Promoter exhibiting high expression activity in Mortierella microorganisms
09765345 · 2017-09-19
Assignee
Inventors
Cpc classification
International classification
C12N15/00
CHEMISTRY; METALLURGY
Abstract
The present invention aims to provide a promoter showing high expression activity in microorganisms belonging to the genus Mortierella. The present invention provides a polynucleotide which contains a nucleotide sequence selected from SEQ ID NOs: 1 to 28, or a variant thereof, as well as a non-human transformant containing such a polynucleotide.
Claims
1. A vector comprising a polynucleotide selected from: (a) a polynucleotide which contains any one nucleotide sequence selected from SEQ ID NOs: 22 to 26; or (b) a polynucleotide which has a nucleotide sequence sharing an identity of 90% or more with any one nucleotide sequence selected from SEQ ID NOs: 22 to 26 and which shows promoter activity in cells of microorganisms belonging to the genus Mortierella.
2. The vector according to claim 1, wherein the promoter activity is confirmed as β-D-glucuronidase (GUS) protein activity of at least 500 nmol/(mg.Math.min) upon expression of GUS reporter gene in cells of microorganisms belonging to the genus Mortierella.
3. The vector according to claim 1, which comprises any one nucleotide sequence selected from SEQ ID NOs: 22 to 26.
4. The vector according to claim 1, which is DNA.
5. A microbial transformant transformed with the vector according to claim 1.
6. The transformant according to claim 5, wherein the transformant is a lipid-producing fungus.
7. The transformant according to claim 6, wherein the lipid-producing fungus is Mortierella alpina.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1)
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
(12)
(13)
BEST MODES FOR CARRYING OUT THE INVENTION
(14) The present invention will be described in more detail below. The following embodiments are illustrated to describe the present invention, and it is not intended to limit the present invention only to these embodiments. The present invention can be implemented in various modes, without departing from the spirit of the present invention.
(15) It should be noted that all publications cited herein, including prior art documents, patent gazettes and other patent documents, are incorporated herein by reference. Moreover, this specification incorporates the contents disclosed in the specification and drawings of Japanese Patent Application No. 2013-066265 (filed on Mar. 27, 2013), based on which the present application claims priority.
(16) Unless otherwise specified herein, nucleotide sequences are shown such that their 5′-terminal end is on the left-hand side and their 3′-terminal end is on the right-hand side.
(17) 1. Promoters
(18) The inventors of the present invention have succeeded, ahead of others, in cloning several types of promoter sequences from a lipid-producing fungus, M. alpina, as described in more detail later in the Example section. Moreover, the inventors of the present invention have also confirmed that proteins expressed under these promoters exert their biological activity.
(19) Promoters according to the present invention are PP7p, CIT1p, PP3p, PP2p, PP6ps, HSC82p, SSA2p, GAL10-2p and/or partial sequences (truncated sequences) thereof. These promoter region sequences and truncated sequences thereof are shown in the table below.
(20) Any one sequence selected from the nucleotide sequences shown in the table, i.e., any one sequence selected from the group consisting of SEQ ID NOs: 1 to 28 is hereinafter referred to as “the promoter sequence of the present invention.”
(21) TABLE-US-00001 TABLE 1 Promoter sequence: Name (SEQ ID NO) Truncated promoter sequence: Name (SEQ ID NO) PP7p PP7p D1000 PP7p D750 PP7p D500 (SEQ ID NO: 1) (SEQ ID NO: 2) (SEQ ID NO: 3) (SEQ ID NO: 4) CIT1p CIT1p D1300 CIT1p D1000 CIT1p D700 CIT1p D400 (SEQ ID NO: 5) (SEQ ID NO: 6) (SEQ ID NO: 7) (SEQ ID NO: 8) (SEQ ID NO: 9) PP3p PP3p D1600 PP3p D1200 (SEQ ID NO: 10) (SEQ ID NO: 11) (SEQ ID NO: 12) PP2p (SEQ ID NO: 13) PP6p PP6p D1000 PP6p D750 (SEQ ID NO: 14) (SEQ ID NO: 15) (SEQ ID NO: 16) HSC82p HSC82p D800 HSC82p D600 HSC82p D400 HSC82p D200 (SEQ ID NO: 17) (SEQ ID NO: 18) (SEQ ID NO: 19) (SEQ ID NO: 20) (SEQ ID NO: 21) SSA2p SSA2p D850 SSA2p D600 SSA2p D400 SSA2p D200 (SEQ ID NO: 22) (SEQ ID NO: 23) (SEQ ID NO: 24) (SEQ ID NO: 25) (SEQ ID NO: 26) GAL10-2p GAL10-2p D2000 (SEQ ID NO: 27) (SEQ ID NO: 28)
(22) Thus, the present invention provides the following polynucleotide as a promoter showing high expression activity in cells of microorganisms belonging to the genus Mortierella.
(23) A polynucleotide of any one selected from the group consisting of (a) to (c) shown below: (a) a polynucleotide which contains the promoter sequence of the present invention; (b) a polynucleotide which has a nucleotide sequence sharing an identity of 90% or more with the promoter sequence of the present invention and which shows promoter activity in cells of microorganisms belonging to the genus Mortierella; and (c) a polynucleotide which is hybridizable under stringent conditions with a polynucleotide consisting of a nucleotide sequence complementary to the promoter sequence of the present invention and which shows promoter activity in cells of microorganisms belonging to the genus Mortierella.
(24) The above polynucleotides shown in (a) to (c) are each hereinafter referred to as “the polynucleotide of the present invention.”
