Recombinant microorganism for preparing terpenoid and method for constructing recombinant microorganism

Abstract

Provided are a recombinant strain for preparing a terpenoid, and method for constructing the recombinant strain. Also provided is a recombinant bacterium 1, the recombinant bacterium 1 being a recombinant bacterium obtained in order to improve the enzymatic activity of α-ketoglutarate dehydrogenase in escherichia coli or the mutant thereof. The method for improving the enzymatic activity of α-ketoglutarate dehydrogenase in escherichia coli or the mutant thereof is replacing the original regulating element of the ketoglutarate dehydrogenase gene (sucAB) in escherichia coli or the mutant thereof with any of the following regulating elements: artificial regulating element M1-46, M1-37, and M1-93. Also provided are a plurality of recombinant bacteria. By improving the enzymatic activity of α-ketoglutarate dehydrogenase, succinic acid dehydrogenase and transaldolase therein and improving the ability of a cell to synthesize NADPH and ATP, the efficiency of the MEP pathway and the production capacity of terpenoid are improved.

Claims

1. A recombinant E. coli strain 1, comprising an artificial regulatory part that has been introduced into the chromosome of a starting E. coli strain to replace an original regulatory part of an α-ketoglutarate dehydrogenase (sucAB) gene, wherein the original regulatory part of the sucAB gene comprises a nucleotide sequence of SEQ ID NO: 15, the artificial regulatory part is selected from the group consisting of (a) M1-46 having a nucleotide sequence of SEQ ID NO: 14, (b) M1-37 having a nucleotide sequence of SEQ ID NO: 10, and (c) M1-93 having a nucleotide sequence of SEQ ID NO: 11, and wherein the recombinant E. coli strain 1 exhibits an increased α-ketoglutarate dehydrogenase enzymatic activity relative to the starting E. coli strain.

2. The recombinant E. coli strain 1 according to claim 1, wherein: the recombinant E. coli strain 1 is further defined as: I) recombinant E. coli strain 1-1, wherein the artificial regulatory part is M1-46 having a nucleotide sequence of SEQ ID NO: 14; or II) recombinant E. coli strain 1-2, wherein the artificial regulatory part is selected from the group consisting of (a) M1-46 having a nucleotide sequence of SEQ ID NO: 14, (b) M1-37 having a nucleotide sequence of SEQ ID NO: 10, and (c) M1-93 having a nucleotide sequence of SEQ ID NO: 11, and the starting E. coli strain is an E. colimutant A constructed by a method comprising the steps of: (i) introducing a β-carotene synthesis gene cluster comprising a trc regulatory part into the chromosome of E. coli strain ATCC 8739 to obtain an intermediate E. colistrain; (ii) in the intermediate E. coli strain obtained from step (i), replacing (a) the trc regulatory part of the β-carotene synthesis gene cluster with an artificial regulatory part M1-93, (b) an original regulatory part of an 1-deoxy-D-xylulose-5-phosphate synthase gene dxs with an artificial regulatory part M1-37, and (c) an original regulatory part of an isopentenyl diphosphate isomerase gene idi with an artificial regulatory part M1-37, wherein the β-carotene synthesis gene cluster is a gene cluster consisting of a geranyl-geranyl diphosphate synthase gene crtE, a β-carotene cyclase gene crtX, a lycopene β-cyclase gene crtY, a phytoene desaturase gene crtl and a phytoene synthase gene crtB, the original regulatory part of the 1-deoxy-D-xylulose-5-phosphate synthase gene dxs has a nucleotide sequence of SEQ ID NO:8, the original regulatory part of the isopentenyl diphosphate isomerase gene idi has a nucleotide sequence of SEQ ID NO:12, and the β-carotene synthesis gene cluster is inserted at site ldhA of the chromosome of E. coli strain ATCC 8739; or (III) recombinant E. coli strain 1-3, wherein the starting E. coli strain is an E. coli mutant B in which the original regulatory part of α-ketoglutarate dehydrogenase gene sucAB has been replaced by the artificial regulatory part M1-46, wherein the E. coli mutant B is constructed by a method comprising a step of deleting a β-carotene cyclase gene crtX and a lycopene β-cyclase gene crtY of the carotene synthesis gene cluster of the recombinant E. coli strain 1-2 of (II).

3. The recombinant E. coli strain 1-1 according to claim 2, wherein the E. coli strain 1-1 is further defined as: (I) recombinant E. coli strain 1-1-A which is constructed by a method comprising introducing a β-carotene synthesis gene cluster into the recombinant strain 1-1, wherein the introducing of the β-carotene synthesis gene cluster into the recombinant strain 1-1 comprises introducing a recombinant vector comprising the β-carotene synthesis gene cluster into the recombinant E. coli strain 1-1; or (II) recombinant E. coli strain 1-1-B which is constructed by a method comprising introducing a lycopene synthesis gene cluster into the recombinant E. coli strain 1-1, wherein the introducing of the lycopene synthesis gene cluster comprises introducing a recombinant vector comprising the lycopene synthesis gene cluster into the recombinant E. coli strain 1-1; and wherein the lycopene synthesis gene cluster is a gene cluster consisting of a geranyl-geranyl diphosphate synthase gene crtE, a phytoene desaturase gene crtl and a phytoene synthase gene crtB.

4. A recombinant E. coli strain 2, which is constructed by a method comprising the steps of: I) introducing a β-carotene synthesis gene cluster comprising a trc regulatory part into the chromosome of a starting E. coli strain, to obtain an intermediate E. coli strain; II) in the intermediate E. coli strain obtained from step (I), replacing (a) an trc regulatory part of an β-carotene synthesis gene cluster with an artificial regulatory part M1-93,(b) an original regulatory part of an 1-deoxy-D-xylulose-5-phosphate synthase gene dxs with an artificial regulatory part M1-37, and (c) an original regulatory part of an isopentenyl diphosphate isomerase gene idi with an artificial regulatory part M1-46, wherein the β-carotene synthesis gene cluster is a gene cluster consisting of a geranyl-geranyl diphosphate synthase gene crtE, a β-carotene cyclase gene crtX, a lycopene β-cyclase gene crtY, a phytoene desaturase gene crtl, and a phytoene synthase gene crtB; the trc regulatory part of the β-carotene synthesis gene cluster has a nucleotide sequence of SEQ ID NO: 6; the artificial regulatory part M1-12 has a nucleotide sequence of SEQ ID NO: 7; the original regulatory part of the 1-deoxy-D-xylulose-5-phosphate synthase gene dxs has a nucleotide sequence of SEQ ID NO:8; the artificial regulatory part M1-37has a nucleotide sequence of SEQ ID NO: 10in the sequence listing; the original regulatory part of the isopentenyl diphosphate isomerase gene idi has a nucleotide sequence of SEQ ID NO:12; the artificial regulatory part M1-46has a nucleotide sequence of SEQ ID NO: 14; the artificial regulatory part M1-93has a nucleotide sequence of SEQ ID NO: 11; and the starting strain is E. coli strain ATCC 8739.

5. The recombinant E. coli strain 2according to claim 4, wherein the β-carotene synthesis gene cluster is introduced into the starting E. coli strain at site ldhA of its chromosome.

6. A recombinant E. coli strain 3, wherein each of the original regulatory part of α-ketoglutarate dehydrogenase gene sucAB, the original regulatory part of succinate dehydrogenase gene sdhABCD, and/or the original regulatory part of transaldolase gene talB of the recombinant strain 2 according to claim 4 has been replaced with an artificial regulatory part M1-46, wherein the original regulatory part of α-ketoglutarate dehydrogenase gene sucAB has a nucleotide sequence of SEQ ID NO: 15; the original regulatory part of succinate dehydrogenase gene sdhABCD has a nucleotide sequence of SEQ ID NO: 16; the original regulatory part of transaldolase gene talB has a nucleotide sequence of SEQ ID NO: 17; and the artificial regulatory part M1-46 has a nucleotide sequence of SEQ ID NO: 14as set forth in the sequence listing.

7. The recombinant E. coli strain 3 according to claim 6, wherein the recombinant strain 3 is further defined as: (I) recombinant strain 3-1, wherein each of the original regulatory parts of α-ketoglutarate dehydrogenase gene SucAB, succinate dehydrogenase gene sdhABCD and transaldolase gene talB of the recombinant strain 2 according to claim 4 has been replaced with an artificial regulatory part M1-46; or (II) recombinant strain 3-2, wherein the original regulatory part of α-ketoglutarate dehydrogenase gene sucAB of recombinant strain 2 according to claim 4 has been replaced with an artificial regulatory part M1-462; or (III) recombinant strain 3-3, wherein each of the original regulatory part of α-ketoglutarate dehydrogenase gene sucAB and the original regulatory part of succinate dehydrogenase gene sdhABCD of the recombinant strain 2 according to claim 4 has been replaced with an artificial regulatory part M1-46; or (IV) recombinant strain 3-4, wherein g each of the original regulatory part of α-ketoglutarate dehydrogenase gene sucAB and the original regulatory part of transaldolase gene talB of the recombinant strain 2 according to claim 4 has been replaced with an artificial regulatory part M1-46.

8. A recombinant strain 4, wherein the β-carotene cyclase gene crtX and the lycopene β-cyclase gene crtY of the β-carotene synthesis gene cluster of the recombinant strain 2 according to claim 4 has been deleted.

9. A recombinant strain 5, wherein the original regulatory parts of α-ketoglutarate dehydrogenase gene sucAB, transaldolase gene talB and/or succinate dehydrogenase gene sdhABCD of recombinant strain 4 has been replaced with an artificial regulatory part M1-46, wherein the recombinant strain 5 is further defined as (I) recombinant strain 5-1, wherein the original regulatory part of α-ketoglutarate dehydrogenase gene sucAB of the recombinant strain 4 has been replaced with an artificial regulatory part M1-46; or (II) recombinant strain 5-2, wherein is constructed by a method comprising a step of: replacing each of the original regulatory parts of α-ketoglutarate dehydrogenase gene sucAB and transaldolase gene talB of the recombinant strain 4 has been replaced with an artificial regulatory part M1-46; or (III) recombinant strain 5-3, wherein is particularly constructed by a method comprising a step of: replacing each of the original regulatory parts of α-ketoglutarate dehydrogenase gene sucAB, succinate dehydrogenase gene sdhABCD and transaldolase gene talB of the recombinant strain 4 has been replaced with an artificial regulatory part M1-46; wherein the original regulatory part of the α-ketoglutarate dehydrogenase gene sucAB has a nucleotide sequence of SEQ ID NO: 15; the original regulatory part of the transaldolase gene talB has a nucleotide sequence of SEQ ID NO: 17; the original regulatory part of the succinate dehydrogenase gene sdhABCD has a nucleotide sequence of SEQ ID NO: 16; and the artificial regulatory part M1-46has a nucleotide sequence of SEQ ID NO: 14.

10. A method of producing lycopene and/or β-carotene comprising: culturing cells of a recombinant E. coli strain according to any one of claims 4, 6, and 9; harvesting the cultured cells; and producing lycopene and/or β-carotene from said harvested cells.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

(1) FIG. 1 is a standard curve of OD.sub.453 nm vs. concentration of β-carotene.

(2) FIG. 2 shows change in β-carotene production after regulation of key genes of TCA pathway, citrate synthase gene (gltA), aconitase gene (acnA), icd, sucAB, sucCD, sdhABCD, fumarase A (fumA), fumarase C (fumC), and mdh gene, in recombinant E. coli CAR001.

(3) FIG. 3 shows change in β-carotene production after regulation of key genes of pentose phosphate pathway, transketolase (transketolase I, tktA), talB, and glucose 6-phosphate-1-dehydrogenase (zwf) gene, in recombinant E. coli CAR001.

(4) FIG. 4 shows change in β-carotene production after regulation of genes sucAB, sdhABCD and a combination thereof in recombinant E. coli CAR001.

(5) FIG. 5 shows production of β-carotene by high-density fermentation of recombinant E. coli CAR005.

(6) FIG. 6 shows production of lycopene by fermentation of recombinant E. coli LYC005.

DETAILED DESCRIPTION OF CERTAIN EMBODIMENTS OF THE INVENTION

(7) The experimental methods employed in following Examples are conventional methods, unless otherwise specified.

(8) All the materials, agents, etc. used in following Examples are publicly available, unless otherwise specified.

EXAMPLE 1

Introduction of β-Carotene Synthesis Gene into E. coli to Obtain Recombinant E. coli

(9) I. Introduction of β-Carotene Synthesis Gene Via a Plasmid to Construct Recombinant E. coli ATCC 8739 (pACYC184-M-Crt)

(10) IPP, DMAPP and FPP may be synthesized by E. coli itself via MEP pathway and FPP synthase. However, E. coli cannot synthesize β-carotene by itself. A cluster of β-carotene synthesis gene exists in Pantoea agglowerans under the same operon. The β-carotene synthesis gene cluster consists of geranyl-geranyl diphosphate (GGPP) synthase gene (crtE, SEQ ID NO: 1), β-carotene cyclase gene (crtX, SEQ ID NO: 2), lycopene β-cyclase gene (crtY, SEQ ID NO: 3), phytoene desaturase gene (crtI, SEQ ID NO: 4), and phytoene synthase gene (crtB, SEQ ID NO: 5).

(11) 1. Construction of Recombinant E. coli ATCC 8739 (pACYC184-M-Crt)

(12) The β-carotene synthesis gene cluster was introduced into E. coli ATCC 8739 (Gunsalus I C, Hand D B. The use of bacteria in the chemical determination of total vitamin C. J Biol Chem. 1941, 141:853-858; publicly available from Tianjin Institute of Industrial Biotechnology), to obtain recombinant strain ATCC 8739 (pACYC184-M-crt), specifically as below:

(13) 1) PCR Amplification of DNA Fragment crtEXYIB Containing β-Carotene Synthesis Gene Cluster

(14) The sequences of the primers were:

(15) TABLE-US-00001 crt-cluster-f: CTGTGAATTCAAGGAGATATACCATGATGACGGTCTGTGCAGAA; crt-cluster-r: TTGCAGTCGACGCTGCGAGAACGTCA;

(16) Underlined portions of above primers were EcoRI and SalI digestion sites, respectively, and AGGAGATATACCA was artificial RBS.

(17) PCR amplification was performed with crt-cluster-f and crt-cluster-r as primers, and the genome of Pantoea agglomerans (CGMCC NO.: 1.2244, publicly available from China General Microbiological Culture Collection Center) as a template, to obtain an about 5800 bp PCR product, i.e., the DNA fragment of crtEXYIB. The PCR product comprises genes crtE, crtX, crtY, crtI and crtB.

(18) 2) Construction of Recombinant Vector pACYC184-M-Crt

(19) A. Construction of Intermediate Vectors pTrc99A-M and pACYC 184-M

(20) An about 1700 bp DNA fragment 1 was amplified with DNA of plasmid pTrc99A (Amann, E., Ochs, B. and Abel, K. J. Tightly regulated tac promoter vectors useful for the expression of unfused and fused proteins in Escherichia coli. Gene. 1988, 69:301-15. publicly available from Tianjin Institute of Industrial Biotechnology) as a template, through primer of 99A-F1-PacI-SpeI-NdeI/99A-R1-PacI, so that Pac I, Spe I and Nde I digestion sites were located before lad gene of plasmid pTrc99A, Pac I digestion site located after terminator rrnB. Fragment 1 was further digested with Dpn I, and phosphorylated with T4 polynucleotide kinase. An about 2000 bp DNA fragment 2 was amplified with DNA of plasmid pTrc99A as a template, through a primer 99A-F2/99A-R2, digested by Dpn I, and linked to phosphorylated DNA fragment 1 with quick-ligase, and then transformed into E. coli trans10 competent cells. The cells were cultured in LB agar plate containing a final concentration of 50 μg/mL of ampicillin overnight. 5 clones were picked, with their plasmid DNA extracted and verified using Pac I, BamH I digestions. The right positive clone was designated as pTrc99A-M.

