DIRECT CRISPR SPACER ACQUISITION FROM RNA BY A REVERSE-TRANSCRIPTASE-CAS1 FUSION PROTEIN
20170275665 · 2017-09-28
Inventors
- Sukrit SILAS (Stanford, CA, US)
- Georg Mohr (Austin, TX)
- Devaki BHAYA (Stanford, CA, US)
- Alan M. Lambowitz (Austin, TX)
- Andrew Fire (Stanford, CA)
Cpc classification
C12N2310/20
CHEMISTRY; METALLURGY
C12N15/111
CHEMISTRY; METALLURGY
C12N9/22
CHEMISTRY; METALLURGY
C12Y207/07049
CHEMISTRY; METALLURGY
C07K2319/80
CHEMISTRY; METALLURGY
C12Q1/6806
CHEMISTRY; METALLURGY
C12P19/34
CHEMISTRY; METALLURGY
International classification
C12P19/34
CHEMISTRY; METALLURGY
C12N15/11
CHEMISTRY; METALLURGY
C12N9/12
CHEMISTRY; METALLURGY
Abstract
The present disclosure provides methods and compositions for the integration of a target RNA or DNA into a DNA substrate. Also provided are methods of forming RNA-DNA bonds and enzymes for performing the same.
Claims
1. A method for ligating RNA to DNA to provide a RNA-DNA hybrid comprising: (a) obtaining RNA and a target DNA comprising a Cas1 recognition sequence; and (b) providing a reverse transcriptase (RT) and a Cas1 protein, thereby producing a RNA-DNA hybrid.
2. The method of claim 1, wherein the RNA is ssRNA.
3. The method of claim 1, wherein the RT protein is at least 85% identical to SEQ ID NO: 6.
4. The method of claim 1, wherein the Cas1 protein is at least 85% identical to SEQ ID NO: 7.
5. The method of claim 1, wherein the RT and Cas1 protein are provided as a RT-Cas1 fusion protein.
6. The method of claim 5, wherein the RT-Cas1 fusion protein is a bacterial RT-Cas1 fusion protein.
7. The method of claim 6, wherein the RT-Cas1 fusion protein is from Arthrospira platensis or Marinomonas mediterranea.
8. The method of claim 1, wherein the RNA is 20-50 nucleotides.
9. The method of claim 1, wherein the RT and/or Cas1 protein is recombinant.
10. The method of claim 1, wherein the method is performed in the presence of added dNTPs.
11. The method of claim 1, wherein providing the RT and Cas1 protein comprises providing an expression vector that encodes the RT and Cas1 protein.
12. The method of claim 1, wherein step (b) further comprises providing a Cas2 polypeptide.
13. The method of claim 11, wherein the method is performed in a bacterial cell.
14. The method of claim 11, wherein the method is performed in a eukaryotic cell.
15. The method of claim 13, wherein the cell is comprised in an organism.
16. The method of claim 1, wherein the Cas1 recognition sequence comprises a CRISPR repeat sequence.
17. The method of claim 16, wherein the CRISPR repeat sequence comprises SEQ ID NO: 1 (GTTTCAGACCCGCTGGCCGCTTAGGCCGTTGAGAC).
18. A RNA-DNA hybrid produced according to the method of claim 1.
19-52. (canceled)
53. A isolated population of polynucleotides comprising a population of DNA-RNA chimeric molecules, each molecule comprising: (i) a first dsDNA region; (ii) a DNA/RNA region comprising one RNA strand and a complementary DNA strand; and (iii) a second dsDNA region.
54-62. (canceled)
63. An expression construct comprising a sequence encoding (i) a RT and a Cas1 protein or a RT-Cas1 fusion protein; and (ii) comprising a sequence encoding a CRISPR adaptation gene.
64-82. (canceled)
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0045] The following drawings form part of the present specification and are included to further demonstrate certain aspects of the present invention. The invention may be better understood by reference to one or more of these drawings in combination with the detailed description of specific embodiments presented herein.
[0046]
[0047]
[0048]
[0049]
[0050]
[0051]
[0052]
[0053]
[0054]
[0055]
[0056]
[0057]
[0058]
[0059]
[0060]
[0061]
DESCRIPTION OF ILLUSTRATIVE EMBODIMENTS
[0062] CRISPR systems mediate adaptive immunity in diverse prokaryotes. CRISPR-associated Cas1 and Cas2 proteins have been shown to enable adaptation to new threats in type I and II CRISPR systems by the acquisition of short segments of DNA (i.e., spacers) from invasive elements. In several type III CRISPR systems, Cas1 is naturally fused to a reverse transcriptase (RT). In the marine bacterium Marinomonas mediterranea (MMB-1), the inventors showed that a RT-Cas1 fusion protein enables the acquisition of RNA spacers in vivo in a RT-dependent manner. In vitro, the MMB-1 RT-Cas1 and Cas2 proteins catalyze the ligation of RNA segments into the CRISPR array, which is followed by reverse transcription. Accordingly, these observations outline a host-mediated mechanism for reverse information flow from RNA to DNA.
[0063] Thus, methods of the present disclosure overcome challenges associated with current technologies by providing an RT-Cas1 fusion protein to site-specifically ligate RNA and/or DNA to a target sequence in vivo or in vitro. In one method, the RT-Cas1 and Cas2 protein complex cleaves the CRISPR array site specifically at the junctions between the leader and first repeat on the top strand and between the first repeat and spacer on the bottom strand, producing a staggered cut. Concomitantly, short polynucleotides (e.g., 19-59 nt long, single-stranded or double-stranded RNA or DNA) are ligated covalently to the 3′ fragment of the CRISPR DNA. This produces a molecule that has, for example, a single stranded RNA attached to a short single stranded DNA followed by a segment of double-stranded DNA. This product allows for ‘filling-in’ the single stranded DNA-RNA hybrid by using the reverse transcriptase activity of the RT-Cas1 protein in the complex, and thus producing, for example, a labelled complementary molecule for further analysis.
[0064] In addition, the reverse transcriptase activity of the RT-Cas1 protein complex produces a DNA copy of any RNA ligated to the target DNA. This method improves on protein complexes that can only use double stranded DNA, and it also includes reverse transcriptase activity to produce cDNAs. Accordingly, the RT-Cas1 protein complex could be developed for use as a single-step RNAseq method for diagnostics, research and therapy. Additionally, it can be used for environmental monitoring of pathogens, and for general use as a reagent in molecular biology research.
II. DEFINITIONS
[0065] As used herein, “essentially free,” in terms of a specified component, is used herein to mean that none of the specified component has been purposefully formulated into a composition and/or is present only as a contaminant or in trace amounts. The total amount of the specified component resulting from any unintended contamination of a composition is therefore well below 0.05%, preferably below 0.01%. Most preferred is a composition in which no amount of the specified component can be detected with standard analytical methods.
[0066] As used herein the specification, “a” or “an” may mean one or more. As used herein in the claim(s), when used in conjunction with the word “comprising,” the words “a” or “an” may mean one or more than one.
[0067] The use of the term “or” in the claims is used to mean “and/or” unless explicitly indicated to refer to alternatives only or the alternatives are mutually exclusive, although the disclosure supports a definition that refers to only alternatives and “and/or.” As used herein “another” may mean at least a second or more.
[0068] Throughout this application, the term “about” is used to indicate that a value includes the inherent variation of error for the device, the method being employed to determine the value, or the variation that exists among the study subjects.
[0069] By “expression construct” or “expression cassette” is meant a nucleic acid molecule that is capable of directing transcription. An expression construct includes, at a minimum, one or more transcriptional control elements (such as promoters, enhancers or a structure functionally equivalent thereof) that direct gene expression in one or more desired cell types, tissues or organs. Additional elements, such as a transcription termination signal, may also be included.
[0070] A “vector” or “construct” (sometimes referred to as a gene delivery system or gene transfer “vehicle”) refers to a macromolecule or complex of molecules comprising a polynucleotide to be delivered to a host cell, either in vitro or in vivo.
[0071] A “plasmid,” a common type of a vector, is an extra-chromosomal DNA molecule separate from the chromosomal DNA that is capable of replicating independently of the chromosomal DNA. In certain cases, it is circular and double-stranded.
