Method for constructing next-generation sequencing library for detection of lowfrequency mutation and kit thereof
11248228 · 2022-02-15
Assignee
- NANJING ANNOROAD GENE TECHNOLOGY CO. LTD (Beijing, CN)
- ANNOROAD GENE TECHNOLOGY (BEIJING) CO., LTD (Beijing, CN)
Inventors
- Xiuli Wang (Beijing, CN)
- Wang Wang (Beijing, CN)
- Ruilin Jing (Beijing, CN)
- Zhaoling Xuan (Beijing, CN)
- Dawei Li (Beijing, CN)
- Junbin Liang (Beijing, CN)
- Chongjian Chen (Beijing, CN)
Cpc classification
C12N15/1065
CHEMISTRY; METALLURGY
C40B50/06
CHEMISTRY; METALLURGY
C12N15/1065
CHEMISTRY; METALLURGY
C12N15/1068
CHEMISTRY; METALLURGY
C12Q1/6806
CHEMISTRY; METALLURGY
C12Q1/6809
CHEMISTRY; METALLURGY
C12Q2537/159
CHEMISTRY; METALLURGY
C12Q2537/159
CHEMISTRY; METALLURGY
C40B40/06
CHEMISTRY; METALLURGY
C12Q1/6806
CHEMISTRY; METALLURGY
International classification
C12N15/10
CHEMISTRY; METALLURGY
C40B40/06
CHEMISTRY; METALLURGY
C40B50/06
CHEMISTRY; METALLURGY
C12Q1/6809
CHEMISTRY; METALLURGY
Abstract
The present invention provides a method for constructing a next-generation sequencing library for detecting low-frequency mutations, and a kit thereof. The constructing method comprises steps of obtaining blunt-end DNA fragments, obtaining DNA fragments with A-tail at the 3′ end, obtaining adapter-added DNA fragments using a specific nucleotide sequence and obtaining amplification products using a specific nucleotide sequence.
Claims
1. A method for constructing a DNA library for detecting DNA low-frequency mutations, comprising: step A: end-repairing DNA fragments to be sequenced in a sample containing low-frequency mutant DNA to obtain blunt-end DNA fragments; step B: A-tailing of a 3′ end to the blunt-end DNA fragments to obtain DNA fragments with A-tail at the 3′ end; step C: annealing single-stranded DNA having a nucleotide sequence of SEQ ID NO: 1 to single stranded DNA of SEQ ID NO: 2 thereby creating at least two adapters, adding the adapters to the DNA fragments with A-tail to the 3′ end to obtain a first adapter-added DNA fragment and a second adapter-added DNA fragment; and step D: binding a single-stranded DNA target primer having a nucleotide sequence of SEQ ID NO: 3 to one of the two adapter-added DNA fragments thereby creating a primer-adapter-added DNA fragment, subjecting the primer-adapter-added DNA fragment to PCR amplification to obtain amplification products; wherein the PCR amplification is conducted only once in step D in this method.
2. The method according to claim 1, wherein a single-stranded DNA having a nucleotide sequence as shown in SEQ ID NO: 4 and a single-stranded DNA having a nucleotide sequence as shown in SEQ ID NO: 5 are further used as PCR amplification primers in said step D.
3. The method according to claim 1, wherein the amount of the DNA fragments in step A is 5 to 50 ng.
Description
DETAILED DESCRIPTION OF THE INVENTION
(1) In one aspect, the present invention provides a method for constructing a next-generation sequencing DNA library for detecting DNA low-frequency mutations (the method for constructing a library of the present invention), comprising:
(2) step A: end-repairing DNA fragments to be sequenced in a sample containing low-frequency mutant DNA to obtain blunt-end DNA fragments;
(3) step B: A-tailing of a 3′ end to the blunt-end DNA fragments to obtain DNA fragments with an A-tail at the 3′ end;
(4) step C: adding adapters to the DNA fragments with A-tail to the 3′ end to obtain adapter-added DNA fragments; and
(5) step D: subjecting the adapter-added DNA fragments to PCR amplification to obtain an amplification products,
(6) wherein in step C, an annealing product of a single-stranded DNA having a nucleotide sequence such as shown in SEQ ID NO: 1 and a single-stranded DNA having a nucleotide sequence such as shown in SEQ ID NO: 2 is used as the adapter;
(7) in step D, a single-stranded DNA having a nucleotide sequence such as shown in SEQ ID NO: 3 is used as a PCR amplification primer; and
(8) the PCR amplification is conducted only once in step D in the method for constructing a library of the present invention.
