Genetic variant of the annexin A5 gene

Abstract

The present invention relates to a nucleic acid molecule comprising an annexin A5 (ANXA5) gene regulation element which comprises at least one point mutation corresponding to nucleotide 186 (G to A), 203 (A to C), 229 (T to C), and 276 (G to A) of SEQ ID NO: 2, a vector comprising the nucleic acid molecule, and a host transformed with the vector. The invention also relates to specific uses, in particular diagnostic uses of the nucleic acid molecules described herein. The invention also relates to haplotyping an ANXA5 gene regulation element from a nucleic acid from an individual which involves determining nucleotides present at positions 186, 203, 229 and 276 of the individual's copy of the ANXA5 gene regulation element by comparison to SEQ ID NO: 2.

Claims

1. A nucleic acid molecule either (a) covalently attached to a fluorescent label or (b) fixed to a solid phase, the solid phase comprising a material selected from the group consisting of plastic, silicon, glass, polystyrene, aluminum, steel, iron, copper, nickel, silver, gold, nitrocellulose, and nylon, the nucleic acid molecule having a sequence with 95% or greater identity to SEQ ID NO: 2 over its full length or having a sequence with 95% or greater identity to SEQ ID NO: 4 over its full length, the nucleic acid molecule comprising at least one point mutation, whereby said at least one point mutation (substitution) is selected from the group consisting of (i) a point mutation G to A at a position which corresponds to nucleotide 186 of SEQ ID NO: 2 or nucleotide 190 of SEQ ID NO: 4; or (ii) a point mutation A to C at a position which corresponds to nucleotide 203 of SEQ ID NO: 2 or nucleotide 209 of SEQ ID NO: 4.

2. The nucleic acid molecule of claim 1, having point mutation G to A at position 186 of SEQ ID NO: 2 or nucleotide 190 of SEQ ID NO: 4.

3. The nucleic acid molecule of claim 1 having point mutation A to C at position 203 of SEQ ID NO: 2 or nucleotide 209 of SEQ ID NO: 4.

4. The nucleic acid molecule of claim 1, further comprising (i) a point mutation T to C at a position which corresponds to nucleotide 229 of SEQ ID NO: 2, or (ii) a point mutation T to C at a position which corresponds to nucleotide 235 of SEQ ID NO: 4.

5. The nucleic acid molecule of claim 1, further comprising (i) a point mutation G to A at a position which corresponds to nucleotide 276 of SEQ ID NO: 2, or (ii) a point mutation G to A at a position which corresponds to nucleotide 284 of SEQ ID NO: 4.

6. The nucleic acid molecule of claim 3 comprising the following sequences: TABLE-US-00005 (i) (SEQ ID NO: 17) TGCGGTTGGGGC; (ii) (SEQ ID NO: 19) GCTGGCGTTTCCGTTGCTTGGATCAGTCTAGGTGCAGCTGC; and (iii) (SEQ ID NO: 20) GGATCC.

7. The nucleic acid molecule of claim 2 comprising the following sequences: TABLE-US-00006 (iii) (SEQ ID NO: 19) GCTGGCGTTTCCGTTGCTTGGATCAGTCTAGGTGCAGCTGC; and (iv) (SEQ ID NO: 20) GGATCC.

8. The nucleic acid molecule of claim 1 comprising: (i) a point mutation G to A at a position which corresponds to nucleotide 186 of SEQ ID NO: 2; (ii) a point mutation A to C at a position which corresponds to nucleotide 203 of SEQ ID NO: 2; (iii) a point mutation T to C at a position which corresponds to nucleotide 229 of SEQ ID NO: 2; and (iv) a point mutation G to A at a position which corresponds to nucleotide 276 of SEQ ID NO: 2.

9. The nucleic acid molecule of claim 1 which is operatively linked to a gene encoding for a marker protein, a signal protein or a reporter gene.

