Recombinant <i>Dermatophagoides farinae </i>type 2 allergen protein and its preparation method and application

Abstract

Provided are an optimized Der f2 gene, a recombinant Der f2 protein encoded thereby, a vector comprising said gene, and a Pichia pastoris strain. Also provided are an expression method, a purification method, and an application of the recombinant Der f2 protein.

Claims

1. A DNA sequence encoding a Der f2 protein, wherein said DNA sequence has a base sequence as shown in SEQ ID NO: 1.

2. A vector comprising the DNA sequence of claim 1.

3. A host cell comprising the vector of claim 2, wherein said host cell is a Pichia pastoris strain.

4. A method for expressing a recombinant Der f2 protein, comprising the steps of: (a) constructing a vector comprising said DNA sequence encoding a Der f2 protein of claim 1; (b) linearizing the vector of step A, transferring it into a Pichia pastoris strain, and culturing under a suitable condition; and (c) recovering a Der f2 fermentation broth and purifying the recombinant Der f2 protein.

5. A method for purifying a recombinant Der f2 protein, comprising the steps of: (a) filtering, through a 0.45 μm filter membrane, an ultrafiltered supernatant, wherein the supernatant is obtained by centrifuging the Der f2 fermentation broth in claim 4 at a low temperature and a high speed before ultrafiltration against a 50 mM sodium acetate buffer at pH 4.0; (b) passing the Der f2 fermentation broth pretreated in step (a) through a chromatographic separation column pre-equilibrated with a first equilibration buffer comprising 50 mM sodium acetate at pH 4.0, and eluting with a gradient of a first elution buffer to collect a Der f2 protein elution peak, wherein the elution buffer comprises 50 mM sodium acetate and 1.0 M sodium chloride at pH 4.0; (c) loading the Der f2 protein elution peak collected in step (b) and subsequently ultrafiltered with a 20 mM phosphate solution at pH 6.0, on an anion chromatographic column, and collecting a Der f2 flow-through peak, wherein the anion chromatographic column is pre-equilibrated with a second equilibration buffer comprising 20 mM phosphate at pH 6.0; and (d) adding ammonium sulfate to the Der f2 flow-through peak collected in step (c) to the final concentration of 1.5 M, pH 6.0 to obtain a Der f2 sample, before loading the Der f2 sample to a hydrophobic chromatographic column pre-equilibrated with a third equilibration buffer comprising 1.5 M ammonium sulfate and 20 mM phosphate at pH 6.0, and eluting with a gradient of a second elution buffer comprising 20 mM phosphate at pH 6.0, thereby purifying the recombinant Der f2 protein.

6. The vector of claim 2, wherein said vector is pAO815, pPIC9, pPIC9K, pPIC3.5, pPIC3.5K, pPICZ A, B, C or pGAPZ A, B, C.

7. The host cell of claim 3, wherein the Pichia pastoris strain is SMD1168, GS115, KM71, X33 or KM71H.

8. The host cell of claim 7, wherein there is a 242 bp interval between the DNA sequence encoding the Der f2 protein and ATG of AOX1 on Pichia pastoris; and the DNA sequence encoding the Der f2 protein is preceded by Kozak sequence GCCACCATGG (SEQ ID NO: 10).

Description

BRIEF DESCRIPTION OF THE DRAWINGS

(1) FIG. 1 is a comparison plot of sequences of the recombinant Der f2 gene before and after optimization.

(2) The sequence before optimization corresponds to the nucleotide sequence of the natural Der f2 gene; the sequence after optimization corresponds to the nucleotide sequence of the recombinant Der f2 gene of the present invention, that is, the codon-optimized sequence.

(3) FIGS. 2A and 2B show the CAI indices of the Der f2 gene in the Pichia pastoris expression system before and after optimization.

(4) FIG. 2A shows that the CAI index of the nucleotide sequence of the natural Der f2 gene in the Pichia pastoris expression system was calculated by a program to be 0.80. FIG. 2B shows that the CAI index of the optimized Der f2 codon of the present invention in the Pichia pastoris expression system is calculated by a program to be 0.90.

(5) FIGS. 3A and 3B are optimal codon frequency distribution region plots of the Der f2 gene in the Pichia pastoris expression host before and after codon optimization.