(9) In step D, a single-stranded DNA having a nucleotide sequence such as shown in SEQ ID NO: 4 and a single-stranded DNA having a nucleotide sequence such as shown in SEQ ID NO: 5 are further used as PCR amplification primers.
(10) SEQ ID NO: 1 5′-TACACTCTTTCCCTACACGACGCTCTTCCGATCT(N)nACGCAGAGTGACT-3′ (wherein n is a positive integer from 6 to 12, and n of Ns are independently selected from A, T, C, and G)
(11) SEQ ID NO: 2 5′-GTCACTCTGCGT-3′
(12) SEQ ID NO: 3 5′-GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT (N) n (X) m-3′ (wherein n is a positive integer from 6 to 12, and n of Ns are independently selected from A, T, C and G; m is a positive integer from 20 to 40, and m of Xs are designed to be complementary to a positive-sense strand sequence near the site to be tested (1 to 50 bp from the site, for example, 2 to 20 bp).
SEQ ID NO: 4: 5′-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT-3′
SEQ ID NO: 5: 5′-CAAGCAGAAGACGGCATACGAGAT(N).sub.8GTGACTGGAGTTCAGACGTGTGCTCTTCCGA TCT-3′ (wherein (N).sub.8 is a tag sequence used to distinguish sequencing data from different samples. 8 Ns are independently selected from A, T, C and G). As the aforementioned tag sequence, for example, a tag sequence recommended by Illumina, Inc. may be used; however, it may also be designed. A person skilled in the art knows that the following principles may be considered in the design of the tag: (1) considering the problem of recognizability and recognition rate between the tag sequences, in designing the tag, the base differences must be equal to or greater than 3 bases in a 8 bp tag; (2) considering the error rate in sequence synthesis or sequencing, in designing the tag, 3 or more consecutive identical bases should be avoided in 8 bases of the tag; (3) considering that the content bias of the four bases ATGC at the same position will affect the sequencing quality in sequencing, in designing the tag, it should be ensured that the GT and AC bases are balanced at each site after the tags is mixed.
(13) In the present description, the low-frequency mutation refers to mutations in which the proportion of mutant DNA in the DNA sample is less than 1%. Examples of the low-frequency mutant DNA include free fetal DNA in maternal plasma, free DNA of tumor characteristics in plasma of cancer patients (tumor gene mutations can be detected), virus DNA in plasma of patients with AIDS, hepatitis, etc., and fragmentation and a low proportion of subclonal mutations which even exist in cancer tissue samples (for example, FFPE).
(14) In the method for constructing a library of the present invention, the amount of the DNA fragments in step A is not particularly limited. However, it should be noted that the method for constructing a library of the present invention can be applied to constructing a library with a small or trace amount of samples. Therefore, the amount of the DNA fragments in step A can be 1 to 200 ng, for example, 5 to 50 ng.
(15) Preferably, in the method for constructing a library of the present invention, the PCR amplification is conducted only once in step D (for example, 10 to 30 temperature cycles may be conducted), and the method does not include any more steps of subjecting the adapter-added DNA fragments to PCR amplification. This can reduce the mismatch introduced by PCR amplification and can effectively decrease the occurrence of false positives.
(16) Preferably, a step of purifying the products is included between step A and step B, step C and Step D, and/or after step D. The purification step can be performed by a conventional method in this technical field, for example, by magnetic beads purification. For FFPE samples, for example, they can be fragmented prior to step A.
(17) In another aspect, the present invention provides a method for detecting DNA low-frequency mutations (the detection method of the present invention), comprising constructing a next-generation sequencing DNA library using the method for constructing a library of the present invention, conducting next-generation sequencing to the next-generation sequencing DNA library, and conducting bioinformatic analysis based on the sequencing result. In the bioinformatic analysis, it can be determined whether a certain mutation is an amplification/sequencing error or a real low-frequency mutation according to the sequence of the region in reads corresponding to (N)n of SEQ ID NO: 3 so as to reduce the false positives of the detection result.
(18) Preferably, the sequencing in the method for detecting DNA low-frequency mutations of the present invention may be performed by, for example, using Illumina platform (e.g., HiSeq 2500 or NextSeq 500).