10. The nucleic acid molecule of claim 1 which is DNA, RNA or PNA.

11. A vector comprising (a) a nucleic acid molecule having a sequence with 95% or greater identity to SEQ ID NO: 2 over its full length or having a sequence with 95% or greater identity to SEQ ID NO: 4 over its full length, the nucleic acid molecule comprising at least one point mutation, whereby said at least one point mutation (substitution) is selected from the group consisting of (i) a point mutation G to A at a position which corresponds to nucleotide 186 of SEQ ID NO: 2 or nucleotide 190 of SEQ ID NO: 4; or (ii) a point mutation A to C at a position which corresponds to nucleotide 203 of SEQ ID NO: 2 or nucleotide 209 of SEQ ID NO: 4; and (b) a nucleic acid having a sequence that is heterologous to (a).

12. The vector of claim 11 which is an expression vector or a gene transfer vector.

13. A nucleic acid molecule either (a) covalently attached to a fluorescent label or (b) fixed to a solid phase, the solid phase comprising a material selected from the group consisting of plastic, silicon, glass, polystyrene, aluminum, steel, iron, copper, nickel, silver, gold, nitrocellulose, and nylon, wherein the nucleic acid molecule is all or a portion of SEQ ID NO: 2 and the nucleic acid having haplotype M1 or M2, wherein haplotype M1 has at position 203 a substitution from A to C and at position 229 a substitution from T to C, and wherein haplotype M2 has at position 186 a substitution from G to A, at position 203 a substitution from A to C, at position 229 a substitution from T to C and at position 276 a substitution from G to A.

14. A nucleic acid molecule either (a) covalently attached to a fluorescent label or (b) fixed to a solid phase, the solid phase comprising a material selected from the group consisting of plastic, silicon, glass, polystyrene, aluminum, steel, iron, copper, nickel, silver, gold, nitrocellulose, and nylon, wherein the nucleic acid molecule is an oligomer having a length of at least 28 nucleotides capable of hybridizing under stringent conditions to: a portion of SEQ ID NO: 1, the oligomer having: (i) a point mutation G to A at a position which corresponds to nucleotide 1259 of SEQ ID NO: 1; (ii) a point mutation A to C at a position which corresponds to nucleotide 1276 of SEQ ID NO: 1; (iii) a point mutation T to C at a position which corresponds to nucleotide 1302 of SEQ ID NO: 1; or (iv) a point mutation G to A at a position which corresponds to nucleotide 1349 of SEQ ID NO: 1; or a portion of SEQ ID NO: 2, the oligomer having: (i) a point mutation G to A at a position which corresponds to nucleotide 186 of SEQ ID NO: 2; (ii) a point mutation A to C at a position which corresponds to nucleotide 203 of SEQ ID NO: 2; (iii) a point mutation T to C at a position which corresponds to nucleotide 229 of SEQ ID NO: 2; or (iv) a point mutation G to A at a position which corresponds to nucleotide 276 of SEQ ID NO: 2; or a portion of SEQ ID NO: 3, the oligomer having: (i) a point mutation G to A at a position which corresponds to nucleotide 243 of SEQ ID NO: 3; (ii) a point mutation A to C at a position which corresponds to nucleotide 262 of SEQ ID NO: 3; (iii) a point mutation T to C at a position which corresponds to nucleotide 288 of SEQ ID NO: 3; or (iv) a point mutation G to A at a position which corresponds to nucleotide 337 of SEQ ID NO: 3; or a portion of SEQ ID NO: 4, the oligomer having: (i) a point mutation G to A at a position which corresponds to nucleotide 190 of SEQ ID NO: 4; (ii) a point mutation A to C at a position which corresponds to nucleotide 209 of SEQ ID NO: 4; (iii) a point mutation T to C at a position which corresponds to nucleotide 235 of SEQ ID NO: 4; or (iv) a point mutation G to A at a position which corresponds to nucleotide 284 of SEQ ID NO: 4.

