Method and system for terpene production platforms in yeast

Abstract

A method is provided for producing modified mutant yeast and the resulting yeast that can be used as a platform for terpene production. The method includes chemical mutagenesis to effect ergosterol dependent growth in yeast. Subsequently, these yeast are subjected to an erg9 knockout mutation to thereby produce ergosterol dependent growth/erg9 knockout mutation yeast cell lines. The resulting yeast are well suited for use in the production of terpenes.

Claims

1. A method for generating terpene producing yeast cell lines, the method comprising: combining yeast with a chemical mutagenesis agent to induce mutations in the yeast to generate chemically mutated yeast; selecting chemically mutated yeast which grows in the presence of nystatin, squalestatin and cholesterol, followed by selecting for ergosterol dependent growth; and subjecting the ergosterol dependent growth yeast to an erg9 knockout mutation, to thereby produce ergosterol dependent growth/erg9 knockout mutation yeast cell lines.

Description

BRIEF DESCRIPTION OF THE FIGURES

(1) FIG. 1 shows biosynthesis of terpenes from natural sources, which often occurs as diverse mixtures with varying compositions in limited amounts due to environmental influences, in which production of single specific terpenes in genetically engineered yeast would alleviate such variability and yield highly valued, single entity compounds.

(2) FIG. 2 is schematic outline of two terpene biosynthetic pathways that operate in plants (the MVA and MEP pathways), their intracellular locations, and examples of the chemical compounds derived from each.

(3) FIG. 3 illustrates mevalonate pathway for ergosterol biosynthesis in yeast (S. cerevisiae).

(4) FIG. 4 illustrates an alternative metabolic pathway for HMG-CoA formation pathway through leucine catabolism pathway.

(5) FIG. 5 illustrates the metabolic pathway in modified yeast strains in accordance with the present invention.

(6) FIG. 6 is a flow diagram showing the biogenesis of modified yeast in accordance with one aspect of the present invention.

(7) FIG. 7 is a graph showing metabolism of two strains BY4741(A) and ZX178-08(B).

(8) FIG. 8 illustrates how yeast strains produced in accordance with the present method can be used for producing specific chemicals.

(9) FIG. 9 shows how the yeast lines developed as outlined in FIG. 8 in comparison to the starting yeast line 4741 were chemically profiled for their terpene biosynthetic capacities.

(10) FIG. 10 is a chart showing the production of various compounds of different strains in accordance with the present invention.

(11) FIG. 11 is a graph showing quantitation of FOH levels in yeast lines having an exogenous sterol requirement growth.

(12) FIG. 12 is a gel confirming erg9 knockout mutation in accordance with the present invention.

(13) FIG. 13 is a chart showing the quantitation of FOH levels in SUE, erg9 mutant lines of yeast demonstrated to have an exogenous sterol requirement for growth and resistance to hygromycin.

(14) FIG. 14 is a flow chart showing constructs used for evaluate yeast sesquiterpene productions.

(15) FIG. 15 is a flow diagram showing the steps in the development of yeast.

DETAILED DESCRIPTION

(16) The present method and modified yeast will now be described with reference to the figures and exemplary experiments, examples and methods. The figures, experiments and examples are merely to provide a more thorough understanding of the present method and modified yeast. However, other methods and generated yeast can be envisioned consistent with the scope and spirit of the present disclosure.

(17) FIG. 5 illustrates one approach used to generate yeast cell lines in accordance with the present disclosure. The approach of FIG. 5 outlines a method for generating yeast cell lines that provide for robust biosynthesis or precursors that can be utilized in the production of many difference classes of terpenes. The strategy takes advantage of the native mevalonate (MVA) pathway that operates normally in yeast for the biosynthesis of ergosterol, the dominant sterol found in yeast. Ergosterol is the main product of the yeast mevalonate pathway, is an important membrane component, and is essential for yeast growth. If the ergosterol biosynthetic pathway is blocked or inhibited, yeast die. In fact, this is the basis for many pharmacological drugs to control fungal infections in man (Maertens, 2004) and agricultural chemicals to control fungal infection in plants (Casida, 2009). To further complicate matters, wild type yeast can take up exogenously supplied sterol from their environment only under anaerobic conditions.

