Synthetic viruses and uses thereof

Abstract

The present invention relates to compositions and methods for producing an immune response or reaction, as well as to vaccines, kits, processes, cells and uses thereof. This invention more particularly relates to compositions and methods of using a synthetic viral particle to produce, modify or regulate an immune response in a subject. In a more preferred embodiment, the invention is based, generally, on compositions using synthetic viral particles as an adjuvant and/or vehicle to raise an immune response against selected antigen(s) or epitopes, in particular a cellular and/or a humoral immune response.

Claims

1. An immunogenic composition comprising a non-infectious synthetic retroviral particle comprising: a core comprising a polypeptide consisting of a self-assembling Gag protein of a particular retrovirus; and a lipid bilayer envelope comprising one or more selected peptide antigens heterologous to any retrovirus; wherein the one or more selected peptide antigens are exposed at the surface of the particle; wherein the non-infectious synthetic retroviral particle is devoid of any retroviral genome; and wherein the non-infectious synthetic retroviral particle is devoid of envelope protein of the particular retrovirus.

2. The immunogenic composition of claim 1, comprising at least about 10.sup.2 to about 10.sup.9 of the synthetic retroviral particles.

3. The immunogenic composition of claim 1, wherein the synthetic retroviral particle is devoid of envelope protein of any retrovirus.

4. The immunogenic composition of claim 1, wherein the particular retrovirus is an onco-retrovirus or a spumavirus.

5. The immunogenic composition of claim 4, wherein the particular retrovirus is not HIV.

6. The immunogenic composition of claim 1, wherein the one or more selected peptide antigen is a glycopeptide antigen.

7. The immunogenic composition of claim 2, wherein the one or more selected peptide antigen naturally comprises at least a portion of a transmembrane domain.

8. The immunogenic composition of claim 2, wherein the one or more selected peptide antigen comprises a synthetic peptide.

9. The immunogenic composition of claim 8, wherein the synthetic peptide is between 3 and 60 amino acids in length.

10. The immunogenic composition of claim 1, further comprising a pharmaceutically acceptable vehicle.

11. The immunogenic composition of claim 10, further comprising an adjuvant.

12. The composition of claim 1, wherein the composition induces an immune response to the one or more selected peptide antigens.

13. A method of stimulating an immune response in a subject, the method comprising steps of administering the immunogenic composition of claim 1 to a subject in need thereof.

14. The method of claim 13, wherein the immune response in the subject includes a humoral response.

15. The composition of claim 1, wherein the core consists of the polypeptide consisting of the self-assembling Gag protein.

Description

LEGEND TO THE FIGURES

(1) FIG. 1: Genetic Organization of MLV (FIG. 1A) and HIV (FIG. 1B) viral genomes. Open rectangles indicate the open reading frame of the gene/genes marked. Horizontal lines between rectangles in HIV-1 schema indicate segments removed by splicing. Arrows point to translation products indicated by light grey rectangles. Only the translation products dealt with by this section are shown. (A) The X indicates the interaction between the Vpr protein and the p6 region of the HIV-1 Gag. (B) The stop codon of MLV Gag protein is indicated. Suppression of this codon leads to synthesis of the Gag-Pol precursors.

(2) FIG. 2: Gag stop codon stem loop (SEQ ID NO: 7). Proposed RNA secondary structure around the gag-pol junction of Mo-MLV (from Jones et al., 1989). The sequences coding for NC and PR after protease cleavage are indicated. The Gag stop codon is underlined.

(3) FIG. 3: Construction of the Ceb-p6 Chimera

(4) FIG. 4: Expression of Gag-p6 chimeras and virion formation. Immunoblots lysates from cells expressing the Ceb constructs indicated (A) and of pellets of the viral supernatant from these cells (B). Results obtained from polyclonal series 2 are shown. Staining was performed using antibodies against the MLV capsid, p30, protein.

(5) FIG. 5: Schematic representation of synthetic retroviral envelope (5A) and gag (5B) proteins, genome (5C) and particles or according to this invention.

(6) FIG. 6: In vivo modulation of an immune response using synthetic retroviral particles.

(7) FIG. 7: Stimulation of CTL using synthetic envelope particles of this invention.

EXAMPLES

A—Incorporation of Foreign Nucleic Acids or Proteins in Synthetic Retroviral Particles

(8) A1. Materials and Methods

(9) A1.1. Insertion of HIV-1 p6 into the MLV Gag-Pol Precursor.