(6) FIG. 3A is an optimal codon frequency distribution region plot of the nucleotide sequence of natural Der f2 gene in the Pichia pastoris system, and it can be seen from the Figure that the occurrence percentage of low-utilization codon in the nucleotide sequence of natural Der f2 gene is 5%. FIG. 3B shows an optimal codon frequency distribution region plot of the optimized Der f2 codon of the present invention in the Pichia pastoris system, and the occurrence rate of low-utilization codon in the sequence of optimized Der f2 codon of the present invention is 0.

(7) FIGS. 4A and 4B are average GC base content distribution region plots of the Der f2 gene in the Pichia pastoris expression system before and after codon optimization.

(8) FIG. 4A shows that the average GC base content of the nucleotide sequence of the natural Der f2 gene in the Pichia pastoris expression system is 39.37%. FIG. 4B shows that the average GC base content of optimized Der f2 codon of the present invention in the Pichia pastoris expression system is 44.93%.

(9) FIG. 5 is an agarose gel electrophoretogram of a PCR product of the codon-optimized Der f2 gene.

(10) Lane 1 represents 500 bp DNA ladder; lane 2 represents a PCR product of the recombinant Der f2 gene containing EcoRI and XhoI restriction sites at both ends.

(11) FIG. 6 is a diagram showing a construction process of the expression plasmid pPICZ-Der f2 for codon-optimized Der f2.

(12) FIGS. 7A-7B are diagrams showing the identification of expression of the codon-optimized Der f2 gene in the host engineering bacteria.

(13) FIG. 7A is a SDS-PAGE gel electrophoretogram of a supernatant of a solution of the host engineering strain containing the codon-optimized Der f2 gene, after methanol-induced expression for one week. Lane 2 represents pre-stained protein loading markers in the range of 10-250 KD; and other lanes represent supernatants of cultured solutions of Der f2 gene-positive monoclonal host engineering strains screened by Zeocin.

(14) FIG. 7B is a western blot plot of a supernatant of a solution of the host engineering strain containing the codon-optimized Der f2 gene, after methanol-induced expression for one week. Lane 1 represents pre-stained protein loading markers in the range of 10-250 KD; and lanes 2-9 represent supernatants of cultured solutions of Der f2 gene-positive monoclonal host engineering strains screened by Zeocin.

(15) FIG. 8A shows a chromatogram of the supernatant of Der f2 fermentation broth by cation chromatography of the first step, and FIG. 8B is a gel electrophoretogram.

(16) FIG. 8A is a chromatogram of the supernatant of Der f2 fermentation broth by cation chromatography of the first step. FIG. 8B is the identification result of cation chromatography purification of the supernatant of Der f2 fermentation broth, wherein lane 1 represents 11-100 KD non-pre-stained protein markers, lane 2 represents the supernatant of the Der f2 fermentation broth before purification, lane 3 represents the flow-through liquid, and lanes 4-10 represent the elution of each tube.

(17) FIG. 9A is a chromatogram of Der f2 protein by anion chromatography of the second step, and FIG. 9B is a gel electrophoretogram.

(18) FIG. 9A is a chromatogram of Der f2 protein by anion chromatography. FIG. 9B is the identification result of anion chromatography purification of Der f2 supernatant, wherein lane 2 represents 11-100 KD non-pre-stained protein markers, lane 1 represents the supernatant before purification of Der f2 protein, lane 2 represents the flow-through liquid of Der f2 protein, and lane 3-6 represent the elution of each tube.

(19) FIG. 10A shows a chromatogram of Der f2 protein by hydrophobic chromatography of the third step and FIG. 10B is a gel electrophoretogram.

(20) FIG. 10A is a chromatogram of Der f2 protein by hydrophobic chromatography of the third step. FIG. 10B is the identification result of hydrophobic chromatography purification of Der f2, wherein lane 1 is Der f2 protein before purification by hydrophobic chromatography, lane 2 is Der f2 penetrate by hydrophobic chromatography, lane 3 represents 11-100 KD non-pre-stained protein markers, and lane 4-10 represent the elution of each tube.