(18) In order to be able to efficiently channel terpene biosynthetic intermediates from the ergosterol biosynthetic pathway, a SUE (sterol uptake enhancement) mutation supporting the aerobic uptake and utilization of exogenous sterol was first created (Bourot and Karst, 1995; Shianna et al., 2001). A SUE mutation is thus a yeast line that can meet all its sterol needs by an exogenous source of sterol, and therefore making the endogenous ergosterol biosynthetic pathway dispensable. The SUE mutation was then complemented by the introduction of a knockout mutation in the ERGS gene (squalene synthase) (Zhang et al., 1993), resulting in a yeast line where the MVA pathway was still operational up to the biosynthesis of FPP and hence, intermediates in the pathway (DMAPP, IPP and FPP) could be diverted to the biosynthesis of other non-essential terpene components. In order to follow and select for the desired mutant lines, the yeast lines could be monitored for farnesol (FOH) accumulation, the dephosphorylated form of farnesyl diphosphate. If the MVA pathway in the yeast line continued to operate as proposed, then one would expect carbon flux to FPP to continue. But, because the downstream utilization of FPP by squalene synthase was abolished, then the accumulating FPP would be subject to the endogenous phosphatase activity for its conversion to FOH, which could be used as an initial screen for monitoring development of the mutant yeast line. Further engineering of such a yeast line could then take advantage of the FPP, DMAPP and IPP pools for their diversion to the biosynthesis of monoterpenes (10 carbon compounds), sesquiterpenes (15 carbon compounds), diterpenes (20 carbon compounds) and triterpenes (30 carbon compounds).

(19) The following experiments were conducted to develop yeast with a dispensible mevalonate pathway. FIG. 6 illustrates three (3) phases in the development of a desired yeast line. In phase I, chemical mutagenesis is used to introduce SUE mutations, which are identified by selecting for yeast cells that do not have a functioning ergosterol biosynthetic pathway and can only grow in the presence of exogenous cholesterol. The SUE mutation was created by subjecting wild type yeast strain BY4741 to EMS mutagenesis (see supplemental materials and methods information for specifics) to introduce random mutations in the whole genome, followed by selection on plates containing three important selection agents: nystatin; cholesterol; and squalestatin. Nystatin binds to ergosterol in the cell membrane causing non-selective membrane permeability and leads to cell death (Silva et al., 2006). Nystatin thus selects against cells that have ergosterol in their membranes. However, yeast have an absolute requirement for sterols in order for their membranes to function properly. Hence, by having the mutagenized yeast plated in the presence of cholesterol, which nystatin cannot bind to, only yeast that can take up the exogenous cholesterol under aerobic conditions and properly incorporate the cholesterol into their membranes survive. Squalestatin is a potent inhibitor of squalene synthase and eliminates the yeast's ability to synthesize ergosterol (Bergstrom et al., 1995), thus assuring that the surviving yeast have a dispensable mevalonate pathway.

(20) In phase II, yeast lines demonstrating an absolute requirement for exogenous sterols for growth were chemical profiled by GC-MS (FIG. 11). Aliquots of those yeast lines exhibiting normal growth characteristics, having growth rates comparable to wild type yeast, were extracted and their chemical constituents separated by gas chromatography and identified by their mass fragmentation patterns. The parental line BY4741 does not accumulate detectable amounts of FOH under these conditions. Mutant lines accumulating 50 or more mg/ml of FOH were selected for phase III knockout mutagenesis of the squalene synthase gene, ERGS.

(21) As shown in FIG. 11, quantitation of FOH levels in yeast lines having an exogenous sterol requirement for growth. Yeast lines were grown as test tube shake cultures with 3 ml of YPD media containing 40 μg/ml of ergosterol and 40 μg/ml of squalestatin for 6 days prior to sampling the cultures. One ml aliquots of cultures were mixed vigorously with 1 ml of acetone, then allowed to stand for 15 min. One ml of hexane containing a cedrene external standard was then added, vortexed, centrifuged in a clinical centrifuge for 5 min, and the upper hexane phase removed and concentrated to 100 μl under a nitrogen stream. One μl aliquots of the hexane extracts were then subjected to GC-MS and FOH levels quantified relative to the external standard.