(25) Moreover, in the context of the present invention, “having” the promoter sequence of the present invention means “comprising” the promoter sequence of the present invention. Thus, an additional sequence(s) (e.g., an enhancer sequence) other than the promoter sequence of the present invention may be added to the upstream (5′-terminal side) or downstream (3′-terminal side) of the promoter sequence of the present invention. Such an additional sequence may be added to the promoter sequence of the present invention via a nucleotide sequence of 1 to 1000 bp, 1 to 900 bp, 1 to 800 bp, 1 to 700 bp, 1 to 600 bp, 1 to 500 bp, 1 to 400 bp, 1 to 300 bp, 1 to 200 bp, 1 to 100 bp, 1 to 75 bp, 1 to 50 bp, 1 to 25 by or 1 to 10 bp, or alternatively, may be directly added to the promoter sequence of the present invention (i.e., the number of nucleotide residues located between the promoter sequence of the present invention and the additional sequence is zero).
(26) As used herein, the term “polynucleotide” is intended to mean DNA or RNA.
(27) As used herein, the expression “polynucleotide which is hybridizable under stringent conditions” is intended to mean, for example, a polynucleotide that can be obtained by means of, e.g., colony hybridization, plaque hybridization or Southern hybridization using, as a probe, the whole or a part of a polynucleotide consisting of a nucleotide sequence complementary to the promoter sequence of the present invention. For hybridization, it is possible to use techniques as described in, e.g., “Sambrook & Russell, Molecular Cloning: A Laboratory Manual Vol. 3, Cold Spring Harbor, Laboratory Press 2001” and “Ausubel, Current Protocols in Molecular Biology, John Wiley & Sons 1987-1997.”
(28) As used herein, the term “high stringent conditions” is intended to mean, for example, conditions of (1) 5× SSC, 5× Denhardt's solution, 0.5% SDS, 50% formamide and 50° C., (2) 0.2× SSC, 0.1% SDS and 60° C., (3) 0.2× SSC, 0.1% SDS and 62° C., (4) 0.2× SSC, 0.1% SDS and 65° C., or (5) 0.1× SSC, 0.1% SDS and 65° C., without being limited thereto. Under these conditions, it can be expected that DNA having a higher sequence identity is more efficiently obtained at a higher temperature. However, the stringency of hybridization would be affected by a plurality of factors, including temperature, probe concentration, probe length, ionic strength, reaction time, salt concentration and so on. Those skilled in the art would be able to achieve the same stringency by selecting these factors as appropriate.
(29) It should be noted that if a commercially available kit is used for hybridization, an Alkphos Direct Labelling and Detection System (GE Healthcare) may be used for this purpose, by way of example. In this case, hybridization may be accomplished in accordance with the protocol attached to the kit, i.e., a membrane may be incubated overnight with a labeled probe and then washed with a primary washing buffer containing 0.1% (w/v) SDS under conditions of 55° C. to detect the hybridized DNA. Alternatively, if a commercially available reagent (e.g., PCR labeling mix (Roche Diagnostics)) is used for digoxigenin (DIG) labeling of a probe during probe preparation based on the whole or a part of a nucleotide sequence complementary to the promoter sequence of the present invention, a DIG nucleic acid detection kit (Roche Diagnostics) may be used for detection of hybridization.
(30) In addition to those listed above, other hybridizable polynucleotides include polynucleotides sharing an identity of 90% or more, 91% or more, 92% or more, 93% or more, 94% or more, 95% or more, 96% or more, 97% or more, 98% or more, 99% or more, 99.1% or more, 99.2% or more, 99.3% or more, 99.4% or more, 99.5% or more, 99.6% or more, 99.7% or more, 99.8% or more, or 99.9% or more with the promoter sequence of the present invention, as calculated by homology search software such as FASTA or BLAST using default parameters.
(31) It should be noted that the identity of nucleotide sequences can be determined by using FASTA (Science 227 (4693): 1435-1441, (1985)) or the algorithm of Karlin and Altschul, BLAST (Basic Local Alignment Search Tool) (Proc. Natl. Acad. Sci. USA 872264-2268, 1990; Proc Natl Acad Sci USA 90: 5873, 1993). Based on the algorithm of BLAST, programs called blastn, blastx, tblastn and tblastx have been developed (Altschul S F, et al: J Mol Biol 215: 403, 1990). If blastn is used for nucleotide sequence analysis, parameters may be set to, for example, score=100 and wordlength=12. If BLAST and Gapped BLAST programs are used, default parameters in each program may be used.
(32) In the context of the present invention, the term “promoter activity” is intended to mean that when a protein-encoding gene sequence (hereinafter referred to as a “target gene”) is inserted downstream of the promoter of the present invention, an expression product of this gene is obtained.
(33) The term “expression product” used here is intended to mean either or both of RNA (e.g., hnRNA, mRNA, siRNA or miRNA) which is a transcribed product of the gene and a protein which is a translated product of the gene.
(34) Insertion of a target gene may be accomplished such that the 5′-terminal end of the target gene is located in a region within 500 bp, 400 bp, 300 bp, 200 bp, 100 bp, 50 bp, 30 by or 10 by from the 3′-terminal end of the promoter sequence of the present invention.
(35) In the case of attempting to confirm the activity of the promoter sequence of the present invention, the target gene is not limited in any way, but is preferably a gene encoding a protein whose activity can be measured by the established method.
(36) Examples of such a gene include, but are not limited to, selection marker genes such as neomycin resistance gene, hygromycin B phosphotransferase gene and so on, as well as expression reporter genes such as LacZ, GFP (Green Fluorescence Protein) and luciferase genes, etc.
(37) Preferably, confirmation of promoter activity may be accomplished by using a gene for β-D-glucuronidase (GUS) to measure GUS activity. In cases where M. alpina is used as a host, the GUS gene is preferably a GUSm gene whose codon usage frequency has been adapted to M. alpina.