(21) FIG. 11 is the sequencing of N-terminal amino acids of Der f2 proteins.

(22) FIG. 12 is a comparison of the reactivity to serum of recombinant Der f2 and natural Der f2 wherein nDer f2 represents the natural Der f2 protein, rDer f2 represents the recombinant Der f2 protein, and NC represents a PBS solution at pH 7.4.

(23) FIG. 13 is an agarose gel electrophoretogram of a PCR-amplified GAP gene, wherein lane 1 represents 250 bp DNA ladder and lane 2 represents the GAP gene.

(24) FIG. 14 is an agarose gel electrophoretogram of positive clone of GAP gene T-vector identified by PCR, wherein lane 1 represents 250 bp DNA ladder, lanes 2-11 represent positive clones obtained by blue-white screening, and lane 12 represents a negative clone obtained by blue-white screening.

(25) FIG. 15 is an agarose gel electrophoretogram of a PCR-amplified Der f2 gene, wherein lane 1 represents 500 bp DNA ladder and lane 2 represents the Der f2 gene.

(26) FIG. 16 is an agarose gel electrophoretogram of Der f2 gene T-vector clone identified by PCR, wherein lane 1 represents 500 bp DNA ladder, lanes 2-10 represent positive clones obtained by blue-white screening, in which only lane 9 and 10 are positive clones, other lanes are false positive clones, and lane 17 represents a positive control (Der f2 gene).

(27) FIGS. 17A and 17B show amplification curves of a standard plasmid.

(28) FIG. 17A shows amplification curves of the standard plasmid T-GAP, and FIG. 17B shows amplification curves of the standard plasmid T-Der f2.

(29) FIGS. 18A and 18B show melting curves of a standard plasmid.

(30) FIG. 18A shows melting curves of the standard plasmid T-GAP, and FIG. 18B shows melting curves of the standard plasmid T-Der f2.

(31) FIGS. 19A and 19B show a standard curve of a standard plasmid.

(32) FIG. 19A shows a standard curve of the standard plasmid T-GAP, and FIG. 19B shows a standard curve of the standard plasmid T-Der f2.

(33) FIGS. 20A and 20B show amplification curves of samples to be tested.

(34) FIG. 20A shows amplification curves obtained when the samples to be tested are amplified with GAP-1 and GAP-2 as primers, and FIG. 20B shows amplification curves obtained when the samples to be tested are amplified with 5′ AOX and 3′ AOX as primers.

(35) FIGS. 21A and 21B show melting curves of samples to be tested.

(36) FIG. 21A shows melting curves obtained when the samples to be tested are amplified with GAP-1 and GAP-2 as primers, and FIG. 21B shows melting curves obtained when the samples to be tested are amplified with 5′ AOX and 3′ AOX as primers.

DETAILED DESCRIPTION OF THE INVENTION

(37) The invention is further illustrated below in conjunction with specific examples. It should be understood that the examples referred to are merely illustrative of the invention and are not intended to limit the scope of the present invention.

Example 1 Codon Optimization of Recombinant Der f2

(38) Based on the DNA sequence of Der f2 disclosed in GenBank (GenBank accession no. EF139432.1), as shown in SEQ ID No: 2, the inventors performed codon optimization of the gene to obtain the Der f2 gene of the present invention of which the nucleotide sequence is as shown in SEQ ID No: 1 and the amino acid sequence is as shown in SEQ ID No: 3. Comparison of each parameter before and after codon optimization of the Der f2 is as follows:

(39) 1. Codon Adaptation Index (CAI)

(40) As can be seen from FIG. 2A, the codon adaptation index (CAI) of the original Der f2 gene in the Pichia pastoris expression system before codon optimization is 0.80. As can be seen from FIG. 2B, the Der f2 gene has a CAI index of 0.90 in the Pichia pastoris expression system after codon optimization. Usually, when CAI=1, it is considered that the gene is in the most ideal expression state in the expression system. The lower the CAI index, the worse the expression level of the gene in the host. Thus, it can be seen the gene sequence obtained by codon optimization can increase the expression level of the Der f2 gene in the Pichia pastoris expression system.