(21) An about 2100 bp DNA fragment 3 was amplified by the same method, with DNA of plasmid pACYC184 (Mok, Y. K., Clark, D. R., Kam, K. M. and Shaw, P. C. BsiY I, a novel thermophilic restriction endonuclease that recognizes 5′ CCNNNNNNNGG 3′ and the discovery of a wrongly sequenced site in pACYC177. Nucleic Acids Res. 1991, 19:2321-2323; publicly available from Tianjin Institute of Industrial Biotechnology) as a template, through a primer 184-F2/184-R2, digested by Dpn I, and linked to phosphorylated DNA fragment 1 with quick-ligase, followed by verification using Pac I, BamH I digestions. The right positive clone was designated as pACYC184-M.

(22) The sequences of the primers were:

(23) TABLE-US-00002 99A-F1-PacI-SpeI-NdeI: TTAATTAACTAGTCATATGGGCATGCATTTACGTTGACA 99A-R1-PadI: TTAATTAAAGAAACGCAAAAAGGCCATC 99A-F2: CATTCAAATATGTATCCGCTCA 99A-R2: CGCAGGAAAGAACATGTGAG 184-F2: GGGAGAGCCTGAGCAAACT 184-R2: CGATGATAAGCTGTCAAACATGA.
B. Construction of intermediate vector pTrc99A-M-Crt: the 5800 bp DNA fragment crtEXYIB obtained in 1) was inserted into plasmid pTrc99A-M between EcoRI and SalI digestion sites, to obtain intermediate vector pTrc99A-M-crt;

(24) Specific method was as follows: DNA fragment crtEXYIB was digested with EcoRI and SalI, and linked to similarly digested pTrc99A-M plasmid backbone (3716 bp), to obtain a recombinant vector; the recombinant vector was sent for sequencing, and the result showed that the recombinant vector was a vector wherein genes crtE, crtX, crtY, crtI and crtB were inserted into pTrc99A-M between EcoRI and SalI, which was designated as pTrc99A-M-crt.

(25) C. Construction of recombinant vector pACYC184-M-crt: DNA fragment crtEXYIB was inserted into pACYC184-M plasmid at PacI digestion site, to obtain recombinant vector pACYC184-M-crt;

(26) Details are as follows, the intermediate vector pTrc99A-M-crt obtained in B was digested by PacI, and an about 7.8 kb fragment was recovered by gel extraction; the recovered fragment was linked to similarly digested pACYC184-M vector that was obtained from A, to obtain a recombinant vector; the recombinant vector was sent for sequencing, and the result showed that DNA fragment crtEXYIB was inserted into pACYC184-M at PacI digestion site, and was designated as pACYC184-M-crt.

(27) 3) Construction of Recombinant E. coli ATCC 8739 (pACYC184-M-Crt)

(28) The pACYC184-M-crt obtained from C was electro-transformed into E. coli ATCC 8739, to obtain recombinant E. coli ATCC 8739 (pACYC184-M-crt).

(29) Specifically, 50 μl of E. coli ATCC 8739 electro-transformed competent cell was placed on ice, added with 1 μl of plasmid pACYC184-M-crt (about 50 ng/ul), and left on ice for 2 minutes, and then transferred to 0.2 cm Bio-Rad cuvette, and subjected to electric shock on a MicroPulser (Bio-Rad) electroporation apparatus, with an electric shock parameter of a voltage of 2.5 kv. Immediately after the shock, 1 ml of the LB culture medium was transferred to the cuvette, and lashed 5 times, after which it was transferred to a tube, and incubated at 75 rpm, 30° C. for 2 hours. 50 μl of the strain solution was coated on a LB plate containing chloromycetin, and incubated at 37° C. overnight, after which 5 positive single colonies were picked, and subjected to a liquid cultivation, and then plasmids of the positive single colonies were extracted for PacI digestion, to obtain a 7.8 kb positive plasmid. The recombinant strain containing the positive plasmid was designated as ATCC 8739 (pACYC184-M-crt).

(30) 2. Production of β-Carotene by Recombinant E. coli ATCC 8739 (pACYC184-M-Crt)

(31) A single colony of recombinant E. coli ATCC 8739 (pACYC184-M-crt) was picked in a tube containing 4 ml LB (containing a final concentration of 34 μg/ml of chloromycetin), cultivated at 30° C., 250 rpm overnight; then, an amount of 1% (volume percent) of the strain solution, i.e. 100 μl of strain solution, from the tube was inoculated in 10 ml culture medium (containing corresponding antibiotics) in 100 ml Tri Flask, and cultivated at 30° C., 250 rpm; when OD.sub.600=0.1, i.e., after about 3 h, a final concentration of 1 mM of IPTG was added for induction; with cultivation for additional 24 h, the color of the strain solution became yellow from white.

(32) 2 ml of the strain solution was subjected to centrifugation at 14000 rpm for 3 min, with supernatant being discarded, the strain cells were washed with sterilized water, and added with 1 ml acetone for extraction in dark at 55° C. for 15 min. After centrifugation at 14000 rpm for 10 min, supernatant was collected, and measured at 453 nm on an ultraviolet spectrophotometer for β-carotene absorption value thereof. The measured value was compared with corresponding cell turbidness (OD.sub.600 nm), to obtain a relative production of β-carotene.

(33) The supernatant was measured using HPLC (high performance liquid chromatograph 1260 Infinity, Agilent Technologies) for the content of β-carotene.

(34) Standard β-carotene was purchased from Sigma, US (Cat. No. C4582), and a standard curve was determined immediately when the standard was received. A 0.45 μm millipore filter (Millpor) was used for filtration; acetone, methanol, dichloromethane, petroleum ether, and acetonitrile were chromatographic pure agents, supplied by Merk.

(35) 5 mg of β-carotene standard was precisely weighted, dissolved in 1 ml of dichloromethane, and diluted to 10 ml with acetone, to obtain a 500 μg/ml standard solution. When used, it was serially diluted with acetone (2×, 4×, 8×, 16×, 32×), and filtered into HPLC vials, to perform HPLC detection. Symmetry C18 column (4.6×250 mm, 5 μm); column temperature: 30° C.; mobile phase: methanol:acetonitrile:dichloromethane=21:21:8; loading volume: 20 μl; loading time: 20 min; DAD light detection; and detection wavelength of 450 nm, were employed, and the standard curve of β-carotene was obtained via the relation between peak area of the standard and the concentration of β-carotene.

(36) Immediately after extraction from the supernatant, the content of β-carotene was measured with HPLC; the supernatant appeared yellow, and the strain became white from yellow after extraction with acetone. With a test with HPLC, the sample has an appearance time of β-carotene identical to that of the standard (an appearance time of 17.2 min).

(37) The result, as shown in FIG. 1, showed that OD.sub.453 nm exhibited excellent linear correlation with β-carotene concentration. After cultivation of 24 hours, ATCC 8739 (pACYC184-M-crt) was obtained with a dry cell weight of 1.55 g/L, a β-carotene yield of 0.87 mg/L, and a β-carotene amount of 0.56 mg/g dry cell weight.

(38) Accordingly, the introduction of a set of crt genes associated with catalytic production of β-carotene in Pantoea agglomerans into E. coli in a form of plasmid, enabled E. coli having the function of producing β-carotene.

(39) II. Integration of β-Carotene Synthesis Gene into E. coli ATCC 8739 Chromosome by Homologous Recombination to Construct Recombinant E. coli QL002

(40) 1. Construction of Recombinant E. coli QL002 by Homologous Recombination

(41) Recombinant E. coli QL002 was such that β-carotene synthesis gene cluster crtEXYIB (a gene cluster consisting of geranyl-geranyl diphosphate synthase gene crtE, β-carotene cyclase gene crtX, lycopene β-cyclase gene crtY, phytoene desaturase gene crtI and phytoene synthase gene crtB) was integrated into E. coli ATCC 8739 chromosome at ldhA site by homologous recombination.

(42) The method may be in reference to Jantama et al., 2008; Zhang et al., 2007, and is detailed as below: In step 1, lactate dehydrogenase gene (ldhA) of E. coli ATCC 8739 was amplified with E. coli ATCC 8739 genomic DNA as a template and primers ldhA-up/ldhA-down.

(43) The primers had sequences of:

(44) TABLE-US-00003 ldhA-up: GATAACGGAGATCGGGAATG ldhA-down: CTTTGGCTGTCAGTTCACCA.

(45) The obtained 1750 bp amplification product is lactate dehydrogenase gene ldhA.

(46) The PCR amplification product was cloned to a clone vector, pEASY-Blunt, to obtain a recombinant vector, which was then sent for sequencing. The result showed a vector pEASY-Blunt with inserted lactate dehydrogenase gene ldhA, demonstrating that the construction of the plasmid was true. The obtained recombinant plasmid was designated as pXZ001. In step 2, PCR amplification was performed with pXZ001 plasmid DNA as a template and primers of ldhA-1/ldhA-2. The primers have sequences as follows:

(47) TABLE-US-00004 ldhA-1: TCTGGAAAAAGGCGAAACCT ldhA-2: TTTGTGCTATAAACGGCGAGT

(48) An about 4778 bp PCR amplification product was obtained, as comprising about 400 bases of upstream and downstream sequence of lactate dehydrogenase gene and the sequence of pEASY-Blunt vector. In step 3, PCR amplification was performed with pLOI4162 plasmid (Jantama K, Zhang X, Moore J C, Shanmugam K T, Svoronos S A, Ingram L O. Eliminating side products and increasing succinate yields in engineered strains of Escherichia coli C. Biotechnol Bioeng. 2008, 101 (5): 881-893, publicly available from Tianjin Institute of Industrial Biotechnology) as a template and primers 4162-F/4162-R, to obtain a 3000 bp DNA fragment comprising a chloromycetin resistent gene (Cam) and a levansucrose transferase gene (Levansucrase, sacB).

(49) The primers had sequences of:

(50) TABLE-US-00005 4162-F: GGAGAAAATACCGCATCAGG 4162-R: GCGTTGGCCGATTCATTA.

(51) The 4778 bp PCR amplification product obtained in step 2 was cleaned with a PCR cleaning kit, and then treated with DpnI; the about 3000 bp PCR amplification product obtained in step 3 was cleaned with a PCR cleaning kit, and then was phosphorylated; and the two fragments were linked to obtain a linked product, which was transformed into trans T1, to obtain a solution of transformed strain. 200 μl of the solution of the transformed strain was coated onto a LB plate containing kanamycin and chloromycetin, and cultivated overnight; thereafter, 5 positive single colonies were picked, and the positive clones were subjected to a liquid cultivation. Then, a positive cloned plasmid was subjected to verification by digestion, proved of that chloromycetin gene and levansucrose transferase gene had been inserted in pEASY-Blunt vector and within 400 bp homologous arms upstream and downstream of the gene encoding lactate dehydrogenase gene, and was designated as pXZ002. In step 4, PCR amplification was performed with pXZ002 plasmid DNA as a template and primers ldhA-up/ldhA-down, to obtain an about 3700 bp DNA fragment I, which comprises about 400 bases of the upstream of gene encoding lactate dehydrogenase, Cat-sacB DNA fragment, and about 400 bases of the downstream of the lactate dehydrogenase encoding gene. The DNA fragment I was used in a first homologous recombination: pKD46 plasmid (Datsenko, wanner. One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc Natl Acad Sci USA. 2000. 97 (12): 6640-6645; publicly available from Tianjin Institute of Industrial Biotechnology) is first transformed into E. coli ATCC 8739 by calcium chloride transformation, and then DNA fragment I was electro-transformed into the E. coli ATCC 8739 with pKD46. Immediately after an electric shock, 1 ml of the LB culture medium was transferred to a cuvette, lashed 5 times, and transferred to a tube, followed by incubation at 75 rpm, 30° C. for 2 hours. pKD46 plasmid was removed. 200 μl of the strain solution was coated on a LB agar plate containing chloromycetin, and cultivated overnight, after which 5 single colonies were picked for PCR verification (using primers ldhA-up/ldhA-down, wherein correctly amplified colony product is an about 3700 bp fragment). A right single colony was picked, and designated as QL001. In step 5, pTrc99A-M-crt plasmid was digested with PacI, and the fragment about 8 kb was recovered by gel extraction and the ends were repaired and made blunt with Klenow Fragment, then linked to the 4778 bp PCR amplification product obtained in step 2. The ligation were transformed into trans T1 and 200 μl of the solution of transformed strain was spreaded on a LB plate containing kanamycin, and cultivated overnight, after which 5 positive single colonies were picked, and the positive clones were subjected to a liquid cultivation. A positive cloned plasmid was extracted for digestion (with PacI, to obtain a fragment of about 8 kb, as a positive plasmid) and sequenced for verification. The results showed that rtEXYIB gene was inserted in pEASY-Blunt vector and within 400 bp homologous arms of upstream and downstream of the gene encoding lactate dehydrogenase gene. It was designated as pXZ003-crt. In step 6, an about 9000 bp DNA fragment II (comprising about 400 bases of upstream of gene encoding lactate dehydrogenase, a trc promoter, a crtEXYIB gene, a rrnB T2 transcription terminator and about 400 bases of downstream of gene encoding lactate dehydrogenase) was amplified with the DNA of pXZ003-crt plasmid as a template and primers ldhA-up/ldhA-down. DNA fragment II was used for a second homologous recombination: pKD46 plasmid was first transformed into QL001 by calcium chloride transformation, and DNA fragment II was then electrotransformed into QL001 with pKD46 plasmid, wherein the electrotransformation was conducted in the conditions that: first, electrotransformation competent cells of QL001 with pKD46 plasmid were prepared; 50 μl of competent cells was placed on ice, added with 50 ng DNA fragment II, and left on ice for 2 minutes, and then transferred to a 0.2 cm Bio-Rad cuvette. An electric shock was conducted using a MicroPulser (Bio-Rad) electroporation apparatus, with an electric shock parameter of a voltage of 2.5 kv. Thereafter, 1 ml of the LB culture medium was immediately transferred to the cuvette, lashed 5 times, and then transferred to a tube, followed by incubation at 75 rpm, 30° C. for 4 hours. pKD46 plasmid was removed. The strain solution was transferred to a LB liquid culture medium (a 250 ml Tri Flask charged with 50 ml culture medium) containing 10% sucrose, free of sodium chloride, and cultivated for 24 hours, and then subjected to a streak culture in a LB solid culture medium containing 6% sucrose, free of sodium chloride. With a PCR verification (using primers ldhA-up/crtE-r, the right colony amplification product is an about 4500 bp fragment), a right single colony was picked, and designated as QL002.

(52) The crtE-r primer has a sequence of:

(53) TABLE-US-00006 crtE-r: TTAACTGACGGCAGCGAGTT.
2. Production of β-Carotene by Recombinant E. coli QL002

(54) A single colony of recombinant E. coli QL002 was picked and placed into 4 ml of a tube with a LB culture medium, and cultivated at 30° C., 250 rpm overnight; then, an amount of 1% (volume percent) of the strain solution, i.e. 100 μl of strain solution, in the tube was inoculated in 10 ml of a culture medium in a 100 ml Tri Flask, and cultivated at 30° C., 250 rpm; when OD.sub.600=0.1, i.e., after about 3 h, a final concentration of 1 mM of IPTG was added for induction; after additional 24 h, samples were taken to determine the yield of β-carotene.

(55) By a method for the determination as seen in above experiment I, as a result, QL002 had a β-carotene yield up to 0.59 mg/L, β-carotene content up to 0.41 mg/g dry cell weight.