15. The nucleic acid of claim 14 which is an oligonucleotide or a peptide nucleic acid (PNA)-oligomer.

16. A composition comprising an oligomer set, wherein the oligomer set consists essentially of two oligomers that allow polymerase chain reaction amplification of a DNA fragment comprising at least from nucleotide 1259 to nucleotide 1349 of SEQ ID NO: 1 the two oligomers including a forward oligomer and a reverse oligomer either or both (a) covalently attached to a fluorescent label or (b) fixed to a solid phase, the solid phase comprising a material selected from the group consisting of plastic, silicon, glass, polystyrene, aluminum, steel, iron, copper, nickel, silver, gold, nitrocellulose, and nylon, the forward oligomer and reverse oligomer each having a length of at least 15 nucleotides, wherein the forward oligomer is capable of hybridizing to: a portion of SEQ ID NO: 1 and wherein the forward and reverse oligomers allow the polymerase chain reaction amplification of a DNA fragment comprising at least from nucleotide 1259 to nucleotide 1349 of SEQ ID NO: 1, wherein the forward or reverse oligomer has; (i) a point mutation G to A at a position which corresponds to nucleotide 1259 of SEQ ID NO: 1; (ii) a point mutation A to C at a position which corresponds to nucleotide 1276 of SEQ ID NO: 1; (iii) a point mutation T to C at a position which corresponds to nucleotide 1302 of SEQ ID NO: 1; or (iv) a point mutation G to A at a position which corresponds to nucleotide 1349 of SEQ ID NO: 1; or, a portion of SEQ ID NO: 2 and wherein the forward and reverse oligomers allow the polymerase chain reaction amplification of a DNA fragment comprising at least from nucleotide 186 to nucleotide 276 of SEQ ID NO: 2, wherein the forward or reverse oligomer has; (i) a point mutation G to A at a position which corresponds to nucleotide 186 of SEQ ID NO: 2; (ii) a point mutation A to C at a position which corresponds to nucleotide 203 of SEQ ID NO: 2; (iii) a point mutation T to C at a position which corresponds to nucleotide 229 of SEQ ID NO: 2; or (iv) a point mutation G to A at a position which corresponds to nucleotide 276 of SEQ ID NO: 2; or, a portion of SEQ ID NO: 3 and wherein the forward and reverse oligomers allow the polymerase chain reaction amplification of a DNA fragment comprising at least from nucleotide 243 to nucleotide 337 of SEQ ID NO: 3, wherein the forward or reverse oligomer has; (i) a point mutation G to A at a position which corresponds to nucleotide 243 of SEQ ID NO: 3; (ii) a point mutation A to C at a position which corresponds to nucleotide 262 of SEQ ID NO: 3; (iii) a point mutation T to C at a position which corresponds to nucleotide 288 of SEQ ID NO: 3; or (iv) a point mutation G to A at a position which corresponds to nucleotide 337 of SEQ ID NO: 3; or a portion of SEQ ID NO: 4 and wherein the forward and reverse oligomers allow the polymerase chain reaction amplification of a DNA fragment comprising at least from nucleotide 190 to nucleotide 284 of SEQ ID NO: 4, wherein the forward or reverse oligomer has; (i) a point mutation G to A at a position which corresponds to nucleotide 190 of SEQ ID NO: 4; (ii) a point mutation A to C at a position which corresponds to nucleotide 209 of SEQ ID NO: 4; (iii) a point mutation T to C at a position which corresponds to nucleotide 235 of SEQ ID NO: 4; or (iv) a point mutation G to A at a position which corresponds to nucleotide 284 of SEQ ID NO: 4, wherein (a) the forward oligomer has SEQ ID NO: 8 or SEQ ID NO: 9 and the reverse oligomer has SEQ ID NO: 10 or SEQ ID NO: 13; (b) the forward oligomer has SEQ ID NO: 11, SEQ ID NO: 21, or SEQ ID NO: 12 and the reverse oligomer has SEQ ID NO: 13 or SEQ ID NO: 10; (c) the forward oligomer has SEQ ID NO: 14 or SEQ ID NO: 15 and the reverse oligomer has SEQ ID NO: 16 or SEQ ID NO: 7; or (d) the forward oligomer has SEQ ID NO: 5 or SEQ ID NO: 6 and the reverse oligomer has SEQ ID NO: 7 or SEQ ID NO: 16.