(19) In another aspect, the present invention further provides a kit for constructing a next-generation sequencing DNA library, which can be used to implement the method for constructing a library of the present invention and which comprises reagents for constructing a next-generation sequencing DNA library, the reagents for constructing a next-generation sequencing DNA library including:
(20) a single-stranded DNA having a nucleotide sequence such as shown in SEQ ID NO: 1 and a single-stranded DNA having a nucleotide sequence such as shown in SEQ ID NO: 2, or an annealing product thereof; and
(21) a single-stranded DNA having a nucleotide sequence such as shown in SEQ ID NO: 3 as a reverse primer.
(22) Preferably, the reagents for constructing a next-generation sequencing DNA library further comprises one or more selected from the group consisting of T4 DNA polymerases, Klenow fragments, Klenow buffer, DNA ligase buffer, DNA ligases, Taq enzymes, dNTP, T4 polynucleotide kinases, and T4 polynucleotide kinase buffer.
(23) Preferably, the reagents for constructing a next-generation sequencing DNA library further comprises a single-stranded DNA having a nucleotide sequence such as shown in SEQ ID NO: 3.
(24) In another aspect, the present invention further provides a kit for detecting DNA low-frequency mutations, which can be used to implement the detection method of the present invention and which comprises:
(25) reagents for constructing a next-generation sequencing DNA library, and
(26) reagents for sequencing a next-generation sequencing DNA library;
(27) wherein the reagents for constructing a next-generation sequencing DNA library comprises:
(28) a single-stranded DNA having a nucleotide sequence such as shown in SEQ ID NO: 1 and a single-stranded DNA having a nucleotide sequence such as shown in SEQ ID NO: 2, or an annealing product thereof;
(29) a single-stranded DNA having a nucleotide sequence such as shown in SEQ ID NO: 3;
(30) a single-stranded DNA having a nucleotide sequence such as shown in SEQ ID NO: 4; and
(31) a single-stranded DNA having a nucleotide sequence such as shown in SEQ ID NO: 5.
(32) Preferably, the reagents for constructing a next-generation sequencing DNA library further comprises one or more selected from the group consisting of T4 DNA polymerases, Klenow fragments, Klenow buffer, DNA ligase buffer, DNA ligases, Taq enzymes, dNTP, T4 polynucleotide kinases, and T4 polynucleotide kinase buffer.
(33) Preferably, the reagents for sequencing a next-generation sequencing DNA library includes one or more selected from the group consisting of resynthesis reagents, linearized P7 adapter, linearized P5 adapter, DNA polymerases, dNTP, flushing hybridization solution/buffer, 100% formamides (mass/volume), Read 2 sequencing primers for sequencing, Index i7 sequencing primers, Read 1 sequencing primers for sequencing, Hiseq Rapid PE Flow Cell, water, and reagents for enhancing photosensitivity/photographing.
(34) Preferably, the reagents for constructing a next-generation sequencing DNA library further comprises a single-stranded DNA having a nucleotide sequence such as shown in SEQ ID NO: 4 and a single-stranded DNA having a nucleotide sequence such as shown in SEQ ID NO: 5.
EXAMPLES
(35) The present invention will be further described in detail below combined with the examples. It should be understood that the specific examples described herein are intended to explain the present invention, rather than to limit the present invention.
Example 1 Constructing a Next-Generation Sequencing DNA Library Using the Method for Constructing a Library of the Present Invention
(36) 1. Specific Primer Design
(37) The following specific primers (equivalent to the single-stranded DNA shown in SEQ ID NO: 3) were designed, wherein PAJ408 can be used to detect AKT1 NM_001014431:c.A655C:p.T219P, PAJ410 can be used to detect TP53 NM_001126115:c.A733C:p.T245P, and PAJ 412 can be used to detect PIK3CA NM_006218:c.A3140G:p.H1047R.
(38) TABLE-US-00001 TABLE 1 Specific primer sequences Specific primer Primer sequence (5′-3′) PAJ408 GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT NNNNNNNNGGCCCTGAAGTACTCTTTCCA (SEQ ID NO: 6) PAJ410 GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT NNNNNNNNCTACAGCCACCTGAAGTCCAAA (SEQ ID NO: 7) PAJ412 GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT NNNNNNNNTTGTTGTCCAGCCACCAT (SEQ ID NO: 8)
(39) 1.2 DNA Extraction
(40) Two plasma samples were selected, cell-free DNA samples (DP13AN00374, DP13AN00375) were extracted from 2 mL plasma using a magnetic bead method and 10 ng of cell-free DNA was quantified to construct a library. The above-mentioned specific primers PAJ408, PAJ410 and PAJ412 were used to detect AKT1 NM_001014431:c.A655C:p.T219P, TP53 NM_001126115:c.A733C:p.T245P and PIK3CA NM_006218:c.A3140G:p.H1047R. For the above two samples, all the operations are the same except that the indexes used in step 1.6 are different.
