RUNX inhibitor
11235001 · 2022-02-01
Assignee
Inventors
Cpc classification
A61K45/00
HUMAN NECESSITIES
C07D403/06
CHEMISTRY; METALLURGY
C12N15/113
CHEMISTRY; METALLURGY
A61P43/00
HUMAN NECESSITIES
A61K31/5377
HUMAN NECESSITIES
A61K31/787
HUMAN NECESSITIES
A61K31/196
HUMAN NECESSITIES
A61K31/496
HUMAN NECESSITIES
A61K31/506
HUMAN NECESSITIES
C07D401/04
CHEMISTRY; METALLURGY
A61K31/7008
HUMAN NECESSITIES
International classification
A61K31/787
HUMAN NECESSITIES
A61K31/496
HUMAN NECESSITIES
C07D401/04
CHEMISTRY; METALLURGY
C07D403/06
CHEMISTRY; METALLURGY
A61P43/00
HUMAN NECESSITIES
A61K31/196
HUMAN NECESSITIES
C12N15/113
CHEMISTRY; METALLURGY
A61K31/7008
HUMAN NECESSITIES
A61K31/5377
HUMAN NECESSITIES
A61K45/00
HUMAN NECESSITIES
A61P35/00
HUMAN NECESSITIES
A61K31/506
HUMAN NECESSITIES
Abstract
Provided are a RUNX inhibitor which binds to a RUNX-binding sequence on DNA and thus inhibits the binding of a RUNX family member to the sequence; an antitumor agent comprising the RUNX inhibitor; and an antiallergic agent comprising the RUNX inhibitor.
Claims
1. A RUNX inhibitor, wherein the inhibitor binds to a RUNX binding sequence on a DNA to inhibit binding of a RUNX family member to the binding sequence and the inhibitor comprises a conjugate of an acting agent and a pyrrole-imidazole polyamide that binds to the RUNX binding sequence, wherein the pyrrole-imidazole polyamide recognizes and binds to the RUNX binding sequence of 5′-TGTGGT-3′ or 5′-TGCGGT-3′, and wherein the pyrrole-imidazole polyamide comprises polyamides containing N-methylpyrrole units (P), N-methylimidazole units (I) and a γ-aminobutyric acid moiety, wherein the P, I and the γ-aminobutyric acid moiety are linked to one another via amide bonds, wherein P is optionally replaced by 3-hydroxypyrrole (Hp) or β-alanine, and wherein a methyl group on a nitrogen atom at position 1 of P or I is optionally substituted by hydrogen or an alkyl group other than a methyl group, and wherein the conjugate of an acting agent and a pyrrole-imidazole polyamide is selected from the group consisting of compounds represented by formula I: ##STR00013## or formula II: ##STR00014## wherein, in formula I or formula II, X.sub.1 represents CH or N, X.sub.2 represents CH or N, X.sub.3 represents CH or N, X.sub.4 represents CH or N, X.sub.5 represents CH or N, X.sub.6 represents CH or N, X.sub.7 represents CH or N, X.sub.8 represents CH or N, Y represents an amide bond, a phosphodisulfide bond, an ester bond, a coordinate bond, or an ether bond, or a moiety containing a functional group that forms at least one selected from the bonds, m represents an integer of 0 to 5, R.sub.1 represents H or alkyl, R.sub.2 represents H or alkyl, R.sub.3 represents H or alkyl, R.sub.4 represents H or alkyl, R.sub.5 represents H or alkyl, R.sub.6 represents H or alkyl, R.sub.7 represents H or alkyl, R.sub.8 represents H or alkyl, wherein each alkyl is a C1-C10 linear, branched, or cyclic saturated or unsaturated alkyl group, R.sub.9 represents H or NHR.sub.11, R.sub.10 represents H or NHR.sub.11, R.sub.11 represents H, biotin, or a fluorescent group, and R represents an acting agent, and wherein in the pyrrole-imidazole polyamide, a P/I pair binds to a C⋅G base pair, a P/P pair binds to an A⋅T or T⋅A base pair, a I/P pair binds to a G⋅C base pair, a Hp/P pair binds to a T⋅A base pair, a β-alanine/β-alanine pair binds to an A⋅T or T⋅A base pair.
2. The RUNX inhibitor according to claim 1, wherein the acting agent is an alkylating agent.
3. The RUNX inhibitor according to claim 2, wherein the alkylating agent is selected from the group consisting of chlorambucil, duocarmycin, seco-CBI (1-chloromethyl-5-hydroxy-1,2-dihydro-3H-benzo[e]indole), pyrrolobenzodiazepine, and Nitrogen mustard.
4. The RUNX inhibitor according to claim 3, wherein the alkylating agent is chlorambucil.
5. The RUNX inhibitor according to claim 4, wherein the conjugate of an acting agent and a pyrrole-imidazole polyamide is selected form the group consisting of compounds represented by formulae: ##STR00015##
6. The RUNX inhibitor according to claim 1, which inhibits binding of all members of RUNX family to the RUNX binding sequence.
7. A pharmaceutical composition comprising the RUNX inhibitor according to claim 1.
8. The pharmaceutical composition according to claim 7, which is an antitumor agent.
9. The pharmaceutical composition according to claim 7, which is antiallergic agent.
10. The pharmaceutical composition according to claim 8, which is used in combination with another antitumor agent.
11. The pharmaceutical composition according to claim 8, for treatment of at least one selected from the group consisting of leukemia, lymphoma, multiple myeloma, lung cancer, esophageal cancer, gastric cancer, colon cancer, renal cell cancer, neuroblastoma, skin cancer, breast cancer, prostate cancer, and brain tumor.
12. A therapeutic method of cancer, mast cell diseases, allergy, or immunological diseases, the method comprising inhibiting binding of a RUNX family member to a RUNX binding sequence on a DNA by administering the RUNX inhibitor of claim 1 to a subject in need thereof, wherein the cancer is selected from the group consisting of leukemia, lymphoma, multiple myeloma, lung cancer, esophageal cancer, gastric cancer, colon cancer, renal cell cancer, neuroblastoma, skin cancer, breast cancer, prostate cancer, and brain tumor.
13. The therapeutic method according to claim 12, wherein the RUNX inhibitor is administered in combination with another antitumor agent.
Description
BRIEF DESCRIPTION OF DRAWINGS
(1)
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
(12)
(13)
(14)
(15)
(16)
(17)
(18)
(19)
(20)
(21)
(22)
(23)
(24)
(25)
(26)
(27)
(28)
(29)
(30)
(31)
(32)
(33)
(34)
(35)
(36)
(37)
(38)
(39)
(40)
(41)
(42)
(43)
(44)
(45)
(46)
(47)
(48)
(49)
(50)
(51)
(52)
(53)
(54)
(55)
(56)
(57)
MODE FOR CARRYING OUT THE INVENTION
(58) 1. RUNX Inhibitors
(59) The binding of the RUNX inhibitors for the present invention to RUNX-binding sequences on DNA leads to inhibition of the binding of RUNX family members to the binding sequences, thereby repressing the RUNX family members' activity.
(60) Examples of the RUNX inhibitors include, but not limited to, synthetic inhibitors containing DNA binding compounds designed to bind to a RUNX binding sequence; and the DNA binding compounds includes PI polyamides, peptide nucleic acids (PNAs), triple-stranded DNAs, TAL effector proteins, bridged nucleic acids (BNAs), locked nucleic acids (LNAs), and zinc finger and the like.
(61) The RUNX inhibitor of the present invention preferably contains a PI polyamide that binds to a RUNX binding sequence. The PI polyamide is a polyamide containing N-methylpyrrole units (P), N-methylimidazole units (I), and a γ-aminobutyric acid moiety, in which P, I, and the γ-aminobutyric acid moiety are linked to one another via amide bonds (—C(═O)—NH—) (Trauger et al, Nature, 382, 559-61(1996); White et al, Chem. Biol., 4,569-78(1997); and Dervan, Bioorg. Med. Chem., 9, 2215-35 (2001)). The PI polyamide is wholly folded in a U-shaped conformation (hairpin form) by the γ-aminobutyric acid moiety serving as a linker (γ-linker). In the U-shaped conformation, two chains containing P and I are arranged in parallel, flanking the linker. When pairs containing P and I formed between the two chains are specific combinations of P and I (P/I pair, I/P pair, or P/P pair), they can bind to specific base pairs in DNA with high affinity. For example, a P/I pair can bind to a C.G pair and an I/P pair can bind to a G⋅C pair. A P/P pair can bind to both an A⋅T pair and a T⋅A pair (White et al, Chem. Biol., 4, 569-78(1997); Dervan: Bioorg. Med. Chem., 9, 2215-35 (2001)). The PI polyamide may contain 3-hydroxypyrrole (Hp) or β-alanine in addition to P and I. An Hp/P pair can bind to a T⋅A pair (White et al., Nature, 391, 468-71 (1998)). A β-alanine/β-alanine pair can bind to a T⋅A pair and an A⋅T pair. The PI polyamide that recognizes a regulatory region of a target gene can be designed by changing the paring combinations of P and I according to the DNA sequence of the target.
(62) In the PI polyamide, a methyl group on a nitrogen atom at position 1 of P or I may be substituted by hydrogen or an alkyl group other than a methyl group. The γ-linker may be a linker having a side chain, for example, N-α-N-γ-diaminobutyric acid and N-β-N-γ-diaminobutyric acid which have an amino group, and the side chain may be modified with a molecule such as a fluorescent group or biotin. The PI polyamide may be modified at its N terminus with not only an acetyl group but also a molecule such as a fluorescent group or biotin. As used herein, examples of the fluorescent group include, but not limited to, fluorescein, rhodamine dyes, cyanine dyes, ATTO dyes, Alexa Fluor dyes, and BODIPY. The fluorescein includes fluorescein derivatives (for example, fluorescein isothiocyanate).
(63) Methods for designing and producing the PI polyamides are known (see, for example, JP-B 3045706, JP-A 2001-136974, WO03/000683, JP-A 2013-234135, and JP-A 2014-173032). For example, the PI polyamides can be produced conveniently by an automated synthesis method comprising solid-phase synthesis using Fmoc (9-fluorenylmethoxycarbony) (Fmoc solid-phase synthesis method).
(64) The PI polyamide may be a modified form of PI polyamide that is modified to maintain or improve the ability to bind to DNA. Examples of the modified form of PI polyamide include a modified form containing an amine added to position α or β of the γ-aminobutyric acid of the PI polyamide, a modified form having a substituted side chain that is N-α-N-γ-diaminobutyric acid or N-β-N-γ-diaminobutyric acid and the modified form further modified with a molecule such as a fluorescent group or biotin, a modified form containing modification with a molecule such as a fluorescent group or biotin at the N terminus of the PI polyamide, and a modified form containing modification with a molecule such as isophthalic acid at the C terminus of the PI polyamide.
(65) As used in the present invention, a PI polyamide recognizes and binds to RUNX consensus binding sequences in genome. A RUNX consensus binding sequence is known to be 5′-TGTGGT-3′ or 5′-TGCGGT-3′. Thus, the pairing combinations of P, I, and/or Hp and β-alanine in the PI polyamide as described above may be determined according to the RUNX consensus binding sequence. The PI polyamide can strongly inhibit biding of RUNX family to a RUNX binding sequence on a genome.
(66) The RUNX inhibitor of the present invention may preferably comprise a conjugate of the above-described DNA binding compound that binds to a RUNX binding sequence with an acting agent. More preferred examples of the RUNX inhibitor of the present invention comprise a conjugate of a PI polyamide that binds to a RUNX binding sequence with an acting agent. The acting agent is a substance that influences DNA and a state of chromatin surrounding the DNA. Examples of the acting agent include, but not limited to, an alkylating agent and a chromatin modifying enzyme-regulating agent. Examples of the chromatin modifying enzyme-regulating agent include, but not limited to, histone acetylase (HAT) regulating agents such as HAT inhibitors (e.g., C646) and HAT activators (e.g., N-(4-chloro-3-(trifluoromethyl)phenyl)-2-ethoxybenzamide (CTB)); histone deacetylase (HDAC) regulating agents such as HDAC inhibitors (e.g., suberoylanilide hydroxamic acid) and HDAC activators; histone methylase regulating agents; and histone demethylase regulating agents. More preferred examples of the RUNX inhibitor of the present invention comprise a conjugate of a PI polyamide that binds to a RUNX binding sequence with an alkylating agent.