EXAMPLE 2

Construction of Recombinant E. coli CAR001 and Fermentation

(56) The construction of recombinant E. coli CAR001 and fermentation thereby were divided into following 8 steps:

(57) 1 Improvement of the Expression Strength of the β-Carotene Synthesis Gene Cluster of Recombinant E. coli QL002 and Construction of Recombinant E. coli QL105

(58) Recombinant E. coli QL105 was such that the trc regulatory part (SEQ ID NO: 6 in the sequence listing) of the β-carotene synthesis gene cluster crtEXYIB of QL002 was replaced with an artificial regulatory part M1-12 (SEQ ID NO: 7 in the sequence listing) by a two-step homologous recombination.

(59) With the two-step homologous recombination, the artificial regulatory part was inserted before the gene to be regulated, and no resistant gene or FRT marker was left after the operation. In a first step homologous recombination, original regulatory part of the gene was replaced with a cat-sacB fragment; and in a second step homologous recombination, the cat-sacB fragment was replaced with artificial regulatory parts with various strengths. The fragments used in the two-step homologous recombination were amplified by a PCR method with two pairs of general primers. Using gene-cat-up (including 50 bp bases before artificial regulatory part inserting site and a 20 bp homologous fragment of cat-sacB gene) and gene-cat-down (including 50 bp bases after artificial regulatory part inserting site and another homologous fragment of cat-sacB gene), DNA fragment I was amplified, to perform the first step homologous recombination. Using gene-up-P (including 50 bp bases before artificial regulatory part inserting site and a 20 bp homologous fragment of the artificial regulatory part) and gene-RBS-down (including 50 bp bases after artificial regulatory part inserting site and another homologous fragment of the artificial regulatory part) primers, DNA fragment II was amplified, to perform the second step homologous recombination.

(60) It is detailed specifically as below. In step 1, the starting vector was pXZ002 plasmid, amplification primers were ldhA-cat-up/crtE-cat-down, the strain to be transformed was recombinant E. coli QL002, and identification primers were ldhA-up/crtE-340-down; specifically as below:

(61) PCR amplification was performed with amplification primers ldhA-cat-up/crtE-cat-down and the starting vector pXZ002 plasmid as a template, to obtain an about 3800 bp DNA fragment I (ldhA-catsacB-crtE), which fragment comprised about 50 bases upstream of ldhA gene, DNA fragment Cat-sacB, about 50 bases upstream of crtE.

(62) TABLE-US-00007 ldhA-cat-up: ATTAAATTTGAAATTTTGTAAAATATTTTTAGTAGCTTAAATGTGATTC ATGTGACGGAAGATCACTTCGCA crtE-cat-down: GCATCGCTGTGTATGAAATTGACGTGTTGTTCTGCACAGACCGTCATC ATTTATTTGTTAACTGTTAATTGTCCTTG

(63) The PCR amplification product of DNA fragment I obtained in step 1 was cleaned with a PCR cleaning kit, treated with DpnI, and then used for a first homologous recombination: the pKD46 plasmid was first transformed into recombinant E. coli QL002 by calcium chloride transformation, and then DNA fragment I was electrotransformed into the E. coli QL002 with pKD46. After electric shock, 1 ml of LB culture medium was immediately transferred to the cuvette, and lashed 5 times, and then it was transferred to a tube, and incubated at 75 rpm, 30° C. for 2 hours. 200 μl of the strain solution was coated onto a LB plate containing chloromycetinaminobenzyl, and after an overnight culture, screened on a LB plate containing chloromycetinaminobenzyl and a kanamycin containing LB plate, respectively, to obtain a clone that is not grown with kanamycin, but grown on the chloromycetinaminobenzyl LB plate, which was verified by PCR (using identification primers of ldhA-up/crtE-340-down, whereby a right colony amplification product was an about 4000 bp fragment), to obtain an intermediate positive clone, for a second step homologous recombination.

(64) TABLE-US-00008 crtE-340-down: GCGACATGTTCACCATACTG In step 2, the starting strain was a recombinant strain M1-12, the amplification primers were ldhA-up-p and crtE-RBS-down, the strain to be transformed was an intermediate positive clone, and the identification primers were the same as above (ldhA-up/crtE-340-down); specifically as below:

(65) PCR amplification was performed with amplification primers ldhA-up-p and crtE-RBS-down, and genomic DNA of recombinant strain M1-12 (Lu J, Tang J L, Liu Y, Zhu X, Zhang T, Zhang X. Combinatorial modulation of galP and glk gene expression for improved alternative glucose utilization. Appl Microbiol Biotechnol. 2012, 93:2455-2462; publicly available from Tianjin Institute of Industrial Biotechnology) as a template, and an about 200 bp DNA fragment II was obtained, which contained about 50 bases downstream of ldhA gene, artificial regulatory part fragment M1-12, and about 50 bases upstream of crtE.

(66) TABLE-US-00009 ldhA-up-P: ATTAAATTTGAAATTTTGTAAAATATTTTTAGTAGCTTAAATGTGATTC ATTATCTCTGGCGGTGTTGAC crtE-RBS-down: GCATCGCTGTGTATGAAATTGACGTGTTGTTCTGCACAGACCGTCATC ATAGCTGTTTCCTGGTT

(67) DNA fragment II was electrotransformed into the intermediate positive clone obtained from step 1. After electric shock, 1 ml of LB culture medium was immediately transferred to the cuvette, and lashed 5 times, and then it was transferred to a tube, and cultivated at 75 rpm, 30° C. for 4 hours, after which it was transferred to 50 ml of LB+10% sucrose medium free of salt in flask. After 24 h, it was streaked on a LB+6% sucrose arga plate free of salt, and cultivated at 41° C. overnight to remove the pKD46 plasmid. The strains were screened on a LB plate containing chloromycetin and a LB plate free of antibiotic. The clones that was not grown on the LB plate containing chloromycetin were verified by PCR using identification primers ldhA-up/crtE-340-down. Right colony amplification product was an about 1000 bp fragment. The stain with right sequencing was designated as recombinant E. coli QL105.

(68) 2. Production of β-Carotene by Recombinant E. coli QL105

(69) A single colony of recombinant E. coli QL105 was picked into 4 ml of LB culture medium in a tube, and cultivated at 30° C., 250 rpm overnight; then, an amount of 1% (volume percent) of the strain solution, i.e. 100 ul of the strain solution, in the tube was inoculated to 10 ml of a culture medium in a 100 ml Tri Flask, and cultivated at 30° C., 250 rpm for 24 h. Thereafter, samples were taken for determining β-carotene yield. The method for the determination was as seen in Example 1.

(70) As a result, the β-carotene yield of QL105 was up to 2.17 mg/L, and the content of β-carotene was up to 1.53 mg/g dry cell weight.

(71) 3. Improvement of the Expression Strength of Recombinant E. coli QL105 Dxs Gene and Construction of Recombinant E. coli Dxs64, Dxs37, Dxs93

(72) Recombinant E. coli Dxs64, Dxs37, Dxs93 were prepared, respectively, in a way as the two-step homologous recombination in Example 2, part 1, wherein original regulatory part (SEQ ID NO: 8) of recombinant E. coli QL105 dxs gene was replaced with artificial regulatory part M1-64 (SEQ ID NO: 9), M1-37 (SEQ ID NO: 10), and M1-93 (SEQ ID NO: 11), respectively.

(73) Construction of Recombinant E. coli Dxs64 (Two-Step Homologous Recombination):

(74) Step 1: the same as Step 1 of part 1 in Example 2, except that the starting vector was pLOI4162 plasmid, the amplification primers were dxs-cat-up/dxs-cat-down, an about 3400 bp DNA fragment I was obtained, and the strain to be transformed was recombinant E. coli QL105; an intermediate positive clone was obtained.

(75) TABLE-US-00010 dxs-cat-up: ACTACATCATCCAGCGTAATAAATAAACAATAAGTATTAATAGGCCCCT GGGAGAAAATACCGCATCAGG dxs-cat-down: GTGGAGTCGACCAGTGCCAGGGTCGGGTATTTGGCAATATCAAAAC TC ATGCGTTGGCCGATTCATTA Step 2: the same as Step 2 of part 1 in Example 2, except that the starting strain was a recombinant strain M1-64 (Lu J, Tang J L, Liu Y, Zhu X, Zhang T, Zhang X. Combinatorial modulation of galP and glk gene expression for improved alternative glucose utilization. Appl Microbiol Biotechnol. 2012, 93:2455-2462; publicly available from Tianjin Institute of Industrial Biotechnology), the amplification primers were dxs-up-P and dxs-RBS-down, an about 200 bp DNA fragment II was obtained, and the strain to be transformed was an intermediate positive clone got in step 1. Recombinant E. coli Dxs64 was obtained.

(76) In both of above two steps, the identification primers were dxs-up-480F and dxs-down-381R (The correct PCR fragment was about 900 bp).

(77) TABLE-US-00011 dxs-up-480F: AGTGGTATTGCCGGAATG dxs-down-381R: GATGGAGGTTGATGAATGC

(78) Construction of recombinant E. coli Dxs37 (two-step homologous recombination): substantially the same as recombinant E. coli Dxs64, except that the starting strain in step 2 was a recombinant strain M1-37 (Lu J, Tang J L, Liu Y, Zhu X, Zhang T, Zhang X. Combinatorial modulation of galP and glk gene expression for improved alternative glucose utilization. Appl Microbiol Biotechnol. 2012, 93:2455-2462; publicly available from Tianjin Institute of Industrial Biotechnology), an about 200 bp DNA fragment II was obtained;

(79) Preparation of recombinant E. coli Dxs93 (two-step homologous recombination): substantially the same as recombinant E. coli Dxs64, except that the starting strain in step 2 was a recombinant strain M1-93 (Lu J, Tang J L, Liu Y, Zhu X, Zhang T, Zhang X. Combinatorial modulation of galP and glk gene expression for improved alternative glucose utilization. Appl Microbiol Biotechnol. 2012, 93:2455-2462; publicly available from Tianjin Institute of Industrial Biotechnology), an about 200 bp DNA fragment II was obtained;

(80) With a correct sequencing verification, the strains in which the regulatory part of dxs gene of QL105 was replaced with artificial regulatory parts M1-64, M1-37, M1-93, respectively, were designated as recombinant E. coli Dxs64, Dxs37, Dxs93, respectively.

(81) 4. Production of β-Carotene by Recombinant E. coli Dxs64, Dxs37, Dxs93

(82) Fermentation culturing of recombinant E. coli QL105, Dxs64, Dxs37, Dxs93 were performed in a way the same as in Example 1, and the yields of β-carotene were determined

(83) As seen from the results shown in Table 1, with the regulation of dxs, β-carotene yield was improved by 1.8-2.3 folds; the maximum β-carotene yield was from M1-37 regulatory part, and the minimum was from M1-93 regulatory part.

(84) TABLE-US-00012 TABLE 1 Improvement of β-carotene production by regulations of genes dxs, idi and crt Dry weight β-carotene β-carotene Increased Strain OD600 (g/L) OD453 content (mg/L) yield (mg/g) folds QL105 4.39 ± 0.00 1.42 ± 0.00 0.26 ± 0.01 2.17 ± 0.00 1.53 ± 0.00 1.0 Monogene regulation Dxs64 3.72 ± 0.01 1.20 ± 0.01 0.45 ± 0.00 3.66 ± 0.00 3.05 ± 0.00 2.0 Dxs37 3.76 ± 0.16 1.21 ± 0.16 0.53 ± 0.16 4.32 ± 0.13 3.56 ± 0.18 2.3 Dxs93 3.93 ± 0.05 1.27 ± 0.05 0.43 ± 0.02 3.55 ± 0.01 2.80 ± 0.00 1.8 Digene regulation Dxs37-Idi30 4.64 ± 0.13 1.50 ± 0.13 0.74 ± 0.03 6.09 ± 0.03 4.07 ± 0.00 2.7 Dxs37-Idi46 4.40 ± 0.00 1.42 ± 0.00 0.92 ± 0.01 7.58 ± 0.01 5.33 ± 0.01 3.5 Dxs37-Idi37 4.51 ± 0.00 1.46 ± 0.00 0.77 ± 0.04 6.30 ± 0.04 4.32 ± 0.04 2.8 Trigene regulation CAR001 4.31 ± 0.01 1.39 ± 0.01 25.67 ± 0.01  18.40 ± 0.01  12.0
5. Regulation of the Expression Strength of Recombinant E. coli Dxs37 Idi Gene and Construction of Recombinant E. coli Dxs37-Idi30, Dxs37-Idi46, Dxs37-Idi37

(85) Recombinant E. coli Dxs37-Idi30, Dxs37-Idi46, and Dxs37-Idi37 were prepared, respectively, in a way as the two-step homologous recombination in Example 2, part 1, wherein original regulatory part (SEQ ID NO: 12) of idi gene of Dxs37 prepared in above part 3 was replaced with artificial regulatory part M1-30 (SEQ ID NO: 13), M1-46 (SEQ ID NO: 14), and M1-37 (SEQ ID NO: 10), respectively.

(86) Construction of Recombinant E. coli Dxs37-Idi30: (Two-Step Homologous Recombination):

(87) Step 1: as Step 1 of part 1 of Example 2, except that the starting vector was pLOI4162 plasmid, the amplification primers were idi-cat-up/idi-cat-down, an about 3400 bp DNA fragment I was obtained, and the strain to be transformed was recombinant E. coli Dxs37; to obtain an intermediate positive clone.

(88) TABLE-US-00013 idi-cat-up: TCACTTGGTTAATCATTTCACTCTTCAATTATCTATAATGATGAGTGAT CTGTGACGGAAGATCACTTCGCA idi-cat-down: CCCGTGGGAACTCCCTGTGCATTCAATAAAATGACGTGTTCCGTTTGCA TTTATTTGTTAACTGTTAATTGTCCTTG Step 2: as Step 2 of part 1 of Example 2, except that the starting strain was a recombinant strain M1-30 (Lu J, Tang J L, Liu Y, Zhu X, Zhang T, Zhang X. Combinatorial modulation of galP and glk gene expression for improved alternative glucose utilization. Appl Microbiol Biotechnol. 2012, 93:2455-2462; publicly available from Tianjin Institute of Industrial Biotechnology), the amplification primers were idi-up-p and idi-RBS-down, an about 200 bp DNA fragment II was obtained, and the strain to be transformed was the intermediate positive clone got in step 1. Recombinant E. coli Dxs37-Idi30 was obtained.

(89) TABLE-US-00014 idi-up-p: TCACTTGGTTAATCATTTCACTCTTCAATTATCTATAATGATGAGTGAT CTTATCTCTGGCGGTGTTGAC idi-RBS-down: CCCGTGGGAACTCCCTGTGCATTCAATAAAATGACGTGTTCCGTTTGCA TAGCTGTTTCCTGGTT

(90) In both of above two steps, the identification primers were Idi-up and idi-down (the correct PCR fragment was about 900 bp).

(91) TABLE-US-00015 Idi-up: ATGACTCCGACGCTCTCTCA idi-down: CGTGGCATCAATACCGTGTA

(92) Construction method (two-step homologous recombination) of recombinant E. coli Dxs37-Idi46: substantially the same as that of recombinant E. coli Dxs37-Idi30, except that the starting strain in Step 2 was a recombinant strain M1-46 (Lu J, Tang J L, Liu Y, Zhu X, Zhang T, Zhang X. Combinatorial modulation of galP and glk gene expression for improved alternative glucose utilization. Appl Microbiol Biotechnol. 2012, 93:2455-2462; publicly available from Tianjin Institute of Industrial Biotechnology), an about 200 bp DNA fragment II was obtained;

(93) Construction method (two-step homologous recombination) of recombinant E. coli Dxs37-Idi37: substantially the same as that of recombinant E. coli Dxs37-Idi30, except that the starting strain in Step 2 was a recombinant strain M1-37, an about 200 bp DNA fragment II was obtained;

(94) After verified as right with sequencing, the strains in which original regulatory part of idi gene of Dxs37 was replaced with artificial regulatory parts M1-30, M1-46, and M1-37, respectively, were designated as recombinant E. coli Dxs37-Idi30, Dxs37-Idi46, and Dxs37-Idi37, respectively.