(10) The p6 coding sequence was inserted into the Ceb plasmid which expresses the Gag-Pol precursor and a blasticidine resistance marker using the MLV LTR (long terminal repeat) as promoter. This plasmid has been previously used to establish several stable packaging cell lines such as TELCeB6 and FLY using blasticidine selection (described in Cosset, 1995b). Briefly the plasmid consists of the LTR, the leader sequence deleted for the encapsidation signal ψ and the polyadenylation signal from the MLV strain FB29. The Gag-Pol coding sequence has been obtained from MoMLV. The bsr (blasticidine) resistance marker was inserted 74 nucleotides downstream of the pol stop codon. Although the level of Gag-Pol expression in stable populations of mammalian cells is very high, Ceb was constructed using the low copy number pBR322 plasmid. Thus, of the gag-pol sequence was transferred into a high copy number plasmid, bluescript SK, to facilitate the cloning procedure. A segment of the MLV Gag-Pol coding sequence, from the XhoI site in the beginning of gag (position 1668) to the XbaI site in the integrase coding sequence (position 5437), was excised and cloned into the XhoI-XbaI digested SK plasmid. This cloning intermediate was named SK-Ceb.

(11) The cloning procedure consisted of insertion of several fragments at once since the number of unique sites in the Ceb sequence and backbone plasmid was limited (FIG. 3). The first step consisted of introducing the required enzyme restriction sites as well as the protease recognition DNA sequences using PCR with appropriately designed primers. The sequences targeted as well as the restriction sites introduced by each primer are shown in FIG. 3A.

(12) The NC coding sequence was modified using 5′ primer A and 3′ primer B. Primer A hybridizes in the NC DNA at the PvuI site at position 2228 of Ceb. Primer B hybridizes to the DNA at the junction between NC and PR and introduces a XbaI restriction site at the sequence coding for the amino acids at positions P2′ and P3′ of the protease cleavage site. The 100 base pair PCR product was named ABNC.

(13) The protease coding sequence was amplified using 5′ primer C and 3′ primer D. Primer C hybridizes to the DNA at the junction between NC and PR and introduces a PvuI site followed by an AatII site at the sequence encoding the amino acids at position P2 and P3 of the protease cleavage site. Primer D hybridizes in the PR DNA sequence at the BclI site located at position 2848 of Ceb. The 500 base pair fragment was named CDPR.

(14) The p6 coding sequence was amplified using the 5′ primer E and the 3′ primer F. Primer E hybridizes to the 5′ of p6 DNA (downstream from codon 5) and introduces 10 nucleotides coding for the amino acids at positions P2′, P3′ and P4′ of the protease cleavage site and a XbaI restriction site. Primer F hybridizes to the 3′ end of the p6 DNA (upstream from codon 48) adding 11 nucleotides coding for amino acids at positions P1, P2 and P3 of the protease cleavage site and an AatII restriction site. The 100 base pair PCR product was named EFp6.

(15) Thus, upon ligation of the 3′ end of ABNC PCR product to the 5′ end of EFp6 PCR product the protease cleavage site is reconstituted between NC and p6. Similarly, ligation of the EFp6 PCR product to the CDPR PCR product reconstitutes the same protease cleavage site between p6 and PR.

(16) The DNA sequence of each primer was:

(17) TABLE-US-00002 primer A, NC: (SEQ ID NO: 1) 5′-CGAAGGAGGTCCCAACTCGA-3′ primer B, NC: (SEQ ID NO: 2) 5′-CGATTGTTAACTCTAGAGTCAGGAGGGAGGTCTGGGGTCTTG-3′ primer C, PR: (SEQ ID NO: 3) 5′CGATTCGATCGCCCCAGACGTCCCTCCTGACCCTAGATGACTAGGGAG GT-3′ primer D, PR: (SEQ ID NO: 4) 5′-ACGGGGGTAGAGGTTGCTTT-3′ primer E, p6: (SEQ ID NO: 5) 5′-TGACTCTAGATGACCCAGAGCCAACAGCCCCACCAGAAGAGAGCT T-3′ primer F, p6: (SEQ ID NO: 6) 5′-GCATTGTTAACGACGTCTCGCTGCCAAAGATCTGCGGGAAGCTAAA GGATACAG-3′

(18) The second step of cloning consisted of inserting CDPR into the SK-Ceb plasmid (FIG. 3B.1). The CDPR PCR product was digested with PvuI and BclI. The KS-Ceb plasmid was digested with XhoI and PvuI to produce a 560 bp fragment and with BclI and XbaI to produce a 2589 bp fragment. The three fragments were then ligated into SK-Ceb vector digested with XhoI and XbaI, generating the SK-Ceb-CDPR cloning intermediate.

