USE OF THE RD29 PROMOTER OR FRAGMENTS THEREOF FOR STRESS-INDUCIBLE EXPRESSION OF TRANSGENES IN COTTON

Abstract

In one aspect, the present application discloses a chimeric gene comprising (a) a first nucleic acid sequence comprising at least 400 consecutive nucleotides of SEQ ID NO: 1 or SEQ ID NO: 2 or a nucleic acid sequence having at least 80% sequence identity thereto any of which confers stress inducibility on said chimeric gene; (b) a second nucleic acid sequence encoding an expression product of interest, which is involved in the response of a cotton plant to stress; and optionally (c) a transcription termination and polyadenylation sequence. In another aspect, the application discloses a cotton plant cell comprising (a) a chimeric gene comprising a first nucleic acid sequence comprising at least 400 consecutive nucleotides of SEQ ID NO: 1 or SEQ ID NO: 2 or a nucleic acid sequence having at least 80 sequence identity thereto any of which confers stress inducibility on said chimeric gene; (b) a second nucleic acid sequence encoding an expression product of interest; and optionally (c) a transcription termination and polyadenylation sequence. In addition, the present application discloses a cotton plant, a method of expressing a transgene in cotton under stress conditions, a method of producing a cotton plant, a method of detecting the expression of a transgene under stress conditions and a method for modulating the resistance of a cotton plant to stress as characterized in the claims.

Claims

1. (canceled)

2. A cotton plant cell comprising a chimeric gene comprising (a) a first nucleic acid sequence comprising at least 400 consecutive nucleotides of SEQ ID NO: 1 or SEQ ID NO: 2 or a nucleic acid sequence having at least 80% sequence identity thereto any of which confers stress inducibility on said chimeric gene; (b) a second nucleic acid sequence encoding an expression product of interest; and optionally (c) a transcription termination and polyadenylation sequence.

3. The cotton plant cell of claim 2, wherein said expression product of interest is (a) a protein or peptide which is involved in the response of a cotton plant to stress or (b) an RNA molecule capable of modulating the expression of a gene comprised in said cotton plant, wherein said gene comprised in said cotton plant is involved in the response of said cotton plant to stress.

4. The cotton plant cell of claim 3, wherein said protein optionally involved in the response of a cotton plant to stress is selected from NPT 1, PNC 1, NMA 1, NMA2, Los5 and proteins involved in oxidative stress such as selected from choline oxidase, superoxide dismutase and ascorbate peroxidase.

5. The cotton plant cell of claim 3, wherein said gene optionally involved in the response of a cotton plant to stress is selected from NPT 1, PNC 1, NMA 1, NMA2, PARP1, PARP2, Los5, FTA, FTB and genes involved in oxidative stress selected from choline oxidase, superoxide dismutase and ascorbate peroxidase.

6. The cotton plant cell of claim 3, wherein modulating is increasing and said second nucleic acid sequence encodes an RNA, which when transcribed (a) yields an RNA molecule capable of increasing the expression of a gene comprised in said cotton plant, said gene being selected from NPT 1, PNC 1, Los5, NMA 1 and NMA2 or (b) yields an RNA molecule capable of decreasing the expression of a gene comprised in said cotton plant, said gene being selected from PARP1, PARP2, FTA and FTB.

7. The the cotton plant cell of claim 3, wherein modulating is decreasing and said second nucleic acid sequence encodes an RNA, which when transcribed (a) yields an RNA molecule capable of increasing the expression of a gene comprised in said cotton plant, said gene being selected from PARP1, PARP2, FTA and FTB or (b) yields an RNA molecule capable of decreasing the expression of a gene comprised in said cotton plant, said gene being selected from NPT 1, PNC 1, Los5, NMA 1 and NMA2.

8. The cotton plant cell of claim 3, wherein said RNA molecule comprises a first and second RNA region wherein (a) said first RNA region comprises a nucleotide sequence of at least 19 consecutive nucleotides having at least about 94% sequence identity to the nucleotide sequence of said gene comprised in said cotton plant; (b) said second RNA region comprises a nucleotide sequence complementary to said 19 consecutive nucleotides of said first RNA region; and (c) said first and second RNA region are capable of base-pairing to form a double stranded RNA molecule between at least said 19 consecutive nucleotides of said first and second region.

