PGC-1beta-protein-function regulator, mitochondria-function regulator, anti-obesity agent, and screening method therefor
09766241 · 2017-09-19
Assignee
Inventors
- Toshihiro Nakajima (Yokohama, JP)
- Hidetoshi Fujita (Chofu, JP)
- Satoko Aratani (Tokyo, JP)
- Naoko Yagishita (Yokohama, JP)
Cpc classification
G01N2500/04
PHYSICS
G01N2333/70567
PHYSICS
G01N2440/36
PHYSICS
C12Q1/6883
CHEMISTRY; METALLURGY
International classification
G01N33/53
PHYSICS
G01N33/50
PHYSICS
Abstract
[Problem] To provide a mitochondria-function regulator effective for treatment or prevention of obesity, and a screening method therefore. [Solution] The mitochondria-function regulator of the present invention contains, as an active ingredient, a PGC-1β-protein function regulator synoviolin. The screening method of the present invention includes a step for causing a test substance to act on an adipose tissue cell or an individual animal, and measuring or detecting one or more of the following in the adipose tissue cell: (1) expression level of synoviolin; (2) a bond between synoviolin and PGC-1β protein; and (3) the ubiquitination of the PGC-1β protein by synoviolin.
Claims
1. A screening method for PGC-1β protein-function regulator, comprising: a step of causing a test substance to contact adipose tissue cells; a step of measuring or detecting a bond between synoviolin and PGC-1β protein in the adipose tissue cells after the test substance contacts the adipose tissue cells to decide whether the test substance inhibits a binding between synoviolin and PGC-1β; and a step of selecting the test substance as a candidate of PGC-1β protein-function regulator when the test substance is decided to inhibit the binding between synoviolin and PGC-1β, wherein the PGC-1β protein-function regulator inhibits binding between synoviolin and PGC-1β.
2. The method according to claim 1, further comprising a step of detecting the candidate of PGC-1B protein-function regulator as the therapeutic agent or the prevention agent for obesity.
Description
BRIEF DESCRIPTION OF DRAWINGS
(1)
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
(12)
(13)
(14)
(15)
(16)
(17)
(18)
(19)
(20)
(21)
(22)
(23)
(24)
(25)
(26)
(27)
(28)
(29)
(30)
(31)
(32)
(33)
(34)
DESCRIPTION OF EMBODIMENTS
(35) The first aspect of the present invention relates to a PGC-1β-protein-function regulator (agent of the present invention). PGC-1β means PPAR coactivator 1β. The PGC-1β-protein-function regulator is, for example, an agent for regulating various functions of the above described PGC-1β protein. The PGC-1β protein has various functions. Thus regulating the functions of the PGC-1β protein is beneficial to analysis of various biological functions to which the PGC-1β protein is involved.
(36) The PGC-1β-protein-function regulator contains, as an active ingredient, a synoviolin expression inhibitor or a synoviolin activity inhibitor. The synoviolin expression inhibitor and the synoviolin activity inhibitor are publicly known. The synoviolin expression inhibitor or the synoviolin activity inhibitor may be obtained by obtaining candidate compounds by using the screening method described later and by measuring whether the candidate compounds have activity to inhibit expression of synoviolin or capacity to inhibit activity of synoviolin. The PGC-1β-protein-function regulator of the present invention facilitates β-oxidation of fatty acid and expression or activation of mitochondria by regulating PGC-1β protein so that activation of the PGC-1β protein is increased. Accordingly, the PGC-1β-protein-function regulator of the present invention is effective for, for example, prevention or treatment of condition such as obesity to which the PGC-1β protein is involved.
(37) The accession number of human synoviolin gene in the public gene database Genbank is AB024690 (SEQ ID NO: 1).
(38) The nucleotide sequence of the gene encoding human synoviolin is shown in SEQ ID NO: 1. Moreover, proteins other than the protein encoded by this nucleotide sequence, that are highly homologous to the sequence (normally, 70% or more; preferably 80% or more; more preferably 90% or more; and most preferably 95% or more) and have functions of the synoviolin protein, are included in the synoviolin of the present invention.
(39) The term “synoviolin gene” as used herein includes, for example, endogenous genes of other organisms that correspond to a DNA comprising the nucleotide sequence of SEQ ID NO: 1 (such as that of homologs of the human synoviolin gene).
(40) Moreover, the endogenous DNA of other organisms that corresponds to DNA comprising the nucleotide sequence of SEQ ID NO: 1 is generally highly homologous to the DNA of SEQ ID NO: 1. The term “highly homologous” means a homology of 50% or more, preferably 70% or more, more preferably 80% or more, and yet more preferably 90% or more (for example, 95% or more, and further, 96%, 97%, 98%, or 99% or more). This homology can be determined using the mBLAST algorithm (Altschul et al., 1990, Proc. Natl. Acad. Sci. USA 87: 2264-8; Karlin and Altschul, 1993, Proc. Natl. Acad. Sci. USA 90: 5873-7). Moreover, if the DNA is isolated from an organism, it is considered to hybridize with the DNA of SEQ ID NO: 1 under stringent conditions. Here, examples of the “stringent conditions” include “2×SSC, 0.1% SDS, 50° C.”, “2×SSC, 0.1% SDS, 42° C.”, and “1×SSC, 0.1% SDS, 37° C.”. Examples of more stringent conditions include “2×SSC, 0.1% SDS, 65° C.”, “0.5×SSC, 0.1% SDS, 42° C.”, and “0.2×SSC, 0.1% SDS, 65° C.”. Those skilled in the art are capable of appropriately obtaining endogenous genes of other organisms that correspond to the synoviolin gene, based on the nucleotide sequence of the synoviolin gene. In the present specification, proteins (genes) corresponding to synoviolin proteins (genes) in organisms other than humans, or proteins (genes) functionally equivalent to the synoviolin described above, may be simply referred to as “synoviolin protein (gene)”.
(41) The “synoviolin” of the present invention can be prepared as a natural protein or as a recombinant protein using gene recombination techniques. Natural proteins can be prepared, for example, by a method using affinity chromatography, which employs antibodies against synoviolin protein, from cell (tissue) extracts considered to express the synoviolin protein. In addition, recombinant proteins can be prepared by culturing cells transfected by DNA encoding the synoviolin protein. The “synoviolin protein” of the present invention is suitably used in, for example, the screening methods described below.
(42) In the present invention, the term “expression” includes “transcription” from genes, “translation” into polypeptides, and the “inhibition of degradation” of proteins. The “expression of synoviolin protein” means the occurrence of the transcription and translation of a gene encoding the synoviolin protein, or the production of the synoviolin protein by such transcription and translation.
(43) The various functions mentioned above can be appropriately evaluated (measured), using general techniques, by those skilled in the art. Specifically, the methods described in the Examples below, or such methods suitably modified, can be performed.
(44) Accordingly, the term “synoviolin expression inhibitor or synoviolin activity inhibitor” refers to lowering or eliminating the quantity, function, or activity of a synoviolin gene or protein as compared with the quantity, function, or activity of the wild-type synoviolin gene or protein. The term “inhibition” includes the inhibition of either or both of function and expression.
(45) Specifically, ubiquitination means a process for the formation of a polyubiquitin chain via repeated cascade of reactions with enzymes such as ubiquitin-activating enzyme (E1), ubiquitin-conjugating enzyme (E2), and ubiquitin ligase (E3), by which ubiquitin molecules are conjugated in a branched form to a substrate protein. The polyubiquitin chain is formed via an ε-amino group at Lys48 in ubiquitin molecules, and then becomes a degradation signal for the 26S proteasome, leading to the degradation of target proteins.
