Method of Producing Nylon
20170260553 · 2017-09-14
Inventors
Cpc classification
C12P13/005
CHEMISTRY; METALLURGY
C12Y206/01062
CHEMISTRY; METALLURGY
C12P13/02
CHEMISTRY; METALLURGY
International classification
C12P13/00
CHEMISTRY; METALLURGY
C12P13/02
CHEMISTRY; METALLURGY
Abstract
There is provided a method of producing aminohexanoic acid and/or aminohexanoic acid ester from synthesis gas, the method comprising: A. contacting the synthesis gas with at least one bacteria capable of carrying out the Wood-Ljungdahl pathway and the ethanol-carboxylate fermentation to produce hexanoic acid; and B. contacting the hexanoic acid with a genetically modified cell to produce aminohexanoic acid and/or aminohexanoic acid ester, wherein the genetically modified cell has an increased activity, in comparison with its wild type, of alkane monooxygenase, alcohol dehydrogenase, and ω-transaminase.
Claims
1. A method of producing aminohexanoic acid and/or aminohexanoic acid ester from synthesis gas, the method comprising: A. contacting the synthesis gas with at least one bacteria capable of carrying out the Wood-Ljungdahl pathway and the ethanol-carboxylate fermentation to produce hexanoic acid; and B. contacting the hexanoic acid with a genetically modified cell to produce aminohexanoic acid and/or aminohexanoic acid ester, wherein the genetically modified cell has an increased activity, in comparison with its wild type, of alkane monooxygenase, alcohol dehydrogenase, and ω-transaminase.
2. The method of claim 1, further comprising the step of esterification of the hexanoic acid of step A to produce a C1-C4 hexanoate and wherein the C1-C4 hexanoate is contacted with the genetically modified cell of step B.
3. The method of claim 2, wherein the step of esterification involves contacting the hexanoic acid of step A with at least one C1-C4 alcohol to produce C1-C4 hexanoate.
4. The method of claim 2, wherein the step of esterification is catalysed by at least one esterification bacteria.
5. The method of claim 1, wherein in the genetically modified cell of step B, a) the enzyme alkane monooxygenase is encoded by the AlkBGT gene from Pseudomonas putida; b) the enzyme alcohol dehydrogenase is encoded by the AlkJ gene from Pseudomonas putida; and/or c) the enzyme ω-transaminase is the ω-transaminase CV2025 from Chromobacterium violaceum DSM30191.
6. The method of claim 1, further comprising a step of converting the aminohexanoic acid ester to aminohexanoic acid.
7. The method of claim 6, wherein the conversion of the aminohexanoic acid ester to the aminohexanoic acid is catalysed by lipase LipA (Q76D26) from Pseudomonas fluorescens.
8. The method of claim 1, wherein the cell of step B is selected from the group consisting of: a genetically modified Escherichia coli cell, a genetically modified Corynebacterium glutamicum cell and a genetically modified Pseudomonas putida cell.
9. The method of claim 1, wherein the bacteria capable of carrying out the Wood-Ljungdahl pathway in step A is an acetogenic bacteria selected from the group consisting of Acetoanaerobium notera (ATCC 35199), Acetonema longum (DSM 6540), Acetobacterium carbinolicum (DSM 2925), Acetobacterium malicum (DSM 4132), Acetobacterium species no. 446, Acetobacterium wieringae (DSM 1911), Acetobacterium woodii (DSM 1030), Alkalibaculum bacchi (DSM 22112), Archaeoglobus fulgidus (DSM 4304), Blautia producta (DSM 2950), Butyribacterium methylotrophicum (DSM 3468), Clostridium aceticum (DSM 1496), Clostridium autoethanogenum (DSM 10061, DSM 19630 and DSM 23693), Clostridium carboxidivorans (DSM 15243), Clostridium coskatii (ATCC no. PTA-10522), Clostridium drakei (ATCC BA-623), Clostridium formicoaceticum (DSM 92), Clostridium glycolicum (DSM 1288), Clostridium ljungdahlii (DSM 13528), Clostridium ljungdahlii C-01 (ATCC 55988), Clostridium ljungdahlii ERI-2 (ATCC 55380), Clostridium ljungdahlii 0-52 (ATCC 55989), Clostridium mayombei (DSM 6539), Clostridium methoxybenzovorans (DSM 12182), Clostridium ragsdalei (DSM 15248), Clostridium scatologenes (DSM 757), Clostridium species ATCC 29797, Desulfotomaculum kuznetsovii (DSM 6115), Desulfotomaculum thermobezoicum subsp. thermosyntrophicum (DSM 14055), Eubacterium limosum (DSM 20543), Methanosarcina acetivorans C2A (DSM 2834), Moorella sp. HUC22-1, Moorella thermoacetica (DSM 521), Moorella thermoautotrophica (DSM 1974), Oxobacter pfennigii (DSM 322), Sporomusa aerivorans (DSM 13326), Sporomusa ovata (DSM 2662), Sporomusa silvacetica (DSM 10669), Sporomusa sphaeroides (DSM 2875), Sporomusa termitida (DSM 4440), and Thermoanaerobacter kivui (DSM 2030).