(95) 6. Production of β-Carotene by Recombinant E. coli Dxs37-Idi30, Dxs37-Idi46, Dxs37-Idi37

(96) Fermentation culturing of recombinant E. coli Dxs37-Idi30, Dxs37-Idi46, and Dxs37-Idi37 were performed in a way as that in Example 1, to determine β-carotene yields.

(97) The results are seen in Table 1. With a combined regulation of dxs and idi, β-carotene yield was improved by 2.7-3.5 folds; and maximum of the β-carotene yield was from Dxs37-Idi46 strain.

(98) 7. Construction of Recombinant Strain CAR001 with Improved Expression of β-Carotene Synthesis Gene Cluster of Recombinant E. coli Dxs37-Idi46

(99) Recombinant strain CAR001 was constructed from recombinant E. coli Dxs37-Idi46 which regulatory part M1-12 (SEQ ID NO: 7) of β-carotene synthesis gene cluster crtEXYIB replaced with artificial regulatory part M1-93 (SEQ ID NO: 11); for which a specific method is as below:

(100) Construction of Recombinant E. coli CAR001 (Two-Step Homologous Recombination):

(101) Step 1: as Step 1 of part 1 in Example 2, except that the starting vector was pXZ002 plasmid, the amplification primers were ldhA-cat-up/crtE-cat-down, an about 3800 bp DNA fragment I was obtained, and the strain to be transformed was recombinant E. coli Dxs37-Idi46, and the identification primers were ldhA-up/crtE-340-down, an intermediate positive clone was obtained.

(102) TABLE-US-00016 ldhA-cat-up: ATTAAATTTGAAATTTTGTAAAATATTTTTAGTAGCTTAAATGTGATTC ATGTGACGGAAGATCACTTCGCA crtE-cat-down: GCATCGCTGTGTATGAAATTGACGTGTTGTTCTGCACAGACCGTCATCA TTTATTTGTTAACTGTTAATTGTCCTTG Step 2: as Step 2 of part 1 in Example 2, except that the starting strain was M1-93, the amplification primers were amplification primers ldhA-up-p and crtE-RBS-down, an about 200 bp DNA fragment II was obtained, and the strain to be transformed was the intermediate positive clone got in step 1. Recombinant E. coli CAR001 was obtained.

(103) TABLE-US-00017 ldhA-up-P: ATTAAATTTGAAATTTTGTAAAATATTTTTAGTAGCTTAAATGTGATTC ATTATCTCTGGCGGTGTTGAC crtE-RBS-down: GCATCGCTGTGTATGAAATTGACGTGTTGTTCTGCACAGACCGTCATCA TAGCTGTTTCCTGGTT

(104) In above two steps, the identification primers were ldhA-up/crtE-340-down, and the correct amplification band was about 900 bp.

(105) TABLE-US-00018 ldhA-up: GATAACGGAGATCGGGAATG crtE-340-down: GCGACATGTTCACCATACTG
8. Production of β-Carotene by Recombinant Strain CAR001

(106) A Fermentation culturing of recombinant E. coli CAR001 was performed in a way as that in Example 1, to determine a β-carotene yield.

(107) As can be seen from the results shown in Table 1, in comparison with recombinant E. coli QL105, the resulting strain CAR001 from the regulation of crt gene had β-carotene content increased by 12 folds. The β-carotene yield was up to 25.67 mg/L, and the β-carotene content was up to 18.4 mg/g dry cell weight.

EXAMPLE 3

Improvement of Expression Strength of α-Ketoglutarate Dehydrogenase Gene of Recombinant E. coli CAR001

(108) 1. Improvement of Expression Strength of α-Ketoglutarate Dehydrogenase Gene of Recombinant E. coli CAR001 and Construction of Recombinant Strains SucAB46-FKF, SucAB37-FKF, and SucAB93-FKF

(109) Recombinant E. coli SucAB46-FKF, SucAB37-FKF, and SucAB93-FKF were, respectively, recombinant E. coli CAR001 having original regulatory part (SEQ ID NO: 15) of α-ketoglutarate dehydrogenase gene (sucAB) replaced with artificial regulatory parts M1-46 (SEQ ID NO: 14), M1-37 (SEQ ID NO: 10), and M1-93 (SEQ ID NO: 11), respectively.

(110) Original regulatory region of a gene on a chromosome of E. coli was replaced with artificial regulatory parts having various intensities through a pair of general primers using one-step homologous recombination. An upstream primer was gene-up-FRT, comprising 50 bases outside the original regulatory region of the gene to be regulated and 20 bases homologous with FRT sequence. A downstream primer was gene-RBS-down, comprising 15 bases homologous with the ribosome bind site of E. coli lacZ gene and 50 bases after the initiation codon of the gene to be regulated.

(111) 1800 bp DNA fragments sucAB-M1-46, sucAB-M1-37 and sucAB-M1-93 were amplified, with sucAB-up-FRT and sucAB-RBS-down as primers, and with recombinant strains M1-46, M1-37, M1-93 as templates; and after one-step homologous recombination of sucAB-M1-46 and E. coli CAR001, a recombinant E. coli SucAB46-FKF was obtained, specifically as below: Firstly, pKD46 plasmid was transformed into E. coli CAR001 by calcium chloride transformation. Next, DNA fragment sucAB-M1-46 was electrotransformed into E. coli CAR001 with pKD46. The electrotransformation was performed in the conditions that: competent cells of E. coli CAR001 with pKD46 plasmid to be electrotransformed were firstly prepared; 50 μl of the competent cell was placed on ice, added with 50 ng of the DNA fragment, and left to stand on ice for 2 minutes, and then transferred to a 0.2 cm Bio-Rad cuvette. After electric shock was performed using an MicroPulser (Bio-Rad) electroporation apparatus, with an electric shock parameter of a voltage of 2.5 kv, 1 ml of the LB culture medium was immediately transferred to the cuvette, and lashed 5 times, and then it was transferred to a tube, and cultivated at 75 rpm, 30° C. for 2 hours. 100 μl of the strain solution was coated onto LB plates containing kanamycin, respectively, and cultivated at 41° C. overnight. pKD46 plasmid was removed. A recombinant strain SucAB46-FKF was obtained.

(112) In the same way of one-step homologous recombination, recombinant E. coli SucAB37-FKF was obtained by homologous recombination of sucAB-M1-37 and E. coli CAR001; and recombinant E. coli SucAB93-FKF was obtained by homologous recombination of sucAB-M1-93 and E. coli CAR001;

(113) Above recombinant E. coli strains were identified by PCR using kan-f and sucAB-r, and the correct PCR fragment was about 900 bp

(114) The primers had sequences of:

(115) TABLE-US-00019 sucAB-up-FRT: CAGTGTATGTCCGAAGGGGCTGAACCCGACGCGCGCCATCGGCCATATCA GTGTAGGCTGGAGCTGCTTC sucAB-RBS-down: CCAGAGAGGTAAGAAGAGTCCAACCAGGCTTTCAAAGCGCTGTTCTGCAT AGCTGTTTCCTGGTT.

(116) The primers for PCR verification had sequences of:

(117) TABLE-US-00020 kan-f: CCGTGATATTGCTGAAGAG sucAB-r: GAAATATTCACGCGTTTGAG.

(118) After verifying the right clones by sequencing, the strains, in which original regulatory part of sucAB gene of CAR001 was respectively replaced with artificial regulatory part M1-46, M1-37, and M1-93, were designated as recombinant E. coli SucAB46-FKF, SucAB37-FKF, and SucAB93-FKF, respectively.

(119) 2. Production of β-Carotene

(120) Fermentation culturing of recombinant E. coli SucAB46-FKF (M1-46), SucAB37-FKF (M1-37), and SucAB93-FKF (M1-93) were performed in a way as that of Example 1, to determine β-carotene yields.

(121) The results are seen in FIG. 2. The β-carotene yields of recombinant E. coli SucAB46-FKF (M1-46), SucAB37-FKF (M1-37), and SucAB93-FKF (M1-93) were 24.47 mg/g, 25.58 mg/g, and 23.92 mg/g, respectively; after the regulation of sucAB, as compared with CAR001, M1-37 had the maximum improvement of β-carotene yield of 39%.

EXAMPLE 4

Improvement of Expression Strength of Succinate Dehydrogenase Gene of Recombinant E. coli CAR001

(122) 1 Improvement of the Expression Strength of Succinate Dehydrogenase Gene of Recombinant E. coli CAR001 and Construction of the Recombinant Strain

(123) Recombinant E. coli Sdh46-FKF, Sdh37-FKF, and Sdh93-FKF were recombinant E. coli CAR001 having original regulatory part (SEQ ID NO: 16) of succinate dehydrogenase gene (sdhABCD) replaced with artificial regulatory part M1-46 (SEQ ID NO: 14), M1-37 (SEQ ID NO: 10), and M1-93 (SEQ ID NO: 11), respectively.

(124) 1800 bp DNA fragments sdhABCD-M1-46, sdhABCD-M1-37 and sdhABCD-M1-93 were amplified by the one-step homologous recombination method of Example 3, part 1, with sdhABCD-up-FRT and sdhABCD-RBS-down as primers, and recombinant strains M1-46, M1-37, M1-93 as a template, respectively; after a homologous recombination of sdhABCD-M1-46 and E. coli CAR001, recombinant E. coli Sdh46-FKF was obtained; after a homologous recombination of sdhABCD-M1-37 and E. coli CAR001, recombinant E. coli Sdh37-FKF was obtained; and after a homologous recombination of sdhABCD-M1-46 and E. coli CAR001, recombinant E. coli Sdh46-FKF was obtained; these were identified by PCR using kan-f and sdhABCD-r, and the correct PCR fragment was about 900 bp.

(125) TABLE-US-00021 sdhABCD-up-FRT: ACTTTGTTGAATGATTGTCAAATTAGATGATTAAAAATTAAATAAATGTT GTGTAGGCTGGAGCTGCTTC sdhABCD-RBS-down: TTAACAGGTCTTTGTTTTTTCACATTTCTTATCATGAATAACGCCCACAT AGCTGTTTCCTGGTT

(126) The primers for the PCR verification had sequences of:

(127) TABLE-US-00022 kan-f: CCGTGATATTGCTGAAGAG sdhABCD-r: AATTTGACGAAGAAGCTGC.

(128) After verifying the right clones by sequencing, the strains, in which original regulatory part of sdhABCD gene of CAR001 was respectively replaced with artificial regulatory parts M1-46, M1-37, and M1-93, were designated as recombinant E. coli Sdh46-FKF, Sdh37-FKF, and Sdh93-FKF, respectively.

(129) 2. Production of β-Carotene by Recombinant E. coli Sdh46-FKF, Sdh37-FKF, and Sdh93-FKF

(130) Fermentation culturing of recombinant E. coli Sdh46-FKF (M1-46), Sdh37-FKF (M1-37), and Sdh93-FKF (M1-93) were performed in a way as that of Example 1, to determine β-carotene yields.

(131) The results are show in FIG. 2. The β-carotene yields of recombinant E. coli Sdh46-FKF (M1-46), Sdh37-FKF (M1-37), and Sdh93-FKF (M1-93) were 23 mg/g, 20.06 mg/g, and 17.48 mg/g, respectively; after the regulation of sdhABCD, as compared with CAR001, M1-46 had the maximum improvement of β-carotene yield of 25%.

EXAMPLE 5

Improvement of Expression Strength of Transaldolase Gene of Recombinant E. coli CAR001

(132) 1 Improvement of the Expression Strength of Transaldolase Gene (talB) of Recombinant E. coli CAR001 and Construction of Recombinant Strains talB46, talB37, and talB93

(133) Recombinant strains talB46, talB37, and talB93 were recombinant E. coli CAR001 having original regulatory part (SEQ ID NO: 17) of transaldolase gene (talB) replaced with artificial regulatory parts M1-46 (SEQ ID NO: 14), M1-37 (SEQ ID NO: 10), and M1-93 (SEQ ID NO: 11), respectively.

(134) Construction of Recombinant Strain talB46 (Two-Step Homologous Recombination):

(135) Step 1: as Step 1 of part 1 in Example 2, except that the starting vector was pLOI4162 plasmid, the amplification primers were talB-cat-up and talB-cat-down, an about 3400 bp DNA fragment I was obtained, and the strain to be transformed was recombinant E. coli CAR001; an intermediate positive clone was obtained. Step 2: as Step 2 of part 1 in Example 2, except that the starting strain was M1-46, the amplification primers were talB-up-P and talB-RBS-down, an about 200 bp DNA fragment II was obtained, and the strain to be transformed was the intermediate positive clone got in step 1. Recombinant E. coli talB46 was obtained.

(136) The primers for the amplification in Step 1 had sequences of:

(137) TABLE-US-00023 talB-cat-up: AGTCTCGCCTGGCGATAACCGTCTTGTCGGCGGTTGCGCTGACGTTGCG TCGTGTGTGACGGAAGATCACTTCGCA talB-cat-down: TCATGATAGTATTTCTCTTTAAACAGCTTGTTAGGGGGATGTAACCGGTC TGCTTATTTGTTAACTGTTAATTGTCCT

(138) The primers talB-up-P/talB-RBS-down for the amplification in Step 2 had sequences of:

(139) TABLE-US-00024 talB-up-P: AGTCTCGCCTGGCGATAACCGTCTTGTCGGCGGTTGCGCTGACGTTGCG TCGTGTTATCTCTGGCGGTGTTGAC talB-RBS-down: AGTGTCGGCCACTACGGTGGTGTACTGACGAAGGGAGGTCAATTTGTCC GTCATAGCTGTTTCCTGGTT

(140) In above two steps, the identification primers were talB-up/talB-down with sequences of (the correct PCR fragment was about 900 bp):

(141) TABLE-US-00025 talB-up: CGGATGTAGCGAAACTGCAC talB-down: GACGCTTCGGTGTCATAGGAAAG.

(142) Construction of recombinant E. coli talB 37: in a way substantially the same as that for recombinant E. coli talB46, except that the starting strain in Step 2 was replaced with M1-37, an about 200 bp DNA fragment II was obtained;

(143) Construction of recombinant E. coli talB 93: in a way substantially the same as that for recombinant E. coli talB46, except that the starting strain in Step 2 was replaced with M1-93, to obtain an about 200 bp DNA fragment II;

(144) After verifying the right clones by sequencing, the strains, in which original regulatory part of talB gene of CAR001 was respectively replaced with artificial regulatory parts M1-46, M1-37, and M1-93, were designated as recombinant E. coli talB46, talB37, and talB93, respectively.

(145) 2. Production of β-Carotene by Recombinant E. coli talB46, talB37, talB93

(146) Fermentation culturing of recombinant E. coli talB46 (M1-46), talB37 (M1-37), and talB93 (M1-93) were performed in a way as Example 1, to determine β-carotene yields.

(147) The results were shown in FIG. 3. The β-carotene yields of recombinant E. coli talB46 (M1-46), talB37 (M1-37), and talB93 (M1-93) were 21.53 mg/g, 18.22 mg/g, and 18.58 mg/g, respectively; after the regulation of talB, as compared with CAR001, M1-46 had the maximum improvement of β-carotene yield of 17%.

EXAMPLE 6

Improvement of Expression Strength of Citrate Synthase Gene, Aconitase Gene, Isocitrate Dehydrogenase Gene, Succinyl-CoA Synthetase Gene, Fumarase Gene and Malate Dehydrogenase Gene of Recombinant E. coli CAR001

(148) 1. Improvement of the Expression Strength of Citrate Synthase Gene of Recombinant E. coli CAR001

(149) As the one-step homologous recombination method in Example 3, part 1, original regulatory part (SEQ ID NO: 18) of citrate synthase gene (gltA) of recombinant E. coli CAR001 was replaced with artificial regulatory parts M1-46 (SEQ ID NO: 14), M1-37 (SEQ ID NO: 10), and M1-93 (SEQ ID NO: 11), to obtain recombinant GltA46-FKF, GltA37-FKF, and GltA93-FKF, respectively.