[0072] An “origin of replication” (“ori”) or “replication origin” is a DNA sequence, e.g., in a lymphotrophic herpes virus, that when present in a plasmid in a cell is capable of maintaining linked sequences in the plasmid and/or a site at or near where DNA synthesis initiates. As an example, an ori for EBV includes FR sequences (20 imperfect copies of a 30 bp repeat), and preferably DS sequences; however, other sites in EBV bind EBNA-1, e.g., Rep* sequences can substitute for DS as an origin of replication (Kirshmaier and Sugden, 1998). Thus, a replication origin of EBV includes FR, DS or Rep* sequences or any functionally equivalent sequences through nucleic acid modifications or synthetic combination derived therefrom. For example, the present disclosure may also use genetically engineered replication origin of EBV, such as by insertion or mutation of individual elements, as specifically described in Lindner, et. al., 2008.
[0073] A “gene,” “polynucleotide,” “coding region,” “sequence,” “segment,” “fragment,” or “transgene” that “encodes” a particular protein, is a nucleic acid molecule that is transcribed and optionally also translated into a gene product, e.g., a polypeptide, in vitro or in vivo when placed under the control of appropriate regulatory sequences. The coding region may be present in either a cDNA, genomic DNA, or RNA form. When present in a DNA form, the nucleic acid molecule may be single-stranded (i.e., the sense strand) or double-stranded. The boundaries of a coding region are determined by a start codon at the 5′ (amino) terminus and a translation stop codon at the 3′ (carboxy) terminus. A gene can include, but is not limited to, cDNA from prokaryotic or eukaryotic mRNA, genomic DNA sequences from prokaryotic or eukaryotic DNA, and synthetic DNA sequences. A transcription termination sequence will usually be located 3′ to the gene sequence.
[0074] The term “promoter” is used herein in its ordinary sense to refer to a nucleotide region comprising a DNA regulatory sequence, wherein the regulatory sequence is derived from a gene that is capable of binding RNA polymerase and initiating transcription of a downstream (3′ direction) coding sequence. It may contain genetic elements at which regulatory proteins and molecules may bind, such as RNA polymerase and other transcription factors, to initiate the specific transcription of a nucleic acid sequence. The phrases “operatively positioned,” “operatively linked,” “under control,” and “under transcriptional control” mean that a promoter is in a correct functional location and/or orientation in relation to a nucleic acid sequence to control transcriptional initiation and/or expression of that sequence.
[0075] The term “cell” is herein used in its broadest sense in the art and refers to a living body that is a structural unit of tissue of a multicellular organism, is surrounded by a membrane structure that isolates it from the outside, has the capability of self-replicating, and has genetic information and a mechanism for expressing it. Cells used herein may be naturally-occurring cells or artificially modified cells (e.g., fusion cells, genetically modified cells, etc.).
[0076] As used herein, “expression” refers to the process by which a polynucleotide is transcribed from a DNA template (such as into and mRNA or other RNA transcript) and/or the process by which a transcribed mRNA is subsequently translated into peptides, polypeptides, or proteins. Transcripts and encoded polypeptides may be collectively referred to as “gene product.” If the polynucleotide is derived from genomic DNA, expression may include splicing of the mRNA in a eukaryotic cell.
[0077] The terms “polypeptide”, “peptide” and “protein” are used interchangeably herein to refer to polymers of amino acids of any length. The polymer may be linear or branched, it may comprise modified amino acids, and it may be interrupted by non-amino acids. The terms also encompass an amino acid polymer that has been modified; for example, disulfide bond formation, glycosylation, lipidation, acetylation, phosphorylation, or any other manipulation, such as conjugation with a labeling component. As used herein the term “amino acid” includes natural and/or unnatural or synthetic amino acids, including glycine and both the D or L optical isomers, and amino acid analogs and peptidomimetics.
[0078] A “fusion protein,” as used herein, refers to a protein having at least two heterologous polypeptides covalently linked in which one polypeptide comes from one protein sequence or domain and the other polypeptide comes from a second protein sequence or domain.
[0079] The term “thermostable” refers to the ability of an enzyme or protein (e.g., reverse transcriptase) to be resistant to inactivation by heat. Typically such enzymes are obtained from a thermophilic organism (i.e., a thermophile) that has evolved to grow in a high temperature environment. Thermophiles, as used herein, are organisms with an optimum growth temperature of 45° C. or more, and a typical maximum growth temperature of 70° C. or more. In general, a thermostable enzyme is more resistant to heat inactivation than a typical enzyme, such as one from a mesophilic organism. Thus, the nucleic acid synthesis activity of a thermostable reverse transcriptase may be decreased by heat treatment to some extent, but not as much as would occur for a reverse transcriptase from a mesophilic organism. “Thermostable” also refers to an enzyme which is active at temperatures greater than 38° C., preferably between about 38-100° C., and more preferably between about 40-81° C. A particularly preferred temperature range is from about 45° C. to about 65° C.
III. EXAMPLES
[0080] The following examples are included to demonstrate preferred embodiments of the invention. It should be appreciated by those of skill in the art that the techniques disclosed in the examples which follow represent techniques discovered by the inventor to function well in the practice of the invention, and thus can be considered to constitute preferred modes for its practice. However, those of skill in the art should, in light of the present disclosure, appreciate that many changes can be made in the specific embodiments which are disclosed and still obtain a like or similar result without departing from the spirit and scope of the invention.
Example 1
Common Features of RT-Cas1 fusions
[0081] To examine the phylogenetic distribution of fused RT-Cas1-encoding genes, the National Center for Biotechnology Information (NCBI) Conserved Domain Architecture Retrieval Tool (CDART) was used to retrieve protein records containing both a Cas1 domain (Pfam database PF01867) and a RT domain of any origin (Pfam database PF00078). Of 93 RT-Cas1-bearing species, all were from bacteria and none were from archaea. RT-Cas1 fusions were most prevalent among cyanobacteria, with 21% of casl-bearing F1 cyanobacteria carrying such fusions (
[0082] The Cas1-fused RT domains were most closely related to RTs encoded by mobile genetic elements (retrotransposons) known as mobile group II introns (Simon and Zimmerly, 2008; Toro and Nisa-Martínez, 2014). Two related structural families of RT-Cas1 proteins were identified. The more abundant family carries a canonical N-terminal RT domain with a conserved RT-0 motif characteristic of group II intron and non-long terminal repeat (LTR)-retrotransposon RTs (Malik et al., 1999; Blocker et al., 2005). This is likely also the case for MMB-1 RT-Cas1. The other group lacks the RT-0 motif, starting instead with an additional N-terminal domain containing a putative Cas6-like RNA recognition motif of the RAMP [repeat-associated mysterious protein (Makarova et al., 2006)] superfamily. Alignments of the retrovirus HIV-1 RT and a group II intron RT [Thermosynechococcus elongatus TeI4c RT (Mohr et al., 2013)] with representatives of the two RT-Cas1 fusion families (from Arthrospira platensis and Marinomonas mediterranea) revealed that both Cas1-fused RTs contain the seven conserved sequence motifs characteristic of the finger and palm regions of retroviral RTs. Each also shares the RT-2a motif, which is conserved in group II intron RTs and related proteins but not present in retroviral RTs, such as the HIV-1 RT (Malik et al., 1999; Blocker et al., 2005). The thumb/X domain, which is found in retroviral and group II intron RTs just downstream of the RT domain, appears to be missing in the Cas1-associated RTs (
[0083] The structural subcategories, limited phylogenetic distribution, and exclusive association with a subset of CRISPR types are consistent with a small number of common origins of RT-Cas1 fusions (Makarova et al., 2006; Simon and Zimmerly, 2008).