17. A kit comprising the oligomer composition of claim 16 for diagnosing or detecting a predisposition for or a tendency to pregnancy loss.

18. The oligomer composition of claim 16 wherein the forward oligomer is selected from the group consisting of: (i) a forward oligomer capable of hybridizing under stringent conditions to a portion of SEQ ID NO: 2 having a point mutation G to A at a position which corresponds to nucleotide 186 of SEQ ID NO: 2; (ii) a forward oligomer capable of hybridizing under stringent conditions to a portion of SEQ ID NO: 2 having a point mutation A to C at a position which corresponds to nucleotide 203 of SEQ ID NO: 2; (iii) a forward oligomer capable of hybridizing under stringent conditions to a portion of SEQ ID NO: 2 having a point mutation T to C at a position which corresponds to nucleotide 229 of SEQ ID NO: 2; and iv) a forward oligomer capable of hybridizing under stringent conditions to a portion of SEQ ID NO: 2 having a point mutation G to A at a position which corresponds to nucleotide 276 of SEQ ID NO: 2, wherein the forward oligomer is selected from the group consisting of: (i) the forward oligomer having SEQ ID NO: 9; (ii) the forward oligomer having SEQ ID NO: 12; (iii) the forward oligomer having SEQ ID NO: 15; and (iv) the forward oligomer having SEQ ID NO: 6.

19. The nucleic acid molecule of claim 1 further comprising a sequence with 95% or greater identity to SEQ ID NO: 1 over its full length.

20. The nucleic acid molecule of claim 1 further comprising a sequence with 95% or greater identity to SEQ ID NO:3 over its full length.

21. The nucleic acid molecule of claim 1 wherein the nucleic acid molecule is covalently attached to a fluorescent label, and the fluorescent label is a cyanine dye.

22. The nucleic acid molecule of claim 21 wherein the cyanine dye is Cy3 or Cy5.

23. The vector of claim 11 wherein the heterologous nucleic acid sequence (b) is selected from the group consisting of a promoter, a polylinker, a termination signal, an origin of replication, and a selection marker.

Description

(1) The Figures show:

(2) FIG. 1: Sequence chromatograms of Barn HI ANXA5 promotor allele variants. N/N=wildtype, M/N=heteroyzgote, M/M=homozygote for the BamHI allele.

(3) FIG. 2: Structure of the ANXA5 core promotor region. The region boundaries are marked with vertical bars and are numbered according to the position of the first transcription start point (tsp1). Untranslated exon 1 is shaded in gray. Transcription factor consensi are in small print and abbreviations of corresponding transcription factors are italisized over the sequence rows. NotI and BamHI restriction sites are underlined and the sequence of the Z-DNA stretch in the promotor is in italics. Nucleotides marking transcription start points (tsp) are underlined. Regions important for promotor function (motifs A and B accordingly) occupy nucleotide positions 295-311 and 328-337. Nucleotides changed in the BamHI.sup.− haplotype are bolded and substituting nucleotides are indicated in bold capital letters over the matching respective positions.

(4) FIG. 3. Measurements of the annexin AS promotor variant activities (luciferase reporter gene assays). N nominates the wild type promotor sequence, which is normalized as 100% activity. M1 contains the nucleotide changes 1A.fwdarw.C and 27T.fwdarw.C, and the M2 variant harbors all four substitutions (−19G.fwdarw.A, 1A.fwdarw.C, 27T.fwdarw.C and 76G.fwdarw.A), characteristic of the BamHI.sup.− ANXA5 promotor variant.

(5) FIG. 4. BamHI restriction digest for detection of BamHI.sup.− ANXA5 promotor allele. Lane 1, PCR product of a wild type (N/N) genotype; lane 2, (M/N), heterozygosity for the BamHI.sup.− allele; lane 3, (M/M), homozygosity for the BamHI.sup.− variant; L is a size standard (100 by ladder, MBI Fermentas).

(6) The examples illustrate the invention.