9. The cotton plant cell of claim 2, wherein said first nucleic acid sequence comprises the nucleotide sequence of SEQ ID NO: 1 or SEQ ID NO: 2.

10. The cotton plant cell of claim 2, wherein said first nucleic acid sequence consists of SEQ ID NO: 1 or SEQ ID NO: 2.

11. The cotton plant cell of claim 2, wherein said stress is water stress, cold stress, high-salt stress or the application of ABA.

12. The cotton plant cell of claim 11, wherein said water stress is drought stress.

13. A cotton plant or seed thereof or cotton plant part comprising a chimeric gene comprising (a) a first nucleic acid sequence comprising at least 400 consecutive nucleotides of SEQ ID NO: 1 or SEQ ID NO: 2 or a nucleic acid sequence having at least 80% sequence identity thereto any of which confers stress inducibility on said chimeric gene; (b) a second nucleic acid sequence encoding an expression product of interest; and optionally (c) a transcription termination and polyadenylation sequence.

14. A cotton fiber obtainable from the cotton plant or seed thereof of claim 13.

15. A method of expressing a transgene in cotton under stress conditions comprising: (a) introducing or introgressing a chimeric gene comprising a first nucleic acid sequence comprising at least 400 consecutive nucleotides of SEQ ID NO: 1 or SEQ ID NO: 2 or a nucleic acid sequence having at least 80% sequence identity thereto any of which confers stress inducibility on said chimeric gene, a second nucleic acid sequence encoding an expression product of interest, and optionally a transcription termination and polyadenylation sequence into a cotton plant and growing the plant. (b) having said plant exposed to stress.

16. A method of producing a cotton plant comprising: (a) introducing or introgressing a chimeric gene comprising a first nucleic acid sequence comprising at least 400 consecutive nucleotides of SEQ ID NO: 1 or SEQ ID NO: 2 or a nucleic acid sequence having at least 80% sequence identity thereto any of which confers stress inducibility on said chimeric gene, a second nucleic acid sequence encoding an expression product of interest, and optionally a transcription termination and polyadenylation sequence; OR (b) growing the plant of claim 13 or growing a plant from the seed of claim 13.

17. A method of detecting the expression of a transgene under stress conditions comprising (a) providing the cotton plant cell of claim 2 or the plant of claim 13, wherein said expression product of interest is the transgene; (b) having the plant exposed to stress; (c) detecting the expression of the transgene.

18. A method for modulating the resistance of a cotton plant to stress comprising (a) introducing or introgressing into a cotton plant a chimeric gene comprising i. a first nucleic acid sequence comprising at least 400 consecutive nucleotides of SEQ ID NO: 1 or SEQ ID NO: 2 or a nucleic acid sequence having at least 80% sequence identity thereto any of which confers stress inducibility on said chimeric gene; ii. a second nucleic acid sequence encoding an expression product of interest which is optionally involved in the response of a cotton plant to stress; and optionally iii. a transcription termination and polyadenylation sequence; (b) having said chimeric gene expressed under stress conditions; wherein the resistance of the stress of the cotton plant comprising the chimeric gene is modulated in comparison with the resistance to stress of a wild-type cotton plant.

19. (canceled)

20. A method of expressing a transgene in cotton under stress conditions comprising: (a) growing the cotton plant of claim 13 or growing a plant from the seed of claim 13; (b) having said plant exposed to stress.

Description

THE FIGURES SHOW

[0140] FIG. 1: Pictures of the rd29::GUS transgenic cotton plants and wild type control under water stress conditions, relative soil water content (rswc) 10%.

[0141] FIG. 2: Expression profile of plants comprising rd29::GUS in comparison with wild-type plants. The expression level of the GUS gene from two independent rd29::GUS transgenic cotton plants designated 8901 and 6301 and wild type control was determined under water stress conditions. The GUS gene is not detected in the wild type control while the expression is detected in the two rd29::GUS cotton plants during water stress. The level of GUS expression returns to 0 after re-watering of the two rd29::GUS cotton plants.