Example 2
Spacer Acquisition by the M. mediterranea Type III-B Machinery in an E. coli Host
[0084] To test whether RT-Cas1 proteins could facilitate the acquisition of new spacers, and to determine whether such spacers might be acquired from RNA, the type III-B CRISPR locus in M. mediterranea (MMB-1) (Solano and Sanchez-Amat, 1999) was chosen, because this is an, easily cultured, nonpathogenic member of the well-studied γ-probacteriumium class that contains a RT-Cas1-encoding gene. Spacer acquisition was first assessed after transplantation of the locus into the canonical γ-probacteriumium experimental model, Escherichia coli. Expression vectors were constructed carrying the type III-B operon of MMB-1 in two configurations, either as a single cassette consisting of the CRISP03 array, the genes encoding RT-Cas1 and Cas2, and an adjacent gene (encoding Marme_0670) with limited homology to the NERD (nuclease-related domain) family (Grynberg et al., 2004), or together with a second cassette encoding the remaining CRISPR-associated factors, Cmr1 to Cmr6 and Marme_0671 (
[0085] Specificity was further tested by evaluating the requirements for RT-Cas1 and Cas2 in spacer acquisition. Two point mutations, E870A and E790A, were constructed in the putative Cas1 active site of MMB-1 RT-Cas1 , based on a three-dimensional homology model computed using the Archaeoglobus fulgidus Cas1 crystal structure (Kim et al., 2013). Each point mutation abolished spacer acquisition, as did a 60-amino acid C-terminal deletion in Cas2 (
[0086] The majority (˜85%) of newly acquired spacers mapped to the E. coli genome, with the rest being derived from plasmid DNA (
Example 3
Transcription-Associated Spacer Acquisition in MMB-1 is RT-Dependent
[0087] The inability to detect RNA spacer acquisition in the ectopic E. coli assay could reflect the absence of required factors or conditions that are present in the native host, MMB-1. To assay spacer acquisition in MMB-1, the RT-Cas1 and Cas2 open reading frames (ORFs) were overexpressed along with Marme 0670 from a broad-host-range plasmid (pKT230), using the 100-bp sequence upstream of the MMB-1 16S ribosomal RNA (rRNA) gene as a F3 promoter (
[0088] In contrast to the E. coli data set, the genomic regions most frequently sampled by the RT-Cas1 spacer acquisition machinery in MMB-1 appeared to be genes that are typically highly expressed in bacteria. This association was further investigated between expression and spacer capture by obtaining RNA sequencing (RNAseq) expression profiles of two independent MMB-1 transconjugants carrying the RT-Cas1 expression vector. The 10% most highly expressed genes accounted for over 50% of newly acquired spacers, with the top 50% of expressed genes accounting for 90% of newly acquired spacers (
[0089] Spacers acquired from transcribed regions could conceivably be integrated into the CRISPR array in either a negative or a positive orientation. Among spacers that mapped to MMB-1 transcripts, there was observed at most a limited preference for the sense strand (
Example 4
RT-Cas1-Mediated Spacer Acquisition from RNA
[0090] The observed association between the gene expression level and the frequency of spacer acquisition in MMB-1, combined with the requirement of the RT domain for this association, is consistent with an acquisition process involving reverse transcription of an RNA molecule. Nonetheless, an alternative hypothesis is that acquisition of DNA spacers could result from increased accessibility of DNA in regions of high transcriptional activity.
[0091] The acquisition of DNA spacer sequences from an RNA molecule can be tested by placing a functional intron into a transcript, which is spliced to yield a ligated-exon junction sequence that is then captured as DNA (Boeke et al., 1995). To test whether the RT-Cas1 complex could acquire spacers directly from RNA, the self-splicing td group I intron, a ribozyme that catalyzes its own excision from its parent transcript, was used leaving behind a splice junction that was not present as a DNA sequence (Belfort et al., 1987). Intron-interrupted versions of two MMB-1 genes—the ssrA gene, encoding a small noncoding RNA [transfer mRNA (tmRNA) (Moore and Sauer, 2007)] and Marme_0982, encoding ribosomal protein S15—in both cases inserting the intron at sites that were well sampled in the spacer libraries. Each construct was designed with four to five mutations to optimize the flanking exon sequences for td intron splicing. These mutations allowed for unambiguously distinguishing between spliced (plasmid-expressed) and native (genomic) ssrA and ribosomal protein S15 transcripts (
[0092] Newly integrated spacers were assayed for in plasmid copies of CRISP03, recovering 80,136 new spacers that map to the MMB-1 genome. The protospacer length, sequence composition, and bias for highly expressed genes remained consistent with the previous results in MMB-1 (
Example 5
Ligation of RNA and DNA oligonucleotides Directly into CRISPR Repeats by a RT-Cas1-Cas2 Complex
[0093] The E. coli Cas1-Cas2 complex has been shown to ligate double-stranded DNA (dsDNA) directly into a supercoiled plasmid containing a CRISPR array by means of a concerted cleavage-ligation (transesterification) mechanism, analogous to that of retroviral integrases (Nunez et al., 2015). To investigate how MMB-1 RT-Cas1 functions in spacer acquisition, this activity was reconstituted in vitro using purified RT-Cas1 and Cas2 proteins. It was confirmed that wild-type RT-Cas1 protein has RT activity that is abolished by the deletion of the RT domain (RtΔ) or mutations at the RT active site (YADD to YAAA at amino acid positions 530 to 533) (
[0094] In initial assays using a dsDNA oligonucleotide, products derived from cleavage of the CRISPR substrate were readily detected in the presence of RT-Cas1 and Cas2 together but not in the presence of either protein alone (
[0095] Although the MMB-1 RT-Cas1-Cas2 complex functions similarly to the E. coli Cas1-Cas2 complex to site-specifically integrate putative spacer precursors into CRISPR arrays, it differs in being able to use a linear CRISPR DNA substrate and to insert not only dsDNA but also ssDNA and RNA oligonucleotides. The ligation of RNA and DNA oligonucleotides into the CRISPR DNA substrate differs in two respects. First, whereas the E870A mutation at the Cas1 active site abolishes ligation of both RNA and DNA oligonucleotides, deletion of the RT domain (RtΔ) abolishes ligation of RNA but not DNA oligonucleotides (
Example 6
Integrated RNA oligonucleotides are Reverse-Transcribed by the RT-Cas1-Cas2 Complex
[0096] It was next tested whether the RT-Cas1-Cas2 complex could reverse-transcribe an integrated RNA oligonucleotide in vitro to generate the cDNA precursor of a fully integrated RNA spacer. The cleavage ligation reactions on either side of repeat R1 generate products with 5′ overhangs that could potentially be substrates for target DNA-primed reverse transcription (TPRT) reactions, in which the 3′ end of the opposite strand is extended to yield a DNA copy of the repeat plus the ligated RNA oligonucleotide (
[0097] The synthesis of these cDNAs depends on the presence of the RNA oligonucleotide, the CRISPR DNA, and RT-Cas1-Cas2 (
[0098] It was then shown that the MMB1 RT-Cas1 fusion protein can mediate the direct acquisition of spacers from donor RNA, using the Cas1 integrase activity to directly ligate an RNA protospacer into CRISPR DNA repeats. The 3′ end generated by cleavage of the opposite DNA strand is then poised for use as a primer for TPRT (Zimmerly et al., 1995). This mechanism shares features with group II intron retrohoming, in which the intron RNA uses its ribozyme activity to insert itself directly into the host genome and is then converted to an intron cDNA by using the 3′ end generated by cleavage of the opposite DNA strand for TPRT (Lambowitz and Zimmerly, 2004). Because type III CRISPR systems are known to target RNA for degradation, and RT-Cas1-encoding genes are exclusively associated with such systems, RNA spacer acquisition makes these CRISPRs uniquely capable of generating immunity against parasitic RNA sequences, potentially including RNA phages and/or other “selfish” RNAs that maintain themselves through the action of host machinery (Blumenthal and Carmichael, 1979; Biebricher and Orgel, 1973; Konarska and Sharp, 1989; Flores et al., 2014). The acquisition of RNA spacers might also contribute to immune responses to highly transcribed regions of DNA phages and plasmids. This Cas1 could then be coupled to an interference system that targets DNA, RNA, or both (Marraffini and Sontheimer, 2008; Hale et al., 2009; Hale et al., 2012; Tamulaitis et al., 2014; Goldberg et al., 2014; Peng et al., 2015; Samai et al., 2015).
[0099] It is possible that fusion between the RT and Cas1 domains may not be necessary to facilitate uptake of RNA spacers; there are several examples of CRISPR loci in which genes encoding similar group II intron-like RTs are adjacent but not fused to Cas1 (Simon and Zimmerly, 2008). Thus, the mechanisms described in the present disclosure could potentially extend to species with separately encoded RT and Cas1 components. In addition, RNA spacer acquisition could be involved in gene regulation, providing a straightforward means for bacteria to down-regulate a set of target loci in response to activation of the CRISPR locus.