(41) 1.3 End Repairing
(42) Preparation of end repairing mix: The required reagents were taken out from a kit stored at −20° C. in advance and were placed on ice to thaw and were mixed thoroughly. Refer to Table 2 for the preparation amount of each reaction.
(43) TABLE-US-00002 TABLE 2 End repairing reaction system Interrupted DNA sample 41 μL 10 × polynucleotide kinase buffer 5 μL dNTP buffer (10 mM) 1 μL T4 DNA polymerase 1 μL T4 polynucleotide kinase 1 μL Klenow fragment 1 μL ATP (10 mM) 1 μL Total volume 50 μL
(44) End repairing reaction: 9 μL of mix was dispensed into a 1.5 mL centrifuge tube and the DNA sample was added to a tube. The reaction system was placed in Thermomixer for 30 minutes at 20° C. After the reaction was completed, the DNA in the reaction system was recovered and purified by using 1.8×Ampure magnetic beads and was dissolved in 32 μL EB.
(45) 1.4 A-Tailing
(46) Preparation of A-tailing mixture: The required reagents were taken out from a kit stored at −20° C. in advance and were placed on ice to thaw and were mixed thoroughly. Refer to Table 3 for the preparation amount of each reaction.
(47) TABLE-US-00003 TABLE 3 A-tailing reaction system Sample from the previous step 32 μL 10 × Blue buffer 5 μL dATP (1 mM) 10 μL Klenow fragment (lacking 3′ to 5′ exonuclease activity) 3 μL Total volume 50 μL
(48) A-tailing reaction: 18 μL of mix was dispensed into a 1.5 mL centrifuge tube and the DNA was added to a tube. The sample was placed in Thermomixer for 30 minutes at 37° C.
(49) 1.5 Adapter Ligation
(50) Preparation of adapter ligation mix: The required reagents were taken out from a kit stored at −20° C. in advance and were placed on ice to thaw and were mixed thoroughly. Refer to Table 4 for the preparation amount of each reaction.
(51) TABLE-US-00004 TABLE 4 Adapter ligation reaction system Sample from the previous step 18 μL 2 × ligase buffer 25 μL PE Index Adapter (1 pmol/μL) 2 μL T4 DNA ligase 5 μL Total volume 50 μL
(52) The PE Index Adapter is an annealing product of a single-stranded DNA as shown in SEQ ID NO: 1 and a single-stranded DNA as shown in SEQ ID NO: 2.
(53) Adapter ligation reaction: 32 μL of mix was dispensed into a 1.5 mL centrifuge tube and the DNA was added to a tube. The sample was placed in Thermomixer for 15 minutes at 20° C. The DNA in the reaction system was purified by using 1.8×Ampure magnetic beads and was dissolved in 30 μL EB.
(54) 1.6 PCR Reaction
(55) Preparation of PCR reaction system: The required reagents were taken out from a kit stored at −20° C. in advance and were placed on ice to thaw and were mixed uniformly. The PCR reaction system was prepared in a 0.2 mL PCR tube. Refer to Table 5 for the preparation amount of each reaction.
(56) TABLE-US-00005 TABLE 5 PCR reaction system Sample after adding adapter and 4 μL purification Index-41 or 42 (10 pmol/μL) 4 μL Ann common primer (10 pmol/μL) 4 μL Specific primer pool (10 pmol/μL) 4 μL 10 × buffer 2.5 μL dNTP 2.0 μL Ex taq 0.2 μL ddH.sub.2O 0.3 μL Total volume 25 μL Ann common primer: (SEQ ID NO: 9) 5′-AATGATACGGCGACCACCGAGATCTACACTC TTTCCCTACACGACGCTCTTCCGATCT-3′ Index-41 primer (for DP13AN00374): (SEQ ID NO: 10) 5′-CAAGCAGAAGACGGCATACGAGATCGTGATGTG TGACTGGAGTTCAGACGTGTGCTCTTCCGATCT-3′ Index-42 primer (for DP13AN00375): (SEQ ID NO: 11) 5′-CAAGCAGAAGACGGCATACGAGATGTCAGTCGT GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT-3′
(57) PCR reaction: The PCR program was set up and it needs to be checked before use. The program of the PCR reaction was as follows. After the reaction, the sample was taken out timely to store at 4° C. and the program was exited or the instrument was shut down.
