Primers of the Present Invention and Common Reverse Primer SEQ ID NO Primer Name Nucleotide Sequence (5′.fwdarw.3′) bp Tm 1 SMN1_ASP30 TAACTTCCTTTATTTTCCTTACAGGGTTTC 30 65.6 2 SMNl_ASP29 AACTTCCTTTATTTTCCTTACAGGGTTTC 29 65.8 3 SMNl_ASP28 ACTTCCTTTATTTTCCTTACAGGGTTTC 28 65.1 4 SMN1_ASP27 CTTCCTTTATTTTCCTTACAGGGTTTC 27 64.6 5 SMNl_ASP26 TTCCTTTATTTTCCTTACAGGGTTTC 26 64.0 6 SMNl_ASP25 TCCTTTATTTTCCTTACAGGGTTTC 25 63.1 7 SMNl_ASP24 CCTTTATTTTCCTTACAGGGTTTC 24 61.7 8 SMN1_ASP23 CTTTATTTTCCTTACAGGGTTTC 23 58.7 9 SMN1_ASP22 TTTATTTTCCTTACAGGGTTTC 22 57.8 10 SMN_RP(1) CACTTTCATAATGCTGGCAGACTTAC 26 65.5
(a-2) Plasmids

[0066] As templates of the PCR reaction, plasmids having a partial sequence shown below which included exon 7 of the SMN1 gene or the SMN2 gene and which was incorporated in a vector were synthesized by Eurofins Scientific SE and used. The underlined part of SEQ ID NO: 11 below shows the sequence of exon 7 (54 bp) of the SMN1 gene, where the upstream is a partial sequence of intron 6, and the downstream shows a partial sequence of intron 7. The underlined part of SEQ ID NO: 12 shows the sequence of exon 7 (54 bp) of the SMN2 gene, where the upstream is a partial sequence of intron 6, and the downstream shows a partial sequence of intron 7.

[0067] The sixth position of exon 7 of the SMN1 gene is C, while the sixth position of exon 7 of the SMN2 gene is T.

TABLE-US-00002 Partial Sequence of SMN1 Gene Including Exon 7 (SEQ ID NO: 11) CAACTTAATTTCTGATCATATTTTGTTGAATAAAATAAGTAAAATGTCTTG TGAAACAAAATGCTTTTTAACATCCATATAAAGCTATCTATATATAGCTAT CTATGTCTATATAGCTATTTTTTTTAACTTCCTTTATTTTCCTTACAGGGT TTCAGACAAAATCAAAAAGAAGGAAGGTGCTCACATTCCTTAAATTAAGGA GTAAGTCTGCCAGCATTATGAAAGTGAATCTTACTTTTGTAAAACTTTATG GTTTGTGGAAAACAAATGTTTTTGAACATTTAAAAAGTTCAGATGTTAAAA AGTTGAAAGGTTAATGTAAAACAATCAATATTAAAGAATTTTGATGCCAAA ACTATTAGATAAAAGGTTAATCTACATCCCTACTAGAATTCTC Partial Sequence of SMN2 Gene Including Exon 7 (SEQ ID NO: 12) CAACTTAATTTCTGATCATATTTTGTTGAATAAAATAAGTAAAATGTCTTG TGAAACAAAATGCTTTTTAACATCCATATAAAGCTATCTATATATAGCTAT CTATATCTATATAGCTATTTTTTTTAACTTCCTTTATTTTCCTTACAGGGT TTTAGACAAAATCAAAAAGAAGGAAGGTGCTCACATTCCTTAAATTAAGGA GTAAGTCTGCCAGCATTATGAAAGTGAATCTTACTTTTGTAAAACTTTATG GTTTGTGGAAAACAAATGTTTTTGAACATTTAAAAAGTTCAGATGTTAGAA AGTTGAAAGGTTAATGTAAAACAATCAATATTAAAGAATTTTGATGCCAAA ACTATTAGATAAAAGGTTAATCTACATCCCTACTAGAATTCTC