[0100] To fully assess the prevalence and importance of CRISPR adaptation to RNA, a greater understanding of the impact of invasive RNAs in bacteria is necessary. However, the knowledge of the abundance and distribution of RNA phages and other RNA parasites is limited, with the vast majority restricted to the Escherichia and Pseudomonas genera. Future research on the distribution of spacers in RT-associated CRISPR loci among natural populations of bacteria and their environments might help shed light on this topic.
Example 7
Materials and Methods
[0101] RT-Cas1 genomic neighborhood analysis: The genomic neighborhoods (up to 20 kb) of RTCas1-encoding genes were retrieved from 50 bacterial strains with a custom BioPython script that uses the NCBI tblastn software. The HMMER 3.0 algorithm was then used to identify whether the RT-Cas1-encoding genes were associated with type I, II, or III CRISPR systems, using Cas3 (TIGR 01587, 01596, 02562, 02621, and 03158), Cas9 (TIGR 01865 and 3031), and Cas10 (TIGR 02577 and 02578) hidden Markov models as “signature” genes for each type, respectively (Makarova et al., 2011). Each result was assessed manually by iterative runs of BLAST (Basic Local Alignment Iterative Search Tool, NCBI) and the CRISPR finder online suite.
[0102] Monte Carlo simulation of expected spacer acquisition characteristics for random sampling of all genes: A Monte Carlo simulation was used to evaluate a null hypothesis based on a random assortment of spacer acquisitions from genomic DNA, with no dependence on gene expression level. For each system, a series of samples of 500 spacers each were randomly chosen in silico from a list of all genes, based on the sizes of the individual genes using the stochastic universal sampling algorithm. Sets of 1000 such trials were used to generate a range of null relationships between gene expression and spacer acquisition. The Monte Carlo bounds depict the envelope of such simulated random assortments. Traces above this envelope indicate preferential spacer acquisition from highly expressed genes; traces below the envelope indicate spacer acquisition from poorly expressed genes more often than expected by random chance. RNAseq data from the E. coli K12 genome were obtained from (Haas et al., 2012) (data set without computational background subtraction). MMB-1 expression data were generated by RNAseq analysis of the transconjugants used in this study (
[0103] Construction of expression vectors: Plasmids for inducible overexpression of the MMB-1 type III-B CRISPR operon in E. coli were built on the pBAD/Myc-His B backbone (Life Technologies). RT-Cas1-associated genes [Marme_0670, Marme_0669 (RT-Cas1), and Marme_0668 (Cas2)] and green fluorescent protein (GFP) were driven by Para, and the CRISP03 array was driven by Ptrc. The other seven genes [Marme_0677 to 0672 (Cmr1 to -6) and Marme_0671] and lacZα were driven by Plac. GFP and lacZα ORFs enabled verification of expression of the transcripts containing RT-Cas1-associated adaptation genes and Cmr effector genes, respectively. Point mutants of the Cas1 (E790A or E870A) and RT domains (YADD to YAAA at amino acid positions 530 to 533) of the RT-Cas1-encoding gene were tested with overexpression of the RT-Cas1-associated subset, with and without the remaining seven genes. Deletion mutants of the RT domain of RT-Cas1 (Δ299-588), and Cas2 (Δ32-92) were tested with overexpression of the RTCas1-associated subset only.
[0104] Plasmids for the overexpression of the RTCas1-associated genes in MMB-1 cells were built on the pKT230 backbone (a gift from L. Banta, Williams College). The genes were driven by the 100-bp promoter-containing sequence (MMB-1 chromosome position 306879 to 306978) upstream of a MMB-1 16S rRNA gene. Cas1 point mutants (E790A or E870A) and the RTΔ mutant were also tested. For experiments with td intron-containing constructs, a copy of the CRISP03 array with its leader sequence was also placed on the pKT230 vector to increase the concentration of CRISPR arrays per unit input DNA in the PCR amplification step, and thus increase the efficiency of the spacer detection assay.
[0105] Plasmids for protein expression and purification were built on the pMal-c2X backbone [New England Biolabs (NEB)] for RT-Cas1 (wild type and mutants) and on the pET14b backbone (Novagene) for Cas2. Variants of RT-Cas1 were expressed with an N-terminal maltose-binding protein tag attached via a noncleavable rigid linker (Mohr et al., 2013). Cas2 was expressed with a N-terminal 6xHis tag. All plasmids were verified by sequencing.
[0106] Strains and culture conditions: All bacterial strains used in this study were stored in 20% glycerol at -80° C. Two clones from each conjugation were maintained for each plasmid (referred to as independent transconjugants).
[0107] pBAD plasmids (AmpR) encoding MMB-1 type III-B operon components were transformed into chemically competent TOP10F′ cells (Life Technologies). TOP10F′-derived strains were grown at 37° C. on Luria-Bertani (LB) agar plates (10 g/l tryptone, 5 g/l yeast extract, 10 g/l NaCl, and 15 g/l agar) with 100 mg/ml of ampicillin, 0.1% w/v arabinose, and 0.1 mM IPTG (isopropyl-β-D-thiogalactopyranoside) overnight.
[0108] pKT230 plasmids (KanR) encodingMMB-1 type III-B operon components were mobilized into a spontaneous rifampicin-resistant mutant of MMB-1 (strain ATCC 700492) from a donor E. coli strain carrying the pRL443 conjugal plasmid (a gift from M. Davison, Carnegie Institution), as described in (51). All transformed MMB-1 strains were grown on 2216 marine agar (Difco) with 50 mg/ml of kanamycin for 16 hours at 25° C.
[0109] For experiments with MMB-1 transconjugants carrying td intron constructs, 150-ml cultures were subsequently prepared in 2216 broth (Difco) with 50 mg/ml of kanamycin and shaken at 26° to 27° C. in 1-liter flasks for 20 hours before midiprep. E. coli strain DH5a (Life Technologies) was used for cloning and Rosetta2 and Rosetta2 (DE3) (Novagen) were used for protein expression. Bacteria were grown in LB medium with shaking at 200 rpm. Antibiotics were added when needed (ampicillin, 100 mg/1; chloramphenicol, 25 mg/l).
[0110] Nucleic acid extraction: Plasmid DNA from E. coli strains was extracted using the QIAprep Spin Miniprep Kit (QIAGEN). Genomic DNA fromMMB-1 strains was extracted using a modified SDS-protease K method: Briefly, cells were scraped from plates and resuspended in 1 ml of lysis buffer (10 mMtris, 10 mM EDTA, 400 mg/ml proteinase K, and 0.5% SDS) and incubated at 55° C. for 1 hour. Digest (50 to 100 ml) was subsequently purified using the Genomic DNA Clean & Concentrator Kit (Zymo Research).
[0111] Total RNA was extracted from MMB-1 strains using a combined trizol-RNeasy method: Briefly, cells were scraped from plates and homogenized directly in 1 ml of trizol (Life Technologies) by vortexing, and total RNA was extracted with 200 ml of chloroform. Ethanol (500 ml) was added to an equal volume of the aqueous phase containing RNA, and the mixture was purified using the RNeasy Kit (QIAGEN) with on-column DNase digestion according to the manufacturer's instructions. This protocol selects RNA >200 nt and thus depletes transfer RNAs. Plasmid DNA was purified from large MMB-1 cultures using a custom midi prep method. Cells were harvested from 150- to 200-ml confluent cultures (3000 g, 30 min, 4° C.) and homogenized in 12 ml of alkaline lysis buffer (40 mM glucose, 10 mM tris, 4 mM EDTA, 0.1 N NaOH, and 0.5% SDS) at 37° C. by pipetting until clear (10 to 15 min). Chilled neutralization buffer (8 ml) was added (3 M CH3COOK and 2 M CH3COOH), and lysates were immediately transferred to ice to prevent digestion of genomic DNA. Samples were mixed by inverting, and the genomic DNA-containing precipitate was removed by centrifugation (20,000 g, 20 min, 4° C.). Clarified lysates were extracted twice with a 1:1 mixture of tris-saturated phenol (Life Technologies) and CHCl3 (Fisher Scientific) and once with CHCl3 in heavy phase lock gel tubes (5 Prime). Ethanol (50 ml) was added and DNA was pelleted by centrifugation (16,000 g, 20 min, 4° C.), washed twice in 80% ethanol, and resuspended in 500 μof elution buffer (10 mM tris, pH 8.5). Samples were treated with 20 μg/ml RNase A (Life Technologies) at 37° C. for 30 min, further digested with 150 μg/ml of proteinase K in 0.5% SDS at 50° C. for 30 min, and purified by organic extraction. Plasmid DNA was resuspended in 0.5 ml of elution buffer, desalted with Illustra NAP-5 G-25 Sephadex columns (GE Healthcare), and eluted with 1 ml of water. Batches of 100 μl were linearized with PvuII-HF (NEB) to aid denaturation during PCR. Last, each digest was purified using a Genomic DNA Clean & Concentrator column (Zymo Research). DNA and RNA preparations were quantified using a fluorometer (Qubit 2.0, Life Technologies).