(22) The objective in phase III was to obtain a knockout mutation of the ERG 9 (squalene synthase) gene, thus assuring the dispensable nature of the endogenous mevalonate pathway for ergosterol biosynthesis. Site specific recombination was afford by appending 5′ and 3′ regions surrounding the native ERG9 gene onto a hygromycin selection marker gene (see supplementary materials and methods information), then introducing this linear gene construct into selected yeast lines from the phase II screening under conditions to promote site-specific, double recombination with the native ERRS gene. The knockout mutants were then selected by plating the cells in the presence of ergosterol and hygromycin. Recombination as depicted in FIG. 6 should result in the coding region of the ERG9 gene being displaced/substituted by the hygromycin resistance marker gene. Confirmation of such a substitution event was obtained by screening the genomic DNA of the selected yeast colonies for the hygromycin marker gene in proximity to genomic DNA sequences normally found 3′ to the ERG9 coding region. Using genomic DNA isolated from hygromycin resistant colonies as template with a hygromycin specific primer (HphF) and a primer specific to a genomic DNA sequence found 3′ to the ERG9 gene (ERG9 450DwR), a PCR amplification product of approximately 1,538 bp would be expected and is evident in the colonies so tested in FIG. 12.

(23) In FIG. 12, PCR confirmation for the ERG9 knockout mutation include DNA isolated from four independent colonies selected for substitution of the hygromycin resistance gene for the ERG9 gene, used as PCR template with a hygromycin specific primer and a specific primer for the genomic DNA surrounding the ERG9 locust. If the HphF gene did insert and replace the ERG9 gene, the expected amplification product would be 1,538 bp. Independent colonies from each of the erg9 knockout lines were then re-evaluated for their growth in liquid media and the dispensable nature of their mevalonate pathway checked by their accumulation of FOH (FIG. 13).

(24) As shown in FIG. 13, quantitation of FOH levels in SUE, erg9 mutant lines of yeast demonstrated to have an exogenous sterol requirement for growth and resistance to hygromycin. Cultures were grown in 3 ml test tube cultures of SCE media supplemented with histidine, leucine, uracil, tryptophan and methionine for 6 days before extracting and quantifying their FOH levels by GC-MS as described in FIG. 11.

(25) Qualification of a New Mutant Yeast Strain for its Utility to Produce a Desired Terpene Compound.

(26) Nine of the yeast lines harboring a SUE mutation and having the native ERGS gene deleted were evaluated indirectly for the available of terpene biosynthetic intermediates, and specifically FPP, to support sesquiterpene biosynthesis in comparison to the parental strain BY4741 (FIG. 7). Hyoscyamus premnaspirodiene synthase (HPS), a catalytically active sesquiterpene synthase first isolated from Hyoscyamus muticus, was chosen for this evaluation because HPS has been characterized for its expression in bacteria (Mathis et al., 1997) and in yeast (Takahashi et al., 2007). An appropriate HPS gene expression vector was engineered into the indicated yeast lines and the subsequent transformants screened for premnaspirodiene accumulation when the yeast were grown as 30 ml shake flask cultures with SCE media containing leucine, tryptophan, uracil, and methionine for 12 days at 23° C. Yeast line ZX178-08 accumulated the highest level of premnaspirodiene, up to 114±26 mg/L, with FOH levels of 23.6±14.5 mg/L. In comparison, the parental line BY4741 accumulated 10 times less premnaspirodiene, 10.94±3.12 mg/L, with no farnesol accumulation detected.

(27) FIG. 9 shows a comparison of terpene accumulation levels in yeast lines (ZX series) developed as terpene production platforms. Each of the ZX cell lines as well as the wild type parental line (BY4741) were independently transformed with an expression vector harboring the Hyoscyamus premnaspirodiene synthase gene. The yeast lines were then grown for 12 days prior to chemically profiling them for their cell constituents by GC-MS and quantifying the levels of premnaspirodiene and farnesol found in each.