(150) Specifically as below: 1800 bp DNA fragments gltA-M1-46, gltA-M1-37 and gltA-M1-93 were amplified with glta-up-FRT and glta-RBS-down as primers, and recombinant strains M1-46, M1-37, M1-93 as a template, respectively; after homologous recombination of gltA-M1-46 and E. coli CAR001, recombinant E. coli gltA 46-FKF was obtained; after homologous recombination of gltA-M1-37 and E. coli CAR001, recombinant E. coli gltA 37-FKF was obtained; and after homologous recombination of gltA-M1-46 and E. coli CAR001, recombinant E. coli gltA 46-FKF was obtained; these were identified by PCR with kan-f and gltA-r, and the correct PCR fragment was about 900 bp.

(151) The primers used were:

(152) TABLE-US-00026 glta-up-FRT: TGTTCCGGAGACCTGGCGGCAGTATAGGCCGTTCACAAAATCATTACAA TGTGTAGGCTGGAGCTGCTTC glta-RBS-down: TCAACAGCTGTGTCCCCGTTGAGGGTGAGTTTTGCTTTTGTATCAGCCAT AGCTGTTTCCTGGTT.

(153) The primers for the PCR verification had sequences of:

(154) TABLE-US-00027 kan-f: CCGTGATATTGCTGAAGAG gltA-r: TCCAGGTAGTTAGAATCGGTC

(155) Fermentation culturing of recombinant E. coli GltA46-FKF, GltA37-FKF, and GltA93-FKF were performed in a way of Example 1, to determine β-carotene yields.

(156) The results are show in FIG. 2. After the regulation of gltA, the β-carotene yields of recombinant E. coli GltA46-FKF, GltA37-FKF, and GltA93-FKF were 23.74 mg/g, 24.66 mg/g, and 24.84 mg/g, respectively; as compared with CAR001, M1-93 had the maximum improvement of β-carotene yield of 35%.

(157) 2 Improvement of the Expression Strength of Aconitase Gene (Aconitate Hydratase) of Recombinant E. coli CAR001

(158) As the process of one-step homologous recombination in Example 3, part 1, original regulatory part (SEQ ID NO: 19) of aconitase gene (acnA) of recombinant E. coli CAR001 was replaced with artificial regulatory parts M1-46 (SEQ ID NO: 14), M1-37 (SEQ ID NO: 10), and M1-93 (SEQ ID NO: 11), respectively, to obtain AcnA46-FKF, AcnA37-FKF, and AcnA93-FKF.

(159) Specifically as below: 1800 bp DNA fragments acnA-M1-46, acnA-M1-37 and acnA-M1-93 were amplified with acnA-up-FRT and acnA-RBS-down as primers, and recombinant strains M1-46, M1-37, M1-93 as a template, respectively; after homologous recombination of acnA-M1-46 and E. coli CAR001, recombinant E. coli acnA 46-FKF was obtained; after homologous recombination of acnA-M1-37 and E. coli CAR001, recombinant E. coli acnA 37-FKF was obtained; and after homologous recombination of acnA-M1-46 and E. coli CAR001, recombinant E. coli acnA 46-FKF was obtained; these were identified by PCR with kan-f and acnA-r, and the correct PCR fragment was about 900 bp.

(160) The primers used were:

(161) TABLE-US-00028 acnA-up-FRT: TAGAACTGTTTGCTGAAGATGATCAGCCGAAACAATAATTATCATCATTC GTGTAGGCTGGAGCTGCTTC acnA-RBS-down: TCTTTGGCCTGCAACGTGTCCTTACTGGCTTCTCGTAGGGTTGACGACAT AGCTGTTTCCTGGTT.

(162) The primers for the PCR verification had sequences of:

(163) TABLE-US-00029 kan-f: CCGTGATATTGCTGAAGAG acnA-r: GTAAAGTCCTGCATCAGCAC.

(164) Fermentation culturing of recombinant E. coli AcnA46-FKF, AcnA37-FKF, and AcnA93-FKF were performed in a way of Example 1, to determine β-carotene yields.

(165) The results are show in FIG. 2. The β-carotene yields of recombinant E. coli AcnA46-FKF, AcnA37-FKF, and AcnA93-FKF were 20.61 mg/g, 19.87 mg/g, and 18.95 mg/g, respectively; after the regulation of acnA, as compared with CAR001, M1-46 had the maximum improvement of β-carotene yield of 12%.

(166) 3 Improvement of the Expression Strength of Isocitrate Dehydrogenase Gene of Recombinant E. coli CAR001

(167) In the way of Example 3, part 1, original regulatory part (SEQ ID NO: 20) of isocitrate dehydrogenase gene (icd) of recombinant E. coli CAR001 was replaced with artificial regulatory parts M1-46 (SEQ ID NO: 14), M1-37 (SEQ ID NO: 10), and M1-93 (SEQ ID NO: 11), respectively, to obtain Icd46-FKF, Icd37-FKF, and Icd93-FKF.

(168) Specifically as below: 1800 bp DNA fragments icd-M1-46, icd-M1-37 and icd-M1-93 were amplified with icd-up-FRT and icd-RBS-down as primers, and recombinant strains M1-46, M1-37, M1-93 as a template, respectively; after homologous recombination of icd-M1-46 and E. coli CAR001, recombinant E. coli icd 46-FKF was obtained; after homologous recombination of icd-M1-37 and E. coli CAR001, recombinant E. coli icd 37-FKF was obtained; and after homologous recombination of icd-M1-46 and E. coli CAR001, recombinant E. coli icd 46-FKF was obtained; these were identified by PCR with kan-f and icd-r, and the correct PCR fragment was about 900 bp.

(169) The primers used were:

(170) TABLE-US-00030 icd-up-FRT: ATAGCCTAATAACGCGCATCTTTCATGACGGCAAACAATAGGGTAGTATT GTGTAGGCTGGAGCTGCTTC icd-RBS-down: TGCAGGGTGACTTCTTGCCTTGTGCCGGAACAACTACTTTACTTTCCATA GCTGTTTCCTGGTT.

(171) The primers for the PCR verification had sequences of:

(172) TABLE-US-00031 kan-f: CCGTGATATTGCTGAAGAG icd-r: ACCGGTGTAAATTTCCATCC.

(173) Fermentation culturing of recombinant E. coli Icd46-FKF, Icd37-FKF, and Icd93-FKF were performed in the way of Example 1, to determine β-carotene yields.

(174) The results are show in FIG. 2. The β-carotene yields of recombinant E. coli Icd46-FKF (M1-46), Icd37-FKF (M1-37), and Icd93-FKF (M1-93) were 21.16 mg/g, 16.93 mg/g, and 19.87 mg/g, respectively; after the regulation of icd, as compared with CAR001, M1-46 had the maximum improvement of β-carotene yield of 15%.

(175) 4 Improvement of the Expression Strength of Succinyl-CoA Synthetase Gene of Recombinant E. coli CAR001

(176) As the process of the one-step homologous recombination in Example 3, part 1, original regulatory part (SEQ ID NO: 21) of succinyl-CoA synthetase gene (SucCD) of recombinant E. coli CAR001 was replaced with artificial regulatory parts M1-46 (SEQ ID NO: 14), M1-37 (SEQ ID NO: 10), and M1-93 (SEQ ID NO: 11), respectively, to obtain SucCD46-FKF, SucCD37-FKF, and SucCD93-FKF.

(177) Specifically as below: 1800 bp DNA fragments sucC-M1-46, sucC-M1-37 and sucC-M1-93 were amplified with sucC-up-FRT and sucC-RBS-down as primers, and recombinant strains M1-46, M1-37, and M1-93 as a template, respectively; after homologous recombination of sucC-M1-46 and E. coli CAR001, recombinant E. coli sucC 46-FKF was obtained; after homologous recombination of sucC-M1-37 and E. coli CAR001, recombinant E. coli sucC 37-FKF was obtained; and after homologous recombination of sucC-M1-46 and E. coli CAR001, recombinant E. coli sucC 46-FKF was obtained; these were identified by PCR with kan-f and sucC-r, and the correct PCR fragment was about 900 bp.

(178) The primers used were:

(179) TABLE-US-00032 sucC-up-FRT:a TTCGGTCTACGGTTTAAAAGATAACGATTACTGAAGGATGGACAGAACAC GTGTAGGCTGGAGCTGCTTC sucC-RBS-down: AAGCCATAGCGGGCAAAAAGTTGTTTTGCCTGATATTCATGTAAGTTCAT AGCTGTTTCCTGGTT.

(180) The primers for the PCR verification had sequences of:

(181) TABLE-US-00033 kan-f: CCGTGATATTGCTGAAGAG sucC-r: TGATACGTTACCAGACGCTT.

(182) Fermentation culturing of recombinant E. coli SucCD46-FKF, SucCD37-FKF, and SucCD93-FKF were performed in the way of Example 1, to determine β-carotene yields.

(183) The results are show in FIG. 2. The β-carotene yields of recombinant E. coli SucCD46-FKF (M1-46), SucCD37-FKF (M1-37), and SucCD93-FKF (M1-93) were 19.32 mg/g, 20.42 mg/g, and 20.06 mg/g, respectively; after the regulation of sucCD, as compared with CAR001, M1-37 had the maximum improvement of β-carotene yield of 11%.

(184) 5. Improvement of the Expression Strength of Fumarase Gene of Recombinant E. coli CAR001

(185) As the process of the one-step homologous recombination in Example 3, part 1, original regulatory part (SEQ ID NO: 22) of fumarase A gene (Fumarase A, fumA) and original regulatory part (SEQ ID NO: 23) of fumarase C gene (Fumarase C, fumC) of recombinant E. coli CAR001 were replaced with artificial regulatory parts M1-46 (SEQ ID NO: 14), M1-37 (SEQ ID NO: 10), and M1-93 (SEQ ID NO: 11), respectively, to obtain FumA46-FKF, FumA37-FKF, FumA93-FKF, FumC46-FKF, FumC37-FKF, and FumC93-FKF.

(186) Specifically as below: 1800 bp DNA fragments fumA-M1-46, fumA-M1-37 and fumA-M1-93 were amplified with fumA-up-FRT and fumA-RBS-down as primers, and recombinant strains M1-46, M1-37, M1-93 as a template, respectively; after homologous recombination of fumA-M1-46 and E. coli CAR001, recombinant E. coli fumA 46-FKF was obtained; after homologous recombination of fumA-M1-37 and E. coli CAR001, recombinant E. coli fumA 37-FKF was obtained; and after homologous recombination of fumA-M1-46 and E. coli CAR001, recombinant E. coli fumA 46-FKF was obtained; these were identified by PCR with kan-f and fumA-r, and the correct PCR fragment was about 900 bp.

(187) 1800 bp DNA fragments fumC-M1-46, fumC-M1-37 and fumC-M1-93 were amplified with fumC-up-FRT and fumC-RBS-down as primers, and recombinant strains M1-46, M1-37, M1-93 as a template, respectively; after homologous recombination of fumC-M1-46 and E. coli CAR001, recombinant E. coli fumC46-FKF was obtained; after homologous recombination of fumC-M1-37 and E. coli CAR001, recombinant E. coli fumC37-FKF was obtained; and after homologous recombination of fumC-M1-46 and E. coli CAR001, recombinant E. coli fumC46-FKF was obtained; these were identified by PCR with kan-f and fumC-r, and the correct PCR fragment was about 900 bp.

(188) The primers used were:

(189) TABLE-US-00034 fumA-up-FRT: GGAGCCGCAAAAAGTCGTACTAGTCTCAGTTTTTGTTAAAAAAGTGTGTA GTGTAGGCTGGAGCTGCTTC fumA-RBS-down: TCTTTTTTGAGTGGAAAAGGAGCCTGATAATGAAAGGGTTTGTTTGAC ATAGCTGTTTCCTGGTT fumC-up-FRT: CTCACACAGTGCACTCGCTGTGTGAAATAAACAGAGCCGCCCTTCGGGGC GTGTAGGCTGGAGCTGCTTC fumC-RBS-down: GGGACATCAATCGCCCCCATCGAATCTTTTTCGCTGCGTACTGTATTCA TAGCTGTTTCCTGGTT.

(190) The primers for the PCR verification had sequences of:

(191) TABLE-US-00035 kan-f: CCGTGATATTGCTGAAGAG fumA-r: CGAGTAGCGCAAATTATCTT fumC-r: ATTCGTCGTCATGCTGTC.

(192) Fermentation culturing of recombinant E. coli FumA46-FKF, FumA37-FKF, FumA93-FKF, FumC46-FKF, FumC37-FKF, and FumC93-FKF were performed in the way of Example 1, to determine β-carotene yields.

(193) The results are show in FIG. 2. The β-carotene yields of recombinant E. coli FumA46-FKF (M1-46), FumA37-FKF (M1-37), FumA93-FKF (M1-93), FumC46-FKF (M1-46), FumC37-FKF (M1-37), and FumC93-FKF (M1-93) were 18.95 mg/g, 20.24 mg/g, 16.01 mg/g, 19.50 mg/g, 18.4 mg/g, and 19.87 mg/g, respectively; after the regulation of fumA, as compared with CAR001, M1-37 had the maximum improvement of β-carotene yield of 10%; after the regulation of fumC, as compared with CAR001, M1-93 had the maximum improvement of β-carotene yield of 8%.

(194) 6. Improvement of the Expression Strength of Malate Dehydrogenase Gene of Recombinant E. coli CAR001

(195) As the process of the one-step homologous recombination in Example 3, part 1, original regulatory part (SEQ ID NO: 24) of malate dehydrogenase gene (mdh) of recombinant E. coli CAR001 was replaced with artificial regulatory parts M1-46 (SEQ ID NO: 14), M1-37 (SEQ ID NO: 10), and M1-93 (SEQ ID NO: 11), respectively, to obtain Mdh46-FKF, Mdh37-FKF, and Mdh93-FKF.

(196) Specifically as below: 1800 bp DNA fragments mdh-M1-46, mdh-M1-37 and mdh-M1-93 were amplified with mdh-up-FRT and mdh-RBS-down as primers, and recombinant strains M1-46, M1-37, M1-93 as a template, respectively; after homologous recombination of mdh-M1-46 and E. coli CAR001, recombinant E. coli mdh 46-FKF was obtained; after homologous recombination of mdh-M1-37 and E. coli CAR001, recombinant E. coli mdh 37-FKF was obtained; and after homologous recombination of mdh-M1-46 and E. coli CAR001, recombinant E. coli mdh 46-FKF was obtained; these were identified by PCR with kan-f and mdh-r, and the correct PCR fragment was about 900 bp.

(197) The primers used were:

(198) TABLE-US-00036 mdh-up-FRT: AGAAACATGCCTGCGTCACGGCATGCAAATTCTGCTTAAAAGTAAATT GTGTAGGCTGGAGCTGCTTC mdh-RBS-down: GCAAGCGCCTGGCCAATACCGCCAGCAGCGCCGAGGACTGCGACTTTCAT AGCTGTTTCCTGGTT.

(199) The primers for the PCR verification had sequences of:

(200) TABLE-US-00037 kan-f: CCGTGATATTGCTGAAGAG mdh-r: CCTGAAGAAGGCTGAAATA.

(201) Fermentation culturing of recombinant E. coli Mdh46-FKF, Mdh37-FKF, and Mdh93-FKF were performed in the way of Example 1, to determine β-carotene yields.

(202) The results are show in FIG. 2. The β-carotene yields of recombinant E. coli Mdh46-FKF (M1-46), Mdh37-FKF (M1-37), and Mdh93-FKF (M1-93) were 18.77 mg/g, 18.95 mg/g, 18.77 mg/g, respectively; after the regulation of mdh, as compared with CAR001, M1-37 had the maximum improvement of β-carotene yield of 3%.