(19) The third step (FIG. 3B.2) involved the insertion of the other two PCR products, ABNC and EFp6, into the SK-Ceb-CDPR plasmid. The ABNC PCR product was digested with PvuI and XbaI and the EFp6 with XbaI and AatII. The two fragments were mixed with the XhoI-PvuI fragment from SK-Ceb (FIG. 3B.1) and then ligated into the SK-Ceb-CDPR plasmid, digested with XhoI and AatII. The DNA sequence of this cloning intermediate, referred to as KS-Ceb-p6 was verified by DNA sequencing.

(20) Finally the XhoI-SacII fragment from SK-Ceb-p6, containing the p6 sequence, was cloned into the original Ceb expression plasmid resulting in the construct named Ceb-p6, depicted in FIG. 3C.

(21) To construct the chimera containing the p6 mutant the p6 sequence was amplified using primers E and F2. The F2 primer is identical to the F primer except that it introduces a single nucleotide change which results in the change of amino acid Leu 44 to Phe. The PCR product was digested with XbaI and AatII, mixed with the XhoI-XbaI fragment containing ABNC from SK-Ceb-p6 and ligated into the SK-Ceb-CDPR, digested with XhoI and AatII. The DNA sequence was confirmed by sequencing. The p6L/F containing fragments was then cloned into the Ceb plasmid using the XhoI and SacII sites as with Ceb-p6. This plasmid was named Ceb-p6L/F.

(22) A1.2. Cell Lines.

(23) The TELFBASAF cell line was used for transfections of the wild-type and chimeric Ceb plasmids (Cosset et al., 1995b). This cell line consists of a polyclonal cell population derived from TE671 cells after phleomycin selection and expresses an amphotropic retroviral envelope and a retroviral lacZ vector. The amphotropic envelope expression plasmid consisted of the sequence coding for the 4070A envelope glycoprotein and a phleomycin resistance marker. The lacZ vector has been previously described (Ferry et al., 1991).

(24) TE671 cells used for infection assays are human rhabdomyosarcoma cells (ATCC CRL 8805).

(25) All cells were grown in DMEM (Life-Technologies) supplemented with 10% fetal bovine serum (Life-Technologies).

(26) A1.3. Transfection and Selection.

(27) For each plasmid, Ceb, Ceb-p6L/F and Ceb-p6, 3 μg/well were transfected by calcium precipitation (Cosset et al., 1995b) into TELFBASAF cells, seeded at 30% confluence in six-well plates. Cells were grown for 48 hours and then harvested, diluted and placed under blasticidine selection (36 μg/ml). Colonies were observed after three weeks at which point they were pooled. Cells were subsequently cultured in normal medium supplemented with blasticidine (36 μg/ml) and phleomycin (10 μg/ml). The process was repeated and three different series of polyclonal cell populations were established.

(28) A1.4. Immunoblot Analysis.

(29) Virus producer cells were harvested with versene (Life Technologies) washed with PBS and lysed in a 20 mM Tris-HCl buffer (pH 7.5) containing 1% Triton-X100, 0.05% SDS, 5 mg/ml sodium deoxycholate, 150 mM NaCl, and 1 mM PMSF. Lysates were incubated for 10 min at 4° C. and were centrifuged for 10 min at 10,000×g to pellet the nuclei. Supernatants were then frozen at −70° C. until further analysis. Virus samples were obtained by ultracentrifugation of culture supernatants (5 ml) in a SW41 Beckman Rotor (30,000 RPM, 1 hr, 4° C.). Pellets were suspended in 50 μl of PBS (phosphate buffered saline), and frozen at −70° C. Samples (30 μg for cell lysates, or 20 μl for purified viruses) were mixed 5:1 (vol:vol) in a 375 mM Tris-HCl (pH 6.8) buffer containing 6% SDS, 30% β-mercapto-ethanol, 10% glycerol, and 0.06% bromophenol blue, boiled for 3 min, then run on 10% SDS acrylamide gels. After protein transfer onto nitrocellulose filters, immunostaining was performed in TBS (Tris buffered saline, pH 7.4) with 5% milk powder and 0.1% TWEEN. The blots were probed with the relevant antibody and developed using HRPO-conjugated Ig (immunoglobulins) raised against the species of each primary antibody (DAKO, UK) and an enhanced chemiluminescence kit (Amersham Life Science).