EXAMPLE I

Materials and Methods used in the Present Invention

(7) Patients with Recurrent Pregnancy Loss

(8) Seventy patients of North European origin with a condition of repeated pregnancy loss (more than two fetal losses), who were referred for genetic counseling to the Institute of Human Genetics, University Clinics Muenster, were examined for mutations in the ANXA5 gene.

(9) These patients were pre-screened for the PTm and factor V Leiden mutations and found to be non-carriers.

(10) The study complies with the ethical guidelines of the institutions involved. Informed consent was obtained from all subjects examined.

(11) Sequence Analysis of the ANXA5 Gene

(12) The analysis was performed on the entire coding sequence of ANXA5, along with 60-80 by of the flanking introns and the gene promoter region (the first untranslated exon and about 270 bp upstream in the 5′ UTR). After PCR amplification of the relevant genomic regions, direct sequencing of amplicons was performed using an automated sequencer, ABI PRISM® 3700 DNA Analyzer (ABI/Perkin-Elmer, Weiterstadt, Germany).

(13) Control Group and Patients Screening

(14) The population frequency of the M1 and M2 promoter variant alleles was analyzed in the sample of 533 anonymized female control persons below reproductive age, of Northwest German origin, as well as in the above described patient group of 70 groups. M2 alleles (BamHI.sup.− variants) were determined through BamHI digestion of amplicons comprised of 436 by ANXA5 promotor region sequence. Heterozygous and homozygous BamHI.sup.− carrierships were confirmed through sequencing of respective amplicons in all BamHI.sup.− patient and control subjects. BamH.sup.+ carriers were further screened for the presence of 1A.fwdarw.C and 27T.fwdarw.C mutations (M1 haplotype), using allele specific PCR amplification with primers 5′ CCCTGGCGGGGGTGGGA 3′ (SEQ ID NO: 11) and 5′ CCCTGGCGGGGGTGGGC 3′ (SEQ ID NO: 12) with reverse primer 5′ GTTGTGGGTAAATCCAGCGCA 3′ (SEQ ID NO: 13), discriminating the 1A and 1C variants and primers 5′ CCGGGCAGGGCCGGGGT 3′ (SEQ ID NO: 14) and 5′ CCGGGCAGGGCCGGGGC 3′ (SEQ ID NO: 15) with reverse primer 5′ GAACCGGGACACAGAAAC 3′ (SEQ ID NO: 16), discriminating the 27T and 27C variants. Amplicons of all heterozygous and homozygous M1 carriers determined by allele specific PCR amplification in the patient and control groups were further sequenced to confirm the 1A.fwdarw.C and 27T.fwdarw.C mutations. In the control group M1 and M2 genotypes were determined through sequencing of the relevant promotor region.

(15) Haplotype Determination for the ANXA5 M1 and M2 (BamHI.sup.−) Alleles

(16) Amplicons of patients or control subjects containing 436 by of the ANXA5 promoter and characterized with two (1A.fwdarw.C and 27T.fwdarw.C) or four (−19G.fwdarw.A,1A.fwdarw.C, 27T.fwdarw.C and 76G.fwdarw.>A) mutations were cloned in the pGL3-Basic vector (Promega, Freiburg, Germany). Ten insert carrying clones of amplicons containing the four mutations were selected at random and plasmid DNA was hydrolyzed with BamHI and inserts of BamHI.sup.+ and BamHI.sup.− clones were sequenced in both directions. Cloned inserts of amplicons containing the two (1A.fwdarw.C and 27T.fwdarw.C) mutations were directly sequenced in both directions from ten randomly selected clones.

(17) Reporter Gene Assays

(18) Analyses were performed in parallel for the M1 and M2 (BamHI.sup.−) ANXA5 promotor variants, to assess their relevance for the expression of the gene. A luciferase gene, contained in the pGL3-Basic vector was selected as reporter. A beta-galactosidase gene under the strong CMV promotor served as internal standard (BD Biosciences Clontech, Heidelberg). The constructs were expressed in HeLa cells and reporter activities were measured. The measurements were repeated each 3 times, for five independent construct expressions and all values were presented as ratios to estimated beta-galactosidase activity.