(38) GUS activity can be measured as follows: the promoter sequence of the present invention is used to cause GUS gene expression in cells of microorganisms belonging to the genus Mortierella, the GUS protein collected from the above cells is then reacted with p-nitrophenyl-β-D-glucuronide, and the reaction system is measured over time for absorbance at a wavelength of 405 nm, followed by calculation from the measured values according to the following equation.
GUS activity (nmol/(mg.Math.min))=1000×[(gradient value in the absorbance versus time graph obtained for each sample)/(gradient value in the calibration graph)]/[(protein concentration in the sample)/5]
(39) The GUS gene used for this purpose is generally the E. coli-derived GUS gene (CDS sequence: SEQ ID NO: 29, amino acid sequence: SEQ ID NO: 30). In cases where the promoter sequence of the present invention is used to cause GUS gene expression in cells of microorganisms belonging to the genus Mortierella, a GUSm gene (CDS sequence: SEQ ID NO: 31, amino acid sequence: SEQ ID NO: 32) may be used, which has been modified such that the codon usage in the E. coli-derived GUS gene is adapted to microorganisms of the genus Mortierella.
(40) As for examples of codon usage modification, reference may be made to the alignment between GUSm and GUS shown in
(41) The promoter activity in the present invention is preferably intended to give GUS protein activity of at least 500, 600, 700, 800, 900, 1000, 1200, 1400, 1600, 1800 or 2000 nmol/(mg.Math.min) upon expression of the GUS reporter gene in cells of microorganisms belonging to the genus Mortierella as described above.
(42) Procedures for gene transfer into host cells are as described later.
(43) The polynucleotide of the present invention mentioned above can be obtained by known genetic engineering procedures or known synthesis procedures.
(44) 2. Vectors and Transformants
(45) In another embodiment, the present invention also provides an expression vector containing the polynucleotide of the present invention (hereinafter referred to as “the vector of the present invention”).
(46) The vector of the present invention is generally configured to comprise: (i) the promoter of the present invention; and (ii) an expression cassette comprising, as constituent elements, signals that function in host cells for transcription termination and polyadenylation of an RNA molecule.
(47) The thus configured vector is introduced into host cells. Examples of appropriate host cells used in the present invention include lipid-producing fungi, yeast and so on.
(48) As lipid-producing fungi, strains as found in MYCOTAXON, Vol. XLIV, No. 2, pp. 257-265 (1992) can be used. Specific examples include microorganisms belonging to the genus Mortierella, as exemplified by microorganisms belonging to the subgenus Mortierella such as Mortierella elongata IFO8570, Mortierella exigua IFO8571, Mortierella hygrophila IFO5941, Mortierella alpina IFO8568, ATCC16266, ATCC32221, ATCC42430, CBS 219.35, CBS224.37, CBS250.53, CBS343.66, CBS527.72, CBS528.72, CBS529.72, CBS608.70, CBS754.68, etc., as well as microorganisms belonging to the subgenus Micromucor such as Mortierella isabellina CBS194.28, IFO6336, IFO7824, IFO7873, IFO7874, IFO8286, IFO8308, IFO7884, Mortierella nana IFO8190, Mortierella ramanniana IFO5426, IFO8186, CBS 112.08, CBS212.72, IFO7825, IFO8184, IFO8185, IFO8287, Mortierella vinacea CBS236.82, etc. Particularly preferred is Mortierella alpina.
(49) Such a vector may be prepared starting from an existing expression vector, e.g., pDura5 (Appl. Microbiol. Biotechnol., 65, 419-425, (2004)), pBIG35 (Appl. Environ. Microbiol., (2009), vol. 75, p. 5529-5535), pD4 (Appl. Environ. Microbiol., November 2000, 66 (11), p. 4655-4661), pDZeo (J. Biosci. Bioeng., December 2005, 100 (6), p. 617-622), pDX vector (Curr. Genet., 2009, 55 (3), p. 349-356) or pBIG3ura5 (Appl. Environ. Microbiol., 2009, 75, p. 5529-5535) by replacement of the promoter region in the starting expression vector with the promoter sequence of the present invention, although the starting expression vector is not limited to the above vectors.
(50) For transformation of host cells, a selection marker may be used to confirm whether the vector has been introduced. Examples of a selection marker available for use include auxotrophic markers (ura5, niaD, trp1), drug resistance markers (hygromycine, zeocin), geneticin resistance gene (G418r), copper resistance gene (CUP1) (Marin et al., Proc. Natl. Acad. Sci. USA, 81, 337 1984), cerulenin resistance genes (fas2m, PDR4) (Junji Inokoshi et al., Biochemistry, vol. 64, p. 660, 1992; Hussain et al., gene, 101, 149, 1991), etc.
(51) Examples of auxotrophic markers include, but are not limited to, (1) to (15) shown below: (1) methionine auxotrophic marker: met1, met2, met3, met4, met5, met6, met7, met8, met10, met13, met14 or met20; (2) tyrosine auxotrophic marker: tyr1 or isoleucine; (3) valine auxotrophic marker: ilv1, ilv2, ilv3 or ilv5; (4) phenylalanine auxotrophic marker: pha2; (5) glutamic acid auxotrophic marker: glu3; (6) threonine auxotrophic marker: thr1 or thr4; (7) aspartic acid auxotrophic marker: asp1 or asp5; (8) serine auxotrophic marker: ser1 or ser2; (9) arginine auxotrophic marker: arg1, arg3, arg4, arg5, arg8, arg9, arg80, arg81, arg82 or arg84; (10) uracil auxotrophic marker: ura1, ura2, ura3, ura4, ura5 or ura6; (11) adenine auxotrophic marker: ade1, ade2, ade3, ade4, ade5, ade6, ade8, ade9, ade12 or ADE15; (12) lysine auxotrophic marker: lys1, lys2, lys4, lys5, lys7, lys9, lys11, lys13 or lys14; (13) tryptophan auxotrophic marker: trp1, trp2, trp3, trp4 or trp5; (14) leucine auxotrophic marker: leu1, leu2, leu3, leu4 or leu5; and (15) histidine auxotrophic marker: his1, his2, his3, his4, his5, his6, his7 or his8.
