COMBINED USE OF A TRKA INHIBITOR AND AN EPHA2 INHIBITOR FOR USING IN THE TREATMENT OF SOLID CANCERS, AND METHOD FOR THE PROGNOSIS OF SURVIVAL OF A PATIENT WHO HAS A SOLID CANCER
20170258871 · 2017-09-14
Assignee
- UNIVERSITE DES SCIENCES ET TECHNOLOGIES DE LILLE (Villeneuve D'ascq, FR)
- Inserm (Institut National De La Sante Et De La Recherche Medicale) (Paris, FR)
Inventors
- Robert Toillon (Bauvin, FR)
- Xuefen Le Bourhis (Chereng, FR)
- Cyril Corbet (Hellemmes, FR)
- Leo Aubert (Lille, FR)
- Matthieu Guilbert (Pont A Marcq, FR)
Cpc classification
A61K31/553
HUMAN NECESSITIES
A61K38/177
HUMAN NECESSITIES
A61K45/06
HUMAN NECESSITIES
G01N33/57492
PHYSICS
A61P35/00
HUMAN NECESSITIES
International classification
Abstract
The invention relates to an EphA2 inhibitor for the use thereof in the treatment of solid cancer treated with a TrkA inhibitor, and a TrkA inhibitor for the use thereof in the treatment of solid cancer treated with an EpbA2 inhibitor. The invention also relates to a method for the prognosis of survival of a patient who has a solid cancer, comprising a step of detecting the expression of TrkA and EphA2 in a biological sample of the patient, the co-expression of TrkA and EphA2 being associated with a poor prognosis of survival of the patient.
Claims
1. A method of treating a solid cancer in a patient treated with a TrkA inhibitor, comprising the step of administering to said patient a EphA2 inhibitor, wherein said TrkA inhibitor is a TrkA antagonist, an inhibitor of TrkA receptor expression, an inhibitor of TrkA tyrosine kinase activity or a molecule preventing the binding of signaling adapter molecules, and wherein said EphA2 inhibitor is an EphA2 antagonist, an inhibitor of EphA2 receptor expression or a molecule preventing the binding of signaling adapter molecules.
2. A method of treating a solid cancer in a patient treated with an EphA2 inhibitor, comprising the step of administering to said patient a TrkA inhibitor, wherein said TrkA inhibitor is a TrkA antagonist, an inhibitor of TrkA receptor expression, an inhibitor of TrkA tyrosine kinase activity or a molecule preventing the binding of signaling adapter molecules, and wherein said EphA2 inhibitor is an EphA2 antagonist, an inhibitor of EphA2 receptor expression or a molecule preventing the binding of signaling adapter molecules.
3. A pharmaceutical composition comprising a TrkA inhibitor, an EphA2 inhibitor and at least one pharmaceutically acceptable carrier, wherein said TrkA inhibitor is a TrkA antagonist, an inhibitor of TrkA receptor expression, an inhibitor of TrkA tyrosine kinase activity or a molecule preventing the binding of signaling adapter molecules, and wherein said EphA2 inhibitor is an EphA2 antagonist, an inhibitor of EphA2 receptor expression, or a molecule preventing the binding of signaling adapter molecules.
4. (canceled)
5. A combination product comprising: a TrkA inhibitor, and an EphA2 inhibitor, wherein said TrkA inhibitor is a TrkA antagonist, an inhibitor of TrkA receptor expression, an inhibitor of TrkA tyrosine kinase activity or a molecule preventing the binding of signaling adapter molecules, and wherein said EphA2 inhibitor is an EphA2 antagonist, an inhibitor of EphA2 receptor expression or a molecule preventing the binding of signaling adapter molecules.
6. (canceled)
7. A method for prognosis of the survival of a patient suffering from a solid cancer, detecting the expression of TrkA and EphA2 in a biological sample of the patient, the co-expression of TrkA and EphA2 being associated with a poor prognosis of survival of the patient.
8. The method according to claim 7, in which the step of detecting the expression of TrkA and EphA2 is carried out by detecting a TrkA/EphA2 complex.
9. The method according to claim 7, in which the biological sample comes from a biopsy of a tumor of the patient,
10-12. (canceled)
13. The method according to claim 1, wherein said solid cancer is breast cancer, prostate cancer, colon cancer, tongue cancer, cancer of the oropharyngeal sphere, thyroid cancer, pancreatic cancer, neuroblastoma, glioma or skin cancer
14. The method according to claim 1, wherein said solid cancer is breast cancer. prostate cancer or cancer of the oropharyngeal sphere.