(19) Statistical Analysis

(20) Genotypic and allelic distributions in cases and controls were compared using χ.sup.2 tests and logistic regression analysis. Computer-based simulation methods were used to test departures in the genotypic frequencies from those expected under Hardy-Weinberg equilibrium, as well as for building 95% confidence intervals for estimates of gene frequencies and odds ratios calculation. The analyses were conducted with software from the SAS v8 library and the web-based EpiMax Calculator; see, inter alia, www.healthstrategy.com/epiper1/epiper1.htm. However, other commonly used software may be used as provided by, inter alia, ISI (International Statistical Institute).

EXAMPLE II

Identification of Specific ANXA5 Promoter Mutations

(21) Through systematic mutation screening of exons together with exon-intron boundaries and 270 by of the 5′ untranslated region of the gene, four consecutive nucleotide substitutions in the ANXA5 promoter were identified in the patient group. These are numbered starting from the first transcription start point of the gene, tsp1, (+1). These substitutions are as follows: −19G.fwdarw.A, 1A.fwdarw.C, 27T.fwdarw.C and 760.fwdarw.A. Alternative numbering is provided herein and relate to the sequences provided herein. The four changes together or only two of them (1A.fwdarw.C and 27T.fwdarw.C) are inherited as haplotypes, i.e. either all four of them are on one and the same DNA strand, M2 haplotype, or the two “middle” changes (1A.fwdarw.C and 27T.fwdarw.C) are found on the same DNA strand, M1 haplotype (allele subcloning and sequencing results). The fourth substitution, 76G.fwdarw.A, changes an existing BamHI restriction site, the resulting mutant promotor allele that contains all four nucleotide replacements was named “BamHI.sup.− allele”. FIG. 1 represents sets of chromatograms of the sequence of an amplicon in wildtype (−/−, i.e. Bam HI.sup.+/Bam HI.sup.+), heterozygous (Bam HI.sup.+/BamHI.sup.−) and homozygous (BamHI.sup.−/BamHI.sup.−) carriers of the BamHI.sup.− allele. The 76G.fwdarw.A substitution is well visible. In addition, the distribution of M1 and M2 alleles in patients and in a control group of 500 individuals (see under Materials and Methods, control group and patients screening) was estimated. The results of M1 and M2 allele distributions in patients and controls are summarized in the following Table 1. In first series of statistical analysis with 500 female control subjects with no recorded history of recurrent pregnancy losses (super-controls), a significant departure from Hardy-Weinberg equilibrium regarding M2 allele presentation was observed in this group (D=0.026, 95% CI: 0.016-0.038). This deviation is confirmed both using a χ.sup.2 test (χ.sup.2=105.2, d.f.=2, p<0.0001) and using a simulation test (p-value<0.0001). The data suggest that in the control sample heterozygotes are underrepresented (31 observed versus −49 predicted under H-W), whereas homozygotes for BamHI.sup.− are overrepresented (observed 10, predicted ˜2).

(22) TABLE-US-00002 TABLE 1 Genotype distributions of the M1 and M2 ANXA5 promoter alleles in patients and controls. Patients Controls Genotype Observed Expected Observed Expected OR CI N/N 45 (64.3%) 44.8 415 (77.8%) 413.3 1.000 n.a. N/M1 6 (8.6%) 6.4 35 (6.6%) 47.8 1.581 0.563-4.208 M1/M1 1 (1.5%) 0.2 1 (0.2%) 1.5 9.222  0.249-342.136 N/M2, 16 (22.8%) 17.2 77 (14.4%) 69 1.916.sup.b 0.983-3.703 M1/M2.sup.a M2/M2 2 (2.8%) 1.4 5 (1%) 1.4 3.689  0.481-22.321 Total 70 70 533 533 Expected: genotype frequency expected at Hardy-Weinberg equilibrium; OR: odds ratio with respect to genotype N/N; CI: 95% confidence interval for the odds ratio; .sup.agenotype M1/M2 was only observed in five control individuals; .sup.bχ.sup.2 = 3.619, 1 d.f., p = 0.057.