(30) The anti-CA (Quality Biotech Inc, USA), a goat antiserum raised against the Rauscher leukemia virus p30 capsid protein (CA), was used diluted 1/10,000.

(31) A1.5. Infection Assays.

(32) Virus-containing supernatants were harvested after overnight production from freshly confluent Gag, Gag-p6L/F or Gag-p6 expressing cells, from the three different series of stables. Target TE671 cells were incubated with serial dilutions of the viral supernatant for 3-5 hours in the presence of polybrene (4 μg/ml). Infected cells were grown for 48-72 hours and stained for β-galactosidase expression.

(33) A2. Results

(34) A2.1. Establishment of Packaging Cell Lines Using Ceb-p6 Expression Plasmids.

(35) The Ceb-p6, Ceb-p6L/F as well as the original Ceb expression plasmids were transfected into the TELFBASAF cell line, expressing the amphotropic MLV envelope and an nlslacZ retroviral vector. Following transfection, blasticidine resistant cells were pooled. Three independent series of stable producers were generated.

(36) Expression of the chimeric Gag-p6 proteins was determined by immunoblot analysis of the cell lysates, using a polyclonal goat serum against the p30 capsid protein (FIG. 4A). This serum interacts with both the fully processed p30 as well as with the Gag precursor and any processing intermediates that contain p30. The results obtained using the polyclonal cell population series 2 are shown in FIG. 4, but similar results were obtained with the other series. The expression of the Gag precursor in cells transfected with Ceb-p6 and Ceb-p6L/F was higher than that obtained in Ceb transfected cells. As expected, the Gag-p6 and Gag-p6L/F precursors migrated more slowly than the Ceb precursor. The size difference corresponds to the size of p6 confirming the presence of this protein in the Gag precursor.

(37) A band migrating closely to the wild-type MLV Gag precursor was also observed, intermediate 1. A similar band, but fainter, was observed with the wild-type MLV Gag. This band could correspond to processing intermediate of Gag, lacking NC and p6, that is more abundant in the case of the MLV Gag-p6 chimeras.

(38) A difference in size between other processing intermediates was observed. In wild-type Ceb, a band was obtained that migrates close to 45 kD, intermediate 2. In the case of the Ceb-p6 and Ceb-p6L/F this band increased in size, suggesting that p6 remains associated with this intermediate. From the estimated size of the band, this could correspond to a cleavage product containing CA-NC in the case of the wild-type MLV Gag and CA-NC-p6 in the case of the MLV Gag-p6 chimeras.

(39) Finally, the level of fully processed intracellular capsid p30 protein was similar in the case of wild-type Gag and chimeric Gag-p6L/F but reduced in the case of the Gag-p6 chimera. For the latter chimera, a band migrating slower was more intense than in the other samples, intermediate 3. The size of the band corresponds to a product containing to CA and NC domains since it is also obtained with wild-type Gag at lower levels (see discussion).

(40) Overall the data suggest that the presence of p6 does not interfere with Gag precursor expression, however, p6 seems to enhance processing of the Gag precursors within the cells.

(41) A2.2. Retroviral Particle Formation.

(42) The production of retroviral particles was analyzed by immunoblot analysis of the pellets obtained after ultracentrifugation of the supernatant from producer cells, using the anti-p30 antibody (FIG. 4B). Virion production from cells expressing Gag-p6L/F was reduced by about 2 fold as compared to that from wild-type Gag expressing cells. The yield of virions obtained from the Ceb-p6 expressing cells was further reduced. This is unlikely to reflect a processing defect in the two chimeras within the virions since their processing within cells is enhanced. Indeed, as the processing intermediates of the Gag-p6 chimeras observed in cell lysates are more abundant than those of wild-type Gag (FIG. 4A), the reduced virion yield could be due to premature processing inside the cell.