(b) PCR Reagent

[0068] The composition of the PCR reagent is shown below. [0069] 1× (final concentration) PCR buffer (Ampdirect Plus; Shimadzu Corporation) [0070] 0.2 μM (final concentration) SMN1 gene forward primer (SEQ ID NOs: 1 to 9) [0071] 0.2 M (final concentration) common reverse primer (SEQ ID NO: 10) [0072] 0.025 U/μL (final concentration) BIOTAQ HSDNA polymerase [0073] 0.5× (final concentration) EvaGreen

(c) Plasmid Dilution Series

[0074] SMN1 gene plasmid (final concentration) 100,000 copy/reaction, 10,000 copy/reaction, 1,000 copy/reaction, 100 copy/reaction

[0075] SMN2 gene plasmid (final concentration) 100,000 copy/reaction, 10,000 copy/reaction

(d) Conditions for PCR Reaction

[0076] (i) 95° C.: 15 minutes [0077] (ii) 95° C.: 15 seconds, 61 to 65° C.: 80 seconds (45 cycles) [0078] (iii) 37° C.: 5 minutes

(e) Real-Time PCR Measurement Using Intercalator

[0079] (e-1) Measurement Method

[0080] The measurement was made by the following procedures. [0081] (i) The PCR reagent and the plasmids were mixed at the final concentrations above, and PCR tubes were prepared by dispensing 40 μL thereof. [0082] (ii) Using a thermal cycler (CFX96; Bio-Rad Laboratories, Inc.), real-time PCR measurement was made, and the Cq values of the respective plasmid concentrations were calculated.
(e-2) Measurement Results

[0083] The results are shown in Table 2. Of the combinations of the conditions for the primers and the amplification elongation temperature, there were 11 combinations in which the reactivity to the SMN2 gene was less than 1% of that to the [0084] gene, that is, there were 11 combinations that satisfied the ΔCq value of less than −0.1, where the ΔCq value was obtained by subtracting the Cq value of the SMN2 gene 10,000 copy/reaction from the Cq value of the SMN1 gene 100 copy/reaction. The forward primers of SEQ ID NOs: 1 to 9 were applicable.

TABLE-US-00003 TABLE 2 Table 2: Measurement Results of Real-Time PCR Using SMN1 Gene-Specific Forward Primers of The Present Invention Amplification Elongation Temperature 61° C. 63° C. 65° C. Forward Primer ASP25 ASP24 ASP23 ASP28 ASP27 ASP26 ASP25 ASP24 ASP23 ASP30 ASP29 ASP28 ASP27 ASP26 SMN1 23.7 23.9 24.1 24.0 24.1 24.2 24.2 24.2 25.5 24.0 24.0 24.1 24.2 25.1 1 × 10.sup.5 copy SMN1 27.2 27.3 27.5 27.3 27.3 27.4 27.4 27.6 28.8 27.4 27.3 27.3 27.4 28.3 1 × 10.sup.4 copy SMN1 30.5 30.6 30.7 30.7 30.7 30.7 30.7 31.0 32.1 31.0 30.6 30.6 30.6 31.6 1 × 10.sup.3 copy SMN1 custom-character custom-character custom-character custom-character custom-character custom-character custom-character custom-character custom-character custom-character custom-character custom-character custom-character custom-character custom-character SMN2 30.0 30.6 32.8 28.9 30.3 32.5 32.6 32.8 34.3 31.7 31.8 32.5 33.0 33.7 1 × 10.sup.5 copy SMN2 custom-character custom-character custom-character custom-character custom-character custom-character custom-character custom-character custom-character custom-character custom-character custom-character custom-character custom-character custom-character ΔCq Value※ 0.8 0.0 4.7 1.7 0.7 −1.5 −1.7 −2.7 −2.5 −0.8 −1.6 −1.7 −1.9 −2.4 ※SMN1 1 × 10.sup.2 copy Cq Value − SMN2 1 × 10.sup.4 copy Cq Value

[Example 2] SMN1 Gene Quantification Systems Using SMN1 Gene-Specific Reverse Primers

(f) Test Materials

[0085] (f-1) SMN1 Gene Amplification Reverse Primers

[0086] Reverse primers for the SMN1 gene amplification (Table 3; SEQ ID NOs: 14 to 22) and a common forward primer (Table 3; SEQ ID NO: 13) were synthesized by Sigma-Aldrich Co. LLC and used.