(52) Examples of drug resistance markers include, but are not limited to, hygromycin (Hygromycin B) resistance gene, bleomycin t (pleomycin) resistance gene (Transformation of filamentous fungi based on hygromycin b and phleomycin resistance markers, Methods in Enzymology, Volume 216, 1992, Pages 447-457, Peter J. Punt, Cees A. M. J. J. van den Hondel), bialaphos resistance gene (Avalos, J., Geever, R. F., and Case, M. E. 1989. Bialaphos resistance as a dominant selectable marker in Neurospora crassa. Curr. Genet. 16: 369-372), sulfonylurea resistance gene (Zhang, S., Fan, Y., Xia, Y. X., and Keyhani, N. O. (2010) Sulfonylurea resistance as a new selectable marker for the entomopathogenic fungus Beauveria bassiana. Appl Microbiol Biotechnol 87: 1151-1156), benomyl resistance gene (Koenraadt, H., S. C. Sommerville, and A. L. Jones. 1992. Characterization of mutations in the beta-tubulin gene of benomyl-resistant field strains of Venturia inaequalis and other pathogenic fungi. Mol. Plant Pathol. 82:1348-1354), acetamide assimilation gene (Acetamidase, AmdS) (Kelly, J. M. and Hynes, M. J. (1985). Transformation of Aspergillus niger by the Eamds gene of Aspergillus nidulans. EMBO J. 4, 475-479), etc.
(53) For transformation of host cells, commonly used known techniques can be used. For example, in the case of lipid-producing fungi, it is possible to use electroporation (Mackenxie D. A. et al. Appl. Environ. Microbiol., 66, 4655-4661, 2000), particle delivery method (described in JP 2005-287403 A entitled “Breeding Method of Lipid Producing Fungi”) or Agrobacterium-mediated method, without being limited thereto.
(54) In addition, as for standard cloning techniques, reference may be made to “Sambrook & Russell, Molecular Cloning: A Laboratory Manual Vol. 3, Cold Spring Harbor Laboratory Press 2001” and “Methods in Yeast Genetics, A laboratory manual (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.),” etc.
(55) 3. Method for Production of Proteins, Lipids or Fatty Acids
(56) In yet another embodiment, the present invention also provides a method for production of proteins, lipids or fatty acids using the above transformant.
(57) A target gene is highly expressed in a non-human transformant transformed with the promoter of the present invention (hereinafter referred to as “the transformant of the present invention”), particularly prepared using a microorganism belonging to the genus Mortierella as a host cell. Thus, when using the transformant of the present invention, a target protein can be produced efficiently.
(58) For example, a target gene is operably introduced into the vector of the present invention and a transformant transformed with this vector is cultured, whereby a target protein can be expressed from the target gene in cells of the transformant.
(59) The expressed target protein may be collected, for example, by preparing a cell lysate from the transformant and treating this lysate in accordance with known procedures. For details of target protein collection, reference may be made to “Sambrook & Russell, Molecular Cloning: A Laboratory Manual Vol. 3, Cold Spring Harbor Laboratory Press 2001” and “Methods in Yeast Genetics, A laboratory manual (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.),” etc.
(60) The target gene is not limited in any way, but is preferably a gene encoding a lipid synthase (hereinafter referred to as a “lipid synthase gene”). Examples include genes encoding acyl-CoA synthase, glycerol-3-phosphate acyltransferase, diacylglycerol acyltransferase, fatty acid elongase, Δ9 fatty acid desaturase gene, Δ12 fatty acid desaturase gene, Δ6 fatty acid desaturase gene, Δ5 fatty acid desaturase gene, Δ4 fatty acid desaturase gene, ω3 fatty acid desaturase gene, lysophospholipid acyltransferase gene, phosphatidic acid phosphatase gene, fatty acid synthase gene, acetyl-CoA carboxylase gene, and ATP:citrate lyase gene.
(61) When cells with lipid synthesis ability, e.g., a lipid-producing fungus or the like is used as a host to express a lipid synthase gene, the lipid synthase expressed from this gene causes synthesis of lipids and/or fatty acids, which may then be collected. Thus, upon culturing the transformant of the present invention, it is possible to produce lipids and/or fatty acids with high efficiency.
(62) Lipids or fatty acids can be extracted as follows from cells which have been transformed in accordance with the present invention. After being cultured, a transformed strain of an organism (e.g., lipid-producing fungus or yeast) is treated in a standard manner, e.g., by centrifugation or filtration to obtain cultured cells. The cells are washed well with water and preferably further dried. Drying may be accomplished by freeze-drying, air-drying, etc. The dried cells are optionally homogenized, e.g., with a Dynomil or by ultrasonication, and then extracted with an organic solvent preferably under a nitrogen stream. Organic solvents used for this purpose include ether, hexane, methanol, ethanol, chloroform, dichloromethane, petroleum ether and so on. Alternatively, good results can also be obtained by alternating extraction with methanol and petroleum ether or by extraction with a single-phase solvent system of chloroform-methanol-water. When the organic solvent is distilled off from the extract under reduced pressure, fatty acid-containing lipids can be obtained. The extracted fatty acids may be converted into corresponding methyl esters by the hydrochloric acid-methanol method, etc.