EXAMPLE 7

Improvement of Expression Intensities of 6-Phosphate-Glucose 1-Dehydrogenase Gene and Transketolase Gene of Recombinant E. coli CAR001

(203) 1 Improvement of the Expression Strength of 6-Phosphate-Glucose 1-Dehydrogenase Gene of Recombinant E. coli CAR001

(204) In the way similar to that in Example 5, original regulatory part (SEQ ID NO: 25) of 6-phosphate-glucose 1-dehydrogenase gene (zwf) of recombinant E. coli CAR001 was replaced with artificial regulatory parts M1-46 (SEQ ID NO: 14), M1-37 (SEQ ID NO: 10), and M1-93 (SEQ ID NO: 11), respectively, to obtain recombinant E. coli zwf46, zwf37, and zwf93.

(205) Construction of Recombinant E. coli Zwf46 (Two-Step Homologous Recombination):

(206) Step 1: as Step 1 of part 1 in Example 2, except that the starting vector was pXZ002 plasmid, the amplification primers were zwf-cat-up and zwf-cat-down, an about 3400 bp DNA fragment I was obtained, and the strain to be transformed was recombinant E. coli CAR001; an intermediate positive clone was obtained. Step 2: as Step 2 of part 1 in Example 2, except that the starting strain was M1-46, the amplification primers were zwf-up-P and zwf-RBS-down, an about 200 bp DNA fragment II was obtained, and the strain to be transformed was the intermediate positive clone got in step 1. Recombinant E. coli zwf46 was obtained.

(207) Construction of recombinant E. coli zwf37: in a way substantially the same as that of recombinant E. coli zwf46, except that the starting strain in Step 2 was replaced with M1-37, an about 200 bp DNA fragment II was obtained;

(208) Construction of recombinant E. coli zwf93: in a way substantially the same as that of recombinant E. coli zwf46, except that the starting strain in Step 2 was replaced with M1-93, to obtain an about 200 bp DNA fragment II;

(209) The primers used were:

(210) TABLE-US-00038 zwf-cat-up: ATCAGTTTTGCCGCACTTTGCGCGCTTTTCCCGTAATCGCACGGGTGGA TAAGTGTGACGGAAGATCACTTCGCA zwf-cat-down: CCAGGGTATACTTGTAATTTTCTTACGGTGCACTGTACTGCTTTTACGA GCTTGTTATTTGTTAACTGTTAATTGTCCT zwf-up-P: ATCAGTTTTGCCGCACTTTGCGCGCTTTTCCCGTAATCGCACGGGTGGA TAAGTTATCTCTGGCGGTGTTGAC zwf-RBS-down: GCGCCGAAAATGACCAGGTCACAGGCCTGGGCTGTTTGCGTTACCGC CATAGCTGTT TCCTGGTT.

(211) In above two steps, the identification primers were zwf-up and zwf-down with sequences of (the correct PCR fragment was about 900 bp):

(212) TABLE-US-00039 ApI-up: TTATCTCTGGCGGTGTTGAC zwf-down: CGGTTTAGCATTCAGTTTTGCC.

(213) Fermentation culturing of recombinant E. coli zwf46, zwf37, and zwf93 were performed in the way of Example 1, to determine β-carotene yields.

(214) The results were shown in FIG. 3. The β-carotene yields of recombinant E. coli zwf46 (M1-46), zwf37 (M1-37), and zwf93 (M1-93) were 19.32 mg/g, 18.4 mg/g, and 19.14 mg/g, respectively; after the regulation of zwf, as compared with CAR001, M1-46 had the maximum improvement of β-carotene yield of 5%.

(215) 2. Improvement of the Expression Strength of Transketolase Gene of Recombinant E. coli CAR001

(216) In a way similar to that of Example 5, original regulatory part (SEQ ID NO: 26) of transketolase gene (tktA) of recombinant E. coli CAR001 was replaced with artificial regulatory parts M1-46 (SEQ ID NO: 14), M1-37 (SEQ ID NO: 10), and M1-93 (SEQ ID NO: 11), respectively, to obtain recombinant strains tktA46, tktA37, and tktA93.

(217) Construction of Recombinant E. coli tktA46 (Two-Step Homologous Recombination):

(218) Step 1: as Step 1 of part 1 in Example 2, except that the starting vector was pXZ002 plasmid, the amplification primers were tktA-cat-up and tktA-cat-down, an about 3400 bp DNA fragment I was obtained, and the strain to be transformed was recombinant E. coli CAR001; an intermediate positive clone was obtained. Step 2: as Step 2 of part 1 in Example 2, except that the starting strain was M1-46, the amplification primers were tktA-up-P and tktA-RBS-down, an about 200 bp DNA fragment II was obtained, and the strain to be transformed was the intermediate positive clone got in step 1. Recombinant E. coli zwf46 was obtained.

(219) In above two steps, the identification primers were tktA-up and tktA-down with sequences of (the correct PCR fragment was about 900 bp):

(220) TABLE-US-00040 tktA-up: TCAGGAAATCACGCCACA tktA-down: ATCCGTCATCATATCCATCA.

(221) Construction of recombinant E. coli tktA37: in a way substantially the same as that of recombinant E. coli tktA46, except that the starting strain in Step 2 was replaced with M1-37, an about 200 bp DNA fragment II was obtained;

(222) Construction of recombinant E. coli tktA93: in a way substantially the same as that of recombinant E. coli tktA46, except that the starting strain in Step 2 was replaced with M1-93, to obtain an about 200 bp DNA fragment II;

(223) The primers used were:

(224) TABLE-US-00041 tktA-cat-up: AAATGCGCCGTTTGCAGGTGAATCGACGCTCAGTCTCAGTATAAGGAAG CGTTGGCCGATTCATTA tktA-cat-down: TCCATGCTCAGCGCACGAATAGCATTGGCAAGCTCTTTACGTGAGGAC ATGGAGAAAATACCGCATCAGG tktA-up-P: AAATGCGCCGTTTGCAGGTGAATCGACGCTCAGTCTCAGTATAAGGAA TTATCTCTGGCGGTGTTGAC tktA-RBS-down: TCCATGCTCAGCGCACGAATAGCATTGGCAAGCTCTTTACGTGAGGAC ATAGCTGTTTCCTGGTT.

(225) Fermentation culturing of recombinant E. coli tktA46, tktA37, and tktA93 were performed in the way of Example 1, to determine β-carotene yields.

(226) The results were shown in FIG. 3. The β-carotene yields of recombinant E. coli tktA46, tktA37, and tktA93 were 20.98 mg/g, 20.24 mg/g, and 21.34 mg/g, respectively; after the regulation of tktA, as compared with CAR001, M1-93 had the maximum improvement of β-carotene yield of 16%.

EXAMPLE 8

Combined Improvement of Expression Intensities of α-Ketoglutarate Dehydrogenase Gene and Succinate Dehydrogenase Gene of Recombinant E. coli CAR001

(227) Recombinant E. coli SucAB46, and SucAB37 were from recombinant E. coli CAR001 which original regulatory part (SEQ ID NO: 15) of α-ketoglutarate dehydrogenase gene (sucAB) replaced with artificial regulatory parts M1-46 (SEQ ID NO: 14), and M1-37 (SEQ ID NO: 10), respectively.

(228) Construction of Recombinant E. coli SucAB46 (Two-Step Homologous Recombination):

(229) Step 1: as Step 1 of part 1 in Example 2, except that the starting vector was pLOI4162 plasmid, the amplification primers were SucAB-cat-up and SucAB-cat-down, and the strain to be transformed was recombinant E. coli CAR001; an about 3400 bp DNA fragment I, an intermediate positive clone was obtained. Step 2: as Step 2 of part 1 in Example 2, except that the starting strain was M1-46, the amplification primers were SucAB-up-P and SucAB-RBS-down, an about 200 bp DNA fragment II was obtained, and the strain to be transformed was the intermediate positive clone got in step 1. Recombinant E. coli SucAB46 was obtained.

(230) The primers for the amplification in Step 1 were:

(231) TABLE-US-00042 SucAB-cat-up: GGTAGTATCCACGGCGAAGTAAGCATAAAAAAGATGCTTAAGGGATCACG TGTGACGGAAGATCACTTCGCA SucAB-cat-down: CCAGAGAGGTAAGAAGAGTCCAACCAGGCTTTCAAAGCGCTGTTCTGCAT TTATTTGTTAACTGTTAATTGTCCT

(232) The primers for the amplification in Step 2 were SucAB-up-P/SucAB-RBS-down with sequences of:

(233) TABLE-US-00043 SucAB-up-P: GGTAGTATCCACGGCGAAGTAAGCATAAAA.

(234) In above two steps, the identification primers were as below (an amplified fragment of about 400 bp was positive):

(235) TABLE-US-00044 ApI-up: TTATCTCTGGCGGTGTTGAC sucAB-r: GAAATATTCACGCGTTTGAG.

(236) Construction of recombinant E. coli SucAB 37: in a way substantially the same as that of recombinant E. coli SucAB46, except that the starting strain in Step 2 was M1-37, an about 200 bp DNA fragment II was obtained;

(237) After verifying the right clones by sequencing, the strains, in which original regulatory part of sucAB gene of CAR001 was replaced with artificial regulatory parts M1-46 and M1-37, respectively, were designated as recombinant E. coli SucAB46 and SucAB37.

(238) Recombinant E. coli sdhABCD46 and sdhABCD37 were recombinant E. coli CAR001 having original regulatory part (SEQ ID NO: 16) of succinate dehydrogenase gene (sdhABCD) replaced with artificial regulatory part M1-46, and M1-37, respectively.

(239) In a similar way, the primers used for the amplification in Step 1 were:

(240) TABLE-US-00045 SdhABCD-cat-up: ACTTTGTTGAATGATTGTCAAATTAGATGATTAAAAATTAAATAAATGTT TGTGACGGAAGATCACTTCGCA SdhABCD-cat-down: TTAACAGGTCTTTGTTTTTTCACATTTCTTATCATGAATAACGCCCACAT TTATTTGTTAACTGTTAATTGTCCT,
to obtain an about 3400 bp DNA fragment I;

(241) The primers for the amplification in Step 2 were SdhABCD-up-P/SdhABCD-RBS-down with sequences of:

(242) TABLE-US-00046 SdhABCD-up-P: ACTTTGTTGAATGATTGTCAAATTAGATGATTAAAAATTAAATAAATGTT TTATCTCTGGCGGTGTTGAC SdhABCD-RBS-down: TTAACAGGTCTTTGTTTTTTCACATTTCTTATCATGAATAACGCCCACAT AGCTGTTTCCTGGTT
to obtain an about 200 bp DNA fragment II;

(243) The primers for the PCR verification had sequences of (an amplified fragment of about 400 bp was positive):

(244) TABLE-US-00047 ApI-up: TTATCTCTGGCGGTGTTGAC sdhABCD-r: AATTTGACGAAGAAGCTGC.

(245) After verifying the right clones by sequencing, the strains, in which original regulatory part of sdhABCD gene of CAR001 was replaced with artificial regulatory parts M1-46 and M1-37, respectively, were designated as recombinant E. coli sdhABCD46 and sdhABCD37.

(246) In a similar way, the expression of sdhABCD gene of SucAB46 and SucAB37 were regulated by artificial regulatory part M1-46 and M1-37, respectively, by methods substantially the same as those of recombinant E. coli sdhABCD46 and sdhABCD37, except that the strain to be transformed in Step 1 was SucAB46 or SucAB37. After verifying the right clones by sequencing, the strains, in which original regulatory part of sdhABCD gene of SucAB46 and SucAB37 was replaced with artificial regulatory parts M1-46 and M1-37, respectively, were designated as recombinant E. coli SucAB46-sdhABCD46, SucAB46-sdhABCD37, SucAB37-sdhABCD46, and SucAB37-sdhABCD37.

(247) 2. Production of β-Carotene

(248) Fermentation culturing of recombinants E. coli SucAB46, SucAB37, sdhABCD46, sdhABCD37, SucAB46-sdhABCD46, SucAB46-sdhABCD37, SucAB37-sdhABCD46, and SucAB37-sdhABCD37 were performed in the way of Example 1, to determine β-carotene yields.

(249) The results were shown in FIG. 4. The β-carotene yields of recombinants E. coli SucAB46, SucAB37, sdhABCD46, sdhABCD37, SucAB46-sdhABCD46, SucAB46-sdhABCD37, SucAB37-sdhABCD46, and SucAB37-sdhABCD37 were 23.77 mg/g, 22.59 mg/g, 22.76 mg/g, 20.72 mg/g, 27.78 mg/g, 22.45 mg/g, 24.47 mg/g, and 11.96 mg/g, respectively; as can be seen, after the regulation of sucAB, as compared with CAR001, M1-46 had the maximum improvement of β-carotene yield of 29%, which was re-designated as CAR002 (SucAB46); after combined regulation of sucAB and sdhABCD, as compared with CAR001, SucAB46-sdhABCD46 had the maximum improvement of β-carotene yield of 51%, which was re-designated as CAR004.

EXAMPLE 9

Combined Modification of TCA Function Module and PPP Function Module of Recombinant E. coli CAR001 to Improve the Production of β-Carotene

(250) 1. Combined Modification of TCA Function Module and PPP Function Module of Recombinant E. coli CAR001

(251) Recombinant E. coli CAR003 was recombinant E. coli SucAB46 (obtained from Example 8) having original regulatory part (SEQ ID NO: 17) of talB gene replaced with artificial regulatory part M1-46.

(252) Specifically as below: Step 1: as Step 1 of part 1 in Example 2, except that the starting vector was pLOI4162 plasmid, the amplification primers were talB-cat-up and talB-cat-down, an about 3400 bp DNA fragment I was obtained; the strain to be transformed was recombinant E. coli SucAB46; an intermediate positive clone was obtained. Step 2: as Step 2 of part 1 in Example 2, except that the starting strain was M1-46, the amplification primers were talB-up-p and talB-RBS-down, an about 200 bp DNA fragment II was obtained; the strain to be transformed was the intermediate positive clone got in step 1. Recombinant E. coli CAR003 was obtained.

(253) In the two steps, the identification primers were talB-up and talB-down (an obtained fragment of about 900 bp was positive).

(254) After verifying the right clones by sequencing, the strains, in which original regulatory part of talB gene of SucAB46 was replaced with artificial regulatory part M1-46, were designated as recombinant E. coli CAR003, respectively.

(255) Recombinant E. coli CAR005 was recombinant E. coli CAR004 (obtained from Example 8) having original regulatory part (SEQ ID NO: 17) of talB gene replaced with artificial regulatory part M1-46; by a method substantially the same as that of recombinant E. coli CAR003, except that the starting strain in Step 1 was replaced with CAR004.

(256) 2. Production of β-Carotene

(257) Fermentation culturing of recombinant E. coli CAR005 was performed in the way of Example 1, to determine the β-carotene yield.

(258) The results are seen in Table 2. As compared with CAR001, the β-carotene yield of CAR005 was improved by 64%.