TABLE-US-00004 TABLE 3 SMN Gene-Specific Reverse Primers of the Present Invention and Common Forward Primer SEQ ID NO Primer Name Nucleotide Sequence (5′.fwdarw.3′) bp Tm 13 SMN_FP(1) AGTAAAATGTCTTGTGAAACAAAATGCT 28 64.5 14 SMN1_RASP27 CACCTTCCTTCTTTTTGATTTTGTCTG 27 67.3 15 SMN1_RASP26 ACCTTCCTTCTTTTTGATTTTGTCTG 26 65.2 16 SMN1_RASP25 CCTTCCTTCTTTTTGATTTTGTCTG 25 64.7 17 SMN1_RASP24 CTTCCTTCTTTTTGATTTTGTCTG 24 61.8 18 SMN1_RASP23 TTCCTTCTTTTTGATTTTGTCTG 23 61.0 19 SMN1_RASP22 TCCTTCTTTTTGATTTTGTCTG 22 59.8 20 SMN1_RASP21 CCTTCTTTTTGATTTTGTCTG 21 58.0 21 SMN1_RASP20 CTTCTTTTTGATTTTGTCTG 20 54.0 22 SMN1_RASP19 TTCTTTTTGATTTTGTCTG 19 52.7
(f-2) Plasmids

[0087] The same plasmids as those in (a-2) above were used.

(g) PCR Reagent

[0088] The composition of the PCR reagent is shown below. [0089] 1× (final concentration) PCR buffer (AMpdirect Plus; Shimadzu Corporation) [0090] 0.2 μM (final concentration) common forward primer (SEQ ID NO: 13) [0091] 0.2 μM (final concentration) SMN1 gene reverse primer (SEQ ID NOs: 14 to 22) [0092] 0.025 U/μL (final concentration) BIOTAQ HSDNA polymerase [0093] 0.5× (final concentration) EvaGreen

(h) Plasmid Dilution Series

[0094] The same plasmid dilution series as those in (c) above were used.

(i) Conditions for PCR Reaction

[0095] The reaction was performed under the same conditions as those in (d) above.

(j) Real-Time PCR Measurement Using Intercalator

[0096] (j-1) Measurement Method

[0097] The measurement was made by the following procedures. [0098] (i) The PCR reagent and the plasmids were mixed at the final concentrations above, and PCR tubes were prepared by dispensing 40 μL thereof. [0099] (ii) Using a thermal cycler (CFX96; Bio-Rad Laboratories, Inc.), real-time PCR measurement was made, and the Cq values of the respective plasmid concentrations were calculated.
(j-2) Measurement Results

[0100] The results are shown in Table 4. Of the combinations of the conditions for the primers and the amplification elongation temperature, there were 8 combinations in which the reactivity to the SMN2 gene was less than 1% of that to the SMN1 gene, that is, there were 8 combinations that satisfied the ΔCq value of less than -0.1, where the ΔCq value was obtained by subtracting the Cq value of the SMN2 gene 10,000 copy/reaction from the Cq value of the SMN1 gene 100 copy/reaction. The reverse primers of SEQ ID NOs: 16 to 21 were applicable.