(41) 2. Optimal Codon Usage Frequency (FOP)

(42) As can be seen from FIG. 3A, based on the Pichia pastoris expression vector, the occurrence percentage of the low-utilization codon (codon with a utilization rate less than 40%) of the Der f2 gene sequence is 5% before codon optimization. This unoptimized gene uses tandem rare codons that may reduce translation efficiency and even disintegrate a translation assembly. As can be seen from FIG. 3B, the Der f2 gene has a low utilization codon frequency of 0 in the Pichia pastoris system after codon optimization.

(43) 3. GC Base Content (GC Curve)

(44) The ideal distribution region of GC content is 30%-70%, and any peak outside this region will affect transcription and translation efficiency to varying degrees. As can be seen from the comparison of the average GC base content distribution region plots of the Der f2 gene in FIG. 4A and FIG. 4B, FIG. 4A shows the average GC base content of the Der f2 gene being 39.37%, and FIG. 4B shows that the peaks of GC content appearing outside the 30%-70% region are removed after optimization, and finally the average GC base content of optimized Der f2 is 44.93%.

Example 2: Construction of an Expression Plasmid Containing the Der f2 Gene

(45) A sequence of EcoRI restriction site was introduced at the 5′ end, and a sequence of XhoI restriction site was introduced at the 3′ end of the codon-optimized Der f2, and then full gene synthesis was performed. The synthesized gene fragment was constructed into the pUC57 plasmid supplied by GenScript (Nanjing) Co., Ltd., thereby obtaining a plasmid for long-term preservation, denoted as pUC57-Der f2 plasmid.

(46) PCR amplification was performed using the pUC57-Der f2 plasmid as a template, and primers of following sequences:

(47) TABLE-US-00001 upstream primer (SEQ ID No: 4): M13 F: TGT AAA ACG ACG GCC AGT downstream primer (SEQ ID No: 5): M13 R: CAG GAA ACA GCT ATG AC

(48) The total volume of the reaction was 50 μL, in which 2.5 μL of each primer at a concentration of 10 μmon was added, 1 μL of dNTP at a concentration of 10 mmol/L was added, and 0.5 μL DNA polymerase being Q5 (#M0491L, purchased from New England BioLabs) at 2 U/μL was added. The reaction conditions were 98° C. for 5 seconds, 55° C. for 45 seconds, and 72° C. for 30 seconds. After 25 cycles, the product was analyzed by 1.0% agarose gel electrophoresis. The results showed that the product size was consistent with the expected size (results as shown in FIG. 5). The product was digested with EcoRI (#R0101S, purchased from New England BioLabs) and XhoI (#R0189S, purchased from New England BioLabs), respectively, and electrophoresed on 1% agarose gel to obtain a gene product, which was purified using a DNA gel recovery kit (DP214, purchased from Tiangen Biotech (Beijing) Co., Ltd.). The purified product was ligated to pPICZA plasmid (purchased from Invitrogen) with T4 ligase (#M0202S, purchased from New England BioLabs), and transformed into DH5a competent cells (CB101, purchased from Tiangen Biotech (Beijing) Co., Ltd.) and cultured in an LB solid medium containing bleomycin (purchased from Invitrogen) at 37° C. overnight. On the second day, the positive clones were picked and sequenced, and the sequence was found identical to the expected sequence by alignment, thereby obtaining the expression plasmid of codon-optimized Der f2, denoted as pPICZ-Der f2 (the plasmid construction was as shown in FIG. 6).

Example 3: Construction of a Pichia pastoris Host Engineering Strain Containing a Recombinant Der f2 Gene

(49) Formulation of YPDS solid medium: the medium was formulated according to the instructions of Easy SelectPichia Expression Kit, Invitrogen, comprising 10 g/L yeast extract, 20 g/L peptone, 20 g/L glucose, 15 g/L agarose, and 182 g/L sorbitol.

(50) Electrocompetent cells were prepared according to the method of instructions of Easy SelectPichia Expression Kit, Invitrogen. The plasmid pPICZ-Der f2 obtained in Example 2 was linearized with Sac I restriction endonuclease (#R0156S, purchased from New England Biolabs), and precipitated with ethanol. The linearized vector was electrotransformed into competent cells of Pichia pastoris X33. The cells were plated on YPDS solid media and cultured at 30° C. until the transformants grew.