(63) Moreover, fatty acids can be separated in a state of mixed fatty acids or mixed fatty acid esters from the above fatty acid-containing lipids by concentration and separation in a standard manner (e.g., urea addition, separation under cooling, column chromatography).
EXAMPLES
(64) The present invention will now be described in more detail by way of the following examples, which are not intended to limit the scope of the present invention.
(65) Genomic Analysis of Mortierella alpina
(66) M. alpina strain 1S-4 was inoculated into 100 ml of GY2:1 medium (2% glucose, 1% yeast extract, pH 6.0) and cultured at 28° C. for 2 days under shaking conditions. The cells were collected by filtration, and their genomic DNA was prepared using DNeasy (QIAGEN).
(67) The nucleotide sequence of the above genomic DNA was determined using a Roche 454 GS FLX Standard, during which nucleotide sequencing was conducted in two runs for a fragment library and in three runs for a mate-paired library. The resulting nucleotide sequences were assembled to give 300 super contigs.
(68) Expression Analysis
(69) M. alpina strain 1S-4 was inoculated into 100 ml of a medium (1.8% glucose, 1% yeast extract, pH 6.0) and pre-cultured for 3 days at 28° C. A 10 L culture vessel (Able Co., Tokyo) was charged with 5 L of a medium (1.8% glucose, 1% soybean meal, 0.1% olive oil, 0.01% Adekanol, 0.3% KH.sub.2PO.sub.4, 0.1% Na.sub.2SO.sub.4, 0.05% CaCl.sub.2.H.sub.2O, 0.05% MgCl.sub.2.6H.sub.2O, pH 6.0) and inoculated with the entire pre-cultured product, followed by aerobic spinner culture under conditions of 300 rpm, 1 vvm and 26° C. for 8 days. On days 1, 2 and 3 of culture, glucose was added in an amount corresponding to 2%, 2% and 1.5%, respectively. The cells were collected at each stage of culture (day 1, 2, 3, 6 or 8) to prepare total RNA by the guanidine hydrochloride/CsCl method. Using SOLiD™ Total RNA-Seq for Whole Transcriptome Libraries (Applied Biosystems), cDNA was synthesized for each stage and sequenced in SOLiD.
(70) Cloning of Promoter Regions
(71) Cloning was performed as follows on promoter regions in genes whose expression levels were considered to be high in M. alpina strain 1S-4 in light of the results of expression analysis or a promoter region in a homolog of the galactose metabolic system gene.
(72) First, primers required for PCR amplification of each promoter region were designed as follows. It should be noted that the underlined parts in the nucleotide sequences of primers shown below each represent a restriction enzyme recognition site. Primers were designed such that XbaI and SpeI recognition sequences were added respectively to both ends of the promoter region. However, only for GAL10-2p which has a SpeI recognition sequence in its sequence, primers were designed such that an XbaI recognition sequence was added to each end. The symbol “F” or “R” appearing in each primer name denotes that the primer is a forward primer or a reverse primer, respectively.
(73) TABLE-US-00002 Promoter PP7p PP7p F XbaI (SEQ ID NO: 33) AATATCTAGATGACCGTGCGCTTTTTGAGAC PP7p R SpeI (SEQ ID NO: 34) AGCAACTAGTCGTATATTTGTTGAAAGGTG Promoter CIT1p CIT1p F XbaI (SEQ ID NO: 35) ATTTTCTAGACACCTCAAAAACGTGCCTTG CIT1p R SpeI (SEQ ID NO: 36) AATAACTAGTGGCGGATATGTGTATGGAG Promoter PP3p PP3p F XbaI (SEQ ID NO: 37) AACGTCTAGACGTGTTATCTTGCGCTGC PP3p R SpeI (SEQ ID NO: 38) TCATACTAGTGATGATTTAGAGGTGTTGG Promoter PP2p PP2p F XbaI (SEQ ID NO: 39) AAGCTCTAGAGACTGTAAAGACGGAGGGG PP2p R SpeI (SEQ ID NO: 40) AGTAACTAGTTGTGGATAGTGGGTAGTGG Promoter PP6ps PP6ps F XbaI (SEQ ID NO: 41) AAAGTCTAGACTGGCAATAGTTAGTGCACG PP6ps R SpeI (SEQ ID NO: 42) ATCAACTAGTGATGGAGGTTTGTTTGAGAAG Promoter HSC82p HSC82p F XbaI (SEQ ID NO: 43) ATCATCTAGAGAGCTCAAGATGAAGGTGCTC HSC82p R SpeI (SEQ ID NO: 44) AATAACTAGTGGTGTGTGTGGTTTGCGGG Promoter SSA2p SSA2p F XbaI (SEQ ID NO: 45) TTAGTCTAGAAAAGTGCTGCTTCGGAACC SSA2p R SpeI (SEQ ID NO: 46) AGATACTAGTGATGTAGATGTGAGTGTGAG Promoter GAL10-2p GAL10-2p F XbaI (SEQ ID NO: 47) AATATCTAGAGGTTCCGAGAGGTGGATTTG GAL10-2p R XbaI (SEQ ID NO: 48) ATAATCTAGATGGCTCCTGAAAGGACGAG
(74) Using the genome of Mortierella alpina strain 1S-4 as a template, each promoter region was cloned by PCR. The polymerase used was PrimeSTAR GXL (TaKaRa).