(46) To confirm influences on synoviolin gene expression or synoviolin protein activity by test substances, such a method as disclosed in WO 2006-137514 can be used.
(47) Influence of synoviolin protein on self-ubiquitination
(48) For example, JP 2008-74753 A (Japanese Patent No. 5008932) discloses that plumbagin (2-methyl-5-hydroxy-1,4-naphthoquinone) and quercetin (2-(3,4-dihydroxyphenyl)-3,5,7-trihydroxy-4H-1-benzopyrano-4-on) inhibit self-ubiquitination of synoviolin protein. The self-ubiquitination of synoviolin means ubiquitination of protein caused by synoviolin-synoviolin interactions as disclosed in JP 2008-74753 A. The self-ubiquitination of protein occurs when synoviolin binds to protein.
(49) Influence of synoviolin protein on self-ubiquitination may be confirmed by using a method disclosed in JP 2008-74753 A (Japanese Patent No. 5008932). For example, test substances may be added to in vitro self-ubiquitination reaction solution containing MBP-Syno ΔTM-His, and incubate at 37° C. for 30 minutes. After the incubation, Western blot analysis using anti-HA antibody may be performed to detect ubiquitinated protein. MBP-Syno ΔTM-His means synoviolin in which transmembrane domain has been deleted and which has maltose-binding protein fused to N terminus side thereof and His tag fused to C terminus side thereof.
(50) Synoviolin Expression Inhibitor or Synoviolin Activity Inhibitor
(51) Examples of synoviolin expression inhibitor or synoviolin activity inhibitor are plumbagin (2-methyl-5-hydroxy-1,4-naphthoquinone) and quercetin (2-(3,4-dihydroxyphenyl)-3,5,7-trihydroxy-4H-1-benzopyrano-4-on) which are disclosed in Japanese Patent No. 5008932, and its pharmacologically acceptable salt or their hydrate.
(52) An example of synoviolin expression inhibitor or synoviolin activity inhibitor is a ubiquitination activity inhibitor of synoviolin protein containing naphthalene derivative of formula (I), pharmaceutically acceptable salts thereof, or pharmaceutically acceptable solvates thereof. Compounds expressed by the formula (I) can be compounded by known methods.
(53) The ubiquitination activity inhibitor of synoviolin protein means an agent to inhibit self-ubiquitination activity of synoviolin. As disclosed later in example, whether the ubiquitination activity is inhibited can be evaluated by, for example, measuring an amount of protein ubiquitinated in vitro. As described later, the ubiquitination activity inhibitor of synoviolin protein is effective as, for example, an obesity therapeutic or prevention agent as well as a rheumatism therapeutic or prevention agent.
(54) The pharmaceutically acceptable salts thereof mean pharmaceutically acceptable salts of naphthalene derivative of formula (I). The pharmaceutically acceptable solvates thereof mean pharmaceutically acceptable solvates of naphthalene derivative of formula (I). Examples of the pharmaceutically acceptable salts include inorganic acid salts, organic acid salts, inorganic basic salts, organic basic salts, and acidic or basic amino acid salts. Examples of the inorganic acid salts include hydrochlorides, hydrobromides, sulfates, nitrates, and phosphates. Examples of the organic acid salts include acetates, succinates, fumarates, maleates, tartrates, citrates, lactates, stearates, benzoates, methanesulfonates, and p-toluenesulfonates. Examples of the inorganic basic salts include alkali metal salts such as sodium salts and potassium salts, alkaline earth metal salts such as calcium salts and magnesium salts, aluminum salts, and ammonium salts. Examples of the organic basic salts include diethylamine salts, diethanolamine salts, meglumine salts, and N,N′-dibenzylethylenediamine salts. Examples of the acidic amino acid salts include aspartates and glutamates. Examples of the basic amino acid salts include arginine salts, lysine salts, and ornithine salts. Examples of solvates include hydrates.
(55) The compounds of the present invention can be isolated/purified by using known methods while applying conventional chemical procedures such as extraction, concentration, evaporation, crystallization, filtration, recrystallization, and various forms of chromatography.
(56) ##STR00001##
(57) In the formula (I),
(58) R.sup.1 to R.sup.4 may be the same or different, and each represents one of a hydrogen atom, a hydroxyl group, a C.sub.1-3 alkyl group, a C.sub.1-3 alkoxy group, and a halogen atom. As demonstrated by the examples described below, at least one of R.sup.1 to R.sup.4 is the hydroxyl group.
(59) R.sup.5 and R.sup.6 may be the same or different, and each represents one of a hydrogen atom, a C.sub.1-3 alkyl group, and a halogen atom.
(60) X.sup.1 and X.sup.2 may be the same or different, and each represents an oxygen atom or a sulfur atom.
(61) A.sup.1-A.sup.2 represents a C—C (single bond) or a C═C (double bond). In a case that the A.sup.1-A.sup.2 is the C═C (double bond), the formula (I) is represented by the formula (II).
(62) The C.sub.1-3 alkyl group means an alkyl group having 1 to 3 carbon atoms. Examples of the C.sub.1-3 alkyl group area methyl group, an ethyl group, a n-propyl group, and an isopropyl group. A preferred example of the C.sub.1-3 alkyl group is a methyl group.
(63) The C.sub.1-3 alkoxy group means alkoxy group having 1 to 3 carbon atoms. Examples of the C.sub.1-3 alkoxy group are a methoxy group, an ethoxy group, a n-propoxy group, and an isopropoxy group. A preferred example of the C.sub.1-3 alkoxy group is a methoxy group.
(64) Examples of the halogen atom are a fluorine atom, a chlorine atom, a bromine atom, and an iodine atom. A preferred example of the halogen atom is a chlorine atom.
(65) A preferred embodiment of the present invention relates to a ubiquitination activity inhibitor of synoviolin protein in which at least one of R.sup.1 and R.sup.4 is the hydroxyl group.
(66) A preferred embodiment of the present invention is ubiquitination activity inhibitor of synoviolin protein, wherein A.sup.1-A.sup.2 represents C═C in the general formula (I). The naphthalene derivative is a naphthalene derivative represented by the following formula (II).
(67) ##STR00002##
(68) A preferred embodiment of the present invention is a ubiquitination activity inhibitor of synoviolin protein, wherein each X.sup.1 and X.sup.2 represents an oxygen atom and A.sup.1-A.sup.2 represents C═C in the formula (I). The naphthalene derivative is a naphthoquinone derivative represented by the following formula (III).
(69) ##STR00003##
(70) A preferred embodiment of the present invention is a ubiquitination activity inhibitor of synoviolin protein, wherein in the formula (I),
(71) R.sup.1 to R.sup.4 may be the same or different, and each represents one of a hydrogen atom, a hydroxyl group, a methyl group, a methoxy group, and a chlorine atom, where at least one of R.sup.1 to R.sup.4 is a hydroxyl group,
(72) R.sup.5 and R.sup.6 may be the same or different, and each represents a hydrogen atom or a methyl group,
(73) each of X.sup.1 and X.sup.2 represents an oxygen atom, and
(74) A.sup.1-A.sup.2 represents C═C.
(75) A preferred embodiment of the present invention is a ubiquitination activity inhibitor of synoviolin protein, wherein in the formula (I),
(76) R.sup.1 to R.sup.4 may be the same or different, and each represents one of a hydrogen atom, a hydroxyl group, a methyl group, a methoxy group, and a chlorine atom, where at least one of R.sup.1 to R.sup.4 is the hydroxyl group,
(77) R.sup.2 and R.sup.3 represent the hydrogen atoms,
(78) each of R.sup.5 and R.sup.6 represents a hydrogen atom,
(79) each of X.sup.1 and X.sup.2 represents an oxygen atom, and
(80) A.sup.1-A.sup.2 represents C═C.