10. The method of claim 1, wherein the bacteria capable of carrying out the ethanol-carboxylate fermentation is selected from the group consisting of Clostridium kluyveri and C. Carboxidivorans.
11. The method of claim 3, wherein the C1-C4 alcohol is methanol.
12. The method of claim 3, wherein the hexanoic acid produced from the synthesis gas is first extracted before being contacted with the C1-C4 alcohol to produce C1-C4 hexanoate.
13. The method of claim 1, wherein the cell is in a culture medium comprising amino acids, which function as amine donor for step B.
14. The method of claim 1, wherein the aminohexanoic acid is catalysed to form nylon.
15. The method of claim 14, wherein the nylon is selected from the group consisting of nylon-6,6, nylon-6, nylon-6,9, nylon-6,10, and nylon-6,12.
Description
BRIEF DESCRIPTION OF THE FIGURES
[0116]
[0117]
[0118]
[0119]
[0120]
[0121]
[0122]
[0123]
[0124]
EXAMPLES
[0125] The foregoing describes preferred embodiments, which, as will be understood by those skilled in the art, may be subject to variations or modifications in design, construction or operation without departing from the scope of the claims. These variations, for instance, are intended to be covered by the scope of the claims.
Example 1
[0126] Production of Ethanol and Acetate from Synthesis Gas
[0127] For the biotransformation of synthesis gas (66% H.sub.2, 33% CO.sub.2) to ethanol and acetate, the bacterium Clostridium ljungdahlii was used. All cultivation steps were carried out under anaerobic conditions in pressure-resistant glass bottles that can be closed airtight with a butyl rubber stopper.
[0128] For the cell culture of C. ljungdahlii 5 mL cryoculture was grown anaerobically in 50 ml of ATCC1754 medium (ATCC1754 medium: pH 6.0, 20 g/L MES, 1 g/L yeast extract, 0.8 g/L NaCl, 1 g/L NH.sub.4Cl, 0.1 g/L KCl, 0.1 g/L KH.sub.2PO.sub.4, 0.2 g/L MgSO.sub.4.7H.sub.2O, 0.02 g/L CaCl.sub.2x2H.sub.2O, 20 mg/L nitrilotriacetic acid, 10 mg/L MnSO.sub.4xH.sub.2O, 8 mg/L (NH.sub.4).sub.2Fe(SO.sub.4).sub.2x6H.sub.2O, 2 mg/L CoCl.sub.2x6H.sub.2O, 2 mg/L ZnSO.sub.4.7H.sub.2O, 0.2 mg/L CuCl.sub.2x2H.sub.2O, 0.2 mg/L Na.sub.2MoO.sub.4x2H.sub.2O, 0.2 mg/L NiCl.sub.2x6H.sub.2O, 0.2 mg/L Na.sub.2SeO.sub.4, 0.2 mg/L Na.sub.2WO.sub.4x2H.sub.2O, 20 g/L d-biotin; 20 μg/L folic acid, 100 μg/L pyridoxine HCl, 50 g/L thiamine-HClxH.sub.2O, 50 g/L riboflavin, 50 g/L nicotinic acid, 50 g/L calcium pantothenate, 1 g/L vitamin B12, 50 g/L p-aminobenzoate, 50 μg/L lipoic acid, about 67.5 mg/L NaOH, 400 mg/L L-cysteine hydrochloride, 400 mg/L Na.sub.2Sx9 H.sub.2O, 5 g/L fructose). From this culture, 10 ml was taken and inoculated in 100 ml of ATCC1754 medium to start the growth culture. This growth culture was incubated at 35° C. for 3 days.