(28) The following experiments methods and procedures provide additional background with regard to the method for producing terpene platforms in yeast and the resulting yeast produced.

(29) Chemical and Media Preparations

(30) All chemical reagents were obtained from Sigma-Aldrich (St. Louis, Mo.), BD Bioscience (Franklin Lakes, N.J.), or Fisher Scientific (Chicago, Ill.), while reagents for molecular manipulations were from Stratagene (San Diego, Calif.), Takara (Shiga, Japan), Invitrogen (San Diego, Calif.), and New England Biolab (Ipswich, Mass.).

(31) Bacteria and yeast were grown using standard culture practices. YPD media for growing yeast without selection consisted of 1% Bactoyeast extract, 2% Bacto-peptone, and 2% glucose (or 0.5% glucose for select experiments). YPDE media was YPD media supplemented with ergosterol (40 mg/L) for ergosterol dependent lines. YPDNCS media for the SUE mutation screening was YPD media supplement with 40 mg/L Nystatin, 40 mg/L cholesterol and 40 mg/L squalestatin. YPDSE media was YPD media supplement with 40 mg/L squalestatin and 40 mg/L ergosterol. Minimal media, SCE (pH 5.3), contained 0.67% Bacto-yeast nitrogen base (without amino acids), 2% dextrose, 0.6% succinic acid, 0.14% Sigma yeast dropout solution (-his,-leu,-ura,-trp), uracil (300 mg/L), L-tryptophan (150 mg/L), L-histidine (250 mg/L), L-methionine (200 mg/L), L-leucine (1 g/L) and 40 mg/L ergosterol. Cholesterol and ergostrol stocks were 10 mg/mL in 50% Triton X-100, 50% ethanol and kept at −20° C. Selection media was prepared similarly except without supplementing the media with the indicated reagent based on the yeast auxotrophic makers. All solid media plates were prepared with 2% Bacto-Agar.

(32) Ethyl Methane-Sulfonate (EMS) Mutagenesis

(33) Strain BY4741 (MATa;his3A1;leu2A0;met15A0;ura3A0) (Janke et al., 2004) was used as the parental yeast line. BY4741 cells were incubated overnight at 30° C. in 5 ml YPD medium with shaking at 200 rpm, and used to establish a 200 ml YPD shake flask culture. When the yeast culture OD600 reached approximately 1.0, the cells were spun down by centrifugation (10 min at 4,000×g), and washed twice with 20 ml 0.1M sodium phosphate buffer, pH7.0. Cells were concentrated by centrifugation again, re-suspended in 1 ml 0.1M sodium phosphate buffer, transferred to a 14 ml FALCON culture tubes, treated with 300 pi EMS (1.2 g/ml, Sigma), followed by incubation at 30° C. for 1 hour with shaking. To stop the mutagenesis, 8 ml of sterile 5% sodium thiosulfate (Fisher) were added to yeast cells by inactive EMS. Cells were pelleted, washed with 8 ml sterile water, concentrated by centrifugation, re-suspended in 1 ml sterile water and 100 pl aliquots plated onto YPD-NCS agar plate (YPD plus 50 mg/L cholesterol, 50 mg/L nystatin, 50 mg/L squalesatin, 2% Bacto-agar). In some experiments, the washed cells were resuspend in 1 ml YPDE liquid media for recovery overnight before plating on YPD-NCS agar medium. The cultures were incubated for up to 2 weeks at 30° C. until distinct colonies became visible.