EXAMPLE III

Analysis of Nucleotide Changes and Receptor Gene Assays

(23) All observed nucleotide changes in the annexin A5 promoter change transcription factor consensus sites, or nucleotides in their direct proximity (+/−1 nucleotide). FIG. 2 depicts the structure of the ANXA5 promotor with highlighted transcription factor binding sites. The −19 G.fwdarw.A substitution is adjacent to the gGCCc consensus of the MTF-I transcription factor. The transcription start point, tspl is changed 1A.fwdarw.C in the promoter haplotype, which also lies in a close proximity to the HNF-3 consensus. The 27T.fwdarw.C substitution breaks an SpI consensus and the 76G.fwdarw.A variant changing the BamHI restriction site is in direct proximity to an AP4/MED-1 consensus, “motif B”, shown to be indispensable for ANXA5 promoter activity [Carcedo et al., 2001].

(24) To investigate whether these nucleotide changes, associated in haplotypes would affect the activity of the ANXA5 major transcription regulatory region, we performed reporter gene assays on both, M1 and M2 variants (see under Materials and Methods, Reporter gene assays). FIG. 3 summarizes the results of activity measurements. Every measurement was taken in triplicate. Data obtained show drastic reduction of the ANXA5 promoter activity when all four nucleotide substitutions (BamHI.sup.− allele) are present. Thus, the M2 promoter activity amounts to 37-42% of the normal ANXA5 promoter activity, measured on the normal allele. In contrast, the M1 allele renders a reduced promotor activity of 57-62%. The observed variation of measured activities is inborn to the procedure applied and stems from varying physiological conditions of expressing cultured cells.

EXAMPLE IV

Statistical Analysis

(25) From patients comprising a high risk pregnancy group 70 subjects were selected in which no thrombophilic factor V Leiden or prothrombin PTm mutations were identified. M1 and M2 promoter allele genotypes were compared in the patient group and control population (Table 1). In the controls genotypes were found to be at Hardy-Weinberg equilibrium rates. In the high-risk group, genotype frequencies appeared to be at their Hardy-Weinberg equilibrium values (D=0.01, 95% CI: −0.012-0.043), which was confirmed with the χ.sup.2 test (χ.sup.2=0.58, d.f.=2, N.S.) and with the simulation test (p-value<0.131).

(26) For the M1 haplotype it was found in a first analysis that for M1 carriers, the association between genotype and disease status is of borderline significance (χ.sup.2=3.905, 1 df, p=0.048). The odds ratio (OR) is 0.423, with a wide 95% confidence interval of 0.172-0.994. Carriership of M1 in either homozygous or heterozygous state is either inconsequential or weakly protective against recurrent abortion.

(27) For the M2 (BamHI.sup.− allele) carriership, the association between genotype and disease status is highly significant (χ.sup.2=18.455, 1 df, p=1.7×10.sup.−5). The odds ratio equals 3.875 (nearly fourfold), with a 95% confidence interval of 1.980-7.542. Thus, M2 is a strong risk factor in that carriers face a four times higher relative risk of recurrent abortion than non-carriers.

(28) Differences between homozygosity and heterozygosity are not conclusive. A possible effect was seen for M2, where heterozygosity N/M2 apparently entailed a higher risk (OR=4.083) than homozygosity (OR=1.582). However, the confidence intervals for the odds ratios widely overlap (1.961-8.457 for N/M2 versus 0.231-8.057 for M2/M2). The observed departure from Hardy-Weinberg equilibrium regarding M2 allele presentation in the control group could be indeed an additional indication of the role of this ANXA5 promotor variant for recurrent pregnancy loss, since selected control subjects have had no recorded pregnancy problems. Comparing with the general population, the risk of carrying the M2 haplotype might be lower, considering that about 10% to 15% of all women suffer from pregnancy losses.

(29) In a further analysis, the following results, which are completely in line with the results provided herein above, are found:

(30) For the M1 haplotype it was found that for M1 heterozygotes, the association between genotype and disease status is of borderline significance (χ.sup.2=0.511, 1 df, p=0.475). The odds ratio (OR) is 1.581, with a wide 95% confidence interval of 0.563-4.208. It was therefore concluded that carriership of M1 in heterozygous state is rather inconsequential for recurrent abortion and the number of homozygotes in patients and controls is too low to make a justified conclusion.