[0129] For the production phase, the cells were harvested from the growth culture and washed with production medium. Subsequently, the cell pellet was resuspended in 75 ml of production medium (DM4 Medium: pH 5.8; 15 mg/l FeCl.sub.2x4H.sub.2O, 2 g/l (NH.sub.4)H.sub.2PO.sub.4, 0.2 g/l NaCl, 0.15 g/l KCl, 0.5 mg/l Resazurin, 3 mg/l H.sub.3BO.sub.3, 2 mg/l CoCl.sub.2x6H.sub.2O.1 mg/l ZnSO.sub.4x7H.sub.2O, 300 μg/l Na.sub.2MoO.sub.4x2H.sub.2O, 300 μg/l MnSO.sub.4xH.sub.2O, 200 μg/l NiCl.sub.2x6H.sub.2O, 100 μg/L CuCl.sub.2x2H.sub.2O, 100 μg/l Na.sub.2SeO.sub.3, 106 μg/l d-Biotin, 5 μg/l Folic acid, 2.5 μg/l Pyridoxin-HCl, 266 μg/l Thiamin-HCl, 12.5 μg/l Riboflavin; 12.5 μg/l Nicotinic acid, 413 μg/l Ca-pantothenate, 12.5 μg/l Vitamin B.sub.12, 12.5 μg/l p-aminobenzoate, 15.0 μg/l lipoic acid, 0.5 g/l MgCl.sub.2x7H.sub.2O, 0.2 g/l CaCl.sub.2x2H.sub.2O in flameproof, sterile glass bottles (volume 250 ml) and the production phase of C. ljungdahlii started. The production culture was capped with a butyl rubber stopper with synthesis gas (66% H.sub.2, 33% CO.sub.2, 1.8 bar) and left for 113.75 h and incubated at 35° C. and shaken at 100 rpm. During the cultivation, the gas phase was changed daily and samples were taken daily to determine the optical density and different analytes produced by NMR. The results showed that the amount of acetate produced increased from 0.02 g/l to 1.2 g/l and the amount of ethanol produced increased from 0.01 g/l to 0.1 g/l. Hexanoic acid and butyric acid could not be detected.
Example 2
[0130] Production of Butyric and Hexanoic Acid from Synthesis Gas
[0131] For the biotransformation of synthesis gas to butyric acid and hexanoic acid, a ω-culture of Clostridium ljungdahlii and Clostridium kluyveri was used in the production phase. The bacterium Clostridium ljungdahlii converted the H.sub.2 and CO.sub.2 from the ambient atmosphere to acetate and ethanol. These products were taken up by from the aqueous phase and converted into butyric acid and hexanoic acid by the Clostridium kluyveri.
[0132] All cultivation steps were carried out under anaerobic conditions in pressure-resistant glass bottles that can be closed airtight with a butyl rubber stopper.
[0133] For the cell culture of C. ljungdahlii 10 mL cryoculture was grown anaerobically in 100 ml of ATCC1754 medium (ATCC1754 medium: pH 6.0, 20 g/L MES, 1 g/L yeast extract, 0.8 g/L NaCl, 1 g/L NH.sub.4Cl, 0.1 g/L KCl, 0.1 g/L KH.sub.2PO.sub.4, 0.2 g/L MgSO.sub.4.7H.sub.2O, 0.02 g/L CaCl.sub.2x2H.sub.2O, 20 mg/L nitrilotriacetic acid, 10 mg/L MnSO.sub.4xH.sub.2O, 8 mg/L (NH.sub.4).sub.2Fe(SO.sub.4).sub.2x6H.sub.2O, 2 mg/L CoCl.sub.2x6H.sub.2O, 2 mg/L ZnSO.sub.4.7H.sub.2O, 0.2 mg/L CuCl.sub.2x2H.sub.2O, 0.2 mg/L Na.sub.2MoO.sub.4x2H.sub.2O, 0.2 mg/L NiCl.sub.2x6H.sub.2O, 0.2 mg/L Na.sub.2SeO.sub.4, 0.2 mg/L Na.sub.2WO.sub.4x2H.sub.2O, 20 g/L d-biotin; 20 μg/L folic acid, 100 μg/L pyridoxine HCl, 50 g/L thiamine-HClxH.sub.2O, 50 g/L riboflavin, 50 g/L nicotinic acid, 50 g/L calcium pantothenate, 1 g/L vitamin B12, 50 g/L p-aminobenzoate, 50 μg/L lipoic acid, about 67.5 mg/L NaOH, 400 mg/L L-cysteine hydrochloride, 400 mg/L Na.sub.2Sx9 H.sub.2O, 5 g/L fructose). This growing culture was incubated at 35° C. for 2 days.