15. The method according to claim 1, wherein said cancer is breast cancer.
16. The method according to claim 2, wherein said solid cancer is breast cancer, prostate cancer, colon cancer, tongue cancer, cancer of the oropharyngeal sphere, thyroid cancer, pancreatic cancer, neuroblastoma, glioma or skin cancer
17. The method according to claim 2, wherein said solid cancer is breast cancer, prostate cancer or cancer of the oropharyngeal sphere.
18. The method according to claim 2, wherein said cancer is breast cancer.
19. The method according to claim 7, wherein said solid cancer is breast cancer, prostate cancer, colon cancer, tongue cancer, cancer of the oropharyngeal sphere, thyroid cancer, pancreatic cancer, neuroblastoma, glioma or skin cancer.
20. The method according to claim 7, wherein said solid cancer is breast cancer, prostate cancer or cancer of the oropharyngeal sphere.
21. The method according to claim 7, wherein said solid cancer is breast cancer.
22. The method of treating a solid cancer, comprising administering a TrkA inhibitor and an EphA2 inhibitor to a patient in need thereof.
23. The method according to claim 22, wherein said TrkA inhibitor is a TrkA antagonist, an inhibitor of TrkA receptor expression, an inhibitor of TrkA tyrosine kinase activity or a molecule preventing the binding of signaling adapter molecules.
24. The method according to claim 22, wherein said EphA2 inhibitor is an EphA2 antagonist, an inhibitor of EphA2 receptor expression or a molecule preventing the binding signaling adapter molecules.
25. The method according to claim 22, wherein said solid cancer is breast cancer, prostate cancer, colon cancer tongue cancer, cancer of the oropharyngeal sphere, thyroid cancer, pancreatic cancer, neuroblastoma, glioma or skin cancer
26. The method according to claim 22, wherein said solid cancer is breast cancer, prostate cancer or cancer of the oropharyngeal sphere.
27. The method according to claim 22, wherein said solid cancer is breast cancer.
Description
FIGURES
[0128]
[0129]
[0130]
[0131]
[0132] A—Correlation of the expression of sortilin (SORT1), TrkA (NTRK1) and EphA2 with metastasis free survival by microarray analysis (SORT1), EphA2 and TrkA (NTRK1) after over-regulation of the sortilin, TrkA and EphA2 (lower curve) or without over-regulation (upper curve).
[0133] B—Expression of the TrkA/EphA2 complex is associated with a reduction in the overall survival of patients in breast cancer. The expression of the TrkA/EphA2 complex was investigated by proximity ligation assays on 182 breast tumours (tissue microarrays CBA4 (Superbiochips) and Hbre-Duc 150Sur-01 (US Biomax)). The expression of the complex has been graded as zero (no marking) weak or very weak expression (0 to 5 complexes detected per cell on average; medium 5 to 15 complexes per cell on average; strong more than 15 complexes per cell on average). The overall survival is reported in the form of a Kaplan Meier graph; the significance is obtained using a log-rank test (n=182, p<0.0001).
[0134]
[0135]
[0136]
[0137] A. Cells MDA-MB-231 HA-TrkA were transfected with siTrkA and then treated with proNGF N.C. The sortilin was immunoprecipitated, EphA2 and HA-TrkA were immunoblotted.
[0138] B. Cells MDA-MB-231 HA-TrkA or kinase-dead HA-TrkA were treated with proNGF N.C. The recruitment of the sortilin and EphA2 was determined after anti-HA immunoprecipitation. The efficacy of the mutagenesis has been verified with an anti-phosphotyrosine antibody.
[0139] C. Cells MDA-MB-231 HA-TrkA were treated with proNGF N.C in the presence or absence of 1 μM neurotensin. HA-TrkA was immunoprecipitated with anti-HA antibody, and sortilin and EphA2 were immunoblotted.
[0140] D. Cells MDA-MB-231 HA-TrkA were transfected with siEphA2 and then treated with proNGF N.C. (30 min). The recruitment of the sortilin and EphA2 was determined after anti-HA immunoprecipitation.
[0141]
[0142] A and D. Cells MDA-MB-231 HA-TrkA were treated with proNGF N.C. (A) or NGF (D) (30 min) in the presence or absence of 10 nM K252a, 15 μM LY294002 and 50 nM SKI-1. The phosphorylation of Akt and Src was determined by using phospho-specific antibodies. The equal charge was verified using Akt and Src antibodies.
[0143] B and E. Cells MDA-MB-231 HA-TrkA or kinase-dead HA-TrkA were treated with proNGF N.C. (B) or NGF (E) (5 and 30 min). The phosphorylation of Akt and Src was measured by the western blot method.
[0144] C and F. The phosphorylation of Akt and Src was determined in the total lysates coming from cells MDA-MB-231 transfected with siEphA2 and treated for 30 minutes with proNGF N.C. (C) or NGF (F).
[0145]
[0146]
EXAMPLES
Example 1
[0147] EphA2 was involved in the cellular invasion of various lines of cancerous cells induced by proNGF through a functional interaction with the sortilin/TrkA complex.