Example 4: Inducible Expression and Identification of Engineering Strains Containing Codon-Optimized Der f2 Gene

(51) Formulation of BMGY medium: the medium was formulated according to the instructions of Easy SelectPichia Expression Kit, Invitrogen, comprising 10 g/L yeast extract, 20 g/L peptone, 3 g/L K.sub.2HPO.sub.4, 11.8 g/L KH.sub.2PO.sub.4, 13.4 g/L YNB, 4×10.sup.−4 g/L biotin, and 10 g/L glycerin.

(52) Formulation of BMMY medium: the medium was formulated according to the instructions of Easy SelectPichia Expression Kit, Invitrogen, comprising 10 g/L yeast extract, 20 g/L peptone, 3 g/L K.sub.2HPO.sub.4, 11.8 g/L KH.sub.2PO.sub.4, 13.4 g/L YNB, 4×10.sup.−4 g/L biotin, and 5 mL/L methanol.

(53) Methanol-Induced Expression of an Engineering Strain of Codon-Optimized Der f2

(54) The host monoclonal engineering strain obtained in Example 3 was picked into a 5 mL BMGY medium and cultured in a 50 mL sterile centrifuge tube at 30° C. and 220 rpm until OD.sub.600 reaches 1.0-2.0. 1 mL of the culture was stored, and the remaining strain solution was resuspended and transferred to BMMY for induced expression at a small scale, and methanol was supplemented every 24 hours to a final concentration of 1%. One week later, the supernatant of the strain solution was collected by centrifugation, and analyzed by SDS-PAGE gel electrophoresis and Western blotting. Brightness of expressed product bands was observed. FIGS. 7A and 7B are plots of identification of induced expression of gene engineering strains containing Der f2. As seen from FIGS. 7A and 7B, the Der f2 protein was significantly expressed in the engineering strain.

Example 5: Purification of Recombinant Der f2 Protein

(55) The Der f2 constructed in this invention is obtained mainly by ion exchange and hydrophobic chromatography purification methods. HiTrap SP FF, HiTrap Q FF, and HiTrap Phenyl HP were selected as the chromatographic packings. The specific steps are as follows:

(56) 1. Pretreatment of the Fermentation Broth by Impurity Removal

(57) The fermentation broth of host engineering strain containing Der f2 obtained according to Example 4 was centrifuged at a low temperature at 12000 rpm for 15 minutes to collect a supernatant, and the supernatant was ultrafiltrated against a 50 mM sodium acetate buffer at pH 4.0, and filtered through a 0.45 μm filter membrane to obtain a supernatant of the treated fermentation broth.

(58) 2. Cation Exchange Chromatography

(59) The treated fermentation broth of the previous step was loaded on a SPFF cation exchange chromatographic column, wherein the equilibration buffer was 50 mM NaAc at pH 4.0, the elution buffer was 50 mM NaAc and 1.0 M NaCl at pH 4.0, isocratic elution was performed at 12%, 25% and 100%, and the sample peaks were mainly concentrated at the 25% elution peak. FIG. 8A is an ion exchange purification chromatogram of Der f2, and FIG. 8B is an SDS-PAGE analysis plot of Der f2 after ion exchange chromatography.

(60) 3. Anion Exchange Chromatography

(61) The Der f2 protein peak purified in the previous step was collected, and the sample was ultrafiltrated with a 20 mM NaH.sub.2PO.sub.4 solution at pH 6.0, and loaded on a HiTrap Q FF chromatography packing. The equilibration buffer was 20 mM NaH.sub.2PO.sub.4 at pH 6.0, and the elution buffer was 20 mM NaH.sub.2PO.sub.4 and 1.0 M NaCl at pH 6.0. The flow-through peak of Der f2 was collected.