(67) An alkylating agent is a compound having a functional group that forms a covalent bond with DNA. The alkylating agent used in the present invention is not particularly limited, but it is preferably an alkylating agent having low or no cytotoxicity in view of application to a pharmaceutical composition as described below. Examples of the alkylating agent include, but not limited to, chlorambucil, duocarmycin, seco-CBI (1-chloromethyl-5-hydroxy-1,2-dihydro-3H-benzo[e]indole), pyrrolobenzodiazepine, and Nitrogen mustard.
(68) A complex is synthesized by binding (hereinafter, also referred to as “conjugation”) etc. between the above-described acting agent and the above-described DNA binding compound. As used herein, the complex is also referred to as a “conjugate”. The synthesis method can be performed by a known method (see, for example, J. Am. Chem. SOC. 1995, 117, 2479-2490). When the DNA binding compound is a PI polyamide, the acting agent is bound to the N terminus, C terminus, or γlinker moiety of the PI polyamide. For example, the acting agent is bound to the N terminus or C terminus of the PI polyamide. In this context, the “binding” manner may be direct binding or binding via a linker. The linker is not particularly limited as long as the linker interferes with neither the action of the acting agent nor the recognition of a RUNX binding site. Examples of the linker include bonds themselves such as an amide bond, a phosphodisulfide bond, an ester bond, a coordinate bond, an ether bond and the like, and a molecule containing a functional group that forms at least one type of the bonds. The “molecule containing a functional group that forms at least one type of the bonds” is a molecule containing a functional group that forms at least one type of bonds selected from the group consisting of an amide bond, a phosphodisulfide bond, an ester bond, a coordinate bond, an ether bond and the like, along with the terminal portion of the PI polyamide and/or the acting agent. The “molecule containing a functional group that forms at least one type of the bonds” may be a molecule containing one or more bonds being at least one type of bonds selected from the group consisting of an amide bond, a phosphodisulfide bond, an ester bond, a coordinate bond, an ether bond and the like. Preferred examples of the linker include an amide bond, and a molecule containing a functional group that forms an amide bond.
(69) Examples of the conjugate of an acting agent and a PI polyamide in the present invention include compounds represented by formula I:
(70) ##STR00004##
or formula II:
(71) ##STR00005##
(72) wherein,
(73) X.sub.1 represents CH or N, X.sub.2 represents CH or N, X.sub.3 represents CH or N, X.sub.4 represents CH or N, X.sub.5 represents CH or N, X.sub.6 represents CH or N, X.sub.7 represents CH or N, X.sub.8 represents CH or N, wherein X.sub.1 to X.sub.8 are selected in a combination that enables the PI polyamide to recognize a RUNX consensus sequence,
(74) R.sub.1 represents H or alkyl, R.sub.2 represents H or alkyl, R.sub.3 represents H or alkyl, R.sub.4 represents H or alkyl, R.sub.5 represents H or alkyl, R.sub.6 represents H or alkyl, R.sub.7 represents H or alkyl, R.sub.8 represents H or alkyl,
(75) R.sub.9 represents H or NHR.sub.11, R.sub.10 represents H or NHR.sub.11,
(76) R.sub.11 represents H, or a molecule such as biotin or a fluorescent group,
(77) R represents an acting agent, preferably an alkylating agent, and more preferably an alkylating agent selected from the group consisting of chlorambucil, duocarmycin, seco-CBI, pyrrolobenzodiazepine, and Nitrogen mustard,
(78) Y represents a linker moiety, and
(79) m represents an integer of 0 to 5, preferably an integer of 0 to 3, more preferably 0 or 1; and modified forms of the compounds.
(80) In the above formulae I and II, Y represents, for example, a bond such as an amide bond, phosphodisulfide bond, an ester bond, a coordinate bond, an ether bond or the like, or a moiety containing a functional group that forms at least one type of the bonds. In this context, the “moiety containing a functional group that forms at least one type of the bonds” is a moiety containing a functional group that forms at least one type of bonds selected from the group consisting of an amide bond, a phosphodisulfide bond, an ester bond, a coordinate bond, an ether bond and the like, along with the terminal portion of the PI polyamide and/or the acting agent. The “moiety containing a functional group that forms at least one type of the bonds” may contain one or more bonds being at least one type of bonds selected from the group consisting of an amide bond, a phosphodisulfide bond, an ester bond, a coordinate bond, an ether bond and the like.
(81) In one embodiment, in the above formulae I and II, Y is the “moiety containing a functional group that forms at least one type of the bonds”, and an example thereof includes a structure represented by formula III:
(82) ##STR00006##
(83) wherein,
(84) A is carbonyl [—C(═O)—] or imino (—NH—),
(85) B is an ether bond (—O—), imino (—NH—) or methylimino [—N(—CH.sub.3)—],
(86) g and k represent independently an integer of 1 to 3,
(87) h and j represent independently an integer of 0 to 5, and
(88) i represents an integer of 0 to 2. For example, it is preferable that h and j represent independently an integer of 0 to 3. In the above formula III, the position of the ester bond and the position of the ether bond or imino bond represented by B may be replaced by, each other. For example, the linker moiety represented by the above formula III is linked at the rightmost position to the acting agent and at the leftmost position to the PI polyamide. However, whereas the linking positions may be reversed. For example, when the linker moiety represented by the above formula III is linked at the leftmost position to the C terminus of the PI polyamide, A is preferably imino.
(89) An Example of Y represented by formula III includes a structure represented by formula IV:
(90) ##STR00007##
(91) Another example of Y represented by formula III includes a structure represented by formula V:
(92) ##STR00008##
wherein, 1 represents an integer of 1 to 5. For example, 1 is an integer of 1 to 3, and preferably 1 is 1.
(93) Another example of Y represented by formula III includes a structure represented by formula VI:
(94) ##STR00009##
Preferably the linker moiety represented by formula VI is used when the acting agent is linked to the C-terminal side of the PI polyamide.
(95) For example, the linker moieties represented by the above formula IV to formula VI are linked at the rightmost position to the acting agent and at the leftmost position to the PI polyamide. However, the linking positions may be reversed.
(96) As used herein, examples of the alkyl group include a C.sub.1-C.sub.10 linear, branched, or cyclic saturated or unsaturated alkyl group, preferably a C.sub.1-C.sub.5 linear, branched, or cyclic saturated or unsaturated alkyl group, and for example, methyl, ethyl, n-propyl, isopropyl, n-butyl, sec-butyl, isobutyl, tert-butyl and the like are included. The alkyl group may be substituted. For example, methylene in the alkyl group may be substituted with oxygen or the like.
(97) Preferred examples of the conjugate of an acting agent and a PI polyamide in the present invention include compounds represented by the following formula:
(98) ##STR00010##
(99) wherein,
(100) R represents an acting agent, preferably an alkylating agent, and more preferably an alkylating agent selected from the group consisting of chlorambucil, duocarmycin, seco-CBI, pyrrolobenzodiazepine, and Nitrogen mustard, and
(101) n represents 0, 1, 2, 3, 4 or 5, preferably 1, 2 or 3, and more preferably n represents 1; and
(102) modified forms of the compounds.
(103) Other preferred examples of the conjugate of an alkylating agent and a PI polyamide in the present invention include conjugates of chlorambucil and a PI polyamide represented by the following formula:
(104) ##STR00011##
(105) wherein,
(106) X.sub.1 represents CH or N, X.sub.2 represents CH or N, X.sub.3 represents CH or N, X.sub.4 represents CH or N, X.sub.5 represents CH or N, X.sub.6 represents CH or N, X.sub.7 represents CH or N, X.sub.8 represents CH or N, wherein X.sub.1 to X.sub.8 are selected in a combination that enables the PI polyamide to recognize a RUNX consensus sequence,
(107) R.sub.1 represents H or alkyl, R.sub.2 represents H or alkyl, R.sub.3 represents H or alkyl, R.sub.4 represents H or alkyl, R.sub.5 represents H or alkyl, R.sub.6 represents H or alkyl, R.sub.7 represents H or alkyl, R.sub.8 represents H or alkyl,
(108) R.sub.9 represents H or NHR.sub.11, R.sub.10 represents H or NHR.sub.11,
(109) R.sub.11 represents H, or a molecule such as biotin or a fluorescent group, and
(110) n represents 0, 1, 2, 3, 4 or 5, preferably 1, 2 or 3, and more preferably n represents 1; and
(111) modified forms of the conjugates.
(112) Further, other preferred examples of the above-described conjugate in the present invention include conjugates of chlorambucil and a PI polyamide represented by the following formulae:
(113) ##STR00012##
(114) wherein, n represents 0, 1, 2, 3, 4 or 5, preferably 1, 2, or 3, and more preferably n represents 1; and
(115) modified forms of the conjugates.
(116) The conjugate of an acting agent and a DNA binding compound, e.g. a PI polyamide, may be in the form of a pharmacologically acceptable salt. Examples of the pharmacologically acceptable salt include inorganic acid salts such as hydrochloride, sulfate, phosphate and hydrobromide, and organic acid salts such as acetate, fumarate, maleate, oxalate, citrate, methanesulfonate, benzenesulfonate and toluenesulfonate.
(117) In the above-described conjugate, at least one moiety or molecule of the acting agent, the DNA binding compound, and/or the linker moiety linking the acting agent and the DNA binding compound may be present in the form of an enantiomer or diastereomer or a mixture thereof. The conjugate includes a mixture of stereoisomers, or a pure or substantially pure isomer thereof. When the conjugate is obtained in the forms of diastereomers or enantiomers, these diastereomers or enantiomers can be separated by a conventional method well known in the art, for example, chromatography or fractional crystallization.
(118) The conjugate may be labeled with a radioisotope (e.g., .sup.3H, .sup.13C, .sup.14C, .sup.15N, .sup.18F, .sup.32P, .sup.35S, .sup.125I, or the like) or the like on at least one moiety or molecule of the acting agent, the DNA binding compound, and/or the linker moiety linking the acting agent and the DNA binding compound, or may be deuterated.
(119) The RUNX inhibitor of the present invention may be the above-described DNA binding compound itself or the above-described conjugate itself of the DNA binding compound and the acting agent, or may contain a carrier or an additive in addition to the DNA binding compound or the conjugate, depending on an intended purpose. Examples of the carrier and the additive include, but not limited to, water, acetic acid, organic solvents, collagen, polyvinyl alcohol, polyvinylpyrrolidone, carboxyvinyl polymers, sodium carboxymethylcellulose, sodium polyacrylate, sodium alginate, water-soluble dextran, sodium carboxymethyl starch, pectin, methylcellulose, ethylcellulose, xanthan gum, gum arabic, casein, agar, polyethylene glycol, diglycerol, glycerol, propylene glycol, Vaseline, paraffin, stearyl alcohol, stearic acid, human serum albumin, mannitol, sorbitol, lactose, and surfactants. The amount of the DNA binding compound or the conjugate contained in the RUNX inhibitor of the present invention can be optionally adjusted depending on an intended purpose.
(120) The RUNX inhibitor of the present invention recognizes and binds to a RUNX consensus binding sequence on a genome. The RUNX consensus binding sequence is a common binding sequence among the members of RUNX family. Thus, the RUNX inhibitor of the present invention inhibits all members of RUNX family. That is, when the RUNX inhibitor of the present invention binds to a RUNX consensus binding sequence on a genome, binding of the all members of the RUNX family to the RUNX binding sequence on the genome is inhibited, which results in inhibition of all activities caused by binding of the members of RUNX family to DNA. Examples of the activity that the RUNX family is involved in include various types such as, but not limited to, activation by transcriptional regulation of p53 suppressors (e.g., BCL11 and TRIM24) (that is, in cancer, tumor suppressor p53 is constantly suppressed by RUNX family), enhancement by transcriptional regulation of BCR-ABL, which is a causative protein of Philadelphia chromosome-positive acute lymphocytic leukemia (PhALL), enhancement of transcription of MLL-AF4 in MLL-AF4+FLT3-ITD acute myeloid leukemia, and enhancement by transcriptional regulation of oncogene c-Myc.