TABLE-US-00005 TABLE 4 Table 4: Measurement Results of Real-Time PCR Using Reverse Primers of The Present Invention Amplification Elongation Temperature 61° C. 63° C. 65° C. Reverse Primer RASP22 RASP21 RASP20 RASP19 RASP24 RASP23 RASP22 RASP21 RASP27 RASP26 RASP25 RASP24 SMN1 23.4 23.5 26.7 0.0 23.0 23.8 24.2 25.8 23.4 23.4 23.6 24.8 1 × 10.sup.5 copy SMN1 26.8 27.0 30.4 0.0 26.3 27.2 27.8 29.2 26.8 26.8 27.0 28.1 1 × 10.sup.4 copy SMN1 30.0 30.2 34.0 0.0 29.9 30.7 31.2 32.8 30.4 30.3 30.5 31.7 1 × 10.sup.3 copy SMN1 custom-character custom-character custom-character custom-character custom-character custom-character custom-character custom-character custom-character custom-character custom-character custom-character 1 × 10.sup.2 copy SMN2 30.4 31.3 36.2 0.0 29.5 32.1 32.8 34.7 26.9 29.4 31.5 33.3 1 × 10.sup.5 copy SMN2 custom-character custom-character custom-character custom-character custom-character custom-character custom-character custom-character custom-character custom-character custom-character custom-character 1 × 10.sup.4 copy ΔCq Value※ −0.2 −1.5 −2.2 0.0 0.2 −1.3 −2.1 −2.4 3.1 0.4 −1.4 -2.4 ※SMN1 1 × 10.sup.2 copy Cq Value − SMN2 1 × 10.sup.4 copy Cq Value

[Example 3] Examination of SMN2 Cross-Amplification Reaction of SMN1 Gene Quantification System with Coexisting Punched Piece of a Dried Blood Spot in a Filter Paper

(a) Test Materials

[0101] (a-1) SMN1 Gene Amplification Primers

[0102] As the primers for the SMN1 amplification, the following primers were synthesized by Sigma-Aldrich Co. LLC and used.

[0103] SMN1-specific forward primer; SEQ ID NO: 6 in Table 1 above

[0104] SMN1 common reverse primer; SEQ ID NO: 10 in Table 1 above

(a-2) SMN1 Detection Probe

[0105] As the probe for observing the PCR amplification of SMN1, the following detection probe which was fluorescently labeled was synthesized and produced by Primetech Corporation and used.

SMN1 Detection Probe

[0106]

TABLE-US-00006 5′-(Quasar670)-GGAAGGTGCTCACATTCCTTAAATTAAGGA- (BHQ3)-3′ (the nucleotide sequence part is SEQ ID NO: 23)

(b) PCR Reagent

[0107] The composition of the PCR reagent is shown below. PCR buffer (Ampdirect Plus; Shimadzu Corporation) [0108] 0.2 μM (final concentration) SMN1-specific forward primer [0109] 0.2 μM (final concentration) SMN1 common reverse primer [0110] 0.1 μM (final concentration) SMN1 detection probe [0111] 0.025 U/μL BIOTAQ HSDNA polymerase

(c) PCR Reagents Containing Standards for Calibration Curve

[0112] A plasmid into which a partial sequence of SMN1 (SEQ ID NO: 11) was incorporated was added to the PCR reagent of (b) above, and PCR reagents containing the standards below (dilution series; STD1 to 4) were prepared. The values in the brackets are the copy numbers of the gene per one PCR reaction. The reagents were used in the solution state without adding to a dried blood spot in a filter paper. STD1 (SMN1 100,000 copy/reaction), STD2 (SMN1 10,000 copy/reaction), STD3

(SMN1 1000 copy/reaction), STD4 (SMN1 100 copy/reaction)

(d) PCR Reagent for SMN2 Cross Test

[0113] A plasmid into which a partial sequence of SMN2 (SEQ ID NO: 12) was incorporated was added to the PCR reagent of (b) above at 50,000 copy/reaction, and a PCR reagent for SMN2 cross test was thus prepared.