(62) 4. Hydrophobic Chromatography

(63) The flow-through peak of Der f2 from the anion chromatography was collected, and ammonium sulfate was added to a final concentration of 1.5 M. The fermentation broth supernatant treated as above was loaded on a Phenyl HP chromatographic column. The equilibration buffer was 20 mM NaH.sub.2PO.sub.4 and 1.5 M (NH.sub.4).sub.2SO.sub.4 at pH 6.0; the elution buffer was 20 mM NaH.sub.2PO.sub.4 at pH 6.0, isocratic elution was performed at 25%, 50%, 70%, and 100%, and the Der f2 protein is mainly concentrated at the 75% elution peak. FIG. 10A is hydrophobic chromatography purification chromatogram of Der f2, and FIG. 10B is an SDS-PAGE analysis plot of Der f2 after hydrophobic chromatography. The yield of target protein per liter of fermentation broth is as high as 200 mg or more.

Example 6: Sequence Analysis of N-Terminal Amino Acids of Protein

(64) The determination of N-terminal sequence of proteins and polypeptides is one of the important links in the quality control of pharmaceutical industry. In this experiment, N-terminal sequence analysis based on classical Edman degradation method was used.

(65) The N-terminal sequence of Der f2 protein purified from Example 5 was analyzed by Shimadzu Automatic Protein Peptide Sequencing Instrument (PPSQ-33A, SHIMADZU). The results showed in FIG. 11 that the first five amino acids of N-terminal were DQVDV (SEQ ID No: 11), which indicated that the N-terminal five amino acid sequences of the recombinant Der f2 protein constructed and expressed were identical to those of the natural protein.

Example 7: Analysis of Der f2 Protein Activity

(66) The purified Der f2 protein was dialyzed against a PBS buffer at pH 7.4, and the protein concentration was determined by a BCA protein concentration assay kit (Cat No: 23225, purchased from Pierce), and fold-diluted to 250 ng, 125 ng, 62.5 ng, 31.25 ng, and 15.625 ng. the obtained solution was detected for the reactivity with sera of patients allergic to Dermatophagoides farinae by comparing with natural Der f2. FIG. 12 shows that the recombinant Der f2 has substantially identical reactivity with the sera as compared with the natural Der f2, showing that the recombinant Der f2 has a similar biological activity as the natural Der f2.

Example 8: Determination of Gene Copy Number of Recombinant Der f2 Engineering Strain

(67) 1. Inoculation X33 strain: the strains were cultured in YPD media for 24 h, the X33 genome was extracted by a genomic extraction kit (purchased from Tiangen Biotech (Beijing) Co., Ltd.), and GAP gene was amplified using the X33 genome as a template, and GAP-1 and GAP-2 as primers of which the sequences are as follows:

(68) TABLE-US-00002 upstream primer (SEQ ID No: 6) GAP-1: GGTATTAACGGTTTCGGACGTATTG downstream primer (SEQ ID No: 7) GAP-2: GATGTTGACAGGGTCTCTCTCTTGG

(69) The total volume of the reaction was 50 μL, in which 2.5 μL of each primer at a concentration of 10 μmon was added, 1 μL of dNTP at a concentration of 10 mmol/L was added, and 0.5 μL DNA polymerase being Taq DNA Polymerase (M0267S, purchased from New England BioLabs) at 2 U/μL was added. The reaction conditions were 94° C. for 10 minutes, 94° C. for 30 seconds, 55° C. for 30 seconds, 68° C. for 30 seconds, and 68° C. for 5 minutes. After 30 cycles, the product was analyzed by 1.0% agarose gel electrophoresis. The results showed that the product size was consistent with the expected size (400 bp) (results as shown in FIG. 13). The obtained gene product was purified by DNA gel recovery kit (DP214, purchased from Tiangen Biotech (Beijing) Co., Ltd.) and ligated into pGM-T vector kit (VT202-01, purchased from Tiangen Biotech (Beijing) Co., Ltd.). The vector was transformed into the Top10 competent cells (CB104, purchased from Tiangen Biotech (Beijing) Co., Ltd.), and cultured at 37° C. overnight on blue-white screening media. On the next day, white clones were picked and identified by PCR for which the primers used were GAP-1 and GAP-2. The PCR reaction conditions were consistent with the above-mentioned conditions. The obtained product was analyzed by 1.0% agarose gel electrophoresis, and the results showed that the product size is consistent with the expected size (400 bp) (results as shown in FIG. 14). The positive clones were sent to GenScript (Nanjing) Co., Ltd. for sequencing, and the sequence was found completely identical to the expected sequence by alignment, thereby obtaining the T vector clone of GAP gene, denoted as T-GAP. The T-GAP clone having a correct sequence was inoculated in an LB liquid medium at 37° C. overnight, and the plasmid was extracted (using a plasmid mini-extract kit DP103, purchased from Tiangen Biotech (Beijing) Co., Ltd.) to obtain a standard plasmid for real-time quantitative PCR.