(34) Yeast Transformation and Culture Performance

(35) Yeast strains were transformed with the respective vector constructs using the FROZEN-EZ Yeast Transformation II Kit (Zymo Research, Orange, Calif.) according to the manufacturer's recommendations. About 1 pg of plasmid or about 5 pg of linearized DNA was used per transformation and followed by selection on agar plates of SCE medium lacking specified amino acids for the auxotrophic markers or YPDE containing 300 mg/L hygromycin B for screening for erg9 knockout at 30° C. Variable numbers of independent colonies were subsequently picked and used to start 3 ml cultures in minimal media to characterize their terpene production capacities. Aliquots of these cultures were analyzed for terpene production after 6 days of incubation at 30° C. with shaking by GC-MS. Cultures exhibiting the highest terpene production levels were chosen for further studies and archived as glycerol stocks at −80° C. Selected lines were characterized for cell growth and terpene production using 30 mL shake flask cultures. Starter cultures grown to saturation in minimal media were inoculated into 30 ml SCE media and 1 mL aliquots withdrawn at every other day intervals for 10-15 days. Cell growth was monitored as the change in optical density at 600 nm every two days, using appropriate dilutions for cultures at later stages of growth. Terpene production was determined by GC-MS similar to the initial screening method.

(36) GC-MS Detection and Quantification of Terpenes

(37) To determine terpene accumulation levels, aliquots of cultures grown for 6 to 12 days were extracted with hexane and aliquots evaluated by GC-MS. In general, to 1 volume of culture, 1 volume of acetone was added and mixed vigorously for 3 to 5 min to lyre the cells. The sample was then allowed to incubate at room temperature for 10 min before adding 1 volume of hexane containing a known amount of cedrene external standard. The mixture was again mixed vigorously, then centrifuged in a clinical centrifuge for 5 min at maximum speed. The upper organic layer was collected and when necessary, concentrated under a N2 stream to 1/10 the original volume. An aliquot of the organic phase (1 μl) was then analyzed by GC-MS with a Varian CP-3800 GC coupled to a Varian Saturn 2200 MS/MS (Varian Medical Systems) using a Supelco SLB-5 ms fused silica capillary column (30 m×0.25 mm×0.25 pm film thickness, Supelco). The initial oven temperature was set at 70° C. for 1 min, ramped to 200° C. at 8° C./min, and then ramped to 300° C. at 20° C./min and held for 5 min more. Farnesol and premnaspirodiene levels were calculated relative to the cedrene external standard.

(38) Construction of the Squalene Synthase (ERG9) Knockout Mutation

(39) The primers ERG9PS1 and ERG-250downS2 were used to amplify the hygromycin resistance gene, hphNT1, from the PFA6-hph-NT1 vector (Janke et al., 2004), and at the same time add DNA sequences homologous to regions surrounding the ERG9 gene in the yeast genome. These primers are flanked by 42 nucleotide sequences (underlined) homologous to DNA sequences found 250 base pairs 5′ (upstream) and 3′ (downstream), respectively, of the ERG9 gene found in the yeast genome. The purified PCR fragment was transformed into various yeast lines identified for their ability to accumulate farnesol (FIG. 11) and grown in 2 ml of YPDE media for an additional 6 hours before being plated on YPDE hygromycin (300 mg/L) agar plates at 28° C. Independent single colonies were picked for ergosterol dependent test, PCR confirmation of recombination with hphF and ERG9 450DWR primer, as well as farnesol production analysis. The recombination sequence was further confirmed by DNA sequencing of a corresponding PCR amplification product.

(40) Expression of the HPS Gene in Yeast

(41) The yeast GPD promoter (Pgpd) was amplified from the PYM-N14 plasmid described by Janke et al. (2004) using the primers GPD-BamHIF and GPD-NotIR primers and inserted into the pESC-His vector digested with BamHl and Notl to replace the original GAL1/10 promoters. The resulting plasmid was named pESC-His-gpd. The HPS gene was cloned into Notl and Spel sites of pESC-His-gpd to obtain the yeast expression vector pESC-His-gpd-HPS as previously by Takahashi et al. (2007). Yeast lines transformed with this construct were then evaluated for their production of the sesquiterpene premnaspirodiene as a measure of the available of intermediates of the mevalonate biosynthetic pathway for the biosynthesis of new terpenes.

(42) Referring to FIG. 14, a yeast expression vector was designed for a strong, consecutive expression of the sesquiterpene synthase HPS gene directed by the gpd promoter (Pgpd) and termination provided by the ADH terminator sequence (ADHterm).

(43) In FIG. 15, steps are shown for the development of yeast having a desirable mevalonate biosynthetic pathway and number of colonies screened at each stage.