[0134] For the cell culture of Clostridium kluyveri, 10 mL of a continuous culture of Clostridium kluyveri, was grown in 100 mL of DMSZ52 medium (DSMZ52 medium: pH=6.98, 10 g/L CH.sub.3COOK, 0.31 g/L K.sub.2HPO.sub.4, 0.23 g/L KH.sub.2PO.sub.4, 0.25 g/l NH.sub.4Cl, 0.20 g/l MgSO.sub.4x7 H.sub.2O, 1 g/L yeast extract, 0.50 mg/L resazurin, 10 μl/l HCl (25%, 7.7 M), 1.5 mg/L FeCl.sub.2x4H.sub.2O, 70 g/L ZnCl.sub.2x7H.sub.2O, 100 g/L MnCl.sub.2x4H.sub.2O, 6 g/L H.sub.3BO.sub.3, 190 μg/L COCl.sub.2x6H.sub.2O, 2 g/L CuCl.sub.2x6H.sub.2O, 24 g/L NiCl.sub.2x6H.sub.2O, 36 g/L Na.sub.2MO.sub.4x2H.sub.2O, 0.5 mg/L NaOH, 3 g/L Na.sub.2SeO.sub.3x5H.sub.2O, 4 μg/L Na.sub.2WO.sub.4x2H.sub.2O, 100 g/L vitamin B12, 80 g/L p-aminobenzoic acid, 20 g/L D(+) Biotin, 200 μg/L nicotinic acid, 100 g/L D-Ca-pantothenate, 300 μg/L pyridoxine hydrochloride, 200 μl/l thiamine —HClx2H.sub.2O, 20 mL/L ethanol, 2.5 g/L NaHCO.sub.3, 0.25 g/L cysteine-HClxH.sub.2O, 0.25 g/L Na.sub.2Sx9H.sub.2O). This growing culture was incubated at 35° C. for 2 days.
[0135] For the production phase, the cells were harvested from both growth cultures separately and washed with production medium. Subsequently, the cell pellets were each resuspended in 35 ml of production medium (PETC mod. Medium: pH 6.0; 10 g/l MES, 2.4 g/l of NaCl, 3 g/l NH.sub.4Cl, 0.3 g/l KCl, 0.3 g/l KH.sub.2PO.sub.4, 0.6 g/l MgSO.sub.4.7H.sub.2O, 0.12 g/l CaCl.sub.2x2H.sub.2O, 20 mg/l nitrilotriacetic acid, 10 mg/l MnSO.sub.4xH.sub.2O, 8 mg/l (NH.sub.4).sub.2Fe(SO.sub.4).sub.2x6H.sub.2O, 2 mg/l CoCl.sub.2x6H.sub.2O, 2 mg/l ZnSO.sub.4.7H.sub.2O, 0.2 mg/l CuCl.sub.2x2H.sub.2O, 0.2 mg/l Na.sub.2MoO.sub.4x2H.sub.2O, 0.2 mg/l NiCl.sub.2x6H.sub.2O, 0.2 mg/l Na.sub.2SeO.sub.4, 0.2 mg/l Na.sub.2WO.sub.4x2H.sub.2O, 2 g/l d-biotin, 2 g/l folic acid, 10 g/l pyridoxine HCl, 5 g/l thiamine-HClxH.sub.2O, 5 g/l of riboflavin, 5 g/l nicotinic acid, 5 g/l of Ca-pantothenate, 5 μg/L vitamin B12, 5 g/l p-aminobenzoate, 5 μg/l lipoic acid, 10 g/l MESNA, approximately 67.5 mg/l NaOH, 300 mg/l cysteine-HClxH.sub.2O, 300 mg/l Na.sub.2Sx9H.sub.2O) in flameproof, sterile glass bottles (volume 250 ml) and the co-production of C. ljungdahlii and C. kluyveri started. The production culture was capped with a butyl rubber stopper with synthesis gas (66% H.sub.2, 33% fully .sup.13C-labeled CO.sub.2, 1.8 bar) and left for 191 h and incubated at 35° C. and shaken at 100 rpm. During the cultivation, the gas phase was changed daily and samples were taken daily to determine the optical density and different analytes produced by NMR.
[0136] The amount of products is determined using semi-quantitative .sup.1H-NMR spectroscopy of a sterile-filtered supernatant from this mixed production. The samples were in accordance with phosphate buffer diluted (in D.sub.2O stated) and measured with water suppression. Measurements were carried out with and without suppression of .sup.13C coupling. As an internal quantification standard, sodium trimethylsilylpropionate (TSP) was used.
[0137] The results showed that the amount of acetate produced increased from 0.05 g/l to 1.7 g/l (93 mol % of the total acetate produced was .sup.13C marked) and the amount of ethanol produced increased from 0.05 g/l to 0.12 g/l (92 mol % of the total ethanol produced was .sup.13C marked). Also, the concentration of hexanoic acid was increased from 0.02 g/l to 0.13 g/l (63 mol % of the total hexanoic acid produced was .sup.13C marked) and butyric acid was increased from 0.01 g/l to 0.07 g/l (63 mol % of the total butyric acid produced was .sup.13C marked). This confirmed that a large percentage of the hexanoic acid and butyric acid produced derived from the C source of the synthesis gas.