(121) The present invention also provides a method for inhibiting activities of RUNX family which comprises using the RUNX inhibitor of the present invention. The method for inhibiting RUNX family of the present invention can inhibit not only a target gene regulated by RUNX1, RUNX2 or RUNX3 but also a gene cluster (a group of target genes) regulated by all members of the RUNX family collectively.
(122) The amount of the RUNX inhibitor of the present invention used can be appropriately determined according to the intended purpose.
(123) 2. Pharmaceutical Composition
(124) The pharmaceutical composition of the present invention is a composition comprising the RUNX inhibitor of the present invention. The pharmaceutical composition of the present invention preferably comprises a RUNX inhibitor comprising a PI polyamide or a conjugate of a PI polyamide with an acting agent. As described above, the RUNX inhibitor of the present invention recognizes and binds to a RUNX consensus binding sequence on a genome. The RUNX consensus sequence (RUNX family protein-binding sequence) is present in regulatory regions of various genes. The RUNX family members regulate the expression of various target genes by binding to the consensus sequence in the regulatory regions. The pharmaceutical composition of the present invention down-regulates the expression of various genes which are targeted by each RUNX family member, by binding to the RUNX consensus sequence. Examples of the target gene include, but not limited to, genes which are highly expressed in CBF leukemia (e.g., IL3, CSF2, CSF2RB, etc.), RUNX family itself (RUNX1, RUNX2, and RUNX3), p53 suppressors (e.g., BCL11, TRIM24, etc.), and c-kit genes.
(125) Various diseases can be treated and prevented by administering the pharmaceutical composition of the present invention in vivo. The pharmaceutical composition of the present invention can be used for every organism, which utilizes double-stranded DNA in biocontrol, particularly mammals (e.g., human, rat, rabbit, sheep, pig, cattle, cat, dog, monkey, etc.).
(126) Target diseases of the pharmaceutical composition of the present invention include all diseases which RUNX family members are involved in. An example of the target diseases of the pharmaceutical composition of the present invention includes cancer, and examples thereof include, but not limited to, leukemia (e.g., acute myeloid leukemia, acute lymphoblastic leukemia, and chronic myeloid leukemia), myelodysplastic syndrome-derived leukemia, lymphoma, myeloma, multiple myeloma, lung cancer, esophageal cancer, gastric cancer, colon cancer, renal cell cancer, neuroblastoma, breast cancer, skin cancer (e.g., melanoma), ovarian cancer, hepatoblastoma, osteosarcoma, Ewing's sarcoma, prostate cancer, pancreatic cancer, liver cancer, hepatoblastoma, osteosarcoma, rhabdomyosarcoma, ovarian cancer, uterine cancer, and brain tumor. As shown in Examples described later, since the RUNX inhibitor of the present invention activates a p53 pathway by regulating transcription of a p53 suppressor, the pharmaceutical composition of the present invention can theoretically suppress, treat, or prevent all cancers. Although the pharmaceutical composition of the present invention may not exert a sufficient antitumor effect on cancer having a p53 mutation when it is used alone, a synergistic anti-tumor effect on cancer having a p53 mutation is exerted when the pharmaceutical composition of the present invention is used in combination with a p53 inducer. Examples of the p53 inducer include 2,2-bis(hydroxymethyl)-1-azabicyclo[2.2.2]octan-3-one (PRIMA-1), 1-[(1-oxopropoxy)methyl]-1H-pyrrole-2,5-dione (MIRA-1), and Nutlin3.
(127) The pharmaceutical composition of the present invention can be used as, for example, an anti-tumor agent or a differentiation inducer.
(128) Further examples of the target diseases of the pharmaceutical composition of the present invention include mast cell diseases such as mast cell tumor and mastocytosis (e.g., mast cell proliferation disease, severe allergic disease, atopic dermatitis, anaphylactic shock, severe bronchia asthmatic attack, and severe dermatitis medicamentosa), various types of allergy, and immunological diseases. Mast cells are defined as cells expressing both FceRI, which is a receptor specific to an IgE antibody that is deeply involved in allergy, and c-kit, which is a receptor of a cytokine called a stem cell factor (SCF), on the cell surface. It is known that when mast cells are stimulated mechanically or chemically or come into contact with an allergen such as a heterologous protein, the mast cells degranulate and thereby release contents stored in the granules (e.g., histamine, heparin, etc.) into the extracellular environment, which causes an allergic reaction. As shown in Examples described later, since the RUNX inhibitor of the present invention inhibits the expression of c-kit (stem cell factor receptor tyrosine kinase) in mast cells, the pharmaceutical composition of the present invention can suppress, treat, or prevent all symptoms or diseases caused by activation of mast cells.
(129) The pharmaceutical composition of the present invention may be in any of dosage forms for oral administration and parenteral administration. These dosage forms can be formulated according to a routine method and may contain a pharmaceutically acceptable carrier or additive. Examples of such a carrier and an additive include water, acetic acid, pharmaceutically acceptable organic solvents, collagen, polyvinyl alcohol, polyvinylpyrrolidone, carboxyvinyl polymers, sodium carboxymethylcellulose, sodium polyacrylate, sodium alginate, water-soluble dextran, sodium carboxymethyl starch, pectin, methylcellulose, ethylcellulose, xanthan gum, gum arabic, casein, agar, polyethylene glycol, diglycerol, glycerol, propylene glycol, Vaseline, paraffin, stearyl alcohol, stearic acid, human serum albumin, mannitol, sorbitol, lactose, and surfactants acceptable as pharmaceutical additives.
(130) The additive is selected alone or in appropriate combination from those described above depending on the dosage form of the pharmaceutical composition of the present invention. Examples of the dosage form for oral administration include tablets, capsules, fine granules, powders, granules, solutions, syrups, sprays, liniments, eye drops, and preparations for external use. Alternatively, the oral administration may be performed in an appropriate dosage form. Examples of the dosage form for parenteral administration include injections. The injections can be administered systemically or locally by, for example, intravenous injection (e.g., drip infusion), subcutaneous injection, intraperitoneal injection, or intratumoral injection.
(131) For example, for use as a preparation for injection, the pharmaceutical composition of the present invention is dissolved in a solvent (e.g., saline, a buffer solution, a glucose solution, 0.1% acetic acid, etc.), and this solution can be supplemented with an appropriate additive (human serum albumin, PEG, a mannose-modified dendrimer, a cyclodextrin conjugate, etc.) and used. Alternatively, the pharmaceutical composition of the present invention may be freeze-dried for a dosage form that is dissolved before use. For example, a sugar alcohol or a saccharide, such as mannitol or glucose, can be used as an excipient for freeze drying.
(132) A dose of the pharmaceutical composition of the present invention differs depending on age, sex, symptoms, administration route, the number of administrations, and the dosage form. The dose, for example, for an adult human (60 kg) is 0.01 to 1,000 mg, preferably 0.1 to 100 mg, more preferably 1 to 30 mg, per day. The administration method is appropriately selected depending on the age and symptoms of a patient. The pharmaceutical composition of the present invention may be administered, for example, once every few days, once a day, or two to four times per day.
(133) The pharmaceutical composition of the present invention may be used in combination with other anti-tumor agents. Examples of the other anti-tumor agents include any anti-tumor agent used for the treatment of a specific cancer, and a p53 inducer. Any known anti-tumor agent can be used as the other anti-tumor agents. Examples of known anti-tumor agent include cytarabine, imatinib, gefitinib, PRIMA-1, MIRA-1, and Nutlin3. An administration ratio of the pharmaceutical composition of the present invention to the other anti-tumor agents is not particularly limited, and may be appropriately determined by a person skilled in the art so that a desired antitumor effect can be achieved.
(134) The present inventors have made RUNX1 knockdown mice using shRNA to investigate the roles of other RUNX family members when only RUNX1 is inhibited. As a result, it has been found that when RUNX1 is inhibited, the activity is compensated by those of other RUNX family members. Thus, the RUNX inhibitor and pharmaceutical composition of the present invention which can inhibit all RUNX family members can exert a stronger antitumor effect than when the expression of each RUNX member is individually reduced.
(135) The present invention also provides a kit comprising the RUNX inhibitor of the present invention. The kit may contain, in addition to the RUNX inhibitor of the present invention, a pharmaceutically acceptable carrier or additive, reagents, auxiliary agents, a dedicated container, other necessary accessories, an instruction manual, etc. The kit of the present invention may be used, for example, as a kit for cancer therapy or a research reagent kit.
(136) The present invention also provides use of CBFβ as a cancer marker. The present inventors have found that CBF is expressed in various cancers and the expression level correlates with the expression of RUNX family (Example 3). Thus, CBFβ can be used as a pan-cancer marker which can be used for detecting various cancers, and the presence of a cancer can be determined by detecting CBFβ in a sample from a subject.
(137) Hereinafter, the present invention is further specifically explained by way of Examples which the present invention is not limited to.
EXAMPLES
(138) Materials and methods used in Examples are described below.
(139) Materials and Methods
(140) Cell Lines
(141) AML cell lines of THP-1 and KG-1a, a CML cell line of K562, a lung cancer cell line of A549, and esophageal cancer cell lines of TE-1, TE-5 and TE-11 were purchased from RIKEN biological resource center (BRC), Japan. AML cell lines of Kasumi-1 and HL60, lung cancer cell lines of LU99A, ABC-1 and RERF-LC-MS, gastric cancer cell lines of MKN7 and MKN45, melanoma cell lines of C32TG and Mewo, a kidney cancer cell line of Caki-1, colon cancer cell lines of HCT116 and LOVO, and an embryonic kidney cell line of HEK293T cell were obtained from Japanese Collection of Research Bioresources (JCRB), Japan. AML cell lines of OCI-AML2, OCI-AML3 and MOLM13 were purchased from Deutsche Sammlung von Mikroorganismen and Zellkulturen GmbH (DSMZ), Germany. AML cell lines of MV4-11 and KG-1a, an ALL cell line of RS4; 11, lymphoma cell lines of SU-DHL-5, Raji and Dauji, a myeloma cell line of KMS-12-BM, a lung cancer cell line of NCI-H2228, and breast cancer cell lines of DU4475, MCF7, HCC1937, MDA-MB-231 and HTB-27 were obtained from American Type Culture Collection (ATCC), USA. ALL cell lines of SU-Ph2 and SU/SR cells were provided by Dr. A Kanamaru (Department of Internal Medicine, Kinki University School of Medicine, Osaka, Japan). An ALL cell line of KOCL-45 was provided by Dr. K. Sugita (Department of Pediatrics, Yamanashi University, Yamanashi, Japan). An AML cell line of MV4-11NR cells harboring a TP53 R248W mutation was provided by Dr T. Ikezoe (Department of Hematology and Respiratory Medicine, Kochi University, Kochi, Japan). Caki-1 and HEK293T cells were maintained in Dulbecco's modified eagle medium (DMEM) supplemented with 10% heat-inactivated fetal bovine serum (FBS) and 1% Penicillin-Streptomycin (PS) at 37° C., 5% CO.sub.2. The other cell lines were cultured in a Roswell Park Memorial Institute (RPMI) 1640 medium containing 10% FBS and 1% PS at 37° C., 5% CO.sub.2.
(142) Cell Growth Curve
(143) To assess cell proliferation, 1×10.sup.5 cells of AML cell lines were transferred to a 6-well plate with 5 mL medium. For the expression of a tetracycline inducible gene or shRNA, doxycycline was added at 3 μM. The trypan blue exclusion assay was performed every other day to count cell number.