(81) A preferred embodiment of the present invention is a ubiquitination activity inhibitor of synoviolin protein, wherein the naphthalene derivative represented by the formula (I) is one of or two or more of 5,8-dihydroxy-4a,8a-dihydro-[1,4]naphthoquinone, 5-hydroxy-4a,8a-dihydro-[1,4]naphthoquinone, 5-hydroxy-2,3,4a,8a-tetrahydro-[1,4]naphthoquinone, 5-hydroxy-7-methoxy-4a,8a-dihydro-[1,4]naphathoquinone, 5-hydroxy-8-methoxy-4a,8a-dihydro-[1,4]naphthoquinone, and 5-chloro-8-hydroxy-4a,8 dihydro-[1,4]naphthoquinone.
(82) An embodiment of the synoviolin expression inhibitor or the synoviolin activity inhibitor contains siRNA of synoviolin as an active ingredient. Nucleic acids having an inhibitory action by means of the RNAi effect are generally referred to as siRNA or shRNA. RNAi is a phenomenon in which, when a short double-stranded RNA (herein abbreviated as “dsRNA”) that is composed of a sense RNA comprising a sequence homologous to mRNA of the target gene, and an antisense RNA comprising the complementary sequence thereto, is introduced into a cell, the dsRNA specifically and selectively binds to target gene mRNA and induces its disruption, and efficiently inhibits (suppresses) target gene expression by cleaving the target gene. For example, when dsRNA is introduced into a cell, the expression of a gene having a sequence homologous to the RNA is suppressed (knocked down). As RNAi is capable of suppressing target gene expression as described above, the technique is attracting attention as a simple gene knockout method replacing conventional gene disruption methods based on homologous recombination, which is complicated and inefficient, and as a method applicable to gene therapy. RNA used for RNAi is not necessarily completely identical to the synoviolin gene or to a partial region of the gene, although it is preferably completely homologous.
(83) siRNA can be designed as follows:
(84) (a) There is no specific limitation to a target region, and any region in the gene encoding synoviolin can be used as a target candidate. For example, in the case of humans, any region described in GenBank accession No. AB024690 (SEQ ID NO: 1) can be used as a candidate.
(b) Among selected regions, sequences which start with AA and have 19 to 25 bases long, preferably 19 to 21 bases long, are selected. For example, sequences having a CG content of 40 to 60% may be selected.
(a) contacting a test compound with a cell expressing the synoviolin gene;
(b) measuring synoviolin gene expression in the cell; and
(c) selecting a compound lowering the expression level as compared to that measured in the absence of the test compound.
(85) An example of synoviolin siRNA is RNA having sequence selected from the following SEQ ID Nos. 2 to 6, complemental sequences thereof, or sequence obtained by replacing, inserting, deleting, or adding one base or two bases with respect to one of these sequences. The RNA having sequences represented by the SEQ ID Nos. 2 to 4 are known as synoviolin siRNA as disclosed in Izumi T, et al., Arthritis Rheum. 2009; 60(1); 63-72., EMBO, Yamasaki S, et al., EMBO J. 2007; 26(1): 113-22. by using experiments. The RNA having sequences represented by the SEQ ID Nos. 5 and 6 are known as synoviolin siRNA as disclosed in WO 2005/074988 by using experiments.
(86) TABLE-US-00001 SEQ ID No. 2: 5′-GCUGUGACAGAUGCCAUCA-3′ SEQ ID No. 3: 5′-GGUGUUCUUUGGGCAACUG-3′ SEQ ID No. 4: 5′-GGUUCUGCUGUACAUGGCC-3′ SEQ ID No. 5: 5′-CGUUCCUGGUACGCCGUCA-3′ SEQ ID No. 6: 5′-GUUUTGGUGACUGGUGCUA-3′
(87) The “RNA having a sequence obtained by replacing, inserting, deleting, or adding one base or two bases with respect to one of these sequences” is RNA having a sequence obtained by replacing, inserting, deleting, or adding one base or two bases with respect to the sequence selected from the SEQ ID Nos. 2 to 6 or the complemental sequences thereof. One of replacement, insertion, deletion, and addition may be occurred, and two or more may be occurred.
(88) For example, WO 2005-018675 and WO 2005-074988 disclose siRNA to a gene encoding synoviolin, screening method thereof, and evaluation method thereof. In the present invention, siRNA to a gene encoding synoviolin can be evaluated by appropriately using the methods disclosed in these publications.
(89) An embodiment of the synoviolin expression inhibitor or the synoviolin activity inhibitor contains, as an active ingredient, a synoviolin decoy nucleic acid having asequence represented by SEQ ID No. 7 or a sequence obtained by replacing, inserting, deleting, or adding one base or two bases with respect to the sequence represented by SEQ ID No. 7. The nucleic acid having the sequence represented by the SEQ ID No. 7 is known as synoviolin decoy nucleic acid as disclosed in Tsuchimochi K, et al., Mol Cell Biol. 2005; 25(16): 7344-56 by examples (SEQ ID No. 7: 5′-AUGGUGACUGGUGCUAAGA-3′).
(90) The synoviolin decoy nucleic acid and a confirmation method thereof are known as disclosed in, for example, WO 2005-093067 and WO 2005-074988.
(91) Another embodiment of the synoviolin expression inhibitor or the synoviolin activity inhibitor contains, as an active ingredient, a synoviolin antisense nucleic acid. The synoviolin antisense nucleic acid and a screening method thereof are disclosed in, for example, JP 2009-155204 A, JP 2006-137514 A1, and JP 2005-074988 A1. The synoviolin antisense nucleic acid means a nucleic acid which has complemental sequence of synoviolin gene and hybridizes with the gene to inhibit synoviolin gene expression. The antisense nucleic acid can be prepared by synthesizing nucleic acid compounds complementary to partial sequence of a gene encoding synoviolin using synthetic chemical technique. In order to confirm whether the nucleic acid compounds efficiently inhibit synoviolin production, screening test may be performed using the expression level of the gene as an index. An example of the antisense nucleic acid compound is the one that can suppress synoviolin expression at least to 50% or less as compared with control.
(92) To inhibit the expression of a specific endogenous gene, methods using antisense technology are well known to those skilled in the art. There are multiple factors by which an antisense nucleic acid inhibits target gene expression. These include inhibition of transcription initiation by triple strand formation, transcription inhibition by hybrid formation at a local open loop structure formed by RNA polymerase, transcription inhibition by hybrid formation with RNA being synthesized, splicing inhibition by hybrid formation at the junction between an intron and an exon, splicing inhibition by hybrid formation at a spliceosome formation site, inhibition of mRNA translocation from the nucleus to the cytoplasm by hybrid formation with mRNA, splicing inhibition by hybrid formation at a capping site or poly-A addition site, inhibition of translation initiation by hybrid formation at a translation initiation factor-binding site, translation inhibition by hybrid formation at a ribosome binding site near the initiation codon, inhibition of peptide chain elongation by hybrid formation in the translated region or polysome binding site of mRNA, inhibition of gene expression by hybrid formation at a nucleic acid-protein interaction site, etc. As described above, antisense nucleic acids inhibit target gene expression by interfering with various processes such as transcription, splicing, or translation (Hirashima and Inoue, “Shin Seikagaku Jikken Koza” [New Biochemistry Experimentation Lectures] 2; Kakusan (Nucleic Acids) IV; Idenshi No Fukusei To Hatsugen [Replication and Expression of Genes]” Edited by The Japanese Biochemical Society, Tokyo Kagaku Dozin, 319-347, 1993).