Example 3
[0138] Production of Hexanoic Acid and Butyric Acid from Ethanol and Acetate
[0139] For the biotransformation of ethanol and acetate to hexanoic acid and butyric acid the bacterium Clostridium kluyveri was used. All cultivation steps were carried out under anaerobic conditions in pressure-resistant glass bottles that can be closed airtight with a butyl rubber stopper.
[0140] A cyroculture of Clostridium in 5 ml of DMSZ52 medium (DSMZ52 medium: pH=6.98, 10 g/L CH.sub.3COOK, 0.31 g/L K.sub.2HPO.sub.4, 0.23 g/L KH.sub.2PO.sub.4, 0.25 g/l NH.sub.4Cl, 0.20 g/l MgSO.sub.4x7 H.sub.2O, 1 g/L yeast extract, 0.50 mg/L resazurin, 10 μl/l HCl (25%, 7.7 M), 1.5 mg/L FeCl.sub.2x4H.sub.2O, 70 μg/L ZnCl.sub.2x7H.sub.2O, 100 μg/L MnCl.sub.2x4H.sub.2O, 6 μg/L H.sub.3BO.sub.3, 190 μg/L COCl.sub.2x6H.sub.2O, 2 μg/L CuCl.sub.2x6H.sub.2O, 24 μg/L NiCl.sub.2x6H.sub.2O, 36 μg/L Na.sub.2MO.sub.4x2H.sub.2O, 0.5 mg/L NaOH, 3 μg/L Na.sub.2SeO.sub.3x5H.sub.2O, 4 μg/L Na.sub.2WO.sub.4x2H.sub.2O, 100 g/L vitamin B12, 80 g/L p-aminobenzoic acid, 20 g/L D(+) Biotin, 200 μg/L nicotinic acid, 100 μg/L D-Ca-pantothenate, 300 μg/L pyridoxine hydrochloride, 200 μl/L thiamine —HClx2H.sub.2O, 20 mL/L ethanol, 2.5 g/L NaHCO.sub.3, 0.25 g/L cysteine-HClxH.sub.2O, 0.25 g/L Na.sub.2Sx9H.sub.2O) was placed in a 250 ml bottle and 50 ml of DSMZ52 medium added. This growing culture was incubated at 35° C. for 3 days. Then 100 ml of DSMZ52 medium was inoculated with 10 ml of this culture to produce a preparatory culture. This preparatory culture was incubated at 35° C. for 3 days. For production of a main culture, 200 ml of DSMZ52 medium was inoculated with 5% of the cells from the preparatory culture in 500 ml bottles. The culture was capped with a butyl rubber stopper and incubated for 98 h and incubated at 35° C. At the start and end of the culturing period, samples were taken. These were tested for optical density and the different analytes by NMR. There was a growth of OD.sub.600˜0.01 to a maximum of 0.35 to 0.37. The results showed that the amount of acetate decreased from 4.9 g/l to 2.4 g/l and the amount of ethanol decreased from 12.5 g/l to 9.2 g/l. Also, the concentration of hexanoic acid was increased from 0.1 g/l to 6.85 g/l and butyric acid was increased from 0.1 g/l to 2.9 g/l.
Example 4
[0141] The Formation of Hexanoic Acid from Synthesis Gas Using C. carboxidivorans
[0142] The wild-type strain Clostridium carboxidivorans (Accession No. DSM 15243) were obtained from DSMZ (Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH) and cultivated autotrophically to form hexanoic acid from synthesis gas. All cultivation steps were carried out under anaerobic conditions in pressure-resistant glass bottles that can be closed airtight with a butyl rubber stopper.
[0143] A complex medium was used to grow the cells. The complex medium was made of: 3 g/l NH.sub.4Cl, 0.3 g/l KCl, 0.6 g/l MgSO.sub.4x7H.sub.2O, 2.4 g/l NaCl, 0.3 g/l KH.sub.2PO.sub.4, 120 mg/l CaCl.sub.2x2 H.sub.2O, 10 g/l MES, 1 g/l yeast extract, 0.4 g/l L-Cysteine-HCl, 20 mg/l nitrilotriacetic acid, 10 mg/l MnSO.sub.4xH.sub.2O, 8 mg/l (NH.sub.4).sub.2Fe(SO.sub.4).sub.2x6H.sub.2O, 2 mg/l CoCl.sub.2x6H.sub.2O, 2 mg/l ZnSO.sub.4x7H.sub.2O, 0.2 mg/l CuCl.sub.2x2H.sub.2O, 0.2 mg/l Na.sub.2MoO.sub.4x2H.sub.2O, 0.2 mg/l NiCl.sub.2x6H.sub.2O, 0.2 mg/l Na.sub.2SeO.sub.4, 0.2 mg/l Na.sub.2WO.sub.4x2H.sub.2O, 20 μg/l d-Biotin, 20 μg/l folic acid, 100 μg/l Pyridoxin-HCl, 50 μg/l Thiamin-HClxH.sub.2O, 50 μg/l Riboflavin, 50 μg/l nicotinic acid, 50 μg/l Ca-pantothenate, 50 μg/l Vitamin B.sub.12, 50 μg/l p-aminobenzoate, 50 μg/l lipoic acid, 100 μg/l MESNA pH 6.0.