[0112] Spacer Sequencing: Leader proximal spacers were amplified by PCR from 3 to 4 ng of genomic DNA per ml of PCRmix using
TABLE-US-00007 forward primer AF-SS-119 (CGACGCTCTTCCGATCTNNNNNCTGAAATGATTGGAAAAAATAAGG, SEQ ID NO: 15)
anchored in the leader sequence and
TABLE-US-00008 reverse primer AF-SS-121 (ACTGACGCTAGTGCATCACGTGGCGGAGATCTTTAA, SEQ ID NO: 16)
in the first native spacer. For each sample, 96 10-μl reactions were pooled. Sequencing adaptors were then attached in a second round of PCR with 0.01 volumes of the previous reaction as a template, using
TABLE-US-00009 AF-SS-44:55 (CAAGCAGAAGACGGCATACGAGATNNNNNNNN GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCACTGACGCTAGTGCAT CA, SEQ ID NO: 17) and AFKLA-67:74 (AATGATACGGCGACCACCGAGATCTACAC NNNNNNNN ACACTCTTTCCCTACACGACGCTCTTCCGATCT, SEQ ID NO: 18),
where the (N)8 barcodes correspond to TruSeq HT indexes D701 to D712 (reverse-complemented) and D501 to D508, respectively (Illumina). Template matching regions in primers are underlined. Phusion High-Fidelity PCR Master Mix with HF Buffer (Fisher Scientific) was used for all reactions. Cycling conditions for round 1 were as follows: one cycle at 98° C. for 1 min; two cycles at 98° C. for 10 s, 50° C. for 20 s, and 72° C. for 30 s); 24 cycles at 98° C. for 15 s, 65° C. for 15 s; and 72° C. for 30 s); and one cycle at 72° C. for 9 min. Conditions for round 2 were one cycle at 98° C. for 1 min; two cycles at 98° C. for 10 s, 54° C. for 20 s, and 72° C. for 30 s; five cycles at 98° C. for 15 s, 70° C. for 15 s, and72° C., 30 s; and one cycle at 72° C. for 9 min. The dominant amplicons containing the first native spacer from unmodified CRISPR templates after rounds 1 and 2 were 123 bp and 241 bp, respectively. We prepared sequencing libraries by blind excision of gel slices at 300 to 320 bp (70 bp above the 241-bp band, consistent with the expected size of an amplicon from an expanded CRISPR array) after agarose electrophoresis (3%, 4.2 V/cm, 2 hours) of the round 2 amplicons.
[0113] When amplifying spacers from plasmids, 1 ng of DNA was used per microliter of PCR mix, synthesis time was shortened to 15 s, and 20 and nine cycles were used in rounds 1 and 2 instead of 24 and five, respectively. Additionally, round 1 amplicons were purified by blind excision of gel slices at 180 to 200 nt after denaturing PAGE (polyacrylamide gel electrophoresis) [pre-run TBEUrea 10% gels (Novex), 180 V, 80 min in XCell SureLock Mini-Cells (Life Technologies)], and agarose gel-purified libraries were further PAGEpurified by blind excision of gel slices at 300 to 320 nt (pre-run TBE-Urea 6% gels, 180 V, 90 min as above). In this way, spacer detection efficiency was increased ˜100-fold. Libraries were quantified by Qubit and sequenced with MiSeq v3 kits (Illumina) (150 cycles, read 1; 8 cycles, index 1; and 8 cycles, index 2).
[0114] Spacers were trimmed from reads using a custom Python script and considered identical if they differed only by one nucleotide. Protospacers were mapped using Bowtie 2.0 (“very-sensitive local” alignments). These methods preserve strand information.
[0115] Directional RNAseq profiling of MMB-1 strains: Total RNA (1 μg) was incubated at 95° C. in alkaline fragmentation buffer (2 mM EDTA, 10 mM Na.sub.2CO.sub.3, and 90 mM NaHCO.sub.3; pH-9.3) for 45 min and PAGE-purified [pre-run 15% TBE-Urea precast gels, 200 V, 45 min in Mini-PROTEAN electrophoresis cells (Bio-Rad)] to select 30- to 80-nt fragments. RNA fragments were 3′ -dephosphorylated with T4 polynucleotide kinase (NEB) at 37° C. for 60 min in the supplied buffer, then desalted by ethanol precipitation. Desphosphorylated RNA was denatured again in adenylated ligation buffer [3.3 mM dithiothreitol (DTT), 10 mM MgCl.sub.2, 10 μg/ml acetylated BSA, 8.3% glycerol, and 50 mM HEPES-KOH; pH ˜8.3) for 1 min at 98° C. and ligated to pre-adenylated adaptor AF-JA-34 (/5rApp AGATCGGAAGAGCACACGTCT/3ddC/, SEQ ID NO: 19) at 22° C. for 4 hours using 10 U T4 RNA Ligase I (NEB). The (N).sub.6 barcode for each RNA fragment allowed us to computationally collapse PCR bias. Excess adaptor was removed by treatment with 5′ deadenylase (NEB) followed by RecJf (NEB) treatment and organic extraction to purify ligation products. RNA was reverse transcribed using primer AF-JA-126 (/5Phos/AGATCGGAAGAGCGTCGTGT/iSp18/CACTCA/iSp18/GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT, SEQ ID NO: 20) with SuperScript II (Life Technologies) and subsequently hydrolyzed in 0.1 M NaOH at 70° C. for 15 min. cDNAwas PAGE-purified (pre-run 10% TBE-urea gels, 200 V, 45 min in Mini-PROTEAN electrophoresis cells) to select 90- to 150-nt fragments and circularized with 50U CircLigase I (Epicentre). Libraries were prepared by six to 14 cycles of PCR with universal adaptor AF-JA-158 (AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATC T, SEQ ID NO: 21) and indexing primers AF-JA-118:125 (CAAGCAGAAGACGGCATACGAGAT NNNNNN GTGACTGGAGTTCAGACGTGTGCTCTTCCG, SEQ ID NO: 22) where the (N).sub.6 barcodes correspond to TruSeq LT indexes AD001 to AD008 (Illumina). Amplicons of 160 to 200 bp were gel purified by agarose electrophoresis.
[0116] Construction and validation of td intron constructs: Constructs with the following features were ordered as gBlocks (Integrated DNA Technologies) and cloned downstream of the T7 promoter in pCR-Blunt II-TOPO (Life Technologies). Bases 208 to 216 (CTTAAGCGT) of the ribosomal protein S15 gene (Marme_0982) and bases 67 to 75 (CGTAAATCC) of the ssrA tmRNA gene (Marme_R0008) were replaced with the wild-type td intron splice junction (CTTGGGT|CT). The 393-bp intron sequence was inserted at the exon junction|. Included were 128 bp of upstream sequence for Marme_0982 and 183 bp of upstream sequence and30bp of downstream sequence for Marme_R0008. Transcripts were generated from linearized plasmids using the MEGAscript T7 Transcription kit (Life Technologies). Mostly unspliced RNA was obtained by arresting the transcription reaction after 5 min at 37° C. and subsequently extracting it with acidified phenol:CHCl3 (Life Technologies). One-third of the reaction product was incubated in a splicing buffer (40 mM tris at pH 7.5, 6 mM MgCl.sub.2, 100 mM KCl, and 1 mM ribo-GTP) at 37° C. for 30 min and desalted by ethanol precipitation. Spliced and unspliced transcripts were visualized by 1/4× tris-acetate-EDTA native agarose gel electrophoresis, with a 100-bp Quickload dsDNA ladder (NEB) providing approximate sizing. Intron containing genes were then transferred to pKT230-derived MMB-1 overexpression vectors carrying RT-Cas1-associated genes and a copy of the CRISP03 array. One clone each from two independent conjugations was isolated for each vector.