(93) The antisense nucleic acids used in the present invention may inhibit synoviolin gene expression and/or function by any of the above mechanisms. In one embodiment, an antisense sequence designed to be complementary to the untranslated region near the 5′-terminal of mRNA of the synoviolin gene is considered to be effective in inhibiting the translation of the gene. Moreover, sequences complementary to the coding region or to the untranslated region on the 3′ side can also be used. Thus, nucleic acids comprising not only antisense sequences of translated regions of the synoviolin gene, but also those of untranslated regions, are included in the antisense nucleic acids used in the present invention. The antisense nucleic acid to be used is linked to the downstream region of an appropriate promoter, and preferably, a sequence containing a transcription termination signal is connected to the 3′ side. A desired animal (cell) can be transformed with the nucleic acid thus prepared using known methods. The sequence of the antisense nucleic acid is preferably complementary to the endogenous-synoviolin gene of the animal (cell) to be transformed or a portion thereof, but the sequence may not be completely complementary as long as the sequence can effectively inhibit gene expression. The transcribed RNA preferably has a complementarity of 90% or more, and most preferably 95% or more, to the transcript of the target gene. In order to effectively inhibit the expression of the target gene (synoviolin) using an antisense nucleic acid, the antisense nucleic acid is preferably at least 15 bases long but less than 25 bases long. However, antisense nucleic acids of the present invention are not necessarily limited to this length, and may be 100 bases long or longer, or 500 bases long or longer.
(94) Moreover, ribozymes or DNAs encoding ribozymes can also be used to inhibit synoviolin gene expression. “Ribozyme” refers to RNA molecule that has a catalytic activity. Ribozymes having various kinds of activity are known. Studies focusing on ribozymes as RNA cleaving enzymes have made it possible to design ribozymes that site-specifically cleave RNA. Some ribozymes such as group I intron ribozymes or the M1 RNA contained in RNase P consist of 400 nucleotides or more, whereas others, called the hammerhead or hairpin ribozymes, have an activation domain of about 40 nucleotides (M. Koizumi and E. Ohtsuka, Tanpakushitsu Kakusan Kohso [Protein, Nucleic Acid, and Enzyme], 35: 2191, 1990).
(95) For example, the self-cleavage domain of hammerhead ribozymes cleaves the 3′ side of C15 in the G13U14C15 sequence. The base pair formation between U14 and A9 is considered important for the above cleavage activity, and it has been shown that the cleavage may also occur when C15 is replaced with A15 or U15 (M. Koizumi et al., FEBS Lett. 228: 228, 1988). When ribozymes are designed to have substrate-binding sites that are complementary to RNA sequences near target sites, they can be restriction enzyme-like RNA-cleaving ribozymes that recognize the sequence of UC, UU, or UA in target RNA (Koizumi, M. et al., FEBS Lett. 239: 285, 1988; M. Koizumi and E. Ohtsuka, Tanpakushitsu Kakusan Kohso [Protein, Nucleic acid, and Enzyme], 35: 2191, 1990; Koizumi, M. et al., Nucl. Acids Res. 17: 7059, 1989).
(96) Hairpin type ribozymes are also useful for the purpose of the present invention. Such ribozyme can be found, for example, in the minus strand of the satellite RNA of tobacco ringspot virus (Buzayan, J. M., Nature, 323: 349, 1986). It has been disclosed that target-specific RNA-cleaving ribozymes can also be designed from hairpin type ribozymes (Kikuchi, Y. and Sasaki, N., Nucleic Acids Res. 19: 6751, 1991; Yo Kikuchi, Kagaku To Seibutsu [Chemistry and Biology] 30: 112, 1992). Thus, the expression of the synoviolin gene of the present invention can be inhibited by specifically cleaving the transcript of the gene.
(97) The expression of endogenous genes can also be suppressed by RNA interference (hereinafter abbreviated as “RNAi”) using a double-stranded RNA having the same or similar sequence to the target gene sequence.
(98) The therapeutic agent of the present invention can be administered orally or parenterally. Examples of parenteral administration type therapeutic agent of the present invention include transpulmonary administration agent type (e.g. using nebulizer etc.), transnasal administration agent type, transdermal administration agent type (e.g. ointment, creams), injection type, and the like. The injection type therapeutic agent can be administered to the whole body or locally by intravenous injection such as dripping, intramuscular injection, intraperitoneal injection, hypodermic injection, or the like.
(99) Administration method is appropriately selected depending on age and symptom of a patient. Effective administration amount is 0.1 μg to 100 mg, preferably 1 μg to 10 μg per 1 kg body weight for one administration. However, administration amount of the above therapeutic agent is not restricted to these administration amounts. In a case that nucleic acid such as siRNA is mixed, an amount of the nucleic acid is, for example, 0.01 to 10 μg/ml, preferably 0.1 to 1 μg/ml.
(100) The therapeutic agent of the present invention can be formulated in the usual manner and may contain pharmaceutically acceptable carriers or additives. Such carriers or additives include water, pharmaceutically acceptable organic solvents, collagen, polyvinyl alcohol, polyvinylpyrrolidone, carboxyvinyl polymer, carboxymethylcellulose sodium, sodium polyacrylate, sodium alginate, water-soluble dextran, carboxymethyl starch sodium, pectin, methylcellulose, ethylcellulose, xanthan gum, gum arabic, casein, agar, polyethylene glycol, diglycerine, glycerol, propylene glycol, vaseline, paraffin, stearyl alcohol, stearic acid, human serum albumin, mannitol, sorbitol, lactose, surfactant acceptable as pharmaceutical additive, and the like.
(101) The above additive may be selected alone or appropriately in combination from the above additives depending on the pharmaceutical form of the therapeutic agent of the present invention. For example, in a case of being used as an injectable preparation, refined ER stress inducer may be dissolved into a solvent (e.g. saline, buffer solution, glucose solution, or the like), and Tween80, Tween20, gelatin, human serum albumin, or the like may be added to the solution. Alternatively, the therapeutic agent of the present invention may be lyophilized to have a pharmaceutical form of dissolving before use. For example, sugar alcohol or saccharide such as mannitol or glucose can be used as excipient for lyophilization.
(102) The second aspect of the present invention relates to a screening method for PGC-1β-protein-function regulator. It is preferable to improve function of PGC-1β protein. It is preferable for the regulator which improves function of PGC-1β protein to act on anti-obesity. In this method, test substances are applied to cells in adipose tissue or to animal individual. After that, at least one of expression level of synoviolin in the cells of the adipose tissue, binding between synoviolin and PGC-1β protein, and ubiquitination of PGC-1β protein by synoviolin is measured or detected. As described above, the present invention is based on the knowledge that inhibiting the activity of the synoviolin causes to increase the activity of PGC-1β protein. Measuring the expression or activity of the synoviolin enables screening the PGC-1β-protein-function regulator (a substance having an action to regulate functions of the PGC-1β protein). Namely, the screening method for PGC-1β-protein-function regulator may include screening for a substance which inhibits expression or activity of synoviolin. Methods disclosed in, for example, JP. 2006/137514 A1, JP 2006/135109 A1, JP 2005/118841 A1, JP 2005/019472 A1, and JP 02/052007 A1 as well as the methods described in the specification and the examples of this application may be appropriately applied to the screening method for the substance which inhibits expression or functions of synoviolin.
(103) One embodiment of the second aspect of the present invention relates to a detecting (screening) method for a mitochondria activator using the above described screening method for the PGC-1β-protein-function regulator.
(104) Another embodiment of the second aspect of the present invention relates to a detecting (screening) method for an anti-obesity therapeutic agent or an anti-obesity prevention agent using the above described screening method for the PGC-1β-protein-function regulator.