(144) Real-time quantitative PCR (qRT-PCR)
(145) A total RNA was isolated with RNeasy mini kit (Qiagen) and reverse transcribed with Reverse script kit (TOYOBO) to generate cDNA. Real-time quantitative polymerase chain reaction (PCR) was carried out with 7500 Real-Time PCR System (Applied Biosystems) according to the manufacturer's instructions. Results were normalized to GAPDH levels. Relative expression levels were calculated using the 2-ΔΔCt method. Primers used for qRT-PCR are shown in Table 1.
(146) TABLE-US-00001 TABLE 1 PCR primers used for qRT-PCR Gene to be amplified Forward (5′ .fwdarw. 3′) Reverse (5′ .fwdarw. 3′) GAPDH CATGTTCGTCATGGGGTGAACCA AGTGATGGCATGGACTGTGGTCA (SEQ ID NO: 1) T (SEQ ID NO: 2) BCL11A AACCCCAGCACTTAAGCAAA GGAGGTCATGATCCCCTTCT (SEQ ID NO: 3) (SEQ ID NO: 4) TRIM24 GCGCCTACTTTTATTTCTTTACT AATGCTTTTGAGGCGTTTCTT G (SEQ ID NO: 5) (SEQ ID NO: 6) IL3 AATCTCCTGCCATGTCTGCC AGATCGCGAGGCTCAAAGTC (SEQ ID NO: 7) (SEQ ID NO: 8) CSF2RB AGCCCAGATGCAGGGGA (SEQ CCCAGGATGTCAGGTAGGGA ID NO: 9) (SEQ ID NO: 10) p53 CCCCTCCTGGCCCCTGTCATCTT GCAGCGCCTCACAACCTCCGTCA C (SEQ ID NO: 11) T (SEQ ID NO: 12) CSF2 GGCCAGCCACTACAAGCAGCACT CAAAGGGGATGACAAGCAGAAAG (SEQ ID NO: 13) (SEQ ID NO: 14) p21 TGTGGACCTGTCACTGTCTTG AATCTGTCATGCTGGTCTGC (SEQ ID NO: 15) (SEQ ID NO: 16) BAX CATGTTTTCTGACGGCAACTTC AGGGCCTTGAGCACCAGTTT (SEQ ID NO: 17) (SEQ ID NO: 18) PUMA GCAGGCACCTAATTGGGCT ATCATGGGACTCCTGCCCTTA (SEQ ID NO: 19) (SEQ ID NO: 20) MDM2 ACCTCACAGATTCCAGCTTCG TTTCATAGTATAAGTGTCTTTTT (SEQ ID NO: 21) (SEQ ID NO: 22) RUNX1 CTGCTCCGTGCTGCCTAC (SEQ AGCCATCACAGTGACCAGAGT ID NO: 23) (SEQ ID NO: 24) RUNX2 GGTTAATCTCCGCAGGTCACT CACTGTGCTGAAGAGGCTGTT (SEQ ID NO: 25) (SEQ ID NO: 26) RUNX3 CAGAAGCTGGAGGACCAGAC GTCGGAGAATGGGTTCAGTT (SEQ ID NO: 27) (SEQ ID NO: 28) Pan_RUNX GCACCGACAGCCCCAACTT GTCTTGTTGCAGCGCCAGTG (RUNX1 + (SEQ ID NO: 29) (SEQ ID NO: 30) RUNX2 + RUNX3) CBFB TGTGAGATTAAGTACACGG TAATGCATCCTCCTGCTGGGCT (SEQ ID NO: 31) (SEQ ID NO: 32)
Immunoblotting
(147) Cells were washed twice with ice cold phosphate-buffered saline (PBS) and harvested in protein lysis buffer [50 mM Tris (pH 7.4), 100 mM NaCl, 0.1 mM EDTA, 1 mM phenylmethylsulfonyl fluoride, 1 mM β-glycerophosphate, 2.5 mM sodium pyrophosphate, 1 mM Na.sub.3VO.sub.4, lx protease inhibitor (Roche) and PhosSTOP (Roche)]. Whole cell extracts were separated by SDS-polyacrylamide gel electrophoresis (SDS-PAGE) and electrotransferred onto polyvinylidene difluoride membranes. Membranes were probed with the following antibodies: anti-Ctip1 antibody (Abcam, ab19487), anti-TRIM24 antibody (Bethyl Laboratories, Inc), anti-RUNX1 antibody (A-2), anti-GAPDH (FL-335), anti-p21 (C-19), anti-Bax (N-20) antibodies (Santa Cruz Biotechnology, Inc.), anti-RUNX2, anti-RUNX3, anti-p53 antibodies (Cell Signaling Technology), anti-CBFβ antibody (FL-182, Santa Cruz Biotechnology, Inc.), anti-cleaved caspase-3 antibody (5A1E, Cell Signaling Technology), anti-PARP antibody (46D11, Cell Signaling Technology). For secondary antibodies, anti-rabbit IgG, or anti-mosue IgG HRP-linked antibodies (Cell Signaling Technology) were used. Blots were detected using Chemi-Lumi One Super (nacalai tesque, Inc.) and ChemiDoc™ XRS+ Imager (Bio-Rad Laboratories, Inc.), as recommended by the manufacturers. Protein levels were quantified with Image Lab Software (Bio-Rad Laboratories, Inc.).
(148) Analysis of Gene Expression Microarray
(149) MV4-11 cells were treated with 1 μM of Chb-M′, Chb-50 or DMSO for 6 hours before total RNA isolation. MV4-11 cells transduced with control shRNA (sh_Luc.) or shRNAs targeting RUNX1 (sh_Rx1 #1 and #2), RUNX2 (sh_Rx2) and RUNX3 (sh_Rx3) (see “siRNA interference” described later) were incubated with 3 μM doxycycline for 24 hours. Then total RNA was isolated from the cells. RNA extraction was conducted using RNeasy MINI Kit (Qiagen, Calif., USA) according to the manufacturer's instructions. The quality of the RNA samples was examined using the Agilent 2100 Bioanalyzer (Agilent Technologies, USA). The mRNA from total RNA samples was amplified into dsDNA. Cyanine 3-labeled cRNA was generated in the presence of T7 polymerase, purified using RNeasy Mini kits and its concentration was measured using Nanodrop ND1000 v3.5.2 (Thermo Scientific). The resultant cRNA (825 ng) was fragmented and subsequently hybridized to Human Gene 2.1 ST Array Strip (Affymetrix, USA). The raw data together with the associated sample information were processed by GeneSpring GX v12.1.0 (Agilent Technologies, USA). The microarray data have been deposited in NCBI's Gene Expression Omnibus and are accessible through GEO Series accession numbers. Gene Set Enrichment Analysis (GSEA) was utilized to analyze the microarray data obtained in the present study (Subramanian, A. et al. Gene set enrichment analysis: a knowledge-based approach for interpreting genome-wide expression profiles. Proc Natl Acad Sci USA 102, 15545-15550, doi:10.1073/pnas.0506580102 (2005)). Gene ontology enrichment analysis was conducted by Database for Annotation, Visualization and Integrated Discovery (DAVID) Bioinformatics Resources 6.7 software according to the provider's instructions (see Huang da, W., Sherman, B. T. & Lempicki, R. A. Systematic and integrative analysis of large gene lists using DAVID bioinformatics resources. Nat Protoc 4, 44-57, doi:10.1038/nprot.2008.211 (2009), and Huang da, W., Sherman, B. T. & Lempicki, R. A. Bioinformatics enrichment tools: paths toward the comprehensive functional analysis of large gene lists. Nucleic Acids Res 37, 1-13, doi:10.1093/nar/gkn923 (2009)).
(150) siRNA Interference
(151) Specific shRNAs (tetracycline-inducible short hairpin RNAs) targeting human RUNX1, RUNX2 and RUNX3 were designed and cloned into pENTR4-HltetOxl, CS-RfA-ETBsd, CS-RfA-ETV, CS-RfA-ETR vectors (RIKEN BioResource Ceneter). Nontargeting control shRNA was designed against luciferase (sh_Luc.). The target sequences are provided in Table 2.
(152) TABLE-US-00002 TABLE 2 Target sequences for shRNA knockdown experiments 5′ .fwdarw. 3′ sh_RUNX1 #1 AGCTTCACTCTGACCATCA (SEQ ID NO: 33) sh_RUNX1 #2 AACCTCGAAGACATCGGCA (SEQ ID NO: 34) sh_RUNX2 AAGGTTCAACGATCTGAGATTT (SEQ ID NO: 35) sh_RUNX3 AAGCAGCTATGAATCCATTGT (SEQ ID NO: 36) sh_Luc. CGTACGCGGAATACTTCGA (SEQ ID NO: 37)
Statistics
(153) Statistical significance of differences between groups was assessed with a 2-tailed unpaired Student's t test. Equality of variances in two populations was calculated with an F-test. Differences were considered statistically significant at a P value of less than 0.05. The results were represented as the average±SEM values obtained from three independent experiments. In transplantation experiments, animals were randomly allocated to each experimental group, and the treatments were given with blinding. The overall survival of mice is shown in a Kaplan-Meier curve. Survival between the indicated groups was compared using the log-rank test. To analyze the overall survival of cancer patients, PrognoScan software was utilized for data extraction and calculation of minimal P value (see Mizuno, H., Kitada, K., Nakai, K. & Sarai, A., BMC Med Genomics 2, 18, doi:10.1186/1755-8794-2-18 (2009)). For the measurement of correlation between mRNA or protein expressions, the Spearman's rank correlation coefficient was used.
(154) Mice
(155) NOD/Shi-scid,IL-2RγKO (NOG) mice were purchased from the Central Institute for Experimental Animals, Japan. Littermates were used as controls in all experiments.
Example 1: Synthesis of PI Polyamides and Conjugates
(156) PI polyamides that specifically recognize the RUNX consensus binding sequences 5′-TGTGGT-3′ and 5′-TGCGGT-3′ were designed and synthesized by successively linking four kinds of pyrrole-imidazole pairs (
(157) General
(158) Reagents and solvents were purchased from standard suppliers and used without further purification. Flash column purifications were performed by a CombiFlash Rf (Teledyne Isco, Inc.) with C18 RediSep Rf Flash Column. Electrospray ionization time-of-flight mass spectrometry (ESI-TOF MS) was performed on a Bio-TOF II (Bruker Daltonics) mass spectrometer using positive ionization mode. Machine-assisted polyamide syntheses were performed on a PSSM-8 (Shimadzu) system with computer-assisted operation. Proton nuclear magnetic resonance (.sup.1H NMR) spectra were recorded with a JEOL JNM ECA-600 spectrometer operating at 600 MHz and in parts per million (ppm) downfield relative to tetramethylsilane used as an internal standard. The following abbreviations apply to spin multiplicity: s (singlet), d (doublet), t (triplet), q (quartet), quint (quintet), m (multiplet).
(159) Synthesis of Chb-M′
(160) A PI polyamide supported by oxime resin was prepared in a stepwise reaction by Fmoc solid-phase protocol. The product with oxime resin was cleaved with N,N-dimethyl-1,3-propane diamine (1.0 mL) at 45° C. for 3 hours. The resin was removed by filtration. The residue was dissolved in the minimum amount of dichloromethane and washed with diethyl ether to yield a 59.6 mg. To the crude compound (59.6 mg, 48.1 μmol), a solution of chlorambucil (32.6 mg, 107 μmol), PyBOP (benzotriazole-1-yl-oxy-tris-pyrrolidino-phosphonium hexafluorophosphate) (101 mg, 195 μmol), and N,N-diisopropylethylamine (100 μL, 581 μmol) in N,N-dimethylformamide (DMF) (300 μL) was added. The reaction mixture was incubated for 1.5 hours at room temperature, washed with diethyl ether and DMF for three times, and dried in vacuo. The crude product was purified by reversed-phase flash column chromatography (water with 0.1% trifluoroacetic acid/MeCN). After lyophilization, a product was obtained (30.2 mg, 19.8 μmol). The alkylating agent chlorambucil conferred stronger and irreversible DNA binding ability to the PI polyamide.
(161) The other conjugates were prepared by the same procedure.