(75) Vector Construction for Promoter Evaluation
(76) GUSm gene (SEQ ID NO: 31) which had been modified such that the codon usage in the E. coli-derived GUS gene (SEQ ID NO: 29) was adapted to microorganisms of the genus Mortierella (
(77) GUSm was ligated to plasmid pBIG35 containing histone promoter (HisP) serving as a constitutive expression promoter (Appl. Environ. Microbiol., (2009), vol. 75, p. 5529-5535) to construct an expression cassette. This expression cassette was further ligated in tandem to a uracil auxotrophic marker gene (ura5) to construct a binary vector for transformation, pBIG35ZhGUSm (
(78) The promoter regions cloned as described above were each excised with restriction enzymes XbaI and SpeI or with a restriction enzyme XbaI, and then inserted in place of HisP into the XbaI- and SpeI-digested vector pBIG35ZhGUSm.
(79) Transformation of Mortierella alpina
(80) A uracil auxotrophic strain (Δura-3) was induced from M. alpina strain 1S-4 in accordance with procedures described in a patent document (WO2005/019437) and cultured on 0.05 mg/mL uracil-containing Czapek-Dox agar medium (3% sucrose, 0.2% NaNO.sub.3, 0.1% KH.sub.2PO.sub.4, 0.05% KCl, 0.05% MgSO.sub.4.7H.sub.2O, 0.001% FeSO.sub.4.7H.sub.2O, 2% agar, pH 6.0). The cultured product thus obtained was collected and filtered through Miracloth (Calbiochem) to prepare a spore suspension of M. alpina Δura-3. Agrobacterium (Agrobacterium tumefaciens C58C1) was transformed with each of the prepared vectors for promoter evaluation by electroporation and cultured at 28° C. for 48 hours on LB-Mg agar medium (1% tryptone, 0.5% yeast extract, 85 mM NaCl, 0.5 mM MgSO.sub.4.7H.sub.2O, 0.5 mM NaOH, 1.5% agar, pH 7.0). Agrobacterium transformants carrying the vectors were confirmed by PCR. Agrobacterium transformants carrying the vectors were cultured at 28° C. at 120 rpm for 2 days under shaking conditions in 100 mL of MM medium (10 mM K.sub.2HPO.sub.4, 10 mM KH.sub.2PO.sub.4, 2.5 mM NaCl, 2 mM MgSO.sub.4.7H.sub.2O, 0.7 mM CaCl.sub.2, 9 μM FeSO.sub.4.7H.sub.2O, 4 mM (NH.sub.4).sub.2SO.sub.4, 10 mM glucose, pH 7.0), centrifuged at 5,800× g and then diluted with fresh IM medium (MM medium supplemented with 0.5% glycerol, 200 μM acetosyringone and 40 mM 2-(N-morpholino) ethanesulfonic acid (MES) and adjusted to pH 5.3) to prepare suspensions. These suspensions were cultured for 8 to 12 hours at 28° C. at 300 rpm under shaking conditions to reach OD 660=0.4 to 3.7. Each of the cell suspensions (100 μL) was mixed with an equal volume of the above M. alpina Δura-3 suspension (10.sup.8 mL.sup.−1), spread onto a nitrocellulose membrane (70 mm diameter; hardened low-ash grade 50, Whatman) placed on a co-culture medium (having the same composition as IM medium, except for containing 5 mM glucose instead of 10 mM glucose and 1.5% agar) and then cultured at 23° C. for 2 to 5 days. After co-culture, the membrane was transferred onto uracil-free and 0.03% Nile blue A (Sigma)-containing SC agar medium (5.0 g Yeast Nitrogen Base w/o Amino Acids and Ammonium Sulfate (Difco), 1.7 g (NH.sub.4).sub.2SO.sub.4, 20 g glucose, 20 mg adenine, 30 mg tyrosine, 1.0 mg methionine, 2.0 mg arginine, 2.0 mg histidine, 4.0 mg lysine, 4.0 mg tryptophan, 5.0 mg threonine, 6.0 mg isoleucine, 6.0 mg leucine, 6.0 mg phenylalanine, 20 g/L agar) and cultured at 28° C. for 5 days. Hyphae from visible fungal colonies were transferred onto uracil-free SC medium. Transfer onto fresh uracil-free SC medium was repeated twice to thereby select transformants stably retaining their traits.
(81) Selection of High Expression Promoters
(82) Culture and Collection of Strains
(83) Each transformant was cultured at 28° C. for 2 days on GY agar medium (2% glucose, 1% yeast extract, 1.5% agar). After completion of the culture, the cells were collected by being scraped off together with the agar.
(84) Protein Extraction From Cells
(85) The collected cells were mixed with 500 μL of a homogenization buffer (100 mM Tris-HCl (pH 8.0), 5 mM 2-mercaptoethanol) and homogenized twice at 5000 rpm for 30 seconds with a TOMY beads shocker using glass beads of 0.1 mm diameter. The homogenate was centrifuged at 8000× g for 10 minutes and the collected supernatant was further centrifuged at 20400× g for 10 minutes to collect the supernatant as a protein solution. The collected solution was measured for its protein concentration and optionally diluted to any concentration with the homogenization buffer. The foregoing operations were all conducted on ice.
(86) GUS Activity Measurement
(87) A substrate (p-nitrophenyl-β-D-glucuronide) was dissolved in an assay buffer (21.7 mM NaH.sub.2PO.sub.4, 33.9 mM Na.sub.2HPO.sub.4, 1.11 mM EDTA (pH 8.0)) to give a final concentration of 1.25 mM. This substrate solution (160 μL) and each protein sample (40 μL) were mixed on a 96-well microtiter plate, and the absorbance at 405 nm was measured over time at 37° C. The absorbance of p-nitrophenol was measured at 0.05 mM, 0.1 mM, 0.2 mM and 0.5 mM to prepare a calibration curve, and the value of GUS activity in each sample was calculated according to the following equation.