(43) The virion yield obtained using the Gag-p6 chimeras was lower than the wild-type Gag but readily detectable (FIG. 4B), suggesting that the insertion of p6 into the MLV Gag was successful, in that it did not inhibit particle formation. Furthermore the virions produced are fully processed.

(44) A2.3. Infectivity of the Chimeric Retroviruses.

(45) To determine whether the produced retroviral particles were infectious, infection assays were carried out on TE671 cells expressing the PiT-2 amphotropic MLV receptor. Results obtained with the three different series of stable cell lines are shown (Table 1).

(46) TABLE-US-00003 TABLE 1 Infections assays for retroviruses produced from TELFBASAF cells stably expressing Ceb, Ceb-p6L/F or Ceb-p6 plasmids. stable polyclonal Plasmid expressed in TELFBASAF cells cells Ceb Ceb-p6L/F Ceb-p6 series 1 >10.sup.6 1.4 × 10.sup.4 3 × 10.sup.3 series 2 >10.sup.6   4 × 10.sup.4 2 × 10.sup.4 series 3 4 × 10.sup.6 2.5 × 10.sup.5 1.9 × 10.sup.5  

(47) Infection assays on TE671 cells. Titers as lacZ i.u./ml. For details see Materials and Methods.

(48) The retroviruses produced from cells expressing the chimeric Gag proteins were infectious with titers reaching the order of 10.sup.5 i.u./ml. On average Gag-p6 expressing cells produced 2 fold lower titers of virus than did Gag-p6L/F expressing cells. In turn viruses from the Ceb-p6L/F expressing cells produced lower titers than did Ceb expressing cells. This difference varied between the different series and was associated with the level of Gag or Gag-p6 expressed in the cells. It is likely that, as polyclonal cell populations were studied, these differences arise due to variation between the total amount of Gag-expressing cells in each series. The differences in titer between each of the chimeric Gag virions and the wild-type Gag virions correlates with the difference in the levels of p30 detected in immunoblots. Therefore, if p6 is associated with the MLV virions, it does not interfere with their infectivity.

(49) A3. Discussion

(50) These results demonstrate that it is possible to insert small proteins into the MLV Gag-Pol precursor without inhibiting processing and assembly into infectious particles. Specifically, an (MLV) Gag-(HIV-1) p6 chimera was efficiently expressed and proved capable of assembling into virions. The proteolytic processing by the viral protease after virion budding proceeds normally, as shown by the immunoblot analysis on purified virions, and by the infectivity of these particles.

(51) The Intracellular Processing of the Gag-p6 Chimeras is Enhanced Compared to that of Wild-Type MLV Gag.

(52) The quantity of virions produced using the Gag-p6 chimeras was lower than that using the wild-type Gag which correlates with the decreased infectious titers obtained. This could be due to the enhanced premature processing of the chimeric Gag precursors within the cell, as judged by the abundance of processing intermediates in the cell lysates compared to those obtained with the wild-type MLV Gag. The exact mechanism of retroviral protease activation is not known, although it is linked to assembly and budding (see general introduction). It has been shown that when the Gag-Pol precursors are overexpressed in cells, premature processing is induced resulting in lower virus yields (Karacostas et al., 1993; Park and Morrow, 1991). Since the Gag-p6 precursors are expressed in higher amounts than the wild-type MLV Gag proteins, this could account for the increased intracellular processing observed.

(53) In HIV-1 full length clones, p6 has been shown to be required for efficient particle release (Gottlinger et al., 1991; Huang et al., 1995). p6 appears to act late during budding and its effect is linked to the viral protease function (Huang et al., 1995). Indeed, inactivation of the HIV-1 protease by mutagenesis (Huang et al., 1995) or expression of HIV-1 Gag in the absence of other viral proteins (Lu et al., 1993; Paxton et al., 1993; Royer et al., 1991), alleviated the requirement of p6 for budding. In this example, the MLV protease was active and thus, it might be possible that p6 has an effect on MLV protease as it does in the HIV-1 context (Huang et al., 1995). Alternatively, fusion of p6 to the MLV Gag precursor might affect the conformation of the polyprotein, thereby altering its processing by the viral protease. Likewise, in the context of HIV-1, Gag removal or mutagenesis of p6 has been suggested to change the Gag protein conformation (Royer et al., 1991).