(162) Chb-M′
(163) .sup.1H NMR (600 MHz, DMSO (dimethyl sulfoxide)-d6): δ=10.43 (s, 1H), 10.30 (s, 1H), 9.92 (s, 1H), 9.90 (s, 1H), 9.894 (s, 1H), 9.890 (s, 1H), 9.83 (s, 1H), 9.44 (s, 1H), 8.30 (t, J=6.2 Hz, 1H), 8.15 (t, J=6.2 Hz, 1H), 7.86 (t, J=5.9 Hz, 1H), 7.63 (s, 1H), 7.52 (s, 1H), 7.44 (s, 1H), 7.39 (d, J=2.0 Hz, 1H), 7.22 (d, J=1.4 Hz, 2H), 7.18 (d, J=1.3 Hz, 1H), 7.17 (d, J=1.3 Hz, 1H), 7.15 (d, J=1.3 Hz, 1H), 7.073 (d, J=2.1 Hz, 1H), 7.066 (d, J=2.0 Hz, 1H), 6.98 (d, J=8.9 Hz, 2H), 6.95 (d, J=2.0 Hz, 1H), 6.88 (d, J=1.4 Hz, 1H), 6.62 (d, J=8.9 Hz, 2H), 4.01 (s, 3H), 3.96 (s, 3H), 3.94 (s, 3H), 3.87 (s, 3H), 3.84 (s, 6H), 3.83 (s, 3H), 3.81 (s, 3H), 3.67 (m, 8H), 3.32-3.23 (m, 6H), 3.07 (m, 2H), 2.79 (d, J=4.8 Hz, 6H), 2.52 (m, 2H), 2.40 (apparent t, J=7.6 Hz, 2H), 2.28 (apparent t, J=7.2 Hz, 2H), 2.04 (apparent t, J=7.4 Hz, 2H), 1.82 (m, 4H), 1.70 (m, 2H). ESI-TOF-MS m/z calcd for C.sub.71H.sub.90Cl.sub.2N.sub.24O.sub.11.sup.2+ [M+2H].sup.2+ 762.3293, 763.3279, found 762.3277, 763.3244.
(164) Chb-50
(165) .sup.1H NMR (600 MHz, DMSO-d6): δ=10.38 (s, 1H), 10.29 (s, 1H), 10.22 (s, 1H), 9.99 (s, 1H), 9.920 (s, 1H), 9.916 (s, 1H), 9.86 (s, 1H), 9.42 (s, 1H), 8.48 (t, J=6.2 Hz, 1H), 8.06 (t, J=5.5 Hz, 1H), 7.87 (t, J=5.8 Hz, 1H), 7.63 (s, 1H), 7.545 (s, 1H), 7.538 (s, 1H), 7.46 (s, 1H), 7.37 (s, 1H), 7.32 (s, 1H), 7.21 (s, 1H), 7.19 (s, 1H), 7.17 (s, 1H), 7.08 (s, 1H), 6.99 (d, J=7.6 Hz, 2H), 6.98 (s, 1H), 6.89 (s, 1H), 6.63 (d, J=8.2 Hz, 2H), 4.01 (s, 3H), 3.98 (s, 3H), 3.97 (s, 3H), 3.96 (s, 3H), 3.87 (s, 3H), 3.86 (s, 3H), 3.82 (s, 3H), 3.81 (s, 3H), 3.68 (m, 8H), 3.30 (apparent quint, J=6.2 Hz, 4H), 3.21 (apparent q, J=6.2 Hz, 2H), 3.07 (m, 2H), 2.78 (d, J=4.8 Hz, 6H), 2.43-2.34 (m, 6H), 2.05 (t, J=7.6 Hz, 2H), 1.86 (quint, J=7.6 Hz, 2H), 1.80 (quint, J=7.6 Hz, 2H), 1.71 (quint, J=7.6 Hz, 2H). ESI-TOF-MS m/z calcd for C.sub.70H.sub.89Cl.sub.2N.sub.25O.sub.11.sup.2+[M+2H].sup.2+ 762.8270, 763.8255, found 762.8247, 763.8251.
(166) Chb-S
(167) .sup.1H NMR (600 MHz, DMSO-d6): δ=10.34 (s, 2H), 10.33 (s, 1H), 10.32 (s, 1H), 9.93 (s, 2H), 9.33 (s, 1H), 9.31 (s, 1H), 8.15 (t, J=5.5 Hz, 1H), 8.04 (t, J=5.2 Hz, 1H), 7.89 (t, J=5.5 Hz, 1H), 7.58 (s, 2H), 7.55 (s, 1H), 7.52 (s, 1H), 7.26 (s, 2H), 7.17 (s, 4H), 6.97 (d, J=7.6 Hz, 2H), 6.95 (s, 1H), 6.91 (s, 1H), 6.61 (d, J=7.6 Hz, 2H), 4.01 (s, 6H), 3.99 (s, 3H), 3.98 (s, 3H), 3.85 (s, 6H), 3.813 (s, 3H), 3.807 (s, 3H), 3.66 (m, 8H), 3.32 (q, J=6.2 Hz, 2H), 3.23 (m, 4H), 3.06 (m, 2H), 2.79 (d, J=3.4 Hz, 6H), 2.52 (m, 2H), 2.38 (m, 4H), 2.04 (t, J=7.5 Hz, 2H), 1.82 (m, 4H), 1.70 (m, 2H).
(168) ESI-TOF-MS m/z calcd for C.sub.70H.sub.89Cl.sub.2N.sub.25O.sub.11.sup.2+ [M+2H].sup.2+ 762.8270, 763.8255, found 762.8247, 763.8230.
Example 2: Cluster Regulation of RUNX Family with PI Polyamide Conjugate
(169) (1) Inhibition of Expression of RUNX1 Target Gene
(170) Inhibition of expressions of RUNX1 target genes were confirmed at mRNA levels using PI polyamides conjugated with an alkylating agent chlorambucil (Chb-M′ and Chb-50) by the Real-time quantitative PCR (qRT-PCR) method. Briefly, MV4-11 cells were treated with 5 μM Chb-M′ or Chb-50 for 6 hours. A total RNA was extracted from the treated cells, and then subjected to qRT-PCR (see the above-described “Real-time quantitative PCR (qRT-PCR)”) to quantify the expression levels of IL3, CSF2 and CSF2RB which were target genes of RUNX1. As a control, the cells treated with DMSO were used. Values obtained from the cells treated with each PI polyamide conjugate were normalized to that of the DMSO treated cells (n=3).
(171) Results are shown in
(172) (2) Inhibition of Expression of BCL11A and TRIM24
(173) Inhibition of expression of the following genes were demonstrated at mRNA levels in the same manner as described in above (1) except that 1 μM Chb-M′ and Chb-50 were used: BCL11A and TRIM24 known as suppressors of p53, both of which were reported to degrade p53 protein either directly or indirectly; and p21, BAX, PUMA and MDM2 which are downstream target genes of p53. Results are shown in
(174) Further, inhibition of expressions of BCL11A, TRIM24, p21, BAX, PUMA and MDM2, and PARP and a cleaved form of PARP, and cleaved caspase-3 were demonstrated at protein levels by the Western blotting method (see the above-described “Immunoblotting”). Briefly, MV4-11 cells were treated with 1 μM Chb-M′ or Chb-50 for 24 hours. The treated cells were dissolved in the protein lysis buffer. Whole cell extracts were resolved by SDS-polyacrylamide gel electrophoresis (SDS-PAGE) and transferred onto polyvinylidene difluoride membranes. The membranes were probed with each antibody. Blots were detected and quantified. As a control, the cells treated with DMSO were used. Results are shown in
(175) The results show that the gene expressions of p53 suppressors BCL11A and TRIM24 were down-regulated by treatment with Chb-M′ and Chb-50 (
(176) (3) Analysis of Gene Expression Pattern by Regulation of RUNX Family
(177) Gene expression patterns were demonstrated at genome levels using PI polyamides conjugated with an alkylating agent chlorambucil (Chb-M′ and Chb-50) by microarray analysis (see the above-described “Analysis of gene expression microarray”). Briefly, MV4-11 cells were treated with 1 μM Chb-M′ or Chb-50 for 6 hours. Top 500 up-regulated genes and top 500 down-regulated genes in the cells were compared with transcripts in MV4-11 cells in which RUNX family was knockdown. As a result, the gene expression patterns in the cells treated with Chb-M′ and Chb-50 significantly correlated to those in cells in which all members of RUNX family (RUNX1, RUNX2 and RUNX3) were knockdown.
(178) (4) Growth Inhibition Assay of Cancer Cells
(179) Growth inhibition of some AML cell lines expressing functional p53 (MV4-11, OCI-AML2, OCI-AML3 and MOLM-13) by PI polyamide conjugates at different concentrations was tested. Briefly, the cells were placed at a density of 1×10.sup.5 cells/mL. Different concentrations of a PI polyamide conjugate (Chb-M′ or Chb-50) were added to media, and the cells were incubated for 48 hours (n=3). The number of viable cells when the PI polyamide conjugate was not added was used as a control (DMSO control). Cell viability was assessed by counting the viable cells with Cell Count Reagent SF (Nacalai tesque, Inc.) and Infinite (registered trademark) 200 PRO multimode reader (TECAN) according to the manufacturer's instructions. Dose-response curves thus obtained are shown in
(180) (5) Inhibition Effects on Various Cancer Cells
(181) The effects of Chb-M′ and Chb-50 on cancer cells of diverse origins were investigated. Specifically, 50% inhibition concentrations (IC.sub.50) of Chb-M′ and Chb-50 were calculated in the following cancer cells expressing functional p53: AML cells (MV4-11, OCI-AML2, OCI-AML3, MOLM13), ALL cells (SU-Ph2, SU/SR, RS4-11), lymphoma cells (SU-DHL-5), myeloma cells (KMS-12-BM), lung cancer cells (A549, LU99A, NCI-H2228), gastric cancer cells (MKN45), esophageal cancer cells (TE1), breast cancer cells (HTB-27, DU4475, MCF7), melanoma (C32TG), kidney cancer cells (Caki-1), and colon cancer cells (HCT116, LOVO). Briefly, the cells were cultured to a density of 1×10.sup.5 cells/mL. Different concentrations of Chb-M′ or Chb-50 were added to media and the cells were incubated for 48 hours (n=3). Cell viability was assessed by counting the viable cells with Cell Count Reagent SF (nacalai tesque, Inc.) and Infinite (registered trademark) 200 PRO multimode reader (TECAN) according to the manufacturer's instructions. Doses that inhibited 50% proliferation (IC.sub.50 were analyzed by the median-effect method (Chou, T. C. & Talalay, P. Quantitative analysis of dose-effect relationships: the combined effects of multiple drugs or enzyme inhibitors. Adv Enzyme Regul 22, 27-55 (1984)). Further, the same test was performed using various cancer cells harboring mutated p53 or no p53 (hereinafter, collectively referred to as “p53-mutated cancer cells”). As the p53-mutated cancer cells, AML cells (MV4-11NR, HL60, ME1, KG1a, THP1, Kasumi-1, NB4, K562), ALL cells (KOCL-45), lymphoma cells (Raji, Dauji), lung cancer cells (ABC-1), gastric cancer cells (MKN7), melanoma cells (Mewo), breast cancer cells (HCC1937, MDA-MB-231), and esophageal cancer cells (TE5, TE11) were used.
(182) Results are shown in
(183) (5) Effect of Concomitant Use with p53 Inducer
(184) These PI polyamide conjugates were found to have their reduced potency in many of the tested p53-mutated cancer cells as compared with the cancer cells expressing functional p53 (
(185) TABLE-US-00003 TABLE 3 IC50 (μM) of Chb-M′ in IC50 (μM) of IC50 (μM) of concomitant PRIMA-1 Chb-M′ use with Status single agent single agent PRIMA-1 Cell of p53 administration administration (5 μM) KG1a p53null >100 >100 >100 HL60 p53null 5.74 11.4 11.7 Kasumi-1 p53mut 7.03 >100 0.359 (+) THP-1 p53mut 6.00 >100 0.5 (+) MV4-11NR p53mut 5.50 >100 0.00103 (+)
(186) In KG1a and HL60, the IC.sub.50 values of Chb-M′ were unchanged by concomitant use of PRIMA-1, and no effect of the concomitant use was found. In Kasumi-1, THP-1 and MV4-11NR, the necessary amount of Chb-M′ was dramatically reduced by concomitant use of PRIMA-1.