(70) 2. The Der f2 gene was amplified using the pPICZ-Der f2 plasmid of Example 2 as a template, and 5′ AOX and 3′ AOX as primers with the following sequences:

(71) TABLE-US-00003 upstream primer (SEQ ID No: 8): 5′ AOX: GACTGGTTCCAATTGACAAGC downstream primer (SEQ ID No: 9): 3′ AOX: GGCAAATGGCATTCTGACAT

(72) The total volume of the reaction was 50 μL, in which 2.5 μL of each primer at a concentration of 10 μmon was added, 1 μL of dNTP at a concentration of 10 mmol/L was added, and 0.5 μL DNA polymerase being Taq DNA Polymerase (#M0267S, purchased from New England BioLabs) at 2 U/μL was added. The reaction conditions were 94° C. for 10 minutes, 94° C. for 30 seconds, 49° C. for 30 seconds, and 68° C. for 60 seconds, and 68° C. for 5 minutes. After 30 cycles, the product was analyzed by 1.0% agarose gel electrophoresis. The results showed that the product size was consistent with the expected size (750 bp) (results as shown in FIG. 15). The obtained gene product was purified by DNA gel recovery kit (DP214, purchased from Tiangen Biotech (Beijing) Co., Ltd.) and ligated into pGM-T vector kit (VT202-01, purchased from Tiangen Biotech (Beijing) Co., Ltd.). The vector was transformed into the Top10 competent cells (CB104, purchased from Tiangen Biotech (Beijing) Co., Ltd.), and cultured at 37° C. overnight on blue-white screening media. On the next day, white clones were picked and identified by PCR for which the primers used were 5′ AOX and 3′ AOX. The PCR reaction conditions were consistent with the above-mentioned conditions. The obtained product was analyzed by 1.0% agarose gel electrophoresis, and the results showed that the product size is consistent with the expected size (750 bp) (results as shown in FIG. 16). The positive clones were sent to GenScript (Nanjing) Co., Ltd. for sequencing, and the sequence was found completely identical to the expected sequence by alignment, thereby obtaining the T vector clone of Der f2, denoted as T-Der f2. The T-Der f2 clone having a correct sequence was inoculated in an LB liquid medium at 37° C. overnight, and the plasmid was extracted using a plasmid mini-extract kit (DP103, purchased from Tiangen Biotech (Beijing) Co., Ltd.) to obtain a standard plasmid for real-time quantitative PCR.

(73) 3. Calculation of Gene Copy Number:

(74) The concentration (ng/μL) of the standard plasmid was determined by a nucleic acid microanalyzer (Nanodrop2000, ThermoFisher). Copy numbers of GAP and Der f2 were calculated according to the following formula:
Copies/u=(60.02×10.sup.23)×(ng/μl×10.sup.−9)/(DNA length×660)
4. Processing Samples to be Tested

(75) The pPICZ-Der f2-X33 engineering strain was inoculated in YPD liquid media at 30° C. overnight; and the genome was extracted the next day, and its concentration (ng/μL) and purity were determined by a nucleic acid quantitative microanalyzer.

(76) 5. Establishment of a Standard Curve

(77) The standard plasmids of T-GAP and T-Der f2 with known copy numbers were gradiently diluted to 10.sup.8, 10.sup.7, 10.sup.6, 10.sup.5, 10.sup.4, and 10.sup.3 copies/μ1, respectively. The fluorescent quantitative PCR were performed using GAP-1 and GAP-2, 5′ AOX and 3′ AOX as primers, respectively. FIG. 17A shows amplification curves of the standard plasmid T-GAP, FIG. 17B shows amplification curves of the standard plasmid T-Der f2, FIG. 18A shows melting curves of the standard plasmid T-GAP, and FIG. 18B shows melting curves of the standard plasmid T-Der f2. Each gradient was assayed 3 times to verify the repeatability of the standard curve. Standard curves were established with the Ct values as the ordinate and the starting template copy numbers as the abscissa. FIG. 19A shows a standard curve of the standard plasmid T-GAP, and FIG. 19B shows a standard curve of the standard plasmid T-Der f2.