[0142] FIG. 3: Expression analysis of leaf tissue of plants comprising the rd29a::PNC1 construct before and after application of drought stress.

SEQUENCE LISTING

[0143] SEQ ID NO: 1: RD29 promoter with one deletion

[0144] SEQ ID NO: 2: RD29 promoter

[0145] SEQ ID NO: 3: primer naste 8

[0146] SEQ ID NO: 4: primer naste9

[0147] SEQ ID NO: 5: vector pGEM-T

[0148] SEQ ID NO: 6: vector pNVS10

[0149] SEQ ID NO: 7: vector pNVS11

[0150] SEQ ID NO: 8: Primer pNVS11FW

[0151] SEQ ID NO: 9: Primer pNVS11RV

[0152] SEQ ID NO: 10: vector pNVS122

[0153] SEQ ID NO: 11: Primer naste 79

[0154] SEQ ID NO: 12: vector pNVS123

[0155] SEQ ID NO: 13: Primer naste75

[0156] SEQ ID NO: 14: Primer naste 80

[0157] SEQ ID NO: 15: vector pNVS124

[0158] SEQ ID NO: 16: vector pTIBE10 comprising RD29 promoter with one deletion

[0159] SEQ ID NO: 17: vector pTIBE28 comprising RD29 promoter

[0160] SEQ ID NO: 18: GUS reporter gene with intron

[0161] SEQ ID NO: 19: nucleic acid sequence of the 3′ CaMV 35S terminator

[0162] SEQ ID NO: 20: nucleic acid sequence encoding the 2mepsps selectable marker cassette

[0163] SEQ ID NO: 21: nucleic acid sequence of the GUS gene with intron comprising the CaMV 3′35S terminator

[0164] SEQ ID NO: 22: nucleic acid sequence encoding the PNC1 protein

[0165] SEQ ID NO: 23: nucleic acid sequence encoding the NMA1 protein

[0166] SEQ ID NO: 24: nucleic acid encoding a microRNA against PARP1

[0167] SEQ ID NO: 25: nucleic acid encoding a hairpin RNA against PARP2

[0168] SEQ ID NO: 26: nucleic acid encoding a hairpinRNA directed against farnesytransferase α (FTA)

[0169] SEQ ID NO: 27: nucleic acid encoding a hairpinRNA directed against farnesytransferase β (FTB)

[0170] SEQ ID NO: 28: nucleic acid sequence encoding the Los5 protein

[0171] The following examples illustrate the invention. It is to be understood that the examples do not limit the spirit and scope of the subject-matter disclosed herein.

EXAMPLES

[0172] Materials

[0173] Unless indicated otherwise, chemicals and reagents in the examples were obtained from Sigma Chemical Company, restriction endonucleases were from Fermentas or Roche-Boehringer, and other modifying enzymes or kits regarding biochemicals and molecular biological assays were from Qiagen, Invitrogen and Q-BIOgene. Bacterial strains were from invitrogen. The cloning steps carried out, such as, for example, restriction cleavages, agarose gel electrophores is, purification of DNA fragments, linking DNA fragments, transformation of E. coli cells, growing bacteria, multiplying phages and sequence analysis o f recombinant DNA, are carried out as described by Sambrook (1989). The sequencing of recombinant DNA molecules is carried out using ABI laser fluorescence DNA sequencer following the method of Sanger.

Example 1

Generation of Expression Constructs with a 933 bp Region from the rd29 Promoter (Comprising One Deletion) and a 934 bp Region from the rd29 Promoter, Respectively, Operably Linked to the GUS Reporter Gene

[0174] The 934 bp promoter region of the rd29a gene of A. thaliana, amplified from genomic Arabidopsis DNA using primer naste 8 5′ GCCCGGGCCATAGATGCAATTCAATCAAAC (SEQ ID NO: 3) and naste 9 5′GCGCTAGCCTCGAGTTAATTAAGATTTTTTTCTTTCCAATA (SEQ ID NO: 4) was cloned into the pGEM-T vector (SEQ ID NO: 5) resulting in the plasmid pNVS10 (SEQ ID NO: 6).