(54) Although both the Gag-p6 and Gag-p6L/F precursors exhibit similar amounts of intracellular processing, certain processing intermediates appear more abundant in the Gag-p6 context as compared to the Gag-p6L/F. Processing of the Gag precursor proceeds in an ordered manner, dictated by the amino acid sequence differences at the cleavage sites and their accessibility to the viral protease (Pettit et al., 1994; Tritch et al., 1991). Effects on the order of processing were also observed in HIV-1 Gag, where mutagenesis of p6 resulted in a reduced rate of cleavage between certain Gag proteins (Huang et al., 1995). This observation is compatible with an effect of p6 either directly on the protease or on Gag precursor conformation that, in turn, alters processing. Mutations within the HIV-1 and RSV Gag precursor that alter the order of processing of the protein result in reduced particle release (Bowles et al., 1994; Tritch et al., 1991). Thus, modified processing of the Gag-p6 protein precursor could explain the even lower particle yield of the Gag-p6 compared to the Gag-p6L/F. Thereby, mutation of the p6 Leu44 to Phe appears to modify the effect of p6 on the cleavage of the MLV Gag. In contrast, mutations in this region of p6 in the context of HIV-1 Gag, had little or no effect on particle release and the ‘effector’ region was identified at the N-terminus of p6 (Huang et al., 1995).

(55) The enhanced intracellular processing of Gag-p6 is useful in determining the sequence of the Gag precursor cleavage events, based on size differences between intermediates containing p6 and the wild-type Gag equivalents. In agreement with previously reported findings (Maxwell and Arlinghaus, 1981; Yoshinaka and Luftig, 1982), the pp12-CA site appears to be processed early during assembly and budding (Intermediate 2, FIG. 4). The CA N-terminus was also reported to be rapidly processed in other viruses, such as HIV-I and RSV release (Tritch et al., 1991; Bowles et al., 1994). The increased and potentially modified processing of the Gag-p6 polyprotein reveals a processing intermediate that is present only at a very low level in the wild-type MLV Gag context (Intermediate 3, FIG. 4). The size of this product corresponds to a polypeptide containing CA and part of NC, or part of CA and part of NC. Previous studies have identified a product containing both CA and NC epitopes within purified MoMLV viral particles (Meyer et al., 1995). The site of cleavage appears to lie within the C-terminus of CA, upstream of the CA-NC junction (Meyer et al., 1995). Although the size of the product found in those studies was lower (about 12KD), than the product we observe (about 34KD), the presence of both products appears associated with high activity of the viral protease which suggests that they are present late in budding. Thus the 31KD protein observed here might be the result of activation of an alternative protease cleavage site within CA or NC or both. It would be interesting to determine whether we also obtain a 12KD intermediate. We will perform further immunoblot analysis using antibodies recognizing other Gag proteins, such as NC and MA, so as to determine in more detail the composition of the different intermediates observed.

(56) Other Possible Effects of p6 on MLV Particle Assembly.

(57) It has been recently reported that mutations within HIV-1 p6 affected envelope glycoprotein incorporation into particles (Ott et al., 1999). Although we have not confirmed the total amount of the MLV envelope glycoprotein in the Gag-p6, Gag-p6L/F derived particles as compared to the wild-type Gag equivalent, we think it is unlikely that p6 affects the amphotropic envelope incorporation. Firstly, in the same study (Ott et al., 1999) the p6 mutants could be complemented with envelope glycoproteins from VSV and MLV but not by a truncated HIV-1 envelope, showing that the effect was specific for HIV-1 glycoproteins. Secondly, the reduced infectious titers obtained with the Gag-p6 derived particles correlate well with the reduced amounts of total virion production as determined by immunoblots using the anti-CA serum. Thus, it is likely that presence of p6 in the MLV Gag precursor does not affect the incorporation of the MLV envelope glycoprotein into the virions, although immunoblot analysis is required to conclude this definitely.

(58) Recent studies have shown than ubiquitin is covalently attached to the p6 protein of HIV and SIV Gag precursors (Ott et al., 1998). Ubiquitin was also detected in MLV virions associated with the pp12 protein (Ott et al., 1998), as well as ALV particles, although it was not found to be associated with ALV Gag (Putterman et al., 1990). The role of this protein in virions has not been determined but its association with p6 raises the possibility that it might be involved in late steps of assembly and budding (Ott et al., 1998). In the chimeric Gag-p6 construct the presence of both pp12 and p6 proteins might increase the ubiquination of the Gag-p6 precursor and this might also interfere with budding of the chimeric virions.