(78) 6. Determination of Copy Number of Der f2 Gene in Recombinant Strains

(79) The genome sample of extracted pPICZ-Der f2-X33 was serially 10-fold-diluted to obtain four gradients of stock solution, 10.sup.−1, 10.sup.−2, and 10.sup.−3. Fluorescent quantitative PCR was performed using GAP-1 and GAP-2, 5′ AOX and 3′ AOX as primers, and each gradient was assayed three times. FIG. 20A shows amplification curves of the samples to be tested with GAP-1 and GAP-2 as primers, FIG. 20B shows amplification curves of the samples to be tested with 5′ AOX and 3′ AOX as primers, FIG. 21A shows melting curves of the samples to be tested with GAP-1 and GAP-2 as primers, and FIG. 21B shows melting curves of the samples to be tested with 5′ AOX and 3′ AOX as primers. The GAP gene exists in Pichia pastoris in a single copy. Therefore, the copy number of the GAP gene can be used to characterize the initial copy number of the genome in the template. The ratio of the copy number of the Der f2 gene to the copy number of the GAP gene is the copy number of Der f2 gene in the Pichia pastoris genome. Table 1 shows the detection results of copy number of the Der f2 gene in the Pichia pastoris gene engineering strain, the detected copy number is between 5.58 and 6.42, and finally the copy number of the Der f2 gene in the recombinant strain was averaged to eliminate the system error and determined to be 6.

(80) TABLE-US-00004 TABLE 1 Results of copy number of Der f2 in the genome detected by real-time fluorescent quantitative PCR Average Ct value gene copy number (10.sup.N)Copy number of Der f2 gene in Pichia pastoris genome Copy number of the Der f2 gene/copy DNA GAP Der f2 GAP Der f2 number of the concentration gene gene gene gene GAP gene Stock 19.86 22.96 6.31 5.88 6.42 solution 10.sup.−1 22.14 24.48 5.95 5.72 5.97 10.sup.−2 23.44 24.53 5.72 5.47 5.58 10.sup.−3 29.07 24.73 3.46 5.47 5.95

Example 9: Analysis of the Acting Elements in the Der f2 Genome

(81) There is no stable additional plasmid in Pichia pastoris, the expression vector is homologously recombined with the host chromosome, and the exogenous gene expression framework is fully integrated into the chromosome to realize the expression of the exogenous gene; the typical Pichia pastoris expression vector contains a regulatory sequence of alcohol oxidase gene, and contains the main structures comprising AOX promoter, multiple cloning site, transcription termination and polyA formation gene sequence (TT), screening markers and the like. The promoter is a cis-element for gene expression regulation and an important element for the genetically engineered expression vector. The important role of the promoter at the transcriptional level determines the gene expression level.

(82) The Der f2 genome was extracted according to the method of Example 8, and the Der f2 gene was amplified from the genome using 5′ AOX and 3′ AOX as primers according to the method in Step 2 of Example 8. The obtained samples were sent to GenScript (Nanjing) Co., Ltd. to detect the acting element before and after the Der f2 gene which was inserted into the genome. The results of genome sequencing indicated that the Der f2 gene expression framework was integrated into the chromosome of Pichia pastoris by a single cross-insertion, which enabled the Der f2 gene to express the gene using the AOX promoter on the yeast chromosome, and thus the expression level was higher.

(83) Generally, the closer the first ATG of the exogenous coding sequence to the ATG of AOX1, the better the expression effect. In the gene construction, the inventors chose an enzyme cleavage site closest to the ATG of AOX1, and found that the Der f2 gene was away from ATG of AOX1 only by 242 bp. In addition, Kozak sequence GCCACCATGG (SEQ ID No: 10) was added in front of Der f2 gene, which can greatly improve transcription and translation efficiency and increase expression efficiency of Der f2 gene in eukaryotes.