[0175] This plasmid contains 1 deletion in the rd29a promoter region compared to Yamaguchi-Shinozaki and Shinozaki (1994): one A missing at bp 3748.

[0176] At the 3′ end of the promoter region (i. e. in the 5′UTR) TCTTTGGAAA (SEQ ID NO:29) was changed into TCTTAATTAA (SEQ ID NO:30) to create a Pacl site for cloning reasons.

[0177] The CaMV 35S enhancer was added 3′ to the promoter region in pNVS10, resulting in pNVS11 (SEQ ID NO: 7).

[0178] For facilitating cloning of GOI with Ncol/Nhel, an Ncol site at the 5′ end of the rd29 promoter was eliminated, and a new Ncol site introduced at the 3′end of the rd29 promoter. This was done using primer pNVS11FW (5′CCTCATGACCATAGATGCAATTCAATCAAAC) (SEQ ID NO: 8) containing a BspHl site and pNVS11 RV (5′CCGCTAGCGCATCCATGGTCCAAAGATTTTTTTCTTTCAATAG) (SEQ ID NO: 9) containing an Ncol and Nhel site and pNVS11 as a PCR template. pNVS11 was digested with Ncol, Nhel, which cuts out the rd29a promoter region. The rd29 PCR product was cut with BspHl (compatible with Ncol) and Nhel. Ligation of the BspHl site into the Ncol site of the vector deleted the original Ncol site. Due to the sequence of the pNVS11Rv primer, an Ncol and an Nhel site were introduced behind the rd29a promoter, in front of the 3′ CaMV 35S. The resulting plasmid is pNVS122 (SEQ ID NO: 10).

[0179] To check if the deletion detected in the rd29 promoter resulted from sequencing errors in the TAIR database (The Arabidopsis Information Resource; http://www.arabidopsis.org/) sequence, or if it was due to a mistake in the original PCR fragment that was introduced to make pNVS10, 2 independent PCR reactions on genomic CTAB (cetrimonium bromide) DNA were performed, using the proofreading polymerase Phusion® with primers naste8 and naste9. Sequencing of PCR products showed that they did not have the deletion. To remove the deletion from pNVS122, a new primer naste 79 (5′CCGCTAGCGCATCCATGGTCCAAAGATTTTTTTCTTTCCAATAGAAGT) (SEQ ID NO: 11) was used in a PCR reaction, to replace primer pNVS11 RV. Using Phusion® polymerase, a PCR product was created with primers pNVS11FW and naste79 using genomic CTAB DNA as template. Both pNVS122 and the PCR product were cut with Spel and Ncol, and the correct PCR fragment was introduced into pNVS122 resulting in plasmid pNVS123 (SEQ ID NO: 12).

[0180] To facilitate further cloning in a T-DNA vector, an MCS-linker (Multiple Cloning Site) was introduced 5′ of the rd29a promoter. Primers naste75 5′-CATGCCCGGGCGCGCCTGTACAGCGGCCGCGAATTCGTTAACTCTAGAG CGATCGC-3′ (SEQ ID NO: 13) and naste80 5′-CCGGGCGATCGCTCTAGAGTTAACGAATTCGCGGCCGCTGTACAGGCG CGCCCGGG-3′ (SEQ ID NO: 14) were annealed, creating a linker with sticky ends. A 3-point-ligation was performed between a Pstl-Ncol fragment of pNVS11 +the sticky-end linker +an Eagl-Pstl fragment of pNVS123. The sticky end at the 5′ end of the linker is a CATG(C) overhang, which anneals to the Ncol site, but this ligation abolishes the Ncol site in the resulting plasmid pNVS124 (SEQ ID NO: 15).

[0181] Generation of the Expression Vectors:

[0182] The rd29a promoter comprising one deletion was amplified from pNVS11 and was cloned for one step cloning in an intermediate vector.