EXAMPLES
(105) Hereinafter, the present invention is further specifically described using Examples. The present invention is not limited to the examples described below.
(106) (Materials: Plasmids and Antibodies)
(107) The coding sequences for full-length mPPARα, mPPARγ, mPGC-1α and mPGC-1β genes were obtained by PCR amplification from mouse 3T3-L1 cDNA. Fragments of a series of deletion mutants of PGC-1β were obtained by PCR amplification. Full-length PGC-1β and each of these deletion mutants were inserted into pcDNA3 HA vector (this vector was prepared by modification of a vector purchased from Amersham Pharmacia Biotech), and used for the GST pull-down assay and transient transfection assay. The sequences of all prepared plasmids were confirmed by sequence analysis. PPRE×3-TK-luc was purchased from addgene Inc. A series of synoviolin plasmids were used those previously disclosed in the literatures (Amano et al., 2003. Synoviolin/Hrd1, an E3 ubiquitin ligase, as a novel pathogenic factor for arthropathy. Genes Dev 17, 2436-2449) (Yamasaki et al., 2007. Cytoplasmic destruction of p53 by the endoplasmic reticulum-resident ubiquitin ligase ‘Synoviolin’. EMBO J 26, 113-122.). The following antibodies were used: anti-FLAG (M2), anti-tubulin from Sigma Chemical Co, anti-HA-tag (12CA5 and 3F10) from Roche, and anti-PGC-1β from Sant cruze bio. Anti-synoviolin rabbit polyclonal antibody described previously (Yamasaki et al., 2007) was used.
Generation Example 1: Synoviolin Conditional Knockout Mice
(108) Synoviolin conditional knockout mice (syno cKO) were prepared using the following method.
(109) 14.8 kb gene region, the region from upstream of exon 1 to downstream of exon 16 of mouse synoviolin gene, was used to construct the targeting vector. A neomycin resistance gene interposed between FRT sequences was inserted between exon 1 and exon 2. In addition, loxP sequences were introduced upstream from exon 2 and downstream from exon 14. The resulting targeting vector was introduced into ES cells. Clones having an allele in which the desired homologous recombination has occurred were selected by confirming removal of the loxP-exon-loxP sequence by Cre treatment and removal of the FRT-neomycin-FRT sequence by FLP treatment using the lengths of the PCR products. Chimeric mice were obtained by introducing the ES cell clones that had the desired homologous recombination into mouse embryos as described in a known method (e.g., EMBO J 16: 1850-1857). Moreover, these chimeric mice were crossed with wild-type C57BL/6 mice to generate mice in which the neomycin sequence had been removed. In addition, since loxP sequences between exons and the long arm incorporated in the targeting vector have the possibility of being lost during homologous recombination, their presence was confirmed by PCR.
(110) The resulting neomycin-removed mice were crossed with CAG-Cre mice to obtain CAG-Cre;syno.sup.flox/flox mice having homozygous synoviolin allele in which loxP sequences were introduced and homozygous Cre-ER introduced gene under control of CMV enhancer and chicken β-actin promoter (See Hayashi, S., and McMahon, A. P. (2002). Efficient recombination in diverse tissues by a tamoxifen-inducible form of Cre: a tool for temporally regulated gene activation/inactivation in the mouse. Dev. Biol. 244, 305-318.).
(111) The mice can induce synoviolin knockout by tamoxifen (Tam).
(112) At 7-8 weeks after birth, CAG-Cre;syno.sup.flox/flox mice (syno cKO) and homozygous syno.sup.flox/flox mice (syno WT) were administered with tamoxifen. Tamoxifen solution was prepared so that 20 mg/ml of tamoxifen to be administered had been dissolved in corn oil (WAKO). Administration of 125 mg/kg of the tamoxifen solution per day was performed by intraperitoneal for 5 consecutive days.
(113) Knockout of synoviolin by administration of tamoxifen was confirmed by PCR of synoviolin on genome, detection of synoviolin mRNA using real-time PCR, Western blotting of synoviolin protein, and the like.
Example 1: Transcription of Factors Relating to β-Oxidation and Mitochondrial Biogenesis
(114) In order to examine possibility of synoviolin to change peripheral energy consumption, comprehensive gene expression analysis was performed by using microarray in white fat cells derived from synoviolin knockout mice.
(115) The results show remarkable increases in expression of genes relating to the β-oxidation such as Ppara, Cpt1b, Cpt, Acox2, Ehhadh, Acsl1, Acat2 and in expression of genes relating to the mitochondrial biogenesis such as Pgc-1a, UCP3, cidea, cox8b, in the synoviolin knockout mice as compared to the synoviolin WT mice.
(116) Accordingly, expression of these genes was confirmed using real-time PCR. Concretely, total RNA was extracted in the usual manner from white fat cells derived from the synoviolin knockout mice (syno cKO), and then real-time PCR was performed. Various primers shown in the following table 1 were used for real-time PCR.
(117) TABLE-US-00002 TABLE 1 SEQ ID Probe Gene Primer No No Ehhadh F ccggtcaatgccatcagt 8 109 R ctaaccgtatggtccaaactagc 9 Acsl1 F ctacggacagaccgagtgc 10 27 R tttacataattgcaaggcatgg 11 Acat2 F actgtcaccccagcgaac 12 89 R ccaggagactattcttgctaaagg 13 Acox2 F agattgggcctatagggaaga 14 26 R caccgggaggtaccaagaa 15 Cpt1b F cccaaaacagtatcccaatcat 16 10 R taagagaccccgtagccatc 17 Cpt2 F ccaaagaagcagcgatgg 18 71 R tagagctcaggcagggtga 19 Slc27a1 F gacaagctggatcaggcaag 20 1 R gaggccacagaggctgttc 21 Hacl1 F tccaggcgaacgtgactt 22 10 R cagaggtttctgccatgcta 23 Ucp1 F accttcccgctggacact 24 9 R ggcaatccttctgtttttgc 25 Ucp2 F agcctgagacctcaaagcag 26 6 R ccttcaatcggcaagacg 27 Ucp3 F tacccaaccttggctagacg 28 69 R gtccgaggagagagcttgc 29 Ppara F ccgagggctctgtcatca 30 78 R gggcagctgactgaggaa 31 Pparg F ggaaagacaacggacaaatca 32 68 R attcggatggccacctct 33 Ppargc1a F tgtggaactctctggaactgc 34 63 R agggttatcttggttggcttta 35 Ppargc1b F ctccagttccggctcctc 36 17 R ccctctgctctcacgtctg 37 Cidea F aaaccatgaccgaagtagcc 38 66 R aggccagttgtgatgactaagac 39 Cox8b F ccagccaaaactcccactt 40 102 R gaaccatgaagccaacgac 41 LKB1 F ggacgtgctgtacaatgagg 42 R gcatgccacatacgcagt 43 NRF1 F tggagtccaagatgctaatgg 44 R gcgaggctggttaccaca 45 F: forward, R: reverse
(118) As a control, real-time PCR was similarly performed using white fat cells derived from synoviolin wild type mice (syno WT).
(119) Reaction condition of real-time PCR is shown below.
(120) Stage 1 (Activation of polymerase): at 95° C. for 10 min
(121) Stage 2 (Thermal denaturation): at 95° C. for 1 sec
(122) (Annealing/Elongation): at 60° C. for 20 sec
(123) Stage 3: repeating Stage 2 40 cycles
(124) Step One Plus (Applied Biosystems) was used as a real-time PCR apparatus.