[0144] An autotrophic cultivation was carried out in a 1 L-septum bottle filled with 500 ml of the complex medium and the Clostridium carboxidivorans strain. The incubation was performed at 37° C. with a shaking frequency of 100 min.sup.−1 in an open water bath shaker (Innova 3100 by New Brunswick Scientific). The gas trapped in the medium was removed by a sparger with a pore size of 10 microns, which was mounted in the center of the reactors. Culturing is carried out with no pH control. The reactors were purged with a premixed gas mixture of composition 67% H.sub.2, 33% CO.sub.2 at atmospheric pressure with an aeration rate of 3 I/h (0.1 vvm) through the sparger.
[0145] The reactor started with 5 ml of a cryoculture of Clostridium carboxidivorans inoculated in glycerol (10%) that was heterotrophic with fructose in the absence of O.sub.2 in the abovementioned complex medium. The culture was and incubated for 46 h and incubated at 35° C.
[0146] When obtaining samples, 5 ml of each sample as taken for determination of OD.sub.600, pH and the product spectrum. The determination of the product concentration was performed by semi-quantitative .sup.1H-NMR spectroscopy. As an internal quantification standard sodium trimethylsilylpropionate (T(M)SP) was used.
[0147] The results showed an increase in OD.sub.600 of 0.01 to 0.18 with a decrease in pH from 5.75 to 5.51. Also, the acetate concentration decreased from 7 mg/l to 0.8 g/l, the ethanol concentration increased from 0 g/l to 0.16 g/l and the butyrate concentration increased from 0 to 0.19 g/l. Also, 63 mg/l of hexanoic acid was formed during this period.
Example 5
[0148] E. coli JM101 (pBT10) as Whole Cell Catalyst for Oxidation of Methyl Hexanoate and/or Hydroxymethyl Hexanoate
[0149] A recombinant E. coli strain JM101 cells which carry the plasmid pBT10 (
[0150] In summary, the following steps were carried out.
[0151] Construction of the alkBGT Expression Vectors
[0152] The construct pBT10 (
[0153] Cloning Strategy
[0154] To simplify the cloning of alkB and alkG, the gene alkF located between them was amplified and cloned together with alkB and alkG. AlkF is of no significance for the reaction that is to be catalysed.
[0155] PCR amplification of the fragment alkBFG=2524 bp (cf. SEQ ID NO:2 (alkB) and SEQ ID NO:3 (alkG) with Ndel cleavage site upstream of alkB and Sail cleavage site downstream of alkG. The sequences of the primers are provided in Table 2 below.
[0156] PCR amplification of the fragment alkT (2958 bp) (SEQ ID NO:4 (alkT))
TABLE-US-00002 TABLE 2 Primers used to amplify alkBFG and alkT SEQ ID NO Sequence Description 5 AAGGGAATTCCATATGCTTG alkBFG forward AGAAACACAGAGTTC 6 AAAATTCGCGTCGACAAGCG alkBFG reverse CTGAATGGGTATCGG 7 TGAGACAGTGGCTGTTAGAG alkT forward 8 TAATAACCGCTCGAGAACGC alkT reverse TTACCGCCAACACAG
[0157] The fragments alkBFG and alkT were amplified by PCR. The plasmid pGEc47 (
[0158] The cloning was carried out by means of the subcloning vector pSMART® HCKan (Lucigen Corporation) which was already linearized and provided with blunt ends, and was ligated with the respective blunt-end PCR product (
[0159] Next, the alkBFG fragment with the restriction enzymes Ndel and Sail and the alkT fragment with the restriction enzymes Pacl and Xhol were cut out of the subcloning vectors. The fragments were separated in agarose gel (1%), cut out of the gel and isolated using a gel extraction kit.
[0160] The fragments were ligated one after another into the vector pCOM10 (Smits, T. H. M. et. al., 2001). In the first step alkBFG was inserted in pCOM10 via the cleavage sites Ndel and Sail, and in a second step alkT was then cloned via the cleavage sites Pacl and Xhol.