[0183] The rd29 promoter fragment with one deletion (SEQ ID NO: 1), the GUS gene with intron (SEQ ID NO: 18) and the 3′ CaMV 35S terminator (SEQ ID NO: 19) were assembled in a backbone vector which contains the 2mepsps selectable marker cassette (SEQ ID NO: 20) to result in expression vector pTIBE10 (SEQ ID NO: 16).

[0184] Expression vector pTIBE28 (SEQ ID NO: 17) contains the Spel-Ncol rd29a promoter without deletion (comprising SEQ ID NO: 2) linked to the Nhel-Ncol GUS gene with intron and the CaMV 3′35S terminator (SEQ ID NO: 21). Both fragments, i. e. GUS-3′35S terminator and Spel-Ncol rd29a promoter were assembled in a a vector which contains the 2mepsps selectable marker resulting in pTIBE28 (SEQ ID NO: 17).

Example 2

Generation of Transgenic Plants Comprising rd29-GUS

[0185] In a next step the recombinant vector comprising the expression cassettes of example 1, i. e. vectors pTIBE10 and pTIBE28, were used to stably transform Gossypium hirsutum coker 312 using the embryogenic callus transformation protocol.

[0186] Control plants are null segregants of the Gossypium hirsutum coker 312 rd29-GUS transgenic lines.

Example 3

Drought Stress Inducibility of rd29::GUS

[0187] β-glucuronidase activity of plants transformed with pTIBE28 was monitored in planta with the chromogen ic substrate X-Gluc (5-bromo-4-Chloro-3-indolyl-β-D-glucuronic acid) during corresponding activity assays (Jefferson R A et al (1987) EMBO J. 20;6(13):3901-7). For determination of promoter activity plant tissue is dissected, embedded, stained and analyzed as described (e.g., Pien S. et al (2001) PNAS 98(20):11812-7), Thus, the activity of beta-glucuronidase in the transformed plants was witnessed by the presence of the blue color due to the enzymatic metabolism of the substrate X-Gluc.

[0188] After growing the plants for about 30 days with sufficient water supply plants were subjected to drought stress by not watering them any more.

[0189] Expression of the GUS reporter gene was monitored over 5 days, re-watering taking place on day 5.

[0190] After five days of drought stress, stressed plants were significantly smaller than non-stressed plants (see FIG. 1).

[0191] FIG. 2 shows the expression profile of two plant lines comprising rd29::GUS from pTIBE28 in comparison with wild-type plants.

[0192] As apparent from the figure, both transgenic lines expressed the GUS reporter gene under control of the rd29 promoter under drought stress conditions. Expression is abolished upon re-watering the plants. Thus, the rd29 promoter may be used for expression of genes under stress conditions.

Example 4

Expression of Chimeric Genes Comprising rd29 do not Impair Fertility and Plant Vigor

[0193] The PNC1 (SEQ ID NO: 22), NMA1 (SEQ ID NO: 23) and Los5 (SEQ ID NO: 28) genes as well as a nucleic acid encoding a micro RNA directed against the PARP1 gene (miPARP1) (SEQ ID NO: 24) and a hairpin construct against the PARP2 gene (SEQ ID NO: 25) were placed under control of the rd29a promoter. The resulting constructs were individually transformed into cotton and plants regenerated. Cotton T0 plants containing the chimeric genes were fertile and produced viable T1 seeds. A germination test with the T1 seeds gave between 90 and 100% germination (20 seeds were sown and scored for germination, all T1 plants had a normal vigor). From the T1 plants no fertility issue was observed, the homozygous and azygous plants produced more than 400 T2 seeds per plants. A germination test with the T2 seeds gave between 80 and 100% germination (15 to 20 seeds were sown and scored for germination, all T2 plants had a normal vigor)