GUS activity (nmol/(mg.Math.min))=1000×[(gradient value in the absorbance versus time graph obtained for each sample)/(gradient value in the calibration graph)]/[(protein concentration in the sample)/5]
(88) The amount (nmol) of p-nitrophenyl-β-D-glucuronide converted into p-nitrophenol by the action of 1 mg/mL protein for 1 minute is defined as 1 unit of GUS activity.
(89) Selection of Strains for GUS Activity Evaluation
(90) The stable transformed strains (30 strains) selected for evaluation of each promoter were cultured on GY agar medium as described above and measured for their GUS activity. From among these 30 strains, 10 strains showing moderate GUS activity were selected.
(91) Evaluation of Promoter Activity
(92) The selected strains were cultured at 28° C. at 300 rpm for 5 days under shaking conditions in GY liquid medium (10 ml) or soybean meal medium (10 ml). After completion of the culture, the cells were collected by filtration and measured for their GUS activity. The mean of the measured values was evaluated as the activity of the promoter. The results obtained are shown in
(93) The evaluated promoters were found to have higher promoter activity than known Mortierella-derived promoters, HisP and GAPp, in the GY medium and/or in the soybean meal medium.
(94) Study on Culture Time and the Activity of Each Promoter
(95) To determine culture time-induced changes in promoter activity, the strains selected for each promoter were cultured at 28° C. under shaking conditions in GY liquid medium (10 ml) for 2 days, 5 days, 7 days or 14 days. After completion of the culture, the cells were collected by filtration and measured for their GUS activity. The results obtained are shown in the table below.
(96) TABLE-US-00003 TABLE 2 Number of days for culture and activity of each promoter Promoter GUS activity (nmol/(min .Math. mg.sub.protein)) name 2 days 5 days 7 days 14 days PP7p 10000 10000 10000 CIT1p 7000 2000 1000 PP3p 2500 28000 30000 PP2p 1000 1000 4500 PP6p 10000 20000 2500 HSC82p 10000 10000 6000 SSA2p 12000 10000 14000 GAPp 3000 2500 2500 HisP 2500 2500 2500
Evaluation of Inducible Promoter
(97) Promoter GAL10-2p was evaluated as follows.
(98) First, stable transformed strains (30 strains) were cultured at 28° C. for 3 days on SC+gal agar medium (SC agar medium containing 2% galactose instead of 2% glucose) and measured for their GUS activity as described above to thereby select 10 strains showing moderate GUS activity. These strains were inoculated into GY liquid medium, and galactose was added thereto at a concentration of 2% on day 4 or 7. Culture conditions were set to 28° C. and 300 rpm.
(99) Study on Regions Required for Promoter Activity
(100) To determine a region required for the promoter activity of each promoter, DNA fragments were prepared for each promoter by shortening the upstream region of the promoter, and evaluated for their promoter activity.
(101) To obtain such DNA fragments, the following primers were prepared for each promoter. It should be noted that the underlined parts each represent a restriction enzyme recognition site.
(102) TABLE-US-00004 PP7p Primer for amplification of promoter PP7p-D1000 PP7p D1000 F XbaI (SEQ ID NO: 49) AGCATCTAGAAAAACTATTCAATAATGGGCG Primer for amplification of promoter PP7p-D750 PP7p D750 F XbaI (SEQ ID NO: 50) ATTTCTAGAATGGCGAGACGCAGGGGGTAG Primer for amplification of promoter PP7p-D500 PP7p D500 F XbaI (SEQ ID NO: 51) AATATCTAGAGAGTGGGCACTGAACTAAAAAG Primer for amplification of promoter PP7p-D250 PP7p D250 F XbaI (SEQ ID NO: 52) AATATCTAGAGACACTGCATGACGCGAAATC CIT1p Primer for amplification of promoter CIT1p-D1300 CIT1p D1300 F XbaI (SEQ ID NO: 53) AAGTCTAGATGTCAATCATCTTTGCTGCTG Primer for amplification of promoter CIT1p-D1000 CIT1p D1000 F XbaI (SEQ ID NO: 54) TGCGTCTAGAATTATAATTATAATGAGGAAGTG Primer for amplification of promoter CIT1p-D700 CIT1p D700 F XbaI (SEQ ID NO: 55) TTATCTAGAGGCGAGTGGCGGACTGC Primer for amplification of promoter CIT1p-D400 CIT1p D400 F XbaI (SEQ ID NO: 56) TTGTCTAGACAATTGGCAAGGCTGGGTTG PP3p Primer for amplification of promoter PP3p-D1600 PP3p D1600 R XbaI (SEQ ID NO: 57) AATATCTAGAGATCCTGGTCGAAAAAGACAG Primer for amplification of promoter PP3p-D1200 PP3p D1200 R XbaI (SEQ ID NO: 58) AATGTCTAGATGAGTTTCTGTTTTTTCCTTTTTGC Primer for amplification of promoter PP3p-D800 PP3p D800 R XbaI (SEQ ID NO: 59) AATATCTAGATGAACAATTCATGCAGCTTCACG Primer for amplification of promoter PP3p-D400 PP3p D400 R XbaI (SEQ ID NO: 