(259) TABLE-US-00048 TABLE 2 Combined modification of TCA function module and PPP function module of recombinant E. coli CAR001 and improvement of β-carotene production Dry β-carotene β-carotene Genetic weight content yield Increased Strain background OD.sub.600 (g/L) (mg/L) (mg/g) folds CAR001 4.31 ± 0.01 1.39 ± 0.01 25.67 ± 0.01 18.40 ± 0.01 0 CAR002 CAR001, SucAB46 4.35 ± 0.03 1.40 ± 0.03 33.40 ± 0.03 23.77 ± 0.03 29% CAR003 CAR001, 4.06 ± 0.04 1.31 ± 0.04 32.17 ± 0.06 24.54 ± 0.06 33% SucAB46-TalB46 CAR004 CAR001, 4.38 ± 0.03 1.42 ± 0.03 39.34 ± 0.04 27.78 ± 0.04 51% SucAB46-Sdh46 CAR005 CAR001, SucAB46- 4.01 ± 0.00 1.29 ± 0.00 39.03 ± 0.02 30.17 ± 0.02 64% Sdh46-TalB46

EXAMPLE 10

High-Density Fermentation of Recombinant E. coli CAR005

(260) High-density fermentation of recombinant E. coli CAR005 was performed in a 7 L fermentation tank (Labfors 4; Infors Biotechnoligy Co. Ltd.), by a method as below: a single colony was picked into 4 ml of a LB culture medium in a tube, and cultivated at 30° C., 250 rpm overnight; then, an amount of 1% of the strain solution, i.e. 300 μl of the strain solution, from the tube was inoculated into 50 ml culture medium in a 250 ml Tri Flask, and after culture at 37° C., 250 rpm for 24 h, the strain solution was namely the seed for the high-density fermentation. The high-density fermentation thereof was performed with a synthetic culture medium. A 7 L fermentation tank was charged with 3 L of the fermentation culture medium, and 300 ml of the seed solution.

(261) The fermentation culture medium (g/L) had ingredients of 10 g of glycerol, 1.7 g of citric acid, 10.5 g of KH.sub.2PO.sub.4.3H.sub.2O, 6 g of (NH.sub.4).sub.2HPO.sub.4, 3.44 g of MgSO.sub.4.7H.sub.2O, and 10 ml of a trace element solution. The trace element solution had ingredients (g/L) of: 10 g of FeSO.sub.4.7H.sub.2O, 5.25 g of ZnSO.sub.4.7H.sub.2O, 3.0 g of CuSO.sub.4.5H.sub.2O, 0.5 g of MnSO.sub.4.4H.sub.2O, 0.23 g of Na.sub.2B.sub.4O.sub.7.10H.sub.2O, 2.0 g of CaCl.sub.2, and 0.1 g of (NH.sub.4).sub.6MO.sub.7O.sub.24.

(262) The fermentation was performed at a temperature of 37° C., an air flow rate of 5 L/min, dissolved oxygen controlled at 30%, and a speed of revolution coupled with dissolved oxygen, between 600-1200 rpm. pH was adjusted at 7.0 with 5 M ammonia. Supplementary medium had ingredients (g/L) of: 500 g of glycerol, 15 g of peptone, 30 g of yeast extract, and 30 g of MgSO.sub.4.7H.sub.2O.

(263) The fermentation was performed in a manner of simulated exponential fed-batch mode, and the concentration of glycerol was kept below 0.5 g/L, the yield of acetic acid was kept below 0.2 g/L, and average feeding rate was 20 ml/h throughout the fermentation.

(264) After 9 h of the fermentation, 2 ml of the strain solution was sampled every 4 h, and centrifuged at 14000 rpm for 3 min, washed with sterilized water, with supernatants discarded, and stored in a refrigerator at −20° C. Prior to use, the sample was added with 1 ml of acetone, and extracted at 55° C. in dark for 15 min, and centrifuged at 14000 rpm for 10 min Supernatant thereof was used to determine the content of β-carotene with HPLC (Agilent Technologies high performance liquid chromatograph 1260 Infinity).

(265) Standard β-carotene (Sigma, US (Cat. No. C4582)) was remained at −80° C., and was used to determine a standard curve immediately after received; when β-carotene was extracted from the supernatant, its content was immediately measured with HPLC (by a method as above), to demonstrate the containment of β-carotene (the supernatant exhibited yellow, but strain became white from yellow after the extraction with acetone; in the HPLC assay, the sample had an appearance time of β-carotene identical with that of the standard (an appearance time of 17.2 min), confirming the containment of β-carotene).

(266) The fermentation results were shown in FIG. 5. The high-density fermentation was in a period of 100 h, wherein the cells entered a stable phase at 70 h, and finally had OD.sub.600 of 146, and a dry weight of 47.16 g/L DCW. The yield of β-carotene kept increasing in first 56 h, with a maximum yield of 2.16 g/L, and a maximum yield per cell of 60 mg/g DCW.

EXAMPLE 11

Deletion of crtXY Gene of Recombinant E. coli CAR001 and Production of Lycopene

(267) 1. Deletion of crtXY Gene of Recombinant E. coli CAR001 and Construction of Recombinant Strain LYC001

(268) Recombinant strain LYC001 was obtained by deletion of the β-carotene cyclase gene crtX and lycopene β-cyclase gene crtY from β-carotene synthesis gene cluster of recombinant E. coli CAR001, via homologous recombination, specifically as below:

(269) Procedures in a way as Example 1, part II: Step 1: amplifying 4000 bp DNA fragment I with the plasmid DNA of pLOI4162 as a template, and primers CrtE-taa-cat-f/CrtI-atg-cat-r, the fragment being DNA fragment I comprising chloromycetin gene and levansucrose transferase gene;

(270) TABLE-US-00049 CrtE-taa-cat-f: ACCATTTTGTTCAGGCCTGGTTTGAGAAAAAACTCGCTGCCGTCAGTTA ATGTGACGGAAGATCACTTCGCA CrtI-atg-cat-r: GCCAGAGCCAGACCACCAAAGCCTGCGCCAATTACTGTAGTTCTATTCAT TTATTTGTTAACTGTTAATTGTCCT Step 2: electrotransforming DNA fragment I obtained in Step 1 into E. coli CAR001 with pKD46, to obtain strain JZ001; Step 3: amplifying with the plasmid DNA of pTrc99A-M-crt as a template, and primers crtE-r/crtI-RBS-F, to obtain an about 7000 bp PCR product:

(271) TABLE-US-00050 CrtE-r: TTAACTGACGGCAGCGAGTT CrtI-RBS-F: CTAAGGAGATATACCATGAATAGAACTACAGTAATTG GCGC; Step 4: phosphorylating and self-linking the about 7000 bp PCR product obtained by the amplification in Step 3, to obtain plasmid pTrc99A-M-crtEIB for use in second homologous recombination, the plasmid being a recombinant vector comprising the lycopene synthesis gene cluster, which was a gene cluster consisting of geranyl-geranyl diphosphate synthase gene crtE, phytoene desaturase gene crtI and phytoene synthase gene crtB; Step 5: amplifying with the plasmid DNA of pTrc99A-M-crtEIB as a template, and primers crtE-f/crtI-484-r to obtain an about 1500 bp DNA fragment II:

(272) TABLE-US-00051 CrtE-f: atgatgacggtctgtgcagaa crtI-484-r: TTAACTGACGGCAGCGAGTT; Step 6: electrotransforming the about 1500 bp DNA fragment II obtained in Step 5 into JZ001 with pKD46 plasmid, to obtain a strain having crtXY gene deleted, which was designated as LYC001.
2. Production of Lycopene by Fermentation of Recombinant E. coli LYC001

(273) A single colony of recombinant E. coli LYC001 was picked into 4 ml of LB culture medium in a tube, and cultivated at 37° C., 250 rpm overnight; then, an amount of 1% of the overnight cultivated seed solution was inoculated to 10 ml of a LB culture medium in a 100 ml Tri Flask, and cultivated at 37° C., 250 rpm in dark for 24 h, after which samples were taken to determine the lycopene yield, in triplicate for each sample.

(274) Determination of lycopene standard curve: standard of lycopene (P/N: L 9 8 7 9) was supplied by Sigma, and used for the determination of the standard curve immediately after received; the filter used for filtration was 0.45 μm millipore filter (Millpor); acetone, methanol, dichloromethane, petroleum ether, acetonitrile were chromatographic pure agents, supplied by Merk.

(275) 50 mg of lycopene standard was precisely weighted and added to 1 ml of dichloromethane to dissolve, and then transferred to a 250 ml brown volumetric flask, and made up with petroleum ether to 250 ml, to formulate a 200 μg/ml stock solution (stored in a refrigerator at −80° C.). When used, it was serially diluted (2×, 4×, 8×, 16×, 32×) with acetone, and filtered into HPLC vials, to subject to HPLC detection (with a Symmetry C18 column (4.6×250 mm, 5 μm); column temperature: 30° C.; mobile phase: methanol:acetonitrile:dichloromethane=21:21:8; injection volume: 20 μl; injection time: 20 min; DAD light detection; and detection wavelength of 480 nm), and through a relation between standard peak area and lycopene concentration, to obtain a standard curve of lycopene.

(276) Step 2: a single colony of recombinant E. coli LYC001 was picked into 4 ml of LB culture medium in a tube, and cultivated at 37° C., 250 rpm overnight; then, an amount of 1% of the overnight cultivated seed solution was inoculated to 10 ml of a LB culture medium in a 100 ml Tri Flask, and cultivated at 37° C., 250 rpm in dark for 24 h, after which samples were taken to determine lycopene yield, in triplicate for each sample.

(277) After lycopene was extracted from supernatant, its content was immediately measured with HPLC; supernatant exhibited red, but the strain became white from red after extraction with acetone. In the HPLC assay, the samples had an appearance time of lycopene identical with that of the standard (an appearance time of 11.3 min).

(278) The results are seen in Table 4. The lycopene yield of LYC001 was up to 10.49 mg/L, and the content of LYC001 was up to 6.52 mg/g dry cell weight.

EXAMPLE 12

Improvement of Expression Strength of α-Ketoglutarate Dehydrogenase Gene of Recombinant E. coli LYC001

(279) 1. Improvement of the Expression Strength of α-Ketoglutarate Dehydrogenase Gene of Recombinant E. coli LYC001 and Construction of Recombinant Strain LYC002

(280) Recombinant strain LYC002 was obtained from LYC001 with original regulatory part (SEQ ID NO: 15) of sucAB gene replaced with artificial regulatory part M1-46 (SEQ ID NO: 14).

(281) A specific method is as blow (two-step homologous recombination): Step 1: as Step 1 of part 1 in Example 2, except that the starting vector was pLOI4162 plasmid, the amplification primers were SucAB-cat-up/SucAB-cat-down, an about 3400 bp DNA fragment I was obtained; and the strain to be transformed was recombinant E. coli LYC001; an intermediate positive clone was obtained. Step 2: as Step 2 of part 1 in Example 2, except that the starting strain was a recombinant strain M1-46, the amplification primers were SucAB-up-P/SucAB-RBS-down, an about 200 bp DNA fragment II was obtained; the strain to be transformed was the intermediate positive clone got in step 1. Recombinant E. coli LYC002 was obtained.

(282) The primers for the amplification in Step 1 were:

(283) TABLE-US-00052 SucAB-cat-up: GGTAGTATCCACGGCGAAGTAAGCATAAAAAAGATGCTTAAGGGATCACG TGTGACGGAAGATCACTTCGCA SucAB-cat-down: CCAGAGAGGTAAGAAGAGTCCAACCAGGCTTTCAAAGCGCTGTTCTGCAT TTATTTGTTAACTGTTAATTGTCCT

(284) The primers for the amplification in Step 2 were SucAB-up-P/SucAB-RBS-down with sequences of:

(285) TABLE-US-00053 SucAB-up-P: GGTAGTATCCACGGCGAAGTAAGCATAAAA

(286) The PCR identification primers in above two steps had sequences of (an amplified fragment of about 400 bp was positive):

(287) TABLE-US-00054 ApI-up: TTATCTCTGGCGGTGTTGAC sucAB-r: GAAATATTCACGCGTTTGAG

(288) After verifying the right clones by sequencing, the strain having the regulatory part sucAB gene of LYC001 replaced with artificial regulatory part M1-46 was designated as recombinant E. coli LYC002.

(289) 2. Production of Lycopene by Recombinant E. coli LYC002

(290) A Fermentation culturing of recombinant E. coli LYC002 was performed in the way of Example 11, to determine lycopene yield. The results are seen in Table 4. 10.67 mg/g lycopene was produced by recombinant E. coli LYC002; after the regulation of sucAB, lycopene yield was improved over LYC001 by 64%.

EXAMPLE 13

Combined Regulation of Expression Intensities of α-Ketoglutarate Dehydrogenase Gene and Transaldolase Gene of Recombinant E. coli LYC001

(291) 1. Combined Regulation of the Expression Intensities of α-Ketoglutarate Dehydrogenase Gene and Transaldolase Gene of Recombinant E. coli LYC001

(292) Recombinant E. coli LYC003 was LYC002 having original regulatory part (SEQ ID NO: 17) of talB gene replaced with artificial regulatory part M1-46.

(293) Detailed method was as below (two-step homologous recombination): Step 1: as Step 1 of part 1 in Example 2, except that the starting vector was pLOI4162 plasmid, the amplification primers were talB-cat-up/talB-cat-down, an about 3400 bp DNA fragment I was obtained; and the strain to be transformed was recombinant E. coli LYC002; an intermediate positive clone was obtained. Step 2: as Step 2 of part 1 in Example 2, except that the starting strain was recombinant strain M1-46, the amplification primers were talB-up-P/talB-RBS-down, an about 200 bp DNA fragment II was obtained; and the strain to be transformed was the intermediate positive clone got in step 1. Recombinant E. coli LYC003 was obtained.

(294) The primers for the amplification in Step 1 were:

(295) TABLE-US-00055 talB-cat-up: AGTCTCGCCTGGCGATAACCGTCTTGTCGGCGGTTGCGCTGACGTTGCG TCGTGTGTGACGGAAGATCACTTCGCA talB-cat-down: TCATGATAGTATTTCTCTTTAAACAGCTTGTTAGGGGGATGTAACCGGTC TGCTTATTTGTTAACTGTTAATTGTCCT

(296) The primers for the amplification in Step 2 were talB-up-P/talB-RBS-down having sequences of:

(297) TABLE-US-00056 talB-up-P: AGTCTCGCCTGGCGATAACCGTCTTGTCGGCGGTTGCGCTGACGTTGCG TCGTGTTATCTCTGGCGGTGTTGAC talB-RBS-down: AGTGTCGGCCACTACGGTGGTGTACTGACGAAGGGAGGTCAATTTGTCC GTCATAGCTGTTTCCTGGTT

(298) In above two steps, the identification primers were talB-up/talB-down having sequences of (the correct PCR fragment was about 900 bp):

(299) TABLE-US-00057 talB-up: CGGATGTAGCGAAACTGCAC talB-down: GACGCTTCGGTGTCATAGGAAAG.

(300) After verifying the right clones by sequencing, the strains having original regulatory part of talB gene of LYC002 replaced with artificial regulatory part M1-46 were designated as recombinant E. coli LYC003, respectively.

(301) 2. Production of Lycopene by Recombinant E. coli LYC003

(302) A Fermentation culturing of recombinant E. coli LYC003 was preformed in the way of Example 11, to determine lycopene yield.

(303) The results are seen in Table 4. 11.03 mg/g lycopene was produced by recombinant E. coli LYC003; after the combined regulation of sucAB and talB, the lycopene yield was improved over LYC001 by 70%.

EXAMPLE 14

Combined Regulation of Expression Intensities of α-Ketoglutarate Dehydrogenase Gene, Transaldolase Gene and Succinate Dehydrogenase Gene of Recombinant E. coli LYC001

(304) I. Combined Regulation of the Expression Intensities of α-Ketoglutarate Dehydrogenase Gene, Transaldolase Gene and Succinate Dehydrogenase Gene of Recombinant E. coli LYC001

(305) 1. Construction of Recombinant E. coli LYC005

(306) Recombinant E. coli LYC005 was recombinant E. coli LYC003 having original regulatory part (SEQ ID NO: 16) of sdhABCD gene replaced with artificial regulatory part M1-46.

(307) Detailed method was as below (two-step homologous recombination): Step 1: as Step 1 of part 1 in Example 2, except that the starting vector was pLOI4162 plasmid, the amplification primers were SdhABCD-cat-up/SdhABCD-cat-down, an about 3400 bp DNA fragment I was obtained; and the strain to be transformed was recombinant E. coli LYC002; an intermediate positive clone was obtained. Step 2: as Step 2 of part 1 in Example 2, except that the starting strain was recombinant strain M1-46, the amplification primers were SdhABCD-up-P/SdhABCD-RBS-down, an about 200 bp DNA fragment II was obtained; the strain to be transformed was the intermediate positive clone got in step 1. Recombinant E. coli LYC005 was obtained.