TABLE-US-00001 a Number of seeds Event Gener- Geno- generated % Construct T0 ation type per plants germination Rd29a:PNC1 04801 T1 Hh 162 100 Rd29a:PNC1 04801 T2 HH 938 90 Rd29a:PNC1 04801 T2 hh 868 100 Rd29a:PNC1 02501 T1 Hh 166 100 Rd29a:PNC1 02501 T2 HH 524 90 Rd29a:PNC1 02501 T2 hh 529 100 rd29a:miRPARP1 10701 T1 Hh 156 100 rd29a:miRPARP1 10701 T2 HH 582 90 rd29a:miRPARP1 10701 T2 hh 544 100 rd29a:miRPARP1 01901 T1 Hh 203 95 rd29a:miRPARP1 01901 T2 HH 567 100 rd29a:miRPARP1 01901 T2 hh 536 80 rd29aNMA1 02102 T1 Hh 653 100 rd29aNMA1 02102 T2 HH 616 100 rd29aNMA1 02102 T2 hh 586 93 rd29aNMA1 02204 T1 Hh 619 100 rd29aNMA1 02204 T2 HH 499 100 rd29aNMA1 02204 T2 hh 512 100 b Number of seeds Gener- Geno- generated % Construct Event ation type per plants Germination Rd29a:LOS5 00801 T0 Hh 352 95 Rd29a:LOS5 006901 T0 Hh 337 95 Rd29a:LOS5 10901 T0 Hh 327 95 Rd29a:hpPARP2 01901 T0 Hh 310 90 Rd29a:hpPARP2 02203 T0 Hh 375 100 Rd29a:hpPARP2 06202 T0 Hh 311 95 Table 1a and b: fertility of T1 and T2 cotton plants comprising a chimeric gene according to the invention, a: six plants per construct examined; b: three plants per construct examined

Example 5

Drought Stress Inducibility of a rd29::PNC1 Chimeric Gene

[0194] Plants comprising a chimeric gene comprising the PNC1 coding sequence were made as described above. Initially, the plants were watered 2 times per week. Drought stress (no watering for five days) was applied to three three week old plants (pncl 1-1, pncl 1-2, and pncl 1-3). The PNC1 expression level was quantified before and after drought stress of the three rd29a::PNC1 plants transformed with the chimeric gene.

[0195] Leaf tissue was harvested from each rd29a::PNC1 plant before and after drought stress and assayed for PNC1 expression level using the quantitative PCR (qPCR) (see FIG. 3). Three normally watered plants comprising the chimeric gene were used as base l ine to calculate variation. After drought stress the transgenic plant showed a 2 to 3 fold increase of the PNC1 expression level compared to the non-stressed transgenic plants.

[0196] Plants comprising the other chimeric genes as indicated in table 1 are examined for stress inducibility as described above. It is shown that expression of the genes is induced after application of drought stress.

Example 6

Expression of Further Chimeric Genes According to the Invention in Cotton

[0197] Plants comprising a chimeric gene comprising a nucleic acid sequence encoding a hairpin construct directed against farnesyltransferase a (SEQ ID NO: 26) and farnesyltransferase β (SEQ ID NO: 27) were made and grown in the greenhouse.

[0198] The plants are shown to be fertile. Plants are examined for stress inducibility as described above. It is shown that expression of the genes is induced after application of drought stress.

REFERENCES

[0199] Ackerson, R. C. (1982). Synthesis and Movement of Abscisic Acid in Water-Stressed Cotton Leaves. Plant Physiol 69, p. 609-613.

[0200] Ahmad et al. (2010). Simultaneous expression of choline oxidase, superoxide dismutase and ascorbate peroxidase in potato plant chloroplasts provides synergistically enhanced protection against various abiotic stresses. Physiol. Plant. 138 (4), p 520-533.

[0201] Allen, R. D. (2010). Opportunities for Engineering Abiotic Stress Tolerance in Cotton Plants; in Biotechnology in Agriculture and Forestry, Springer Verlag, Berlin, p: 127-160.

[0202] Behnam et al. (2007). Arabidopsis rd29A::DREB1A enhances freezing tolerance in transgenic potato. Plant Cell Rep, p. 1275-1282.