[0117] In vivo splicing efficiency was measured by high-throughput sequencing as follows. Total RNA was extracted and 1 μg was reverse-transcribed (SuperScript III, high GC content protocol; Life Technologies) with gene-specific primers downstream of the splice junctions that would bind both spliced and unspliced transcripts: AF-SS-238 (CTTAGCGACGTAGACCTAGTTTTT, SEQ ID NO: 23) for Marme_0982 and AF-SS-241 (GGTTATTAAGCTGCTAAAGCGTAG, SEQ ID NO: 24) for Marme_R0008. cDNA was treated with RNase H, and libraries were prepared by a two round PCR method adapted from the CRISPR spacer sequencing method described above. Round 1 of PCR was performed at annealing temperatures of 48° and 65° C. for two and 19 cycles, respectively, with primers
TABLE-US-00010 AF-SS-242 (CGACGCTCTTCCGATCTNNNNNGATTCGCATGGTAAAC, SEQ ID NO: 25) and AF-SS-243 (ACTGACGCTAGTGCATCAAACTAGTGTAACGTGCTG, SEQ ID NO: 26)
for Marme_0982, and for two and 16 cycles, respectively, with primers
TABLE-US-00011 AF-SS-247 (CGACGCTCTTCCGATCTNNNNNCACGAACCTGAGGTG, SEQ ID NO: 27) and AF-SS-248 (ACTGACGCTAGTGCATCACGTCGTTTGCGACTATATAATTGA, SEQ ID NO: 28)
for Marme_R0008. This approach simultaneously generated amplicons of identical length for both spliced and unspliced transcripts, which were then attached to adaptors (Illumina) with a second round of PCR as before.
[0118] The presence of exon-junction sequences corresponding to the td intron constructs in DNA form outside the CRISPR arrays was also tested by high-throughput sequencing. Libraries consisting of the ˜100-bp region containing the td intron insertion sites in Marme.sub.—R0008 and Marme_0982 were prepared by a two-round PCR method identical to the one described above for measuring splicing efficiency by RT-PCR, using 100 ng of genomic DNA (˜2×107 copies) as a template instead of reverse-transcribed cDNA. Round 1 of PCR was performed at annealing temperatures of 57° C. and 68° C. for two and 16 cycles, respectively, with primers
TABLE-US-00012 AF-SS-318 (CGACGCTCTTCCGATCTNNNNNCACATTCATGACCACCATTCTCG, SEQ ID NO: 29) and AF-SS-309 (ACTGACGCTAGTGCATCACTTCGGTCTTAGCGACGTAGAC, SEQ ID NO: 30)
for Marme_0982 and primers
TABLE-US-00013 AF-SS-310 (CGACGCTCTTCCGATCTNNNNNGGGGTGACATGGTTTCGACG, SEQ ID NO: 31) and AF-SS-311 (ACTGACGCTAGTGCATCAGCAGGTTATTAAGCTGCTAAAGCG, SEQ ID NO: 32)
for Marme R0008. The amplicons were then attached to adaptors (Illumina) with a second round of PCR as before. Each library was sequenced to a depth of ˜5million reads. To ensure that the PCR was not bottlenecked, we also included a spike-in (1 molecule per 1000 copies of the MMB-1genome) of synthetic ssDNA templates-AF-SS-312 (TAAAAACATTGAAGGTCTA CAAGGTCACTTTAAAGCTCACATTCATGACCACCATTCTCGTCGCNNNNNNNNNNNN ATGGTAAACCAACGTCGTAAGTTGTTGGATTACCAGCTGCGTAAAGACGCAGCACG TTACACTAGTTTGANNNNNNNNNNNNGTCTACGTCGCTAAGACCGAAG, SEQ ID NO: 33) for Marme_0982 and AF-SS-313 (GGGGTGACATGGTTTCGACG NNNNNNNNNNNNCCTGAGGTGCATGTCGAGAGTGATACGTGATCTCAGCTGTCCCC TCGTATCAATTATATAGTCGCAAANNNNNNNNNNNNCGCTTTAGCAGCTTAATAAC CTGCTAGTGTGCTGCCCTCAGGTTGCTTGTAGCCCGAGATTCCGCAGT, SEQ ID NO: 34) for Marme.sub.—R0008—that could be amplified concomitantly by the same primer sets to yield identically sized amplicons.
[0119] The spike-in derived reads are easily identified by sequence, with the diversity of randomized (N).sub.12 segments used to evaluate the degree to which distinct reads in the amplified pool represent independent molecules from the pre-amplification mixture. A large number of spike-in barcodes (ideally a different barcode for every spike-in read) indicate that a high fraction of reads from the amplified pool represent unique molecules in the initial sample, whereas repeated appearances of a small number of (N).sub.12 barcodes in the amplified pool would be indicative of bottleneck formation during PCR (and hence a less than optimal relationship between read counts and molecules in the initial pool). For the purpose of estimating the number of molecules sampled from an initial pool, we calculated a nonredundancy fraction, which is the ratio of spike-in-derived barcodes to total spike-in-derived reads. The nonredundancy fraction provides a multiplier that can be used to correct raw read counts from an amplified pool to obtain an estimate of the contributing number of molecules from the initial pool. This is particularly applicable for estimating a minimal incidence of a rare class (i.e., setting a detection limit for spliced copies of the td intron-containing DNA constructs in this work). Given nonredundancy fractions of >0.45 for all samples in these experiments, the observed totals of control (nonspliced, genomic) sequence reads (
[0120] PCR Fidelity: Analyzing sequence distributions through PCR and sequencing entails certain best practices in terms of both experimental protocols and analysis. In particular, several precautions were observed in constructing sequencing libraries for spacer sequencing. PCR titrations were performed to ensure that the amplification kinetics were in the linear range of the reactions before any size selection step (e.g., band excision from native agarose gels); this avoids renaturation artifacts in complex sequence pools. The overall error rate was empirically determined for every experiment by analyzing the distribution of mismatches in the sequences obtained from the first native spacer in the CRISP03 array; this enabled the estimation of the error rate in the region of the sequencing reads that contained newly acquired spacers. PCR bottlenecking was also measured as the number of repeat occurrences of any given new spacer. All synthetic sequences that could lead to confounding contamination issues were avoided: No sequences from E. coli , MMB-1, or other sources have been synthesized as amplifiable substrates. As a benchmark for recovery of individual sequences, a nonbacterial sequence was synthesized as a spacer flanked by the appropriate CRISPR repeats. This repeat-flanked spacer sequence (CTGGGACATATAATATCGTCCCCGTAGATGCCTAT (SEQ ID NO: 35); a segment of the phage MS2) was recovered effectively in experiments with an E. coli transformant carrying a plasmid with the indicated template. Appearances of MS2 sequences in other trials were limited to this single sequence, indicating a likely source due to a low level of cross sample “bleeding.”
[0121] Protein purification: Expression plasmids were transformed into E. coli strains Rosetta2 (pMal derivatives) or Rosetta2 (DE3), and single transformed colonies were grown in an LB medium supplemented with appropriate antibiotics over night at 37° C. with shaking. Six flasks each containing 1 liter LB were inoculated with 1% of the overnight culture and grown at 37° C. with shaking to log phase. After the culture reached an optical density at 600 nm of ˜0.8, IPTG was added to 1 mM final concentration and the cultures were incubated at 19° C. for 20 to 24 hours. Cells were harvested by centrifugation and the pellet was dissolved in A1 buffer (25 mM KPO4, pH 7; 500 mM NaCl; 10% glycerol; 10 mM β-mercaptoethanol; 10 ml/g cell paste) on ice. Lysozyme was added to 1 mg/ml final concentration and incubated at 4° C. for 0.5 hours. Cells were then sonicated (Branson Sonifier 450; three bursts of 15 s each with 15 s between each burst). The lysate was cleared by centrifugation (29,400 g, 25 min, 4° C.), and polyethyleneimine (PEI) was added to the supernatant in six steps on ice with stirring to a final concentration of 0.4%. After 10 min, precipitated nucleic acids were removed by centrifugation (29,400 g, 25 min, 4° C.), and proteins were precipitated from the supernatant by adding ammonium sulfate to 60% saturation on ice and incubating for 30 min. Proteins were collected by centrifugation (29,400 g, 25 min, 4° C.), dissolved in 20 ml A1 buffer, and filtered through a 0.45-mm polyethersulfone membrane (Whatman Puradisc).