(125) Measured values were normalized using values in 18s ribosomal RNA as endogenous control, and were shown by the ratio to a mean value (n=3) of the syno WT. The results were shown in
(126)
Example 2: Observation of Mitochondria in Synoviolin Knockout Mice
(127) In the white fat cells derived from the synoviolin knockout mice (syno cKO) used in Example 1, mitochondria were observed in the usual manner by using an electron microscope. As a control, the white fat cells derived from synoviolin wild type mice (syno WT) were similarly observed. The results were shown in the left of
(128) Further, the white fat cells derived from mice in which synoviolin had been knocked out specifically in fat cells (syno Adipose KO) were similarly observed. The results were shown in the right of
(129)
Example 3: Binding Between Synoviolin and PGC-1β In Vitro
(130) Transcription factor family PPAR (PPARα, PPARγ) deeply relating to differentiation and activity of adipocytes, and corresponding transcription coactivator PGC family (PGC-1α, PGC-1β, PRC) were hitherto known as a factor having activity of controlling both β-oxidation and duplication of mitochondria. Accordingly, whether each factor described above can bind with synoviolin protein was confirmed.
(131) Firstly, GST fusion synoviolin which lack transmembrane domain (GST syno ΔTM) was incubated with glutathione-Sepharose 4B. The GST fusion protein was incubated with whole cell extract from HEK-293T expressing HA PPARγ, HA PPARα, HA PGC-1α, or HA PGC-1β. Bound protein was eluted and separated by SDS-PAGE, and Western blot was performed using anti-HA antibody. GST which was not fused to any protein was used as a control. The results were shown in
(132)
Example 4: Binding Between Synoviolin and the Fragmented and Modified PGC-1β In Vitro
(133) In order to identify the binding region of PGC-1β which binds to synoviolin, GST pulldown assay was performed using a series of the fragmented and modified PGC-1β (See
(134) Specifically, the fragmentation of PGC-1β was performed by PCR according to a method in a previously reported article (Aratani, S. et al., (2001). Dual roles of RNA helicase A in CREB-department transcription. Mol. Cell Biol. 21, 4460-4469.). Conceptual diagrams of each fragmented and modified PGC-1β were shown in
(135)
Example 5: Binding Between Fragmented and the Modified Synoviolin and PGC-1β In Vitro
(136) In order to identify a region of synoviolin which binds to PGC-1β, GST pulldown assay was performed using a series of the fragmented and modified synoviolin (See
(137)
Example 6: Binding Between Synoviolin and PGC-1β In Vivo
(138) Whether synoviolin and PGC-1β actually form a complex in in vivo was investigated. Specifically, a plasmid for expressing PGC-1β with HA tag (HA PGC-1β) and a plasmid for expressing synoviolin with FLAG tag (SYVN1/FLAG) or the modified synoviolin with FLAG tag (SYVN1ΔSyU/FLAG) were transfected in HEK-293T cells. Whole cell extract from the HEK-293T cells transfected with the expression plasmids was prepared to immunoprecipitate using anti-FLAG antibody. Proteins bound to the anti-FLAG antibody were eluted and separated by SDS-PAGE, and Western blot was performed using anti-HA antibody and the anti-FLAG antibody. The results were shown in
(139)
(140) In order to further investigate physical binding between synoviolin and PGC-1β, whole cell extract from the HEK-293 expressing synoviolin and PGC-1β was immunoprecipitated using anti-synoviolin antibody, and immuno blotting was performed using anti-PGC-1β antibody. The results were shown in
(141)
Example 7: Subcellular Localization of Synoviolin and PGC-1β
(142) It is known that synoviolin is ER resident protein and PGC-1β translocates into nucleus. Thus, subcellular localization of synoviolin and PGC-1β was investigated. Plasmids for expressing HA PGC-1β and/or syno/FLAG, synoviolin 3S/FLAG or synoviolin ΔSyU/FLAG were transfected in HEK-293T cells. After 24 hours, the subcellular localization of synoviolin and PGC-1β was investigated by immunofluorescence staining using anti-HA antibody and anti-FLAG antibody. The results were shown in
(143)
Example 8: Ubiquitination of PGC-1β by Synoviolin
(144) It is known that synoviolin is an E3 ubiquitin ligase (see Amano, T., et al. (2003). Synoviolin/Hrd1, an E3 ubiquitin ligase, as a novel pathogenic factor for arthropathy. Genes Dev. 17, 2436-2449). Then, whether PGC-1β is a substrate of synoviolin as the E3 ubiquitin ligase was investigated. In vitro ubiquitination assay was performed using in vitro transcribed/translated PGC-1β (FLAG-PGC), ubiquitin activating enzyme E1 (E1-His), ubiquitin binding enzyme E2 (UBE2G2-His), and ubiquitin (PK-His-HA-Ub), and the modified synoviolin fused to GST (syno(236-338)). The results were shown in
(145) As shown in
(146) Next, ubiquitination of PGC-1β in vivo was investigated. Plasmids for expressing ubiquitin/FLAG, HA PGC-1, and synoviolin or synoviolin 3S were transfected in HEK-293T cells. Whole cell extract from the HEK-293T cell was immunoprecipitated using anti-HA antibody. Proteins bound to the anti-HA antibody were eluted and separated by SDS-PAGE, and Western blot was performed using anti-FLAG antibody. The results were shown in
(147) As shown in
(148) These results indicate that PGC-1β is a putative substrate of synoviolin in vitro and in vivo.
(149) It is well known that ubiquitinated proteins are degradated in proteasome. Therefore, in order to investigate that the protein levels of PGC-1β was regulated by synoviolin, the following experiments were performed.
(150) Western blot was performed to measure the protein levels of synoviolin and PGC-1β in epididymis and mesentery of mice in which synoviolin had been knocked out after neonatal period (syno cKO).
(151)
(152) Next, mRNA and protein levels of PGC-1β in mouse post-neonatal skin fibroblasts were investigated.
(153) Skin fibroblasts from syno CKO mice were cultivated in DMEM medium and treated by tamoxifen (Tam) or solvent (DMSO) for 48 hours. Cell extracts or total RNA were collected, each was used for western blot and real-time PCR, respectively. The results were shown in
(154) The protein level of PGC-1β was markedly increased in Tam-treated skin fibroblasts from synoviolin conditional knockout mice (1.4 folds). As expected, no change was observed in mRNA level of PGC-1β.
(155) Further, in order to investigate whether PGC-1β was involved in synoviolin-mediated degradation of PGC-1β in cells, after the treatment by tamoxifen or solvent in the above experiment, 10 μM of MG-132, which is a proteasome inhibitor, was added and treated for two hours, and then, similar experiment was performed.
(156)
(157) These results indicate that the protein level of PGC-1β is negatively regulated by synoviolin at posttranscriptional process and strongly suggest that the synoviolin is a major E3 for PGC-1β in cells.
Example 9: Effect of Synoviolin siRNA on PGC-1β Functions
(158) In addition to the effect of lacking a portion of the gene, effect of siRNA (Syno siRNA) for synoviolin was confirmed by the following experiment.
(159) Firstly, synoviolin knock down was performed by siRNA in HEK 293 cells. Synoviolin siRNA was prepared in accordance with already reported article (see, Yamasaki, S., et al. (2007). Cytoplasmic destruction of p53 by the endoplasmic reticulum-resident ubiquitin ligase ‘Synoviolin’. EMBO J 26, 113-122.). Transfection of siRNA into cells was performed in accordance with a protocol with Lipofectamine 2000 (Invitrogen, Corporation). The results were shown in
(160)
(161) It was known that PGC-1β has a function as a transcription coactivator of some transcription factors such as PPARα and PPARγ, and that PGC-1β was involved in various biological phenomena including mitochondrial biogenesis, β-oxidation, and weight control (see Scarpulla, R. C. (2008). Transcriptional paradigms in mammalian mitochondrial biogenesis and function. Physiol. Rev. 88, 611-638.). Therefore, PGC-1β was hypothesized to be a factor that causes the observed phenomena in syno cKO mice. In order to verify this hypothesis, two representative PGC-1β mediated cellular phenomena which were disturbed in syno cKO were analyzed. One is coactivator activity of PGC-1β and another is mitochondrial biogenesis.