[0161] The recombinant plasmid was transformed in E. coli DH.sub.5α. Plasmid-bearing clones were selected on kanamycin-containing LB medium. The isolated plasmid was checked by restriction analysis and sequencing. It is designated pBT10 (
[0162] All cell assays were carried out using the following conditions:
[0163] The E. coli strain JM101 cells were grown at 30° C. in M9 medium (composition: 6.8 g/l Na.sub.2PO.sub.4.2H.sub.2O, 2.4 g/l KH.sub.2PO.sub.4, 0.4 g/l NaCl, 1.6 g/l NH.sub.4Cl, 0.5 g/l MgSO.sub.4.7H.sub.2O, 1 ml of trace element solution US3, consisting of 36.5 g/l of 37% strength hydrochloric acid, 1.91 g/l MnCl.sub.2.4H.sub.2O, 1.87 g/l ZnSO.sub.4.7H.sub.2O, 0.84 g/l Na-EDTA.2H.sub.2O, 0.3 g/l H.sub.3BO.sub.3, 0.25 g/l Na.sub.2MoO.sub.4.2H.sub.2O, 4.7 g/l CaCl.sub.2.2H.sub.2O, 17.3 g/l FeSO.sub.4.7H.sub.2O, 0.15 g/l CuCl.sub.2.2H.sub.2O). Inoculation was done when the OD.sub.450=0.2. The cells were left to grow and when OD.sub.450 reached 0.5, induction of gene expression was carried out with 0.025% (v/v) dicyclopropylketone (DCPK), a potent gratuitous inducer of alkane hydroxylase activity. The cells were incubated for a further 4 hours. The cells were then harvested by centrifugation, the cell pellet was resuspended in 50 mM potassium phosphate buffer (KPi, pH 7.4 containing 1% (w/v) glucose and put in a bioreactor. The growth was stopped with 40 μl of 10% (v/v) perchloric acid which allows for protonation to the resulting acid and thus makes the extraction of the reaction mixture by ether feasible.
[0164] The reaction mixture was then extracted by diethyl ether and subsequent quantification of the substrate and product concentrations carried out by gas chromatography. Each of the recombinant cells was contacted with methyl hexanoate separately in a resting cell assay and samples taken over a longer period.
[0165] Resting E. coli JM101 (pBT10) catalysed the conversion of methyl hexanoate to hydroxymethyl hexanoate efficiently as shown in
[0166] As can be seen in Table 3 below, the maximum specific activity for the hydroxylation reaction (first step) was shown to be approximately 90 U g.sub.CDW and for the alcohol oxidation step (second step) was shown to be 6 U g.sub.CDW.
[0167] When hydroxymethyl hexanoate was used as a substrate for E. coli JM101 (pBT10), there was a slow and inefficient AlkBGT-catalyzed oxidation of alcohol hydroxymethyl hexanoate to oxomethyl hexanoate. A similar behaviour was observed when hydroxymethyl hexanoate was used as a substrate for E. coli JM101 (pBT10) as shown in
Example 6
[0168] E. coli JM101 (pJ10) as Whole Cell Catalyst for Oxidation of Hydroxymethyl Hexanoate
[0169] The alkane hydroxylase system alkBGT from Pseudomonas putida GPo1 is used for the hydroxylation of hexanoic acid or of methyl hexanoate. The second step to the aldehyde is catalysed by the alcohol dehydrogenase alkJ.
[0170] A second recombinant E. coli strain JM101 cells which carry the plasmid pJ10 expressing the gene encoding for the alcohol dehydrogenase AlkJ from P. putida (
[0171] A more efficient hydroxymethyl hexanoate oxidation was achieved by the introduction of the alcohol dehydrogenase AlkJ in E. coli JM101. The oxidising ability of E. coli JM101 (pJ10) carrying AlkJ was examined in resting cell assays. Hydroxymethyl hexanoate was used as a substrate and the results shown in
TABLE-US-00003 TABLE 3 Measurement of maximum specific activity in the production of methyl hexanoate and 6-hydroxymethylhexanoate with resting E. coli JM101 (pBT10) and E. coli JM101 (pJ10). Biomass concentration 0.68-0.91 g.sub.CDW L.sup.−1 in KPi-buffer (pH 7.4) containing 1% (w/v) glucose Step 1 Step 2 Plasmid Substrate [U/g.sub.CDW] [U/g.sub.CDW] pBT10 Hexanoic acid methylester 90 ± 10 6 ± 2 6-Hydroxyhexanoicmethylester — 25 ± 2 pJ10 6-Hydroxyhexanoicmethylester — 232 ± 39
[0172] For efficient oxidation of the alcohol to the aldehyde, the presence of AlkJ appeared to be necessary.