[0122] Protein purification was achieved by using a BioLogic fast protein liquid chromatography system (BioRad). RT-Cas1 was purified by loading the filtered crude protein onto an amylose column (30 ml; NEB Amylose High Flow resin), washing with 50 ml of A1 buffer, followed by 30 ml A1 plus 1.5M NaCl and 30 ml of A1 buffer. Bound proteins were eluted with 50 ml of 10 mM maltose in A1 buffer. Fractions containing RT-Cas1 were identified by SDS-PAGE, pooled, and diluted to 250 mM NaCl. The protein was then loaded onto a 5-ml heparin-Sepharose column (HiTrap Heparin HP column; GE Healthcare) and eluted with a 100 mM to 1-M NaCl gradient. Peak fractions (˜700 mM NaCl) were identified by SD S-PAGE, pooled, and dialyzed into A1 buffer. The dialyzed protein was concentrated to >10 mM using an Amicon Ultra Centrifugal Filter (Ultracel-50K). The protein was stable in A1 buffer on ice for about 3 months.
[0123] The initial steps in the Cas2 purification were similar, except that the cell paste was resuspended in N1 buffer (25 mM tris-HCl, pH 7.5; 500 mM KCl; 10 mM imidazole; 10% glycerol; and 10 mM DTT) and the ammonium sulfate precipitation step was omitted. Instead, the Cas2 PEI supernatant was loaded directly onto a 5-ml nickel column (HiTrap Nickel HP column; GE Healthcare) and eluted with an imidazole gradient (60 ml 10 to 500 mM in N1 buffer). Peak fractions containing Cas2 were identified by SD S-PAGE and pooled. After adjusting the KCl concentration to 200 mM, the pooled fractions were loaded onto two tandem 5-ml heparin-Sepharose columns. The protein was eluted with a linear KCl gradient (50 ml, 100 mM to 1 M), and Cas2 peak fractions (˜800 mM KCl) were identified by SDS-PAGE and stored on ice in elution buffer. The protein was stable on ice for several months. All protein concentrations were measured using the Qubit Protein assay kit (Life Technologies) according to the manufacturer's protocol. Proteins were >80% pure based on densitometry.
[0124] Formation of RT-Cas1+Cas2 complex: Purified RTCas1 (2500 pMol) was mixed with a two-fold excess of purified Cas2 in 250 mM KCl, 250 mM NaCl, and 12.5 mM tris-HCl (pH 7.5); 12.5 mM KPO.sub.4 (pH7); 5 mM DTT; 5 mM BME; and 10% glycerol and incubated on ice for >16 hours prior to reactions.
[0125] RT assay: RT assays with poly(rA)/oligo(dT).sub.24 were performed by pre-incubating poly(rA)/oligo(dT).sub.24 (80 μM and 50 μM, respectively) in 200 mM KCl, 50 mM NaCl, 10 mM MgCl.sub.2, and 20 mM tris-HCl (pH 7.5); 1 mM unlabeled deoxythymidine triphosphate (dTTP); and 5 mCi [α-32P]-dTTP (3000 Ci/mmol; PerkinElmer) for 2 min at the desired temperature, then initiating the reaction by adding the RT-Cast proteins (1 to 2 mM final concentration). The reactions (20 to 30 ml) were incubated for times up to 30min. A 3-μl sample was withdrawn at each time point and added to 10 μl of stop solution (0.5% SDS and 25 mM EDTA). Reaction products were spotted onto Whatman DE81 paper (10×7.5-cm sheets; GEHealthcare Biosciences), which was then washed three times with 0.3M NaCl and 0.03 M sodiumcitrate, dried, and scanned with a Phosphorlmager (Typhoon Trio Variable Mode Imager; GEHealthcare Biosciences) to quantify the bound radioactivity.
[0126] CRISPR DNA cleavage/ligation assay: MMB-1 CRISPR DNA substrate was a PCR product amplified with primers MMB 1 cri sp5b (CACTCGACCGGAATTATCGACGAA, SEQ ID NO: 36) and MMB1crisp3 (TCTGAAACTCTGAATACTAACGAAAAATAG, SEQ ID NO: 37) using Phusion High-fidelity DNA polymerase according to the manufacturer's protocol (NEB or Thermo Scientific). The resulting 268-bp PCR fragment contains 120 bp of the leader, 35 bp of repeat 1, 33 bp of spacer 1, 35 bp of repeat 2, 37 bp of spacer 2, and 8 bp of repeat 3. Internally labeled substrate was prepared by adding 25 μCi [α-.sup.32P]-dTTP or dCTP (Perkin Elmer) and 40 μM dTTP or dCTP, respectively, to the PCR reactions. Labeled DNA was purified by electrophoresis in a native 6% polyacrylamide gel, cutting out the labeled band, and electro-eluting the DNA using midi DTube dialyzer cartridges (Novagen). The eluted DNA was extracted with phenol:chloroform:isoamyl alcohol (phenol-CIA), ethanol-precipitated, and quantitated using a Qubit dsDNA assay kit (Life Technologies).
[0127] CRISPR DNA cleavage-ligation assays contained RTCas1 -Cas2 complex (500 nM final), MMB-1 CRISPR substrate (1 nM), 20 mM tris (pH 7.5), and 7.5 mM free MgCl2. DNA or RNA oligonucleotides and dNTPs or Mg.sup.2+ were added at 2.5 mM and 1 mM final concentrations as indicated for individual experiments. Reactions were incubated at 37° C. for 1 hour and stopped by adding phenol-CIA. The supernatant was mixed at a 2:1 ratio with loading dye (90% formamide, 20 mM EDTA, and 0.25 mg/ml bromophenol blue and xyan cyanol), and nucleic acids were analyzed in a 6% polyacrylamide 7 M urea gel. Gels were dried and scanned with a phosphorimager.
[0128] Labeled DNA or RNA oligonucleotide ligation assays were performed as described above but using 22.5 μM unlabeled CRISPR PCR fragment and ˜0.25 μM 5′ -end-labeled gel-purified oligonucleotides. Control assays were performed without adding CRISPR PCR fragment. For nuclease treatment of oligonucleotide ligation to CRISPR DNA, reactions were scaled up fourfold, treated with phenol-CIA, and ethanol-precipitated. The precipitated nucleic acids were dissolved in 30 μl of water. Equal amounts were then either untreated or treated with RNase H (2 units, Invitrogen), DNase I (RNase-free, 10 units, Roche), RNase A/T1mix [0.5 mg RNaseA (Sigma) and 500 units RNase T1 (Ambion)] in 40 mM tris (pH 7.9), 10 mM NaCl, 6 mM MgCl2, and 1 mM CaCl2 for 20 min at 37° C. Samples were extracted with phenol-CIA to terminate the reaction and analyzed by electrophoresis in a denaturing polyacrylamide gel, as described above. Labeled cDNA extension reactionswere carried out as above but using cold CRISPR DNA and oligonucleotides with 0.25 mM unlabeled dATP, dGTP, and dTTP and 5 mCi [α-.sup.32P]-dCTP (3000 Ci/mMol, PerkinElmer). Oligonucleotides for cleavage/ligations assays were as follows: 29-nt DNA (TTTGGATCCTCATCTTTTAGGGCTCCAAG, SEQ ID NO: 38), 33-nt dsDNA-top (GATGCTTATGGTTATTGCAGCTACCCTCGCCCT, SEQ ID NO: 39), 33-nt dsDNA-bottom (AGGGCGAGGGTAGCTGCAATAACCATAAGCATC, SEQ ID NO: 40), 21-nt RNA (GCCGCUUCAGAGAGAAAUCGC, SEQ ID NO: 41), and 35-nt RNA (UUACGGUGCUUAAAACAAAACAAAACAAAACAAAA, SEQ ID NO: 42).
[0129] All of the methods disclosed and claimed herein can be made and executed without undue experimentation in light of the present disclosure. While the compositions and methods of this invention have been described in terms of preferred embodiments, it will be apparent to those of skill in the art that variations may be applied to the methods and in the steps or in the sequence of steps of the method described herein without departing from the concept, spirit and scope of the invention. More specifically, it will be apparent that certain agents which are both chemically and physiologically related may be substituted for the agents described herein while the same or similar results would be achieved. All such similar substitutes and modifications apparent to those skilled in the art are deemed to be within the spirit, scope and concept of the invention as defined by the appended claims.