(31) For the M2 (BamHI.sup.− allele) carriership, the association between genotype and disease status is significant (χ.sup.2=4.763, 1 df, p=0.029). The odds ratio equals 2.024, with a 95% confidence interval of 1.068-3.810. Thus, M2 is a risk factor in that carriers face about two times (1.840) higher relative risk of recurrent abortion than non-carriers.

(32) Numbers in the cases group are too small to test for any interaction between haplotypes, or for differences between homozygosity and heterozygosity. A possible effect was seen for M2, where homozygosity N/M2 apparently entailed a higher risk (OR=3.689) than heterozygosity (OR=I.916). However, the confidence interval for the M2/M2 odds ratio is rather wide (0.481-22.321), so that such a conclusion would not be justified from a statistical point of view. Since the control group is a representative sample of the population from Northwest Germany, the estimated risk of carrying the M2 haplotype should be indicative of the population risk, considering that about 10% of all women suffer from pregnancy losses.

EXAMPLE V

Analytical Procedures

(33) The proposed analytical procedure for detection of the M2 (BamHI.sup.−) allele may comprise consecutive steps: 1. PCR reaction; 2. Barn HI restriction digest of an aliquot of the PCR product; and 3. Gel electrophoresis of the restriction digest products

(34) The template for 1. is human genomic DNA from peripheral blood. The products of 2. are subjected to electrophoretic separation in an agarose gel and visulalized with ethidium bromide staining. 1. PCR reaction:

(35) In 25 μl volume on 100 ng genomic DNA. Composition of the reaction mix and reaction buffer may be different and depend on the Tag polymerase supplier. Oligonucleotide amplification primers, 20 pM each:

(36) TABLE-US-00003 ANX5.P.F: (SEQ ID NO: 22) 5′ CCGAGCCCTGGACAGCTCCCCA 3′ ANX5.ex1.R: (SEQ ID NO: 23) 5′ CCAGACTGTGGGACCCAAGT 3′
amplicon size: 436 bp. Cycling conditions: (94° C., 45 s); 30×[(94° C., 30 s); (60° C., 30 s); 68° C., 1 min)]; (68° C., 7 min); (15° C., ∞); 2. Restriction digest:

(37) In 10 μl volume, with 1 U of Bam HI restriction enzyme (various suppliers). Restriction digest on 5-7 μl of the PCR product (reaction 1), on 37° C., 18-20 hours. 3. Agarose gel electrophoresis:

(38) The products of (2) are mixed with 2 μl 6x gel loading buffer and are then loaded on 1.5% agarose gels. The gels run in 1×TAE buffer, constant voltage (6V/cm) for 30 min. The separated and ethidium bromide stained reaction products are visualized on a transilluminator (384 nm) and can be documented. If the BamHI restriction site is intact (wildtype DNA), in homozygous condition two bands can be seen (336 and 100 bp), and three bands in heterozygotes with a BamHI.sup.− allele (an additional 436 by band, non-digested amplicon). When the BamHI restriction site is not intact in homozygotes, there is only the 436 by band to be seen. FIG. 4 shows a gel picture of BamHI digested PCR products from patients and control individuals.

(39) TABLE-US-00004 diagnostic bands genotypes 436 bp 336 bp 100 bp BamHI.sup.+/BamHI.sup.+ − + + homozygote BamHI.sup.+/BamHI.sup.−- + + + heterozygote BamHI.sup.−/BamHI.sup.−- + − − homozygote

(40) The analytical procedure we developed is able to discriminate M2 (Bam HI) allele carriers (heteroyzgotes and homozygotes), who possess about four fold (3.875) higher relative risk of recurrent abortion compared to non-carriers, as measured among healthy, female control subjects with no previously reported pregnancy problems (see under IV, Statistical analysis). Statistically differences on the relative risk rates of individuals, heterozygous or homozygous for the M2 (BamHI.sup.−) allele have not been established.