[0203] Braasch and Corey (2001). Locked nucleic acid (LNA): fine-tuning the recognition of DNA and RNA. Chem Biol 8(1), p. 1-7.

[0204] Carrington & Freed 1990. Cap-independent enhancement of translation by a plant potyvirus 5′ nontranslated region. J. Virol. 64, p. 1590-1597.

[0205] Chaudhary et al. (2008). EVOLUTION & DEVELOPMENT 10(5), p. 567-582.

[0206] Hong et al. (2006). Sci China C Life Sci, p: 436-45.

[0207] Liu, H. and Stone, S. L. (2010). Abscisic Acid Increases Arabidopsis ABI5 Transcription Factor Levels by Promoting KEG E3 Ligase Self-Ubiquitination and Proteasomal Degradation. Plant Cell 22, p. 2630-2641.

[0208] Logan, Edwards and Saunders (Editors; Real-Time PCR: Current Technology and Applications, Caister Academic Press 2009, ISBN: 978-1-904455-39-4.

[0209] López-Carbonell and Jáuregui (2005). A rapid method for analysis of abscisic acid (ABA) in crude extracts of water stressed Arabidopsis thaliana plants by liquid chromatography-mass spectrometry in tandem mode. Plant Physiol Biochem 43, p. 407-411.

[0210] Mansfield, T. A. (1987) Hormones as regulators of water balance. In Plant hormones and their role in growth and development, R. D. Davies, ed (Dordrecht, The Netherlands: Martinus Nijhoff Publishers), p. 411-430.

[0211] Masood et al. (2006). Differential response of antioxidant enzymes to salinity stress in two varieties of Azolla (Azolla pinnate and Azolla tilieuloides) . Env. Exp. Bot. 58, p. 216-222.

[0212] Mittler (2002). Oxidative stress, antioxidants and stress tolerance. Trends Plant Sci. 7, p, 405-410.

[0213] Needleman and Wunsch (1970). A general method applicable to the search for similarities in the amino acid sequence of two proteins. J. Mol. Biol., 48, p.443-453.

[0214] Pearson and Lipman (1988). Improved tools for biological sequence comparison. Proc. Natl. Acad. Sci 85, p.2444-48.

[0215] Pellegrineschi et al. (2004). Stress-induced expression in wheat of the Arabidopsis thaliana DREB1A gene delays water stress symptoms under greenhouse conditions. Genome 47, p. 493-500.

[0216] Sambrook, J. F., Russell, D. W. and Irwin, N. (2000). Molecular Cloning: A Laboratory Manual, 3rd edition Volumes 1 , 2, and 3. Cold Spring Harbor Laboratory Press.

[0217] Seo M. and Koshiba, T. (2002). Complex regulation of ABA biosynthesis in plants. Trends Plant Sci.7 (1): 41-48.

[0218] Wang et al. (2005). Molecular tailoring of farnesylation for plant drought tolerance and yield protection. The Plant Journal 43, p. 413-24.

[0219] Waterman, M. S. (1995). Introduction to Computational Biology: Maps, sequences and genomes. Chapman & Hall. London.

[0220] Xiong et al. (2001). The Arabidopsis LOS5/ABA3 Locus Encodes a Molybdenum Cofactor Sulfurase and Modulates Cold Stress- and Osmotic Stress-Responsive Gene Expression. The Plant Cell 13, p. 2063-2083.

[0221] Yamaguchi-Shinozaki, K. and Shinozaki, K. (1993). Characterization of the expression of a desiccation-responsive rd29 gene of Arabidopsis thaliana and alanysis of its promoter in transgenic plants. Mol Gen Genet 236, p. 331-340.

[0222] Yamaguchi-Shinozaki and Shinozaki (1994). A Novel cis-Acting Element in an Arabisopsis Gene Is Involved in Responsiveness to Drought, Low-Temperature, or High-Salt Stress. The Plant Cell 6, p. 251-264.

[0223] Zanoni et al. (2009) Nature 460, p:264-269; see also Nature Protocols: mRNA expression analysis by Real-Time PCR; ISSN: 1754-2189.