(58) TABLE-US-00006 94° C. 2 minutes 94° C. 15 seconds 58° C. 30 seconds {close oversize brace} 25 cycles 72° C. 30 seconds 72° C. 5 minutes 4° C. ∞
(59) 1.7 Purification of the PCR Products
(60) The PCR products in the reaction system were purified by using 0.9×Ampure magnetic beads and were dissolved in 30 μL EB.
(61) 1.8 Library Quantification
(62) The library was subjected to 2100 Bioanalyzer (Agilent)/LabChip GX (Caliper) and QPCR tests, and passed the quality inspection.
(63) 1.9 the Constructed Library was Subjected to PE100 Sequencing Using Illumina HiSeg™ 2500.
(64) 1.10 the Finally Obtained Bioinformatic Data is Shown in the Following Table:
(65) TABLE-US-00007 Compar- Targeted Detection ison capture site rawdata(Mb) Q20 Q30 rate efficiency DP13A AKT1 92.5 96% 94% 98.7% 85.3%.sup. N00374 c.A655C TP53 90% c.A733C PIK3CA 88% c.A3140G DP13A AKT1 107 96% 94% 98.7% 85.7%.sup. N00375 c.A655C TP53 89% c.A733C PIK3CA 90% c.A3140G
Rawdata: The amount of total data produced by sequencing;
Q20 and Q30: In high-throughput gene sequencing, each base measured provides a corresponding quality value, which measures sequencing accuracy. Q20 and Q30 in the industry indicate the percentage of the base with a quality value ≥20 or 30. The Q20 value refers to that in the base calling process of the sequencing process, the error probability of the identified base is 1%, that is, the error rate is 1%, or the accuracy is 99%. The Q30 value refers to that in the base calling process of the sequencing process, the error probability of the identified base is 0.1%, that is, the error rate is 0.1%, or the accuracy is 99.9%.
Mapping rate: the percentage of obtained sequencing data after low quality filtration aligned to a reference genome.
Target capture efficiency: the amount of data aligned to the target region divided by the amount of data aligned to the reference genome*100%, or it can be described as the percentage of the amount of data aligned to the target region accounts for from the amount of data aligned to the reference genome.
Example 2
(66) A cell-free DNA sample (DP13AN00381) extracted from 2 mL of plasma by a magnetic bead method was selected, and 10 ng of cell-free DNA (named as DP13AN00381-1, DP13AN00381-2 and DP13AN00381-3 respectively) were quantified and taken respectively to construct the library.
(67) For DP13AN00381-3, the same operation was performed as in the above Example 1, except that the following Index-45 was used instead of Index-41 or Index-42 in step 1.6.
(68) TABLE-US-00008 Index-45: (SEQ ID NO: 12) 5′-CAAGCAGAAGACGGCATACGAGATCAGTCGTAGTGTGACTGGAGTTC AGACGTGTGCTCTTCCGATCT-3′
Comparative Example 1
(69) For DP13AN00381-1 obtained in the above Example 2, the same operation was performed as in the above Example 1, except that
(70) in step 1.6, a first round PCR was conducted using a specific primer pool consisting of PAJ 413, PAJ 414 and PAJ 415 first, and after purification by magnetic beads, a second round PCR was conducted using a specific primer pool consisting of PAJ416, PAJ417 and PAJ418.
(71) Specific Primer Sequences of the First Round PCR
(72) TABLE-US-00009 Specific Primer sequence primer (5′-3′) PAJ413 TGTGGGGCCGCAGTTCCAG (SEQ ID NO: 13) PAJ414 CATCTCTCCTCCCTGCTTCTG (SEQ ID NO: 14) PAJ415 TGCTGTTTAATTGTGTGGAAGAT (SEQ ID NO: 15)
(73) Specific Primer Sequences of the Second Round PCR
(74) TABLE-US-00010 Specific primer Primer sequence (5′-3′) PAJ416 GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTGGCCCT GAAGTACTCTTTCCA (SEQ ID NO: 16) PAJ417 GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTCTACAG CCACCTGAAGTCCAAA (SEQ ID NO: 17) PAJ418 GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTTTGTTG TCCAGCCACCAT (SEQ ID NO: 18)
Reaction System and Conditions of the First Round PCR:
(75) TABLE-US-00011 Sample after adding adapter and purification 4 μL Ann common primer (10 pmol/μL) 4 μL Specific primer pool (10 pmol/μL) 4 μL 10 × buffer 2.5 μL dNTP 2.0 μL Ex taq 0.2 μL ddH.sub.2O 6.3 μL Total volume 25 μL
(76) The program of the PCR reaction is as follows. After the reaction, the sample was taken out timely to store at 4° C. and the program was exited or the instrument was shut down.