[0148] Prior research had demonstrated that numerous epithelial cancer cells responded to NGF or to proNGF (24, 25, 51-54). The effects of NGF and proNGF on the invasion capacity of various cancer lines was therefore tested.
[0149] The experiments were carried out on cancer cells from the tongue (CAL27, CAL33), larynx (SQ20B), pharynx (FaDu), prostate (DU145, PC3) and breast (MDA-MB-231).
Chemicals and Reagents
[0150] The reagents were supplied by Sigma (France) and the cell culture media were obtained from Invitrogen (France). Cell culture consumables and plastics came from BD-Falcon (France) and Greiner (France). The recombinant human β NGF was supplied by Scil Proteins (Germany), the recombinant human non-cleavable proNGF (proNGF N.C.) by Alomone Labs (Israel) and the pharmacological inhibitor K252a was obtained from Calbiochem (United Kingdom). The antibodies came from Cell Signaling Technology (France) except for the anti-HA antibodies (Covance; France) and anti-sortilin (R&D Systems; France).
Cell Cultures
[0151] The cell lines CAL 27, CAL 33, SQ20B and FaDu (cancer lines from the upper aerodigestive tracts) were supplied by the Centre Oscar Lambret (Lille), and the cell lines DU145 and PC3 (prostate cancer lines), and MDA-MB-231 (breast cancer lines) came from the American Tissue Culture Collection (ATCC, Manassas, Va., USA).
[0152] Cells were maintained in minimum essential medium from Eagle (MDA-MB-231), medium from Dulbecco (CAL 27, CAL 33 and SQ20B), medium RPMI 1640 (DU145, PC3 and FaDu) containing 10% inactivated foetal calf serum (FCS) (Hyclone, France), 2 mM L-glutamine, 1% non-essential amino acids, 40 UI/ml penicillin, 40 μg/ml streptomycin, 50 μg/ml gentamicin and in the presence of ZellShield™ (IX, Biovalley, France) (37° C., 5% CO.sub.2 in a saturated humidity atmosphere).
[0153] The breast cancer line (MDA-MB-231) overexpressing HA-TrkA (hereinafter named “MDA-MB-231 HA-TrkA”) was established in the laboratory by stable overexpression of the TrkA receptor (variant 1 NM_001012331.1) which exhibited a silent mutation at position 799, CAA gives CAG (Thr.fwdarw.Gln), and a sequence conflict at position 263 (Val>Leu) (indexed in Swiss Prot) with an HA label (Hemagglutinin: Tyr Pro Tyr Asp Val Pro Asp Tyr Ala) in the N-terminus position.
Sequential Invalidation Test
[0154] The sequences of siRNA used against EphA2 (siEphA2) at 100 pmol for each transfection, and against TrkA (pool of 3 siTrkA 1, 2 and 3) are given in table 1. The transfections of siRNA are produced by means of INTERFERin™ according to the manufacturers instructions (POL409-10, Polyplus transfection, Ozyme, Saint Quentin en Yvelines, France).
TABLE-US-00001 TABLE 1 RNA inter- ference Sequence siEphA2 GCAAGGAAGUGGUACUGCUGGACUU (SEQ ID NO: 1) siTrkA1 GAACCUGACUGAGCUCUAC (SEQ ID NO: 2) siTrkA2 UGGAGUCUCUCUCCUGGAA (SEQ ID NO: 3) siTrkA3 GCUGCAGUGUCAUGGGCAA (SEQ ID NO: 4)
Western Blot
[0155] After treatment, the cells were lysed (lysis buffer: 40 mM HEPES pH 7.5; 1 mM EDTA pH 8.0; 120 mM NaCl; 10 mM NaPPi; 50 mM NaF; 1.5 mM Na3VO4; 1% Triton X 100; 0.1% SDS; 1 mM PMSF; 10% glycerol and 1/100 th of protease inhibitor cocktail (Sigma) (20 min; 4° C.)). The lysates were recovered and clarified by centrifugation (12,000 g; 10 min; 4° C.). The supernatant was then stored at −80° C. until use. The protein extracts were diluted to 2 μg.Math.μL−1 in a Laemmli 1× buffer (7 min; 100° C.) then deposited and separated on SDS-PAGE (concentration gel 3.6% acrylamide and separation gel 7.5% to 10% acrylamide (thickness 1 mm); 180 V; 10 min then 200 V constant; until output of the migration front). The proteins separated by SDS-PAGE were transferred according to the semi-dry transfer method (buffer: 48 mM Tris base, 39 mM glycine, 1.64 mM SDS, 20% methanol (v/v); 14 V; 15 min per gel) or liquid (buffer: 25 mM Tris base and 192 mM glycine; 15% methanol (v/v); 100 V; 30 min) on nitrocellulose membranes (0.45 μm; Whatman; Germany) or PVDF (0.45 μm; Immobilon P; Millipore; France). The PVDF membrane was “activated” beforehand (methanol; 10 min; 20° C.). The membranes were then saturated (TBS-T; 5% BSA; 1 h; 20° C.) then incubated (16 h; 4° C.) with the chosen primary antibody. The membranes were then washed (TBS-T), incubated (1 h; 20° C.) with a secondary antibody (diluted to 1/5000 th (anti-rabbit) or to 1/10000 th (anti-mouse) in 5% bovine albumin serum) coupled with HRP (horseradish peroxidase), then revealed using the SuperSignal® West Pico kit (Pierce). The membranes were placed in an image analyser (LAS 4000; Fuji) connected to a computer which allowed image generation (software Image Reader LAS 4000).