60) AATATCTAGACGTCTAAGCGTTTACGTGCC Primer for amplification of promoter PP3p-D200 PP3p D200 R XbaI (SEQ ID NO: 61) AATATCTAGACTCGTTTTGATGGAGTTCTC PP2p Primer for amplification of promoter PP2p-D1200 PP2p D1200 F XbaI (SEQ ID NO: 62) ATTTCTAGATGCATTTACAGGTGAATATTAC Primer for amplification of promoter PP2p-D800 PP2p D800 F XbaI (SEQ ID NO: 63) TTATCTAGACATAAAAGTGTCTGGAGCG Primer for amplification of promoter PP2p-D400 PP2p D400 F XbaI (SEQ ID NO: 64) TTATCTAGAACTAAGTGGTGTCTACTTTGG Primer for amplification of promoter PP2p-D200 PP2p D200 F XbaI (SEQ ID NO: 65) AATTCTAGAGGATACTCCATCCCCACCC Primer for amplification of promoter PP6ps PP6ps-D1000 PP6ps D1000 F XbaI (SEQ ID NO: 66) AATTCTAGACAGTTACCGTGCGCCCACTG Primer for amplification of promoter PP6ps-D750 PP6ps D750 F XbaI (SEQ ID NO: 67) AATTCTAGACTTTCACAAATAGGCATCCTATC Primer for amplification of promoter PP6ps-D500 PP6ps D500 F XbaI (SEQ ID NO: 68) AATTCTAGAGGCTTTTTCGTTTATTGGATTG Primer for amplification of promoter PP6ps-D100 PP6ps D100 F XbaI (SEQ ID NO: 69) ACGTCTAGATATCCAATTCTCACCACTTC HSC82p Primer for amplification of promoter HSC82p-D800 HSC82p D800 F XbaI (SEQ ID NO: 70) AATTCTAGATTTTACTACCGCATTCCCTTTTC Primer for amplification of promoter HSC82p-D600 HSC82p D600 F XbaI (SEQ ID NO: 71) ACGTCTAGACCTTTTCAGTAAACAATTTC Primer for amplification of promoter HSC82p-D400 HSC82p D400 F XbaI (SEQ ID NO: 72) ATTTCTAGACACAAAGAAGAAGGGTGTGTC Primer for amplification of promoter HSC82p-D200 HSC82p D200 F XbaI (SEQ ID NO: 73) ACGTCTAGAACTGTTTTCTTGAAACTTC SSA2p Primer for amplification of promoter SSA2p-D850 SSA2p D850 F SpeI (SEQ ID NO: 74) AGTAACTAGTTGACGGCGTGTATATGTCAG Primer for amplification of promoter SSA2p-D600 SSA2p D600 F SpeI (SEQ ID NO: 75) AGGTACTAGTCCATTGTATCGATTTCTGAT Primer for amplification of promoter SSA2p-D400 SSA2p D400 F SpeI (SEQ ID NO: 76) AGTAACTAGTGCTATGCGAACGGTTCATTTTG Primer for amplification of promoter SSA2p-D200 SSA2p D200 F SpeI (SEQ ID NO: 77) AGGTACTAGTTTTTTTCTCTCTGGTGTGAACG GAL10-2p Primer for amplification of promoter GAL10-2p-D2000 GAL10-2p D2000 F XbaI (SEQ ID NO: 78) AATTCTAGACGCAGAGTGATGGTCATTACC Primer for amplification of promoter GAL10-2p-D1600 GAL10-2p D1600 F XbaI (SEQ ID NO: 79) AATTCTAGACTCTATGGCAAGATTACGAG Primer for amplification of promoter GAL10-2p-D1200 GAL10-2p D1200 F XbaI (SEQ ID NO: 80) AATTCTAGATGCTCGTGAAGAGGGGCAC Primer for amplification of promoter GAL10-2p-D800 GAL10-2p D800 F XbaI (SEQ ID NO: 81) ACGTCTAGACATTTTTTGCCGCCAATTCTG Primer for amplification of promoter GAL10-2p-D400 GAL10-2p D400 F XbaI (SEQ ID NO: 82) ATTTCTAGACCCCCGCCTATTTTTTTTTTC
(103) To prepare truncated promoters of each promoter, the previously prepared vector for evaluation of each promoter was used as a template in PCR with the above primers and the reverse primers used in the examples (PP7p R SpeI, CIT1p R SpeI, PP3p R SpeI, PP2p R SpeI, PP6ps R SpeI, HSC82p R SpeI, SSA2p R SpeI, GAL10-2p R XbaI), each corresponding to the 3′-side of each promoter. The resulting DNA fragments were each excised with restriction enzymes XbaI and SpeI or with a restriction enzyme XbaI and then inserted into the vector for promoter evaluation.
(104) In the same manner as described in the section “Transformation of Mortierella alpina,” M. alpina was transformed to select stable transformed strains. These strains were measured for their GUS activity in the same manner as used in the examples. It should be noted that the number of days for culture was set to 3 days (CIT1p), 5 days (PP7p, PP6p, HSC82p, SSA2p, GAPp) or 10 days (PP3p), depending on the properties of each promoter. The results obtained are shown in
(105) In the case of the galactose-inducible promoter, stable transformed strains were pre-cultured at 28° C. for 3 days on SC+gal agar medium (SC agar medium containing 2% galactose instead of 2% glucose) or pre-cultured at 28° C. at 300 rpm for 4 days in SC+raf medium (SC liquid medium containing 2% raffinose instead of 2% glucose), followed by addition of galactose to give a final concentration of 2%. Culture was continued for an additional 1 day, and the cells were measured for their GUS activity. The results obtained are shown in
(106) As can be seen from
INDUSTRIAL APPLICABILITY
(107) The present invention enables the high expression of target genes in lipid-producing fungi and thereby allows efficient synthesis and collection of target proteins, lipids and fatty acids.
(108) Sequence Listing Free Text
(109) SEQ ID NOs: 31 to 82: synthetic DNAs
(110) Sequence Listing