(308) Step 1 amplification primers:

(309) TABLE-US-00058 SdhABCD-cat-up: ACTTTGTTGAATGATTGTCAAATTAGATGATTAAAAATTAAATAAATGTT TGTGACGGAAGATCACTTCGCA SdhABCD-cat-down: TTAACAGGTCTTTGTTTTTTCACATTTCTTATCATGAATAACGCCCACAT TTATTTGTTAACTGTTAATTGTCCT

(310) The primers for the amplification in Step 2 were SdhABCD-up-P/SdhABCD-RBS-down having sequences of:

(311) TABLE-US-00059 SdhABCD-up-P: ACTTTGTTGAATGATTGTCAAATTAGATGATTAAAAATTAAATAAATGTT TTATCTCTGGCGGTGTTGAC SdhABCD-RBS-down: TTAACAGGTCTTTGTTTTTTCACATTTCTTATCATGAATAACGCCCACAT AGCTGTTTCCTGGTT

(312) The identification primers ApI-up and sdhABCD-r in above two steps (an obtained fragment of about 400 bp was positive) were:

(313) TABLE-US-00060 ApI-up: TTATCTCTGGCGGTGTTGAC sdhABCD-r: AATTTGACGAAGAAGCTGC.

(314) After verifying the right clones by sequencing, the strain, having the regulatory part of sdhABCD gene of LYC003 replaced with artificial regulatory part M1-46, was designated as recombinant E. coli LYC005.

(315) 2. Production by Recombinant E. coli LYC005

(316) A Fermentation culturing of recombinant E. coli LYC005 was performed in the way of Example 11, to determine lycopene yield.

(317) The results are seen in Table 3. 11.53 mg/g of lycopene was produced by recombinant E. coli LYC005; after the combined regulation of genes sucAB, talB and sdhABCD, the lycopene yield was improved over LYC001 by 76%.

(318) TABLE-US-00061 TABLE 3 Combined engineering of TCA function module and PPP function module of recombinant E. coli LYC001 and improved production of β-carotene Dry Lycopene Lycopene Genetic weight content yield Increased Strain background OD.sub.600 (g/L) (mg/L).sup.a (mg/g) folds LYC001 4.25 ± 0.22 1.61 ± 0.12 10.49 ± 0.52  6.52 ± 0.11 0  LYC002 LYC001, SucAB46 3.79 ± 0.04 1.44 ± 0.02 15.36 ± 0.11 10.67 ± 0.03 64% LYC003 LYC001, 3.79 ± 0.08 1.44 ± 0.04 15.89 ± 0.08 11.03 ± 0.02 70% SucAB46-TalB46 LYC005 LYC001, SucAB46- 4.34 ± 0.04 1.64 ± 0.02 18.91 ± 0.61 11.53 ± 0.18 76% Sdh46-TalB46

EXAMPLE 15

High-Density Fermentation of Recombinant E. coli LYC005

(319) High-density fermentation of recombinant E. coli LYC005 was performed in a 7 L fermentation tank (Labfors 4; Infors Biotechnoligy Co. Ltd.), by a method as below: single colonies were picked into 4 ml of a LB culture medium in a tube, and cultivated at 30° C., 250 rpm overnight; then, an amount of 1% of the strain solution, i.e. 300 μl of the strain solution, in the tube was inoculated to 50 ml of a LB culture medium in a 250 ml Tri Flask, and cultivated at 37° C., 250 rpm for 12 h, the resulting strain solution being the seed for high-density fermentation. The high-density fermentation thereof was performed using a synthetic culture medium. A 7 L fermentation tank was charged with 3 L of the fermentation culture medium, and 300 ml of the seed solution.

(320) The fermentation culture medium (g/L) had ingredients of 10 g of glycerol, 1.7 g of citric acid, 10.5 g of KH.sub.2PO.sub.4.3H.sub.2O, 6 g of (NH.sub.4).sub.2HPO.sub.4, 3.44 g of MgSO.sub.4.7H.sub.2O, and 10 ml of a trace element solution. The trace element solution had ingredients (g/L) of: 10 g of FeSO.sub.4.7H.sub.2O, 5.25 g of ZnSO.sub.4.7H.sub.2O, 3.0 g of CuSO.sub.4.5H.sub.2O, 0.5 g of MnSO.sub.4.4H.sub.2O, 0.23 g of Na.sub.2B.sub.4O.sub.7.10H.sub.2O, 2.0 g of CaCl.sub.2, and 0.1 g of (NH.sub.4).sub.6MO.sub.7O.sub.24.

(321) The fermentation was performed at a temperature of 30° C., an air flow rate of 4 L/min, and dissolved oxygen controlled at 30%. In order to control dissolved oxygen at 30%, it was required that the speed of revolution was coupled with the dissolved oxygen, with speed of revolution maintained at 400-1200 rpm, and constantly maintained at 1200 rpm after the dissolved oxygen was recovered (the initial carbon source was exhausted). pH was controlled at 7.0 with 5 M ammonia. A supplemented medium (g/L) had ingredients of: 500 g of glycerol, 15 g of peptone, 30 g of yeast extract, and 30 g of MgSO.sub.4.7H.sub.2O.

(322) The fermentation was performed in a way of simulated exponential fed-batch mode, and throughout the fermentation the concentration of glycerol was kept below 0.5 g/L, the yield of acetic acid was kept below 0.2 g/L, and the average feed rate was 18 ml/h. After 10 h of fermentation, 2 ml of the strain solution was sampled every 6 h, centrifuged at 14000 rpm for 3 min, washed with sterilized water, with supernatant discarded, and stored in a refrigerator at −20° C. Prior to the content measurement, the samples were added with 1 ml of acetone, extracted at 55° C. in dark for 15 min, and centrifuged at 14000 rpm for 10 min, and the supernatant was taken for measure the content of lycopene using HPLC (Agilent Technologies high performance liquid chromatograph 1260 Infinity).

(323) The fermentation results were shown in FIG. 6. The high-density fermentation was in a period of 88 h, wherein the cells entered a stable phase at 72 h, and finally had OD.sub.600 of 149, and a weight of 56.55 g/L DCW. The yield of β-carotene kept increasing in first 82 h, with a maximum yield of 0.95 g/L.

EXAMPLE 16

Improvement of Expression Strength of sucAB Gene of E. coli ATCC8739 and Improvement of β-Carotene and Lycopene

(324) I. Construct of Recombinant Strains E. coli ATCC8739 (pTrc99A-M-Crt), 8739-SucAB46 (pTrc99A-M-Crt), ATCC8739 (pTrc99A-M-crtEIB), and 8739-SucAB46 (pTrc99A-M-crtEIB)

(325) 1. Construction of Recombinant Strain 8739-SucAB46

(326) 1) Construction of Recombinant Strain 8739-SucAB46

(327) Recombinant E. coli 8739-SucAB46 was a strain in which original regulatory part (SEQ ID NO: 15) of sucAB gene of ATCC8739 was replaced with artificial regulatory part M1-46 (SEQ ID NO: 14).

(328) Detailed method is as below (two-step homologous recombination): Step 1: as Step 1 of part 1 in Example 2, except that the starting vector was pLOI4162 plasmid, the amplification primers were SucAB-cat-up/SucAB-cat-down, an about 3400 bp DNA fragment I was obtained; and the strain to be transformed was ATCC8739; Step 2: as Step 2 of part 1 in Example 2, except that the starting strain was a recombinant strain M1-46, the amplification primers were SucAB-up-P/SucAB-RBS-down, an about 200 bp DNA fragment II was obtained; and the strain to be transformed was the intermediate positive clone got in step 1. Recombinant E. coli 8739-SucAB46 was obtained.

(329) The primers for the amplification in Step 1 were:

(330) TABLE-US-00062 SucAB-cat-up: GGTAGTATCCACGGCGAAGTAAGCATAAAAAAGAT GCTTAAGGGATCACG TGTGACGGAAGATCACTTCGCA SucAB-cat-down: CCAGAGAGGTAAGAAGAGTCCAACCAGGCTTTCA AAGCGC TGTTCTGCAT TTATTTGTTAACTGTTAATTGTCCT.

(331) The primers for the amplification in Step 2 were SucAB-up-P/SucAB-RBS-down having sequences of:

(332) TABLE-US-00063 SucAB-up-P: GGTAGTATCCACGGCGAAGTAAGCATAAAA sucAB-RBS-down: CCAGAGAGGTAAGAAGAGTCCAACCAGGCTTTCA AAGCGCTGTTCTGCATAGCTGTTTCCTGGTT.

(333) The identification primers in above two steps (an amplified fragment of about 400 bp was positive) were:

(334) TABLE-US-00064 ApI-up: TTATCTCTGGCGGTGTTGAC sucAB-r: GAAATATTCACGCGTTTGAG

(335) After verifying the right clones by sequencing, the strains having the promoter of sucAB gene of ATCC8739 was replaced with artificial regulatory part M1-46 were designated as recombinant E. coli 8739-SucAB46, respectively.

(336) 2) Enzymatic Activity Assay of α-Ketoglutarate Dehydrogenase (SucAB)

(337) Single colonies of E. coli ATCC8739 and recombinant E. coli 8739-SucAB46 were picked into 4 ml of LB culture medium (with a final concentration of 100 μg/ml of ampicillin) in a tube, and cultivated at 30° C., 250 rpm overnight, respectively; then, an amount of 1% of the strain solution, i.e. 100 μl of the strain solution, in the tube was inoculated to 10 ml of a culture medium in a 100 ml small shaking flask, and cultivated at 30° C., 250 rpm. 30 ml of the fermented solution at mid-late of logarithmic growth was placed into a 50 ml centrifuge tube, and centrifuged at 4° C., 10000 rpm for 10 min, with supernatant discarded. After washed with 5 ml of 100 mmol/L Tris-HCl solution twice, the cells were suspended in 3 ml of 100 mmol/L Tris-HCl solution, and placed into an ice tank to be ultrasonicated for 20 min. After centrifugation at 4° C., 10000 rpm for 20 min, the supernatant was used for the enzymatic activity assay. The reaction solution for the enzymatic activity assay of α-ketoglutarate dehydrogenase had a composition shown in Table 4:

(338) TABLE-US-00065 TABLE 4 Composition of the reaction solution for enzymatic activity assay of α-ketoglutarate dehydrogenase Stock Volumn Final concentration concentration (ul/ml) Water 565 50 mM potassium phosphate (pH 8.0) 500 mM  100 1 mM MgCl2 100 mM  10 2.6 mM cysteine hydrochloride 26 mM 100 2.5 mM NAD+ 25 mM 100 0.2 mM TPP 40 mM 5 0.13 mM CoA 13 mM 10 2 mM ketogluterate potassium 20 mM 100 Crude extract 10

(339) 10 μl of above supernatant that had been ultrasonicated and centrifuged was added and mixed well, and placed into a colorimeter cell, and changes in A.sub.340 were recorded. A reaction buffer solution added with 10 μl of ddH.sub.2O was the control.

(340) The enzymatic activity unit was defined as: μmol of NADH consumed by per mg of protein per minute.

(341) The α-ketoglutarate dehydrogenase of E. coli ATCC8739 had enzymatic activity of 0.057 U/mg protein, and the enzymatic activity of α-ketoglutarate dehydrogenase of recombinant E. coli 8739-SucAB46 of 0.12 U/mg protein. With original regulatory part of sucAB gene replaced with artificial regulatory part M1-46, the enzymatic activity of α-ketoglutarate dehydrogenase was improved by 111%.

(342) 2. E. coli ATCC8739 (pTrc99A-M-Crt), 8739-SucAB46 (pTrc99A-M-Crt), ATCC8739 (pTrc99A-M-crtEIB), 8739-SucAB46 (pTrc99A-M-crtEIB)

(343) Plasmids pTrc99A-M-crt (which plasmid contained β-carotene synthesis gene cluster crtEXYIB) and pTrc99A-M-crtEIB (which plasmid contained lycopene synthesis gene cluster crtEIB, as constructed by a process in Example 11) were electrotransformed into ATCC8739 and 8739-SucAB46, respectively. The electrotransformation was in conditions that: firstly, competent cells of E. coli ATCC8739 and 8739-SucAB46 to be electrotransformed were prepared; 50 μl of competent cells were placed on ice, added with 1 μl of a corresponding plasmid (about 50 ng/μl), and kept to stand on ice for 2 minutes, and thereafter was transferred to a 0.2 cm Bio-Rad cuvette, and subjected to electric shock using an MicroPulser (Bio-Rad) electroporation apparatus, with an electric shock parameter of a voltage of 2.5 kv. After the electric shock, 1 ml of LB culture medium was immediately transferred to the cuvette, and lashed 5 times, and then it was transferred to a tube, and incubated at 75 rpm, 30° C. for 2 hours. 50 μl of the strain solutions were coated on a LB plate containing ampicillin, and incubated at 37° C. overnight. Thereafter, 5 positive single colonies were picked for a liquid culturing, and positive cloned plasmids were extracted for verification by digestion. The results showed that each of the plasmids was successfully transformed into a corresponding strain, to obtain E. coli ATCC8739 (pTrc99A-M-crt), 8739-SucAB46 (pTrc99A-M-crt), ATCC8739 (pTrc99A-M-crtEIB), and 8739-SucAB46 (pTrc99A-M-crtEIB).

(344) II. Production of β-Carotene and Lycopene

(345) Single colonies of recombinant E. coli ATCC8739 (pTrc99A-M-crt), 8739-SucAB46 (pTrc99A-M-crt), ATCC8739 (pTrc99A-M-crtEIB), and 8739-SucAB46 (pTrc99A-M-crtEIB) were picked into 4 ml of LB culture medium (with a final concentration of 100 μg/ml of ampicillin) in a tube, and cultivated at 30° C., 250 rpm overnight, respectively; then, an amount of 1% of the strain solution, i.e. 100 μl of the strain solutions, in the tubes were inoculated to 10 ml of a culture medium in a 100 ml small shaking flask, and cultivated at 30° C., 250 rpm for 24 h, respectively. Thereafter, samples were taken to determine β-carotene and lycopene yields. The β-carotene yield was determined by a method as seen in Example 1 and the lycopene yield was determined by a method as seen in Example 11.

(346) Recombinant E. coli ATCC8739 (pTrc99A-M-crt) had a β-carotene yield of 0.58 mg/g, 8739-SucAB46 (pTrc99A-M-crt) had a β-carotene yield of 0.75 mg/g. After the regulation of sucAB, the β-carotene yield was improved by 29%.

(347) Recombinant E. coli ATCC8739 (pTrc99A-M-crtEIB) had a lycopene yield of 0.12 mg/g, and 8739-SucAB46 (pTrc99A-M-crtEIB) had a lycopene yield of 0.38 mg/g. After the regulation of sucAB, the lycopene yield was improved by 217%.

INDUSTRIAL APPLICATION

(348) It is confirmed from the experiments of the present invention that the present invention regulates the expression of key genes in MEK pathway using a gene expression regulating strategy different than previously used, and studies the effect thereof on the capability of β-carotene production. Several artificial regulatory parts with different intensities are used to regulate these key genes, to find optimal expression intensity strength for each of the genes. In the present invention, a plurality of recombinant strains are constructed to improve the activities of α-ketoglutarate dehydrogenase, succinate dehydrogenase and transaldolase, so as to improve the ability of a cell to synthesize NADPH and ATP, thus to improve the efficiency of the MEP pathway and the production capability of terpenoid. Particularly, the expression strength of α-ketoglutarate dehydrogenase gene sucAB was improved in E. coli by homologous recombination, so that the productions of β-carotene and lycopene may be improved.