(59) Other Gag-Peptide/Nucleic Acid Fusions.

(60) Although this example discloses specifically the incorporation of a p6 peptide in the MLV synthetic retroviral particle, the teaching of the invention is more general and provides a novel approach to incorporate peptides, polypeptides or nucleic acids into viral particles. In this regard, any nucleic acid encoding a peptide or polypeptide of between 3 and 100 amino acids, even more preferably between 3 and 70 amino acids can be inserted in the gag-fusion of this invention. Also, as indicated above, the fusion may contain a protease cleavage site, to release to inserted polypeptide sequence upon expression of the fusion molecule, or may not contain such a site.

B—Use of a Synthetic Retroviral Particle to Produce an Immune Response In Vivo

(61) The immunogenicity of synthetic retroviral particles presenting a synthetic viral envelope protein has been demonstrated in vivo, following injection thereof into mice. The synthetic envelope protein is the glycoprotein (GP) of the LCMV virus, whose principal epitope is the GP33-41 epitope, presented by the histocompatibility molecules H-2D.sup.b. The particles immunogenicity has been determined in CR-transgenic C57BL/6 mice (H-2D.sup.b), whose CD8 T lymphocytes express a T receptor (TCR Vα2 V138) specific for the GP33-41 epitope. The activation status of the transgenic CD8 T lymphocytes has been measured on the basis of CD44 (Pgp-1) and CD45RB surface markers expression. In the GP-LCMV retrovirus-infected mice, the GP33-41-specific T lymphocytes present a phenotype characteristic of effector cells (expressing both the CD44 and CD45RB markers at high levels), seven days post infection.

(62) The synthetic retroviral particles have been produced from the packaging cell line H293-341-LCMV.GP. H293-341-LCMV.GP derives from the human embryonic kidney cell line H293 (ATCC: CRL-1573) by transfection with plasmid pNp3189 containing the Moloney (Mo-MLV) Gag and Pol coding sequences, then with plasmid phCMV-LCMV.GP; and selection for resistance to both blasticidine and neomycine. The selected clones were cultured in production media (DMEM), free of serum, for 24 hours, and the supernatant was collected and filtered, prior to injection.

(63) In this experiment, 500 μl of non-concentrated supernatant have been injected intraperitoneally into 2-3 weeks old TCR-transgenic mice. Control mice received injection of supernatant of clones H293-341. Seven days post injection, blood and spleen samples were collected, immunolabeled (using 2.10.sup.6 cells), and analysed by flux cytometry. The percentages of cells having a naïve (CD44.sup.lo CD45RB.sup.hi) effector (CD44.sup.hi CD45RB.sup.hi) or memory (CD44.sup.hi CD45RB.sup.lo) phenotype have been determined and are disclosed in the Table 2 below for the CD8.sup.+ TCR Vα2 T cell population (see also FIG. 6.

(64) TABLE-US-00004 TABLE 2 CD8.sup.+ TCR Vα2 T cells phenotype Production CD44.sup.lo (naïve) % CD44.sup.hi effector-memory H293-341 57.6 37.6 H293-341-LCMV.GP 24.5 63.9
These results show that the synthetic retroviral particles presenting at their surface the synthetic LCMV glycoprotein have the ability to induce an immune response in vivo, directed against the viral GP33-41 epitope, efficiently recognized by corresponding Ag-specific T cells.

C—Immunogenic Composition Comprising a Modified Envelope Protein

(65) The dominant epitope GP.sub.33-41 of the LCMV env was subcloned into the amphotrope MLV env 4070A. The recombinant plasmid comprising this chimeric envelope gene with the inserted LCMV epitope was transfected into the fibroblast cell line MC57. Proper expression and presentation of the epitope was assayed in a cytotoxic T-lymphocyte (CTL) assay. For that purpose, a mouse was immunized with the above peptide epitope and, at day 3, the spleen cells were collected for the CTL assay. The CTLs were mixed with the transfected fibroblasts, and lysis of target cells was measured. Negative and positive controls were assayed in parallel. The results presented on FIG. 7 show an effective lysis of epitope-presenting cells. This demonstrates, for the first time, that in this context an epitope incorporated into a retroviral envelope can be properly processed and recognized by the immune system.