REFERENCES
[0130] The following references, to the extent that they provide exemplary procedural or other details supplementary to those set forth herein, are specifically incorporated herein by reference. [0131] Baltimore, D., RNA-dependent DNA polymerase in virions of RNA tumour viruses. Nature 226, 1209-1211, 1970. [0132] Barrangou et al., CRISPR provides acquired resistance against viruses in prokaryotes. Science 315, 1709-1712, 2007. [0133] Belfort et al., Genetic delineation of functional components of the group I intron in the phage T4 td gene. Cold Spring Harb. Symp. Quant. Biol. 52, 181-192, 1987. [0134] Biebricher and Orgel, An RNA that multiplies indefinitely with DNA-dependent RNA polymerase: Selection from a random copolymer. Proc. Natl. Acad. Sci. U.S.A. 70, 934-938, 1973. [0135] Blocker et al., Domain structure and three-dimensional model of a group II intron-encoded reverse transcriptase. RNA 11, 14-28, 2005. [0136] Blumenthal and Carmichael, RNA replication: Function and structure of Qbeta-replicase. Annu. Rev. Biochem. 48, 525-548, 1979. [0137] Boeke et al., Ty elements transpose through an RNA intermediate. Cell 40, 491-500 m 1985. [0138] Bolotin et al., Clustered regularly interspaced short palindrome repeats (CRISPRs) have spacers of extrachromosomal origin. Microbiology 151, 2551-2561, 2005. [0139] Brouns et al., Small CRISPR RNAs guide antiviral defense in prokaryotes. Science 321, 960-964, 2008. [0140] Datsenko et al., Molecular memory of prior infections activates the CRISPR/Cas adaptive bacterial immunity system. Nat. Commun. 3, 945, 2012. doi: 10.1038/ncomms1937; pmid: 22781758 [0141] Flores et al., Viroids: Survivors from the RNA world? Annu. Rev. Microbiol. 68, 395-414, 2014. [0142] Goldberg et al., Conditional tolerance of temperate phages via transcription-dependent CRISPR-Cas targeting. Nature 514, 633-637, 2014. [0143] Greider and Blackburn, Identification of a specific telomere terminal transferase activity in tetrahymena extracts. Cell 43, 405-413, 1985. [0144] Grynberg et al., DNA processing-related domain present in the anthrax virulence plasmid, pXO1. Trends Biochem. Sci. 29, 106-110, 2004. [0145] Haas et al., How deep is deep enough for RNA-Seq profiling of bacterial transcriptomes? BMC Genomics 13, 734, 2012. [0146] Hale et al., Essential features and rational design of CRISPR RNAs that function with the Cas RAMP module complex to cleave RNAs. Mol. Cell 45, 292-302, 2012. [0147] Hale et al., RNA-guided RNA cleavage by a CRISPR RNACas protein complex. Cell 139, 945-956, 2009. [0148] Heler et al., Cas9 specifies functional viral targets during CRISPR-Cas adaptation. Nature 519, 199-202, 2015. [0149] Kim et al., Crystal structure of Cas1 from Archaeoglobus fulgidus and characterization of its nucleolytic activity. Biochem. Biophys. Res. Commun. 441, 720-725, 2013. [0150] Konarska and Sharp, Replication of RNA by the DNA-dependent RNA polymerase of phage T7. Cell 57, 423-431, 1989. [0151] Lambowitz and Zimmerly, Mobile group II introns. Annu. Rev. Genet. 38, 1-35 (2004). Lindner, et. al., 2008. [0152] Liu et al., Reverse transcriptase-mediated tropism switching in Bordetella bacteriophage. Science 295, 2091-2094, 2002. [0153] Ludwig and Klenk, Bergey's Manual of Systematic Bacteriology, 2:49-65, 2001. [0154] Makarova et al., A putative RNA-interference-based immune system in prokaryotes: Computational analysis of the predicted enzymatic machinery, functional analogies with eukaryotic RNAi, and hypothetical mechanisms of action. Biol. Direct 1, 7, 2006. [0155] Makarova et al., An updated evolutionary classification of CRISPR-Cas systems. Nat. Rev. Microbiol. 13, 722-736, 2015. [0156] Makarova et al., Evolution and classification of the CRISPR-Cas systems. Nat. Rev. Microbiol. 9, 467-477, 2011. [0157] Malik et al., The age and evolution of non-LTR retrotransposable elements. Mol. Biol. Evol. 16, 793-805, 1999. [0158] Marraffini and Sontheimer, CRISPR interference limits horizontal gene transfer in staphylococci by targeting DNA. Science 322, 1843-1845, 2008. [0159] Marraffini and Sontheimer, CRISPR interference: RNAdirected adaptive immunity in bacteria and archaea. Nat. Rev. Genet. 11, 181-190, 2010. [0160] Mohr et al., Mechanisms used for genomic proliferation by thermophilic group II introns. PLOS Biol. 8, e1000391, 2010. [0161] Mohr et al., Thermostable group II intron reverse transcriptase fusion proteins and their use in cDNA synthesis and next-generation RNA sequencing. RNA 19, 958-970, 2013. [0162] Mojica et al., Intervening sequences of regularly spaced prokaryotic repeats derive from foreign genetic elements. J. Mol. Evol. 60, 174-182, 2005. [0163] Moore and Sauer, The tmRNA system for translational surveillance and ribosome rescue. Annu. Rev. Biochem. 76, 101-124, 2007. [0164] Nuñez et al., Integrase-mediated spacer acquisition during CRISPR-Cas adaptive immunity. Nature 519, 193-198, 2015. [0165] Peng et al., She, An archaeal CRISPR type III-B system exhibiting distinctive RNA targeting features and mediating dual RNA and DNA interference. Nucleic Acids Res. 43, 406-417, 2015. [0166] Pourcel et al., CRISPR elements in Yersinia pestis acquire new repeats by preferential uptake of bacteriophage DNA, and provide additional tools for evolutionary studies. Microbiology 151, 653-663, 2005. [0167] Samai et al., Co-transcriptional DNA and RNA cleavage during Type III CRISPR-Cas immunity. Cell 161, 1164-1174, 2015. [0168] Simon and Zimmerly, A diversity of uncharacterized reverse transcriptases in bacteria. Nucleic Acids Res. 36, 7219-7229, 2008. [0169] Solano and Sanchez-Amat, Studies on the phylogenetic relationships of melanogenic marine bacteria: Proposal of Marinomonas mediterranea sp. nov. Int. J. Syst. Bacteriol. 49, 1241-1246, 1999. [0170] Solano et al., Marinomonas mediterranea MMB-1 transposon mutagenesis:Isolation of a multipotent polyphenol oxidase mutant. J. Bacteriol. 182, 3754-3760 (2000). [0171] Tamulaitis et al., Programmable RNA shredding by the type III-A CRISPR-Cas system of Streptococcus thermophilus. Mol. Cell 56, 506-517, 2014. [0172] Temin and Mizutani, RNA-dependent DNA polymerase in virions of Rous sarcoma virus. Nature 226, 1211-1213, 1970. [0173] Toro and Nisa-Martinez, Comprehensive phylogenetic analysis of bacterial reverse transcriptases. PLOS ONE 9, el14083, 2014. [0174] van der Oost et al., E. R. Westra, R. N. Jackson, B. Wiedenheft, Unravelling the structural and mechanistic basis of CRISPRCas systems. Nat. Rev. Microbiol. 12, 479-492 , 2014. [0175] Wei et al., Cas9 function and host genome sampling in Type II-A CRISPR-Cas adaptation. Genes Dev. 29, 356-361, 2015. [0176] Xiong and Eickbush, Origin and evolution of retroelements based upon their reverse transcriptase sequences, 9, 3353-3362, 1990. [0177] Yosef et al., Proteins and DNA elements essential for the CRISPR adaptation process in Escherichia coli. Nucleic Acids Res. 40, 5569-5576, 2012. [0178] Zimmerly et al., Group II intron mobility occurs by target DNA-primed reverse transcription. Cell 82, 545-554, 1995.