(187) Next, to quantify the effect of concomitant use of Chb-M′ and PRIMA-1, combination index (CI) theorem of Chou-Talalay was calculated using COMPUSYN software (Chou, T. C. Theoretical basis, experimental design, and computerized simulation of synergism and antagonism in drug combination studies. Pharmacol Rev 58, 621-681, doi:10.1124/pr.58.3.10 (2006)). CI value<1 is considered statistically significant, which means synergism effect. Plots of CI values against a rate of suppressed cells (Fa: fraction affected) are shown in
(188) TABLE-US-00004 TABLE 4 Cell Status of p53 CI (Fa = 0.5) KG1a p53null 2.01 HL60 p53null 1.10 Kasumi-1 p53mut(+) 0.156 THP-1 p53mut(+) 0.249 MV4-11NR p53mut(+) 0.380
(189) As clearly shown from the above-described results, the concomitant used of Chb-M′ with a p53 inducer PRIMA-1 showed stronger inhibition effect on cell proliferation than that of single-agent administration of the p53 inducer or Chb-M′, and showed synergistic inhibition effect on cell proliferation. Further, the same experiments were performed using a p53 inducer MIRA-1 and the same results were obtained. Although the PI polyamide conjugates of the present invention may greatly reduce their potency in p53 mutated cells (cancer cells harboring mutated p53 or no p53), concomitant use with a p53 inducer enables suppression of such p53 mutated cells. These results suggest that the mechanism for exerting the antitumor effect of Chb-M′ is different from that for a p53 inducer.
(190) (6) In Vivo Antitumor Effect
(191) 1. Safety Test of PI Polyamide Conjugate
(192) To check the pharmacological safety of the PI polyamide conjugates in vivo, acute toxicological testing of Chb-M′ in mice was first performed. NOD/Shi-scid,IL-2RγKO (NOG) mice were injected with Chb-M′ at various concentrations. Complete blood cell counts, blood biochemistry and body weight were measured (n=5). Results are shown in
(193) 2. Creation of Xenograft Mouse Model
(194) To investigate in vivo anti-tumor effects of Chb-M′ and Chb-50, xenograft mouse models of human cancer cell lines were created using NOG mice. For leukemia mouse models, 2.5×10.sup.6 cells/body of MV4-11 or SU/SR cells were intravenously injected. Peripheral blood (PB) was collected every week and chimerism was checked by using an anti-human CD45 antibody (BD Biosciences). At day 7, each treatment was started. For creating a lung cancer mouse model, 1×10.sup.6 cells/body of A549 cells were injected via a retro-orbital vein. The lung cancer cells were transduced with luciferase-expressing lentivirus produced by pLenti-luciferase vector (addgene) for cell trafficking. D-Luciferin (Wako Pure Chemical Industries, Ltd.) was injected peritoneally at 150 mg/kg body weight, and the amount of tumor volume was assessed by IVIS Spectrum In Vivo Imaging System (PerkinElmer) every week. For the creation of gastric cancer xenograft mouse model, 1×10.sup.6 cells/body of MKN45 cells were injected subcutaneously at the right dorsal flank. The gastric cancer cells were marked with luciferase, and tumor growth was monitored by IVIS.
(195) 3. Antitumor Effect in AML Mouse Model
(196) The xenogfaft AML mouse model created in above 2 was, 7 days after transplantation, intravenously injected with 320 μg/kg body weight of Chb-M′ or Chb-50 twice a week to examine their efficacy (n=7). As controls, the mice were treated with a solvent (dimethyl sulfoxide; DMSO) (320 μg/kg body weight, twice a week IV injections), chlorambucil (320 μg/kg body weight, twice a week IV injections), Chb-S (320 μg/kg body weight, twice a week IV injections), and cytarabine (Ara-C) (Wako Pure Chemical Industries, Ltd.) (i.p. injections of 100 mg/kg body weight, 5 consecutive days (from day 7 through day 11)). At 14 days, bone marrow, liver and spleen tissues were removed from the AML mice, and subjected to hematoxylin and eosin staining (hereinafter, also referred to as “H&E staining”) and immunohistochemical staining with an anti-human CD45 antibody (hereinafter, also referred to as “hCD45 staining”), and microscopic images were taken. The H&E staining stains hematopoietic tissues. The hCD45 staining stains human hematopoietic dells with brown and does not stain mouse tissues.
(197) Results of survival tests of mice by each treatment are shown in
(198) Regarding the H&E staining of the bone marrow from the mice transplanted with MV4-11 cells, administration of DMSO, cytarabine, or Chb-S resulted in little change, and the tissue was filled with homogeneous leukemia cells (magnification 4× and 20×). When Chb-M′ was administered, the homogeneity was lost, and the image moved toward a normal bone marrow image (WT) (
(199) Regarding the hCD45 staining of the liver tissue from the mice transplanted with MV4-11 cells, when DMSO, cytarabine, Chb-S or Chb-M′ was administered, the tissue was not stained with brown like the tissue from a non-transplanted mouse (WT). Thus, it was found that AML cells hardly invaded liver. In spleen tissue, the same result was observed.
(200) MV4-11 cells show a resistance to a currently available anticancer agent cytarabine. The PI polyamide conjugates of the present invention were effective in vivo even against such cancer that was resistant to the conventional anticancer agent.
(201) 4. Antitumor Effect in ALL Mouse Model
(202) The xenograft ALL mouse model created in above 2 was intravenously injected with 320 μg/kg body weight of Chb-M′ twice a week to examine its efficiency (n=5). As controls, the mice were treated with DMSO (320 μg/kg body weight, twice a week IV injections), and imatinib. The treatment with imatinib was performed by oral administration of 100 mg/kg body weight of imatinib mesylate (Focus Biomolecules) twice a day from day 7 until the recipient mice died from the disease. In the same manner as described in above 3, bone marrow, liver and spleen tissues were removed from the ALL mice, and subjected to H&E staining and hCD45 staining, and microscopic images were taken. Results of survival tests of mice by each treatment are shown in
(203) As evident from
(204) Regarding the H&E staining of the bone marrow tissue from the xenograft ALL mice, administration of DMSO or imatinib resulted in little change, and the tissue was filled with homogeneous leukemia cells (magnification 4× and 20×). When Chb-M′ was administered, the homogeneity was lost, and the image moved toward a normal bone marrow image (
(205) Regarding the hCD45 staining of the liver tissue from the xenograft ALL mice, the tissue was stained with brown in the DMSO-administered group (
(206) SU/SR cells have a T315I mutation which delivers a resistance to currently available tyrosine kinase inhibitors (e.g., imatinib). The PI polyamide conjugate of the present invention was effective in vivo even against such cancer that was resistant to the conventional anticancer agents.
(207) 5. Antitumor Effect in Lung Cancer Mouse Model
(208) Treatment of the xenograft lung cancer mouse model created in above 2 with Chb-M′ (320 μg/kg body weight, twice a week IV injections), DMSO (320 μg/kg body weight, twice a week IV injections), or gefitinib (100 mg/kg body weight, fifth a week oral administrations) was started 7 days after transplantation (n=5). From day 7 after transplantation, luciferin was intraperitoneally injected every week, and engraftment of the transplanted lung cancer cells was checked by IVIS imaging. In addition, lung tissue was removed from the lung cancer mice at day 14 after transplantation, and subjected to H&E staining and immunohistochemical staining with an anti-human Ki-67 antibody, and microscopic images were taken. Results are shown in
(209) As evident from
(210) Further, as evident from IVIS images of the lung cancer mice receiving each treatment, at day 7 after transplantation of the human lung cancer cells (before administration of each drug), engraftment of the transplanted cancer cells in lung was confirmed (
(211) Regarding H&E staining of the lung tissue from human lung cancer-transplanted mice, in the DMSO-administered group and the gefitinib-administered group, pulmonary alveoli were densely filled with lung cancer cells and the pulmonary alveoli contained little air (lung cancer was densely packed), so that ventilation of air in the pulmonary alveoli was not possible (
(212) A549 is a human lung cancer cell line that is resistant to currently clinically available standard tyrosine kinase inhibitors against epidermal growth factor receptors (EGFR), such as gefitinib and erlotinib. Actually, gefitinib did not show effect on the lung cancer model (
(213) 6. Antitumor Effect in Gastric Cancer Mouse Model
(214) Treatment of the xenograft gastric cancer mouse model created in above 2 with Chb-M′ (320 μg/kg body weight, twice a week IV injection) or with the same amount of DMSO was started 7 days after transplantation (n=8). From day 7 to day 35 after transplantation, luciferin was intraperitoneally injected twice a week, and tumor growth was monitored by IVIS imaging. In addition, the tumor graft was removed from the gastric cancer mice at day 35 after transplantation, and the gastric cancer volume was determined based on the height, width, and depth dimensions. Results are shown in
(215) As evident from
(216) MKN45 is a human gastric cancer cell line resistant to Her2 inhibitors (drugs whose indications include Her2-positive gastric cancer). The PI polyamide conjugate of the present invention was effective in vivo even against such cancer that was resistant to the conventional anticancer agents.
Example 3: CBFβ as a Novel Pan-Cancer Marker which Reflects Total RUNX Amount
(217) To target whole RUNX family members for treatment of cancer, the expression variance of RUNX1, RUNX2, RUNX3 and CBFβ in cancer tissues and their normal counterparts was checked. Based on previously reported array data sets (Reference database for gene Expression Analysis; RefExA) (Ge, X. et al. Interpreting expression profiles of cancers by genome-wide survey of breadth of expression in normal tissues. Genomics 86, 127-141, doi:10.1016/j.ygeno.2005.04.008 (2005)), expressions of CBFβ were consistently higher among cancer tissues compared to their normal counterparts, while each RUNX expression was variable between cancers and their normal counterparts. Intriguingly, however, when total RUNX expressions (RUNX1+RUNX2+RUNX3) in AML cells (MV4-11, MOLM-13, OCI-AML2, OCI-AML3, MV4-11NR, HL60, THP-1, KG1a, Kasumi-1) were quantified using primers for detecting the common region of RUNX1-3 by the above-described “Real-time quantitative PCR (qRT-PCR)” method, they were positively correlated to the expressions of CBF (
(218) Next, the protein expressions of CBFβ in cancer cell lines of various origins and in their normal counterparts were explored. AML cells (MV4-11, MOLM-13, OCI-AML2, OCI-AML3, MV4-11NR, HL60, THP-1, KG-1a, Kasumi-1), ALL cells (SU-Ph2, SU/SR, RS4; 11, KOCL-45), lung cancer cells (PC-3, Lu99a, A549), breast cancer cells (DU4475, MCF-7, HTB-27, MDA-MB-231, HCC1937), kidney cancer cells (A498, 7860, Caki-1), and melanoma cells (C32TG, Mewo) were used. Immunoblotting of CBFβ elucidated that expressions of CBFβ are consistently higher among cancer cells than their normal counterparts at protein levels as well. Furthermore, it was found that in patients with AML, multiple myeloma, breast cancer, lung cancer, colorectal cancer, bladder cancer, ovarian cancer, prostate cancer and melanoma, the overall survival of the patients having high-level expression of CBFβ was lower than that of the patients having low-level expression of CBFβ. Thus, it was shown that expressions of CBFβ may be a novel prognostic marker across various types of cancer, including AML, multiple myeloma, breast cancer, lung cancer, colorectal cancer, bladder cancer, ovarian cancer, prostate cancer and melanoma.