(162) Specifically, control siRNA or Syno siRNA was temporarily transfected in HEK-293 cells. Reporter plasmid containing PPAR binding sites (PPRE ×3-TK-luc), CMV-β-gal expression construct, or siRNA was temporarily transfected in HEK-293 cells. After 16 hours, DMSO or Wy-14643 was treated for 6 hours, and then Luciferase assay was performed (
(163) It is known that PPAR-luciferase (PPRE ×3-TK-luc) contains 3×PPAR binding sites, and that it was strictly regulated by PPAR, their ligands and the coactivators (see Kim, J. B., et al. (1998). ADD1/SREBP1 activates PPAR gamma through the production of endogenous ligand. Proc. Natl. Acad. Sci. USA 95, 4333-4337.).
(164) In addition, in order to investigate the effect of synoviolin overexpression, the amount of vector for expressing synoviolin was increased in stages and co-transfected in the experiment (
(165) After 16 hours from the transfection, cells were treated with solvent (DMSO) or Wy-14643 for 6 hours and the Luciferase assay was performed.
(166)
(167)
(168) These results indicate that synoviolin knockdown enhances PPARα mediated transcription through a pathway depending on PGC-1β.
(169) Further, in order to verify whether the synoviolin knockdown regulates mitochondrial biogenesis in cells, synoviolin siRNA treated cells, which had been treated similar to the above, were observed with an electron microscope. The resulting pictures were shown in
(170)
Example 10: Inhibition of Binding Between Synoviolin and PGC-1β by Inhibitor of E3 Ubiquitin Ligase Activity of Synoviolin
(171) In order to investigate an influence on PGC-1β functions by inhibitor of E3 ubiquitin ligase activity of synoviolin, an effect on inhibition of binding between the synoviolin and the PGC-1β was firstly investigated. Specifically, in a usual binding assay using MBP-PGC-1β-His protein and GST-Syno ΔTM protein, LS-102 (PARMACOPIEA, Corporation) was added and these proteins were incubated for 12 hours. Then, these proteins were separated by SDS-PAGE of 12% gel concentration, and Western blot was performed. Anti-GST antibody diluted 2500 folds were used as a primary antibody, and anti-rat HRP diluted 10000 folds was used as a secondary antibody. The results were shown in
(172) The LS-102 is a compound represented by the following structural formula and is a chemical compound which selectively inhibits E3 ubiquitin ligase activity of synoviolin.
(173) ##STR00004##
(174)
Example 11: Screening of Substances which Inhibit the Binding Between Synoviolin and PGC-1β
(175) In order to obtain a substance which inhibits the binding between synoviolin and PGC-1β, with respect to the substances shown in the following table 2 included in screening library relating to E3 ubiquitin ligase, in order to examine influence on the binding between synoviolin and PGC-1β, in vitro binding assays similar to the examples 3 to 6 were performed. The results were shown in
(176)
(177) TABLE-US-00003 TABLE 2 Name of substance Structure Supplier 348 (B)
(178)
Example 12: Influences of Inhibitor of E3 Ubiquitin Ligase Activity of Synoviolin and Substances which Inhibit the Binding Between Synoviolin and PGC-1β on PGC-1β Functions
(179) The luciferase assay was performed similar to the example 9 except for using 5 μM of LS-102, 0.1 μM and 0.5 μM of 348, 0.1 μM and 5 μM of 349, and 5 μM of 351 and 355 instead of transfecting the Syno siRNA in the example 9. The same volume of DMSO, which is a solvent of each compound, was added as a control. The results were shown in
(180)
(181) When a protein level of the PGC-1β was investigated as a confirmation, the protein level of the PGC-1β was doubled in LS-102 treated cells. On the other hand, the expression of PGC-1β mRNA was not changed by the LS-102 treatment.
Example 13: Influences of Substances which Inhibit the Binding Between Synoviolin and PGC-1β on Mitochondrial Functions
(182) The observation of mitochondria was performed similar to the example 9 except for observing after 72 hours from adding 1 μM of 348, 349, 351 and 355 to cells instead of transfecting the Syno siRNA in the example 9. The resulting pictures were shown in
Example 14: Effect of the Inhibition of Synoviolin Expression and Inhibition of Ubiquitination Activity
(183) 3T3-L1 cells, which are preadipocytes of mice, were cultivated in Dulbecco's Modified Eagle Medium (DMEM; High Glucose) containing 10% fetal bovine serum (FBS) for 3 days after reaching confluent state. 500 μM of isobutyl-methylxanthine (IBMX), 1 μM of Dexamethasone, and 5 μg/mL of insulin were added to induce differentiation. At the same time, 10 μM of LS-102 (ubiquitination activity inhibitor of synoviolin) or DMSO was added. After cultivation for 3 days, the medium was replaced with medium containing 4 μg/mL of Insulin, and 10 μM of LS-102 or DMSO was added. After cultivation for 3 days, the medium was replaced with DMEM (High Glucose) containing 10% FBS to cultivate for 3 days. As siRNA treatment, 200 pmol of siRNA Syno770 (sense strand consists of the following SEQ ID NO: 2) was introduced using the Lipofectamine2000 two days before induction of differentiation.
(184) TABLE-US-00004 SEQ ID No. 2: 5′-GCUGUGACAGAUGCCAUCA-3′
(185) After the cultivated 3T3-L1 cells were washed with PBS(−) (Phosphate Buffered Saline solution from which magnesium and calcium had been eliminated), the cells were fixed by 10% formalin. The cells were washed with the PBS(−) to be replaced with 60% isopropanol. After staining for 20 minutes with 18 mg/ml of Oil Red O (isopropanol was used as solvent), the cells were washed with 60% isopropanol and PBS(−), and observed by a microscope.
(186) In the cells in which the synoviolin gene activity was inhibited by siRNA, the number of differentiated adipose cells was less as compared to a control, and the differentiation was suppressed. Further, lipid droplets, which were not observed in normal adipocytes, in the form of annular ring were observed. These results indicate that synoviolin gene expression and self-ubiquitination of synoviolin protein were inhibited.
Example 15: Oxygen Consumption of Adipocyte in Synoviolin Knockout Mice
(187) In order to investigate whether mitochondrial functions are activated in CAG-Cre-ER;Syv1.sup.flox/flox mice, oxygen consumption per one cell of adipocytes was measured.
(188) (Measuring Method of Oxygen Consumption)
(189) Measuring method of oxygen consumption was as follows. Subcutaneous fat was collected from CAG-Cre-ER;Syvn1.sup.flox/flox mice and control mice to obtain single cell by treating 0.1% (w/v) collagenase at 37° C. for 1 hour. For a suspension of the obtained single cells, oxygen consumption was measured by using MitoXpress (registered trademark)-Xtra-HS (Luxcel Biosciences Ltd. Ireland) according to a manual attached to a kit. The results were shown in
(190)
Example 16: Base Metabolic Rate in Synoviolin Knockout Mice
(191) In order to investigate whether mitochondrial functions are activated in CAG-Cre-ER;Syvn1.sup.flox/flox mice, the base metabolic rate of CAG-Cre-ER;Syvn1.sup.flox/flox mice was measured (
(192) (Measuring Method of Base Metabolic Rate)
(193) Measuring method of the base metabolic rates was as follows. By using mice of 7 days after Tam administration, oxygen consumption (VO.sub.2) and production amount of carbon dioxide (VCO.sub.2) in a case of fasting for 4 hours and being rest were measured by Oxymax Equal Flow System (Columbus Instruments, 950 N. Hague Ave; Columbus, Ohio USA). Further, motor activity (the number of motion) was measured together using DAS system (Neuro Science, Inc., Japan).