(e) DNA-Free Dried Blood Spot in a Filter Paper

[0114] Blood obtained by mixing a human erythrocyte fraction from which leukocytes were removed and human plasma (EDTA) at a ratio of 6:4 in a volume of 40 μL was blotted on a filter paper for blood collection (Advantec) and directly dried, and the blood obtained was used as a DNA-free dried blood spot in a filter paper. This means that the dried blood spot in a filter paper did not contain SMN1 and SMN2.

(f) Conditions for PCR Reaction

[0115] (i) 95° C.: 15 minutes [0116] (ii) 95° C.: 15 seconds, 63° C.: 60 seconds (40 cycles) [0117] (iii) 37° C.: 5 minutes

(g) Real-Time PCR Measurement

[0118] (g-1) Measurement Method

[0119] The measurement was made by the following procedures. [0120] (i) From the DNA-free dried blood spot in a filter paper, a circular punched piece with a diameter of 1.5 mm was taken using a puncher. As a control, a punched piece having the same size was taken from a filter paper for blood collection (Advantec) (empty punched piece). [0121] (ii) To PCR reaction tubes (manufactured by Roche, Inc.: LightCycler8-TubeStrips, made of polypropylene), the punched pieces were introduced. [0122] (iii) After adding 40 μL of the PCR reagent for SMN2 cross test to the PCR reaction tubes, the tubes were sealed using the caps (included as a set with the tubes). [0123] (iv) The PCR reagents containing the standards for a calibration curve in a volume of 40 μL were also dispensed to tubes (the tubes did not contain the punched pieces). [0124] (v) Using a thermal cycler (LightCycler96; Roche, Inc.), real-time PCR measurement of SMN1 and examination of the cross reaction to SMN2 were conducted.
(f-2) Measurement Results
(i) The amplification reaction curves of the PCR reagents containing the standards for a calibration curve are shown in FIG. 1.

[0125] It was observed that the amplification is excellent to SMN1 100 copy/reaction.

(ii) The parts of the amplification reaction curves of the PCR reagent for SMN2 cross test at 25 to 40 cycles are shown in FIG. 2.

[0126] Interestingly, it was observed that the rising of the amplification delayed by Cq value of around 1 (the dotted line in the figure) when the punched piece of the DNA-free dried blood spot in a filter paper coexisted, as compared to the case where the empty punched piece (the punched piece containing no blood) coexisted (the solid line in the figure). This means that, under the conditions, the cross reaction to SMN2, in terms of the copy number, decreased by about 50%. That is, it was found that, when a primer designed in a manner that the reactivity to the SMN2 gene is less than 1% of that to the SMN1 gene in the invention is applied to a case where a dried blood spot in a filter paper is used as an analyte, the reactivity to the SMN2 gene weakens. This means that it was found that, when PCR reaction is performed using the primer of the invention, the cross reaction to the SMN2 gene is reduced more in the presence of a punched piece of a dried blood spot in a filter paper in the reaction system.

[0127] Therefore, the invention leads to a reduction in the risk of overlooking a SMA patient having homozygous deletion of SMN1 (false negative) in newborn screening test.

[0128] Here, when a test was conducted in the same manner also regarding SMN1, inhibition of the amplification by a dried blood spot in a filter paper was not observed (the results are not shown in the figures). Therefore, it was found that the phenomenon of the delayed rising of the amplification due to the coexistence of a dried blood spot in a filter paper is specific to the amplification reaction of the SMN2 gene. Thus, in other words, the invention of the present application is a method for weakening the reactivity to the SMN2 gene using a specific primer in a method for detecting the SMN1 gene in a dried blood spot in a filter paper by real-time PCR.

INDUSTRIAL APPLICABILITY

[0129] According to the invention, the provision of a method for specifically detecting or quantifying the SMN1 gene in a dried blood spot in a filter paper by real-time PCR has been enabled using the specific primer of the invention. Therefore, a rapid detection/quantification system for the SMN1 gene which can be applied to newborn screening in which the symptoms tend to become severe and in which the treatment is desirably started at an early stage can be provided.