(77) TABLE-US-00012 98° C. 30 seconds 98° C. 10 seconds 68° C. 30 seconds {close oversize brace} 20 cycles 72° C. 3 minutes 4° C. ∞
(78) The PCR product in the reaction system was recovered and purified by using 0.9×Ampure magnetic beads and was dissolved in 20 μL EB.
(79) Reaction System and Conditions of the Second Round of PCR:
(80) TABLE-US-00013 Products of the first round PCR 18 μL Index-43 (10 pmol/μL) 1 μL Ann common primer (10 pmol/μL) 1 μL Specific primer pool (10 pmol/μL) 1 μL 10 × buffer 2.5 μL dNTP 1.0 μL Ex taq 0.2 μL ddH.sub.2O 0.3 μL Total volume 25 μL Ann common primer: (SEQ ID NO: 9) 5′-AATGATACGGCGACCACCGAGATCTACACTCTTT CCCTACACGACGCTCTTCGATCT-3′ Index-43: (SEQ ID NO: 19) 5′-CAAGCAGAAGACGGCATACGAGATAGCTGCTGGT GACTGGAGTTCAGACGTGTGCTCTTCCGATCT-3′
(81) The program of the second round PCR reaction is as follows:
(82) TABLE-US-00014 98° C. 30 seconds 98° C. 10 seconds 68° C. 30 seconds {close oversize brace} 24 cycles 72° C. 3 minutes 4° C. ∞
Comparative Example 2
(83) For DP13AN00381-3 obtained in the above Example 2, the same operation was performed as in the above Comparative Example 1, except that a specific primer pool consisting of PAJ408, PAJ410 and PAJ412 was used instead of the specific primer pool consisting of PAJ416, PAJ417 and PAJ418, and the following Index-44 was used instead of Index-43 for the second round PCR.
(84) TABLE-US-00015 Index-44: (SEQ ID NO: 20) 5′-CAAGCAGAAGACGGCATACGAGATCTGTCAGCGTGACTGGAGTTCAG ACGTGTGCTCTTCCGATCT-3′
(85) For Example 2 and Comparative Examples 1 and 2, the finally obtained bioinformatic data is shown in the following table. It can be seen that the method of the present invention can effectively remove false positives, enhance enrichment efficiency of target DNA fragments and reduce waste of sequencing data.
(86) TABLE-US-00016 Targeted Sample Detection Comparison capture name site Rawdata(Mb) Q20 Q30 rate efficiency Sensitivity DP13A AKT1 103 96% 94% 99% 75.3%.sup. .sup. 1% N00381-1 c.A655C TP53 78% .sup. 1% c.A733C PIK3CA 78.2%.sup. .sup. 1% c.A3140G DP13A AKT1 97 96% 94% 99% 75.7%.sup. 0.7% N00381-2 c.A655C TP53 77% 0.7% c.A733C PIK3CA 79% 0.7% c.A3140G DP13A AKT1 105 96% 94% 99% 87% 0.5% N00381-3 c.A655C TP53 90.3%.sup. 0.5% c.A733C PIK3CA 91% 0.5% c.A3140G
(87) It should also be noted that any one of the technical features or combinations thereof described as constituents of a technical solution in the present specification may also be applied to other technical solutions; moreover, the technical features described as constituents of different technical solutions may also be combined in any manner to form other technical solutions on the premise that they can be practiced and do not contradict the gist of the present invention. The present invention also includes technical solutions obtained by combinations in the aforementioned cases, and these technical solutions are regarded as being described in the present specification.
(88) The above description shows and describes preferred examples of the present invention. As mentioned above, it should be understood that the present invention is not limited to the forms disclosed herein, and should not be construed as an exclusion of other examples, but may be applied to various other combinations, modifications and environments, and may be altered within the scope of the inventive concepts described herein by the above teachings or techniques or knowledge in related fields. Alterations and variations made by the skilled person in the art without departing from the spirit and the scope of the present invention are intended to be included within the scope of the appended claims of the present invention.
INDUSTRIAL APPLICABILITY
(89) According to the present invention, a method for detecting DNA low-frequency mutations which can effectively remove false positives, enhance enrichment efficiency of target DNA fragments and reduce waste of sequencing data, a method for constructing a next-generation sequencing DNA library for detecting DNA low-frequency mutations and a kit thereof are provided.