(44) FIG. 8 shows FOH accumulation in a yeast line (178-08) selected for a dispensable mevalonate biosynthetic pathway in comparison to that accumulating in the parental line (BY4741) used to generate the new mutant yeast lines. GC-MS chromatograph of hexane extracts were prepared from the wild type and engineered yeast lines. The top of FIG. 8, for (A) BY4741, shows no farnesol accumulated in parental yeast. In the bottom part of FIG. 8, (B) ZX178-08, over 100 mg of FOH/L accumulated in the newly developed yeast line, as quantified on the basis of a cedrene external standard.

(45) The following table shows primers used in various molecular manipulations described in the present disclosure.

(46) TABLE-US-00002 Primer Sequence Name Primer sequence Identifier ERG9pS1 GTACATTTCATAGCCCATCTTCAAC SEQ ID AACAATACCGACTTA NO: 1 CCCGTACGCTGCAGGTCGAC SEQ ID  NO: 2 ERG9 CAGATTGACGGAGAGAGGGCCACAT SEQ ID 250dw52 TGTTTGTCGGCAA NO: 3 TAAATCGATGAATTCGAGCTCG SEQ ID NO: 4 Hph F ATGGGTAAAAAGCCTGAACTCA SEQ ID NO: 5 Hph R TTATTCCTTTGCCCTCGGACGAG SEQ ID NO: 6 ERG9 AGATGCTAGTCAATGGCAGAAG SEQ ID 450c1Wr NO: 7 ERG9p300upF TGCTTACACAGAGTGAACCTGC SEQ ID NO: 8 ERG9 300R CTCGTGGAAGTGACGCAAC SEQ ID NO: 9 HPS Notl F gggGCGGCCGCaAAAACA  SEQ ID atggccccagctatagtgatgag NO: 10 HPS SpeIR gACTAGT  SEQ ID tcaaatatcaatagaatccacc NO: 11 pGPD- cgGGATCCagtttatcattatca SEQ ID BarnHI F atactcgcc NO: 12 pGPD-NotIR gggGCGGCCGCgagctcagttta SEQ ID tcattatc NO: 13

(47) It will be understood that various details of the presently disclosed subject matter can be changed without departing from the scope of the subject matter disclosed herein. Furthermore, the foregoing description is for the purpose of illustration only, and not for the purpose of limitation.

(48) The present application includes a sequence listing:

(49) Name: 13177N_1860CO_SequenceListing.txt

(50) Date Created: Nov. 5, 2020

(51) Size: 6 KB

REFERENCES

(52) Numerous references have been cited throughout this disclosure including the following. All are incorporated by reference. Asadollahi M A, Maury J, Moller K, Nielsen K F, Schalk M, Clark A, Nielsen J (2008) Production of plant sesquiterpenes in Saccharomyces cerevisiae: Effect of ERGS repression on sesquiterpene biosynthesis. Biotechnology and Bioengineering 99: 666-677 Asadollahi M A, Maury J, Schalk M, Clark A, Nielsen J (2010) Enhancement of farnesyl diphosphate pool as direct precursor of sesquiterpenes through metabolic engineering of the mevalonate pathway in Saccharomyces cerevisiae. Biotechnology and Bioengineering 106: 86-96 Bedoukian P E (1983) Perfumery and flavour materials. Perfumer & Flavorist 8: 1, 3-6 Bergstrom J D, Dufresne C, Bills G F, Nallinomstead M, Byrne K (1995) Discovery, biosynthesis, and mechanism of action of the zaragozic acids potent inhibitors of squalene synthase. Annual Review of Microbiology 49: 607-639 Bhilwade H N, Tatewaki N, Nishida H, Konishi T (2010) Squalene as novel food factor. Current Pharmaceutical Biotechnology 11: 875-880 Bourot S, Karst F (1995) Isolation and characterization of the saccharomyces-cerevisiae sut1 gene involved in sterol uptake. Gene 165: 97-102 Buckingham J (2003) Dictionary of Natural Products. Chapman & Hall/CRC Chemical Database Casida J E (2009) Pest toxicology: The primary mechanisms of pesticide action. Chemical Research in Toxicology 22: 609-619 Fischer M J C, Meyer S, Claude! P, Bergdoll M, Karst F (2011) Metabolic engineering of monoterpene synthesis in yeast. Biotechnology and Bioengineering 108: 1883-1892 Huang Z-R, Lin Y-K, Fang J-Y (2009) Biological and pharmacological activities of squalene and related compounds: potential uses in cosmetic dermatology. Molecules 14: 540-554 Janke C, Magiera M M, Rathfelder N, Taxis C, Reber 5, Maekawa H, Moreno-Borchart A, Doenges G, Schwob E, Schiebel E, Knop M (2004) A versatile toolbox for PCR-based tagging of yeast genes: new fluorescent proteins, more markers and promoter substitution cassettes. Yeast 21: 947-962 Keasling J (2009) Synthetic biology in pursuit of inexpensive, effective, antimalarial drugs. Biosocieties 4: 275-282 Kirby J, Romanini D W, Paradise E M, Keasling J D (2008) Engineering triterpene production in Saccharomyces cerevisiae-beta-amyrin synthase from Artemisia annua. Febs Journal 275: 1852-1859 Maertens J A (2004) History of the development of azole derivatives. Clinical Microbiology and Infection 10: 1-10 Martin V J J, Pitera D J, Withers S T, Newman J D, Keasling J D (2003) Engineering a mevalonate pathway in Escherichia coli for production of terpenoids. Nature Biotechnology 21: 796-802 Mathis J R, Back K, Starks C, Noel J, Poulter C D, Chappell J (1997) Pre-steady-state study of recombinant sesquiterpene cyclases. Biochemistry 36: 8340-8348 Nicolaou K C, Yang Z, Liu J J, Ueno H, Nantermet P G, Guy R K, Claiborne C F, Renaud J, Couladouros E A, Paulvannan K, Sorensen E J (1994) Total synthesis of taxol. Nature 367: 630-634 Reddy L H, Couvreur P (2009) Squalene: A natural triterpene for use in disease management and therapy. Advanced Drug Delivery Reviews 61: 14121426 Seki H, Ohyama K, Sawal S, Mizutani M, Ohnishi T, Sudo H, Akashi T, Aoki T, Saito K, Muranaka T (2008) Licorice beta-amyrin 11-oxidase, a cytochrome P450 with a key role in the biosynthesis of the triterpene sweetener glycyrrhizin. Proceedings of the National Academy of Sciences of the United States of America 105: 14204-14209 Shianna K V, Dotson W D, Tove S, Parks L W (2001) Identification of a UPC2
homolog in Saccharomyces cerevisiae and its involvement in aerobic sterol uptake. Journal of Bacteriology 183: 830-834 Silva L, Coutinho A, Fedorov A, Prieto M (2006) Competitive binding of cholesterol and ergosterol to the polyene antibiotic nystatin. A fluorescence study. Biophysical Journal 90: 3625-3631 Takahashi S, Yeo Y, Greenhagen B T, McMullin T, Song L, Maurina-Brunker J, Rosson R, Noel J P, Chappell J (2007) Metabolic engineering of sesquiterpene metabolism in yeast. Biotechnology and Bioengineering 97: 170-181 Tu Y (2011) The discovery of artemisinin (qinghaosu) and gifts from Chinese medicine. Nature Medicine 17: 1217-1220 Wall M E, Wani M C (1995) Paclitaxel—from discovery to clinic. In GICTTOIVDM Georg, ed, Taxane Anticancer Agents: Basic Science and Current Status, Vol 583, pp 18-30 Wu S Q, Schalk M, Clark A, Miles R B, Coates R, Chappell J (2006) Redirection of cytosolic or plastidic isoprenoid precursors elevates terpene production in plants. Nature Biotechnology 24: 1441-1447 Zhang D L, Jennings S M, Robinson G W, Poulter C D (1993) Yeast squalene synthase—expression, purification, and characterization of soluble recombinant enzyme. Archives of Biochemistry and Biophysics 304: 133143