(194) As shown in
Example 17: Relation Between Synoviolin and Fat Burning
(195) In order to investigate adiponectin and synoviolin in each tissue of wild-type WT mice and synoviolin KO mice, Western blotting was performed.
Example 18: Measurement of Half-Life of PGC-1β
(196) In order to investigate whether the interaction between SYVN1 and PGC-1β is important for degradation of PGC-1β via SYVN1, the half-life of PGC-1β was measured.
(197) A test was performed by modifying the conventional known method (Yamasaki, S., et al. EMBO J. 26, 113-122 (2007) and Bernasconi, R., et al. J. Cell Biol. 188, 223-235 (2010)) as follows. 1 μg of pcDNA3 Synoviolin/FLAG, empty vector, or 1.5 μg of pcDNA3 Synoviolin ΔSyU/FLAG and 0.75 μg of pcDNA3 HAPGC-1β were transfected in mouse embryonic fibroblasts (MEF Syno−/−) from synoviolin knockout mice. After 48 hours from the transfection, the cells were treated with 40 μM Cycloheximide for 0.5, 1, 2, or 4 hours and dissolved by buffer (10 mM Tris-HCl pH 8.0, 150 mM NaCl, 1 mM EDTA, 1% NP-40, 1 mM DTT, protease inhibitors) to be subjected to immunoblot analysis by anti-PGC-1β, anti-SYVN1, or anti-alpha-tubulin antibody. Each test was performed at least three times. The results were shown in
Example 19: Influence of Ubiquitination Activity Inhibitor LS-102 of Synoviolin on Mitochondrial Functions
(198) 50 mg/kg body weight of LS-102 per day or solvent (DMSO) as a control was administered intraperitoneally to 7 to 8-week-old C57BL/6J mice to observe adipose tissue slices of the mice of fifty seventh day after the administration using a microscope. The results were shown in
(199)
Example 20: Half-Life of PGC-1β
(200) Empty vector (control: CONT), synoviolin wild-type (SYVN1 WT), and synoviolin unique domain (modified synoviolin in which the binding region with PGC-1β has been deleted: SYVN1 ΔSyU) were respectively transfected with expression vector of PGC-1β in mouse embryoinic fibriblasts (MEF) established from synoviolin KO mice in accordance with a conventional method. After 48 hours from the transfection, treatment with Cycloheximide (40 μM), which is a typical protein translation inhibitor, was performed for 0.5, 1, 2, and 4 hours as shown in
(201) This result shows that the half-life of the PGC-1β, namely degradation thereof has been regulated by existence of synoviolin, and that SyU domain is essential for the regulation.
Example 21: Evaluation of Ubiquitination
(202) The binding assay was performed using the following assay system. 2 μg of MBP-PGC-1β His (1-367aa) and 2 μg of the modified synoviolin fused to GST were bound for 12 hours in a buffer (20 mM Tris-HCl pH 8.0, 100 mM NaCl, 1 mM EDTA. 0.1% NP-40, 5% glucose 1, and protease inhibitors) to detect PGC-1β using anti-PGC-1β antibody.
(203) The ubiquitin assay was performed using the following assay system. E1-His 125 ng, UbcH5C 150 ng, MBP-SYVN1 ΔTM-His 150 ng, GST-PGC-1β (1-367 aa; GST-P5), and HA-ubiquitin (HA-Ub) 750 ng were reacted at 30° C. for 2 hours in a buffer (50 mM Tris-HCL pH 7.5, 5 mM MgCl.sub.2, 0.6 mM DTT, and 2 mM ATP) to be ubiquitinated. Thereafter, the ubiquitinated proteins were bound to Glutathione Sepharose in GST washing buffer (50 mM Tris-HCl pH 7.5, 0.5 M NaCl, 1% Triton X, 1 mM EDTA, 1 mM DTT, and protease inhibitors). After washing with the GST washing buffer, ubiquitination of PGC-1β was detected by Western blotting using anti-PGC-1β antibody and anti-HA antibody. The results of in vitro ubiquitination assay were shown in
(204)
Example 22: Inhibition of Ubiquitination of Test Substances
(205) In order to examine the concentration dependency of the inhibiting activity of test substances 348 and 349 in PGC-1β ubiquitination by synoviolin (SYVN1), the in vitro binding assay was performed in the same manner as described in Example 11.
Example 23: Binding Between the Fragmented and Modified Synoviolin and PGC-1β
(206) The Example 5 showed the high possibility that synoviolin (SYVN1) binds to PGC-1β in the region of 236 to 270 (SyU domain). In this example, in order to find a portion to which the PGC-1β binds with high possibility from the SyU domain, the following example was performed.
(207)
Example 24: Binding Between the Fragmented and Modified Synoviolin and PGC-1β
(208) Amino acid sequence of the portion of 266-270aa is RRAIR. Peptide consisting of the amino acid sequence of AAAAA (control), amino acid in 266.sup.th R had been replaced with A (R266A), amino acid in 267.sup.th R had been replaced with A (R267A), amino acid in 270.sup.th R had been replaced with A (R270A), amino acid in 266.sup.th R and 267.sup.th R had been replaced with A (R266, 267A), amino acids in 266.sup.th R and 270.sup.th R had been replaced with A (R266, 270A), amino acids in 267.sup.th R and 270.sup.th R had been replaced with A (R267, 270A), and amino acids in the three R had been replaced with A (3A) was prepared, and Western blot was performed in the same manner as in the Example 5. The results were shown in
INDUSTRIAL APPLICABILITY
(209) The mitochondrial function regulator of the present invention causes increases in number and size of mitochondria, enhances β-oxidation of the fatty acid and the mitochondrial biogenesis, and can be applied to treatment or prevention of obesity. Therefore, the present invention can be utilized in pharmaceutical industries.
SEQUENCE LISTING FREE TEXT
(210) Sequence 2: Synthetic RNA
(211) Sequence 3: Synthetic RNA
(212) Sequence 4: Synthetic RNA
(213) Sequence 5: Synthetic RNA
(214) Sequence 6: Synthetic RNA
(215) Sequence 7: Synthetic RNA
(216) Sequence 8: Primer
(217) Sequence 9: Primer
(218) Sequence 10: Primer
(219) Sequence 11: Primer
(220) Sequence 12: Primer
(221) Sequence 13: Primer
(222) Sequence 14: Primer
(223) Sequence 15: Primer
(224) Sequence 16: Primer
(225) Sequence 17: Primer
(226) Sequence 18: Primer
(227) Sequence 19: Primer
(228) Sequence 20: Primer
(229) Sequence 21: Primer
(230) Sequence 22: Primer
(231) Sequence 23: Primer
(232) Sequence 24: Primer
(233) Sequence 25: Primer
(234) Sequence 26: Primer
(235) Sequence 27: Primer
(236) Sequence 28: Primer
(237) Sequence 29: Primer
(238) Sequence 30: Primer
(239) Sequence 31: Primer
(240) Sequence 32: Primer
(241) Sequence 33: Primer
(242) Sequence 34: Primer
(243) Sequence 35: Primer
(244) Sequence 36: Primer
(245) Sequence 37: Primer
(246) Sequence 38: Primer
(247) Sequence 39: Primer
(248) Sequence 40: Primer
(249) Sequence 41: Primer
(250) Sequence 42: Primer
(251) Sequence 43: Primer
(252) Sequence 44: Primer