REFERENCES
[0173] Altschul, S. et al., Journal of Molecular Biology 215 (1990), pages 403-410 [0174] Barker H. A., HARVEY LECT THE HARVEY LECTURES HARVEY LECTURES, Series 45/242-59 1949, [0175] Barz et al. Plant Science, Vol. 155, pages 101-108 (2000). [0176] Becker et al., FEBS Letters, Vol. 579, pages 1177-1182 (2005) [0177] “Bioprozesstechnik 1. Einfuhrung in die Bioverfahrenstechnik” [Bioprocess Techniques 1. Introduction to Bioprocess Engineering] (Gustav Fischer Verlag, Stuttgart, 1991) [0178] Bornstein B. T., et al., J. Biol. Chem. 1948, 172:659-669. [0179] Byoung, S. J. et al., Enzyme and Microbial Technology 53 (2013) 143-151 [0180] de Lorenzo et al., J Bacteriol., Vol. 172 (11), pages 6568-6572 and 6557-6567 (1990) [0181] Deveroy, J. et al., Nucleic Acid Research 12 (1984), page 387, Genetics Computer Group University of Wisconsin, Madison (Wis.) [0182] Ding H. et al, Bioresource Technology 101 (2010) 9550-9559, [0183] Drake et al., 2004. Strict and Facultative Anaerobes: Medical and Environmental Aspects. pp. 251-281, Horizon Scientific Press, United Kingdom [0184] Drake & Kusel, 2005 Acetogenic clostridia. In: Durre, P. (ed.), Handbook on Clostridia, pp. 719-746. CRC Press, Boca Raton, Fla. [0185] Drake et al., 2006, Acetogenic prokaryotes. In: Balows A, Truper H G, Dworkin M, Harder W and Gerhardt, P et al (ed) American Society for Microbiology, Washington, D.C. p. 248-277 [0186] Eggink et al. (1987) J. Biol. Chem. 262, 17712-17718 [0187] Kaulmann et al., 2007; Enzyme and Microbial Technology, Vol. 41, pages 628-637 [0188] Kieun C., Appl Biochem Biotechnol (2013) 171:1094-1107 [0189] Kojima and Shimizu, Journal of Bioscience and Bioengineering, Volume 96 (3), pages 219-226 (2003). “Manual of Methods for General Bacteriology” of the American Society for Bacteriology (Washington D.C., USA, 1981) [0190] Needleman and Wunsch, Journal of Molecular Biology 48 (1970), pages 443-453 [0191] Panke et al., Appl and Environm. Microbiol., pages (1999) 5619-5623 [0192] “Polymerization Processes”, Interscience, New York, 1977, pages 424-467, especially pages 444-446. [0193] Reed, T B, 1981, Biomass gasification: principles and technology, Noves Data Corporation, Park Ridge, N.J. [0194] Riesenberg, D Appl Microbiol and Biotechnololgy, Vol. 34 (1), pages 77-82 (1990) [0195] Seedorf, H. et al. (2008): In: Proc Natl Acad Sci USA. 105(6); 2128-2133 [0196] Smits, T. H. M., Seeger, M. A., Witholt, B. & van Beilen, J. B. (2001) Plasmid 46, 16-24 [0197] Stadtman E. R., et al., J. Biol. Chem. 1950, 184:769-794 [0198] Steinbusch K. J. J, et al, Energy Environ. Sci., 2011, 4, 216-224 [0199] Storhas (“Bioreaktoren und periphere einrichtungen” [Bioreactors and Peripheral Equipment], Vieweg Verlag, Brunswick/Wiesbaden, 1994). [0200] van Beilen et al. Journal of Bacteriology, Vol. 184 (6), pages 1733-1742 (2002) [0201] van Beilen et al. in “Oil & Gas Science and Technology”, Vol. 58 (4), pages 427-440 (2003) [0202] Van Eerten-Jansen, M. C. A. A et al., ACS Sustainable Chem. Eng. 2013, 1, 513-518 [0203] Vaysse et al., “Enzyme and Microbial Technology”, Vol. 31, pages 648-655 (2002)). [0204] Wood, 1991 Life with CO or CO2 and H2 as a source of carbon and energy. FASEB J. 5:156-163 [0205] Zhang, F., et al., Water Research (2013) [0206] WO98/00558, WO 00/68407, ATCC 49587, ATCC 55988 and ATCC 55989, WO2009/077461, EP0748797, U.S. 2007/0275447, U.S. 2008/0057554, WO00/20566, US2007/0092957, GB1009370A, DE1495198, DE2558480, EP0129196