Example 4: Inhibition Effect on CML (Chronic Myeloid Leukemia) and PhALL (Philadelphia Chromosome-Positive Acute B-Cell Leukemia)
(219) CML and PhALL are leukemia caused by BCR-ABL fusion protein. Effects of Chb-M′ and Chb-50 on CML and PhALL cells were examined. As CML cells, BV173 cell line and MYL cell line (provided by Department of Hematology and Respiratory Medicine, Saga Medical School) were used. Both BV173 and MYL are cell lines harboring wild-type p53 and wild-type p210BCR-ABL. As PhALL cells, SU-Ph2 cell line and SU/SR cell line were used. SU-Ph2 is a cell line harboring wild-type p190BCR-ABL. SU/SR is a tyrosine kinase inhibitor-resistant cell line harboring mutated p190BCR-ABL having a T351I point mutation.
(220) (1) Inhibition of Expression of BCR-ABL Fusion Protein
(221) To BV173 cells, MYL cells, SU-Ph2 cells, and SU/SR cells, 3 μM or 1 μM of Chb-M′ was administered. After 6 hours, a total RNA was extracted from the cells, and then subjected to qRT-PCR (see the above-described “Real-time quantitative PCR (qRT-PCR)”) to quantify the expression levels of BCR-ABL gene. As a control, DMSO was administered. Results of MYL cells, and SU-Ph2 cells and SU/SR cells are shown in
(222) To BV173 cells, MYL cells, SU-Ph2 cells, and SU/SR cells, 3 μM or 1 μM of Chb-M′ were administered. After 24 hours, proteins were extracted, and then subjected to the Western blotting method (see the above-described “Immunoblotting”) using an ABL antibody to confirm expressions of BCR-ABL fusion protein at protein levels. As a control, DMSO was administered. Results of MYL cells, and SU-Ph2 cells and SU/SR cells are shown in
(223) As evident from
(224) Further, by ChIP (chromatin immunoprecipitation) assay, it was confirmed that RUNX1 bound to a promoter region of BCR. Accordingly, it was found that Chb-M′ binds to a RUNX consensus sequence that is present in the promoter region of BCR, and suppresses BCR-ABL fusion protein at a transcriptional level.
(225) In addition, in MYL cells treated with Chb-M′, the expressions of Bcl2 and C-Myc at protein levels were confirmed by the Western blotting method (see the above-described “Immunoblotting”). Bcl2 is the most downstream apoptotic suppressor of BCR-ABL fusion protein. It is known that C-Myc is an expression product of oncogene c-Myc, and C-Myc is transcriptionally induced in CML. Results are shown in
(226) In addition, 1.5 μM or 3 μM of Chb-M′ was administered to MYL cells. After 48 hours, the percentage of apoptosis was analyzed by PI-AnnexinV apoptosis staining. As a result, early apoptosis rates were increased dependent on the concentration of Chb-M′ (
(227) (2) Cell Growth Inhibition Assay
(228) Different concentrations of Chb-M′ were added to media, and MYL cells were incubated for 48 hours. Different concentrations of various drugs (Chb-50, Chb-M′, or imatinib) were added to media, and SU-Ph2 cells and SU/SR cells were incubated for 48 hours. Cell viability after 48 hours was determined using. Cell Count Reagent SF (nacalai tesque, Inc.) and Infinite (registered trademark) 200 PRO multimode reader (TECAN), and IC50 values (viability of 50%) were calculated (MTS assay using SF reagent). Results are shown in
(229) As evident from
(230) As described above, the RUNX inhibitor of the present invention was effective against leukemia caused by BCR-ABL fusion protein.
Example 5: Effects on Bone Marrow Niche
(231) Bone marrow niches are important spaces for homing of leukemia cells. A vascular endothelium niche and an osteoblastic niche are two important niches in the bone marrow niches. E-selectin is an important factor which is expressed only in the vascular endothelial niche of bone marrow.
(232) (1) Inhibition of Expression of E-Selectin
(233) HUVEC (human umbilical vein endothelial cell line) (ATCC catalogue Number: ATCC CRL-1730) was treated with different concentrations (0 μM, 0.5 μM, 1 μM, or 5 μM) of Chb-M′ for 6 hours. HUVEC is a cell line whose proliferation is not inhibited by Chb-M′ (IC.sub.50 value: 50 μM or more). After 6 hours, a total RNA was extracted from the cells, and then subjected to qRT-PCR (see the above-described “Real-time quantitative PCR (qRT-PCR)” to quantify the expression levels of E-selectin gene. As controls, the expression levels of P-selectin, Tie2, ICAM-1, VCAM-1, and Jagged-1 genes were quantified. Results are shown in
(234) As evident from
(235) (2) In Vitro Change in Expression Level of E-Selectin
(236) Using HUVEC, changes in expression levels of E-selectin by the RUNX inhibitor and RUNX knockdown were analyzed by FACS (fluorescence-activated cell sorter). To HUVEC, 1 μM of Chb-M′ was administered. After 24 hours, different antibodies were used for immunostaining and changes in the cell surface expression of CD62E (E-selectin) were measured. As a control, DMSO was administered. In addition, HUVEC in which RUNX1 gene expression was knockdown by sh_RUNX1 #2 were immunostained using different antibodies to measure changes in the cell surface expression of CD62E (E-selectin). As a control, the cells were knockdown by a siRNA targeting luciferase (sh_Luc.). As the antibodies, an anti-human CD62E (E-selectin) antibody (manufactured by eBioscience) and an isotype antibody (mouse IgG1) of anti-human CD62E (E-selectin) antibody (manufactured by eBioscience) were used.
(237) Results are shown in
(238) As evident from
(239) (3) In Vivo Change in Expression Level of E-Selectin
(240) Changes in expression levels of E-selectin in bone marrow endothelial cells by Chb-M′ administration were examined in vivo. To normal mice, DMSO (control) or Chb-M′ was administered 6 times over 2 weeks (320 μg/kg per administration). Twenty-four hours after the last administration (in a state in which Chb-M′ had been eliminated from the body of the mouse), the femur and tibia were harvested, from them bone marrow hematopoietic cells were removed, and endothelial cells were collected and subjected to FACS analysis. CD45 negative cells (bone marrow cells without bone marrow hematopoietic cells) were gated, and a ratio between CD31 positive cells (vascular endothelial marker-positive) and Lin-negative CD45-negative CD31-positive E-selectin-positive cells (E-selectin-positive bone marrow vascular endothelial cells) was analyzed by FACS. A schematic illustration of the experiment scheme is shown in
(241) As evident from
(242) (4) Homing Assay
(243) Migration of leukemia stem cells to a specific distant site is called “homing effect”. In this experiment, leukemia stem cells were transplanted by intravenous injection, and then the number of the leukemia stem cells migrating to bone marrow and surviving in a microenvironment was measured.
(244) Mouse bone marrow (B6) was transfected with an MLL-ENL leukemia fusion gene using a retroviral vector. The transfected cells were repeatedly subcultured to obtain immortalized mouse leukemia cells (MLL-ENL leukemia cells labelled with GFP). To normal B6 mice, DMSO (control) or Chb-M′ was administered 6 times over 2 weeks (320 μg/kg per administration). Twenty-four hours after the last administration (in a state in which Chb-M′ had been eliminated from the body of the mouse: the half-life of the polyamide is about 5 hours), the mice were subjected to irradiation, and injected with 1×10.sup.7 MLL-ENL leukemia cells from tail vein. After 24 hours, bone marrow cells from the right femur and left femur and spleen were harvested, and the numbers of MLL-ENL cells present in the bone marrow and the spleen were analyzed by FACS. A schematic illustration of the experiment scheme is shown in
(245) As evident from
(246) From the above-described results, it was found that the RUNX inhibitor of the present invention is effective not only against leukemia cells but also against a microenvironment (niche) side to which the leukemia cells adhere. Thus, it is suggested that the RUNX inhibitor of the present invention enhances the effect of an anticancer drug and is effective for eliminating small residual lesions in bone marrow niches.
Example 6: Effects on Her2-Positive Gastric Cancer
(247) In Her2-positive gastric cancer, PI3-AKT signal and MAPK-ERK signal are enhanced by Her2, which is an RTK (Receptor Tyrosine Kinase), to increase cell proliferation. Her2 is regulated by GRB2-SOS1 adaptor protein beneath cell membrane. When the adaptor protein is enhanced and activated, Her2 is phosphorylated and kept activated.
(248) To an MKN45 gastric cancer cell line (Her2 inhibitor-resistant cell line), 1 μM of Chb-M′ was administered. After 48 hours, the protein expressions of Her2, p-ERK, ERK, p-AKT, and AKT were evaluated by the Western blotting method (see the above-described “Immunoblotting”). As a control, DMSO was administered. Results are shown in
(249) To the MKN45 gastric cancer cell line, 0.1 μM, 1 μM, or 10 μM of Chb-M′ was administered. After 48 hours, the protein expressions of SOS1, p-Her2 (phospho-Her2), and Her2 were evaluated by the Western blotting method (see the above-described “Immunoblotting”). As a control, DMSO was administered. Results are shown in
(250) To the MKN45 gastric cancer cell line, 1 μM of Chb-M′ was administered. After 6 hours, the mRNA level of SOS1 was evaluated by RT-PCR method using qRT-PCR (see the above-described “Real-time quantitative PCR (qRT-PCR)”). As a control, DMSO was administered. Results are shown in
(251) As evident from
Example 7: Effects on EGFR Wild-Type Lung Adenocarcinoma [EGFR Inhibitor (Gefitinib)-Resistant Lung Cancer Cell Line]
(252) (1) Effects on EGFR Wild-Type p53 Wild-Type Lung Adenocarcinoma Cell Line
(253) Different concentrations of various drugs (Chb-M′, gefitinib, or chlorambucil) were added to media, and EGFR wild-type p53 wild-type lung adenocarcinoma cell lines (A549 and LU99A) were incubated for 48 hours. Cell viability after 48 hours was determined using Cell Count Reagent SF (nacalai tesque, Inc.) and Infinite (registered trademark) 200 PRO multimode reader (TECAN), and IC50 values (viability of 50%) were calculated (MTS assay using SF reagent). Results are shown in
(254) As evident from
(255) (2) Effects on EGFR Wild-Type p53-Mutated Lung Adenocarcinoma Cell Line
(256) Different concentrations of various drugs (Chb-M′, gefitinib, chlorambucil, or Chb-S) were added to media, and EGFR wild-type p53-mutated lung adenocarcinoma cell lines (ABC-1 and RERF-LC-MS) were incubated for 48 hours. Cell viability after 48 hours was determined using Cell Count Reagent SF (nacalai tesque, Inc.) and Infinite (registered trademark) 200 PRO multimode reader (TECAN), and IC50 values (viability of 50%) were calculated (MTS assay using SF reagent). Results are shown in
(257) As evident from
(258) (3) Effects on EGFR Signal
(259) To LU99A cells and A549 cells, 1 μM Chb-M′ was administered. After 24 hours, the expression of Mig6 protein was evaluated by the Western blotting method (see the above-described “Immunoblotting”). As a control, DMSO was administered. Results are shown in
(260) As evident from
(261) (4) Apoptosis Inducing Effect
(262) To A549 cells and LU99A cells, 1 μM Chb-M′ was administered. After 24 hours, the expression levels of apoptosis-related factors (p53, p21, PUMA, and BAX) were evaluated by the Western blotting method (see the above-described “Immunoblotting”). As a control, DMSO was administered. Results are shown in
(263) As evident from
Example 8: Effect on Human Mast Cell
(264) Mast cells cause symptoms or diseases such as allergic reaction by receptor-mediated activation. In addition, c-kit signal transduction enhances release of chemical mediators from stimulated mast cells. The effect of the RUNX inhibitor on human mast cells was examined. As human mast cells, a LAD2 cell line (expressing wild-type c-kit) and an HMC-1.2 cell line (expressing mutated c-kit) were used. The HMC-1.2 cell line has KIT D816V mutation and V560G mutation. Wild-type c-kit is a SCF receptor and the cell proliferation is dependent on SCF. Accordingly, regarding the LAD2 cell line, 50 ng/ml of SCF was administered and experiments were performed as described below. The HMC-1.2 cell line has a mutation in c-kit and the cell proliferation is independent of SCF. Accordingly, regarding the HMC-1.2 cell line, SCF was not administered and experiments were performed as described below. As the RUNX inhibitor, Chb-M′ was used. The LAD2 cell line was provided by Dr. Kirshenbaum A. S. and Dr. Metcalfe D. D. (Laboratory of Allergic Diseases, NIAID, NIH). The HMC-1.2 cell line, which was established by Dr. Nilsson G. (Department of Genetics and Pathology, Uppsala University), was provided by Dr. Metcalfe D. D. (Laboratory of Allergic Diseases, NIAID, NIH).
(265) (1) Effect on Cell Surface Expression of KIT
(266) To the LAD2 cell line, 10 μM Chb-M′ was administered. After 3 hours and 18 hours, different antibodies were used for immunostaining of c-kit expressed on the cell surface, and the expression levels were analyzed by FACS (fluorescence-activated cell sorter). To the HMC-1.2 cell line, 10 μM Chb-M′ was administered. After 18 hours, different antibodies were used for immunostaining of c-kit expressed on the cell surface, and the expression levels were analyzed by FACS. As a control, the same experiments were carried out using DMSO instead of Chb-M′. As the antibodies, an anti-human CD117 (c-kit) antibody (clone 104D2, manufactured by BioLegend) and a mouse IgG1, K isotype Ctrl (FC) antibody (clone MOPC-21, manufactured by BioLegend) were used.
(267) Results are shown in
(268) As evident from
(269) (2) Effect on Total Amount of KIT
(270) To the LAD2 cell line and the HMC-1.2 cell line, 10 μM Chb-M′ was administered. After culturing the cells for 18 hours, extracts were obtained from the cells, and the protein expression levels of c-kit, phospho-c-Kit, AKT, phosphorylated AKT, Mitf, and GAPDH were analyzed by the Western blot analysis (see the above-described “Immunoblotting”) using different antibodies. AKT is an important signaling protein downstream of c-kit. Mitf is a representative transcriptional driver for c-kit. As a control, DMSO was administered. Results are shown in
(271) As evident from
(272) In the HMC-1.2 cell line, the expression levels of c-kit and phospho-c-Kit were suppressed by Chb-M′. It has been reported that mutated c-kit is generally transported to endolysosomes rather than cell membrane, and activates Akt. Regarding the HMC-1.2 cell line, in view of the results of FACS as shown in the above-described (1), it was thought that c-kit in cytoplasm was predominantly reduced. Actually, as shown in
(273) On the basis of the above results, it was found that, regarding wild-type c-kit, Chb-M′ leads to a marked decrease in the total amount of c-kit and suppresses the downstream signal of c-kit. On the other hand, it was confirmed that, regarding mutated c-kit, Chb-M′ significantly suppresses cytoplasmic c-kit protein rather than that on the cell surface. Based on these experiments, it was found that Chb-M′ leads to decrease in the total amount of c-kit (both wild-type c-kit and mutated c-kit) in mast cells.
(274) Further, by ChIP assay, it was confirmed that RUNX1 bound to intron 1 of c-kit in mast cells (HMC-1.2 cell line). Thus, it was found that Chb-M′ suppresses c-kit protein, which is indispensable to cell proliferation in mast cells, at a transcriptional level. Thus, Chb-M′ can regulate an allergic reaction in mast cells. In addition, Chb-M′ led to decrease in the expression of c-kit in mast cells having mutated c-kit (HMC-1.2 cell line), and led to suppression of cell proliferation.
(275) From the above-described results, it is suggested that RUNX1 regulates the expression of c-kit and can be a novel therapeutic target in human mast cells diseases.
Example 9: Effect on Colon Cancer
(276) Different concentrations of various drugs (Chb-M′ or chlorambucil) were added to media, and p53-mutated colon cancer cell line HT29 (purchased from JCRB Cell Bank) was incubated for 72 hours. Cell viability after 72 hours was determined using Cell Count Reagent SF (nacalai tesque, Inc.) and Infinite (registered trademark) 200 PRO multimode reader (TECAN) (
(277) TABLE-US-00005 TABLE 5 Reagent IC50 (μM) Chlorambucil Not measurable Chb-M′ 2.92
Example 10: Effect on Prostatic Adenocarcinoma
(278) (1) Cell Growth Inhibition Assay
(279) Different concentrations of various drugs (Chb-M′, Chb-S, chlorambucil, or Enzalutamide) were added to media, and prostatic adenocarcinoma cell line PC-3 (p53null/PTEN del/androgen-independent) (purchased from ATCC), DU-145 (androgen-independent) (purchased from JCRB Cell Bank), and LNCaP (androgen-dependent) (purchased from ATCC) were incubated for 48 hours. Cell viability after 48 hours was determined using Cell Count Reagent SF (nacalai tesque, Inc.) and Infinite (registered trademark) 200 PRO multimode reader (TECAN), and IC50 values (viability of 50%) were calculated (MTS assay using SF reagent). Results are shown in
(280) TABLE-US-00006 TABLE 6 IC50 (μM) in IC50 (μM) in IC50 (μM) in Reagent PC-3 cells DU-145 cells LNCaP cells Chb-M′ 0.62 1.82 0.68 Chb-S 25.11 107.87 107.87 Chlorambucil N/A 38.08 37.57 Enzalutamide 88.144 47.17 —
(281) As evident from
(282) (2) Inhibition of Expression of Prostatic Adenocarcinoma-Related Factor
(283) To prostatic adenocarcinoma cell line PC-3, 5 μM Chb-M′ was administered. After 6 hours, the mRNA levels of GATA2, E2F5, and AR (androgen receptors), which are important genes for proliferation of prostate cancer cells, were evaluated by qRT-PCR (see the above-described “Real-time quantitative PCR (qRT-PCR)”). As a control, DMSO was administered. Results are shown in
(284) (3) Effect on Apoptosis Induction
(285) To PC-3 cells, 3 μM Chb-M′ was administered. After 48 hours and 72 hours, the percentage of apoptosis was analyzed by PI-AnnexinV apoptosis staining. As a control, DMSO was administered. As a result, the apoptosis rate was increased depending on the concentration of Chb-M′ (
Example 11: Effect on Brain Tumor
(286) (1) Cell Proliferation Test
(287) Different concentrations of various drugs (Chb-M′, Chb-S, or chlorambucil) were added to media, and medulloblastoma cell line DAOY (SHH, TP53-mutated) was incubated for 48 hours. Cell viability after 48 hours was determined using Cell Count Reagent SF (nacalai tesque, Inc.) and Infinite (registered trademark) 200 PRO multimode reader (TECAN), and IC50 values (viability of 50%) were calculated (MTS assay using SF reagent): Results are shown in
(288) TABLE-US-00007 TABLE 7 Reagent IC50 (μM) Chb-M′ 0.812 Chb-S 39.33 Chlorambucil 18.17
(2) Inhibition of Expression of Medulloblastoma-Related Factor
(289) To medulloblastoma cell line DAOY, 1 μM Chb-M′ was administered. After 6 hours, the mRNA levels of cancer promoting factors ROR1 and ROR2, which are important for medulloblastoma, were evaluated by qRT-PCR (see the above-described “Real-time quantitative PCR (qRT-PCR)”). As a control, DMSO was administered. Results are shown in
(290) To DAOY cells, 1 μM Chb-M′ was administered. After 24 hours, proteins were extracted, and the expression of ROR1 and ROR2 at protein level were confirmed by the Western blotting method (see the above-described “Immunoblotting”) using an anti-ROR1 antibody and an anti-ROR2 antibody. As a control, DMSO was administered. Results are shown in
Example 12: Effect on APL (Acute Promyelocytic Leukemia)
(291) Chb-M′ or ATRA (all-trans-retinoic acid: vitamin A derivative) was added to media, and p53-mutated APL cell line NB4 (purchased from DSMZ (Deutsche Sammlung von Mikroorganismen and Zellkulturen)) or p53-null APL cell line UF1 (provided by Department of Hematology and Oncology, Keio University School of Medicine) was incubated for 48 hours or 72 hours. Cell viability was determined using Cell Count Reagent SF (nacalai tesque, Inc.) and Infinite (registered trademark) 200 PRO multimode reader (TECAN), and IC50 values (viability of 50%) were calculated (MTS assay using SF reagent). Results are shown in
(292) TABLE-US-00008 TABLE 8 Reagent Cell Culture time IC50 (μM) Chb-M′ NB4 (p53MT) 48 hours 0.3567 72 hours 0.04460 UF1 (p53Null) 48 hours 1.748 72 hours 0.6742 ATRA NB4 (p53MT) 48 hours 75.72 72 hours 60.08 UF1 (p53Null) 48 hours 12.43 72 hours 10.30
(293) As evident from
INDUSTRIAL APPLICABILITY
(294) The RUNX inhibitor of the present invention can inhibit the activities of all members of RUNX family. The anti-tumor agent comprising the RUNX inhibitor of the present invention can target various types of cancers including leukemia by cluster regulation of RUNX family. The anti-tumor agent of the present invention exerts its effect even on tumors resistant to other molecular target drugs. Particularly, the anti-tumor agent of the present invention exerts its effect even on cancers on which the current clinically available molecular target drugs have no effect. Thus the anti-tumor agent of the present invention is expected to be used as a universal anticancer drug which is effective even against so called intractable cancers. In addition, the RUNX inhibitor of the present invention can be used as an antiallergic agent.
(295) Sequence Listing Free text
(296) SEQ ID NO:1: Forward primer for amplification of GAPDH gene
(297) SEQ ID NO:2: Reverse primer for amplification of GAPDH gene
(298) SEQ ID NO:3: Forward primer for amplification of BCL11A gene
(299) SEQ ID NO:4: Reverse primer for amplification of BCL11A gene
(300) SEQ ID NO:5: Forward primer for amplification of TRIM24 gene
(301) SEQ ID NO:6: Reverse primer for amplification of TRIM24 gene
(302) SEQ ID NO:7: Forward primer for amplification of IL3 gene
(303) SEQ ID NO:8: Reverse primer for amplification of IL3 gene
(304) SEQ ID NO:9: Forward primer for amplification of CSF2RB gene
(305) SEQ ID NO:10: Reverse primer for amplification of CSF2RB gene
(306) SEQ ID NO:11: Forward primer for amplification of p53 gene
(307) SEQ ID NO:12: Reverse primer for amplification of p53 gene
(308) SEQ ID NO:13: Forward primer for amplification of CSF2 gene
(309) SEQ ID NO:14: Reverse primer for amplification of CSF2 gene
(310) SEQ ID NO:15: Forward primer for amplification of p21 gene
(311) SEQ ID NO:16: Reverse primer for amplification of p21 gene
(312) SEQ ID NO:17: Forward primer for amplification of BAX gene
(313) SEQ ID NO:18: Reverse primer for amplification of BAX gene
(314) SEQ ID NO:19: Forward primer for amplification of PUMA gene
(315) SEQ ID NO:20: Reverse primer for amplification of PUMA gene
(316) SEQ ID NO:21: Forward primer for amplification of MDM2 gene
(317) SEQ ID NO:22: Reverse primer for amplification of MDM2 gene
(318) SEQ ID NO:23: Forward primer for amplification of RUNX1 gene
(319) SEQ ID NO:24: Reverse primer for amplification of RUNX1 gene
(320) SEQ ID NO:25: Forward primer for amplification of RUNX2 gene
(321) SEQ ID NO:26: Reverse primer for amplification of RUNX2 gene
(322) SEQ ID NO:27: Forward primer for amplification of RUNX3 gene
(323) SEQ ID NO:28: Reverse primer for amplification of RUNX3 gene
(324) SEQ ID NO:29: Forward primer for amplification of Pan RUNX gene
(325) SEQ ID NO:30: Reverse primer for amplification of Pan RUNX gene
(326) SEQ ID NO:31: Forward primer for amplification of CBFB gene
(327) SEQ ID NO:32: Reverse primer for amplification of CBFB gene