[0156] The antibody against EphA2 was sc-924 (Santa Cruz), the antibody against sortilin was BD Bioscience 612101, the antibody against TrkA was sc 14024 (Santa Cruz), the antibody against HA was MMS-101R (Covance), the antibody against Akt was Cell Signaling 4691, the antibody against phospho-Akt (Ser 473) was Cell Signaling 9271, the antibody against Src was Cell Signaling 2109 (WB), the antibody against PhosphoSrc (Tyr416) was Cell Signaling 2105 and the antibody against actin was Sigma A2066.
Immunoprecipitation
[0157] The beads (Protein G-agarose, Millipore) were washed twice (12,000 g; 1 min; 4° C.) and recovered in PBS IX (at 50% (v/v)). The protein samples (1 mg) were pre-clarified (1 h; 4° C.; on a wheel (10 rpm)) with 100 μl of beads and 5 μg of isotypical antibodies (mouse IgG2b), centrifuged (12,000 g; 2 min; 4° C.), then the supernatant was incubated (2 h; 4° C.; on a wheel (10 rpm)) with 5 μg of α-HA 12CA5 antibody (Roche). The beads (100 μL at 50% in PBS IX) were added directly to the antibody/protein complex then incubated (2 h; 4° C.; on a wheel (10 rpm)). The antibody/antigen/bead complexes were then centrifuged (12,000 g; 5 min; 4° C.), washed three times (lysis buffer; 4° C.), then disassociated by addition of Laemmli 2× buffer (25 mM Tris-HCl, 0.8% SDS, 4% glycerol, 1% β-mercaptoethanol, pH 6.8) (7 min; 100° C.). Finally, after centrifugation (12,000 g; 10 min; 4° C.), the supernatant was stored at −20° C. The antibody against EphA2 was sc-924 (Santa Cruz), the antibody against sortilin was BD Bioscience 612101, and the antibody against HA was Roche 11 666 606 001.
In situ PLA (Proximity Ligation Assay) in cells MDA-MB-231 HA-TrkA, MDA-MB-231, DU145, PC3 and tissue microarrays.
[0158] The cells (20,000 cells per well) were seeded in the Labtek® which had been treated beforehand with alcohol/hydrochloric acid (absolute ethanol+2% HCl). The cells with then weaned (0.1% FCS; 1 h; 37° C.) then treated or not with proNGF N.C. (0.5 nM) or NGF (16 nM) for 5 minutes. After a fixing step (paraformaldehyde (PFA) 4% in PBS 1× (Phosphate Buffered Saline: 2.7 mM KCl, 8 mM Na2HPO4, 1.8 mM KH2PO4, 137 mM NaCl, pH 7.4; 30 min; 20° C.), the cells were incubated with a blocking solution (TBS-T: 20 mM Tris base, 137 mM NaCl, 0.1% Tween 20, pH 7.6, 4% de bovine serum albumin (BSA); 1 h; 20° C. then with the anti-HA, anti-sortilin and anti-EphA2 primary antibodies diluted to 1/50 th (anti-sortilin and anti-HA) or to 1/100 th (anti-EphA2) in the blocking solution. The cells were then washed twice with PBS 1× for 5 minutes then incubated for 2 hours at 37° C. with the anti-mouse or anti-rabbit “plus” and anti-rabbit or anti-goat “minus” marked oligo PLA probe (Olink Bioscience) diluted to ⅕ th in a solution of 4% BSA. The choice of PLA probes depended on the primary antibodies used. After two washings of 5 minutes with TBS-T, the signal was detected by the 613 Duolink® detection kit (Olink Bioscience) according to the manufacturer's instructions. In order to visualize the nuclei, the cells were also incubated with Hoechst 33 258 (1 mM in PBS 1×) then the samples were mounted on a slide using fluorescence mounting medium (Dako). The PLA images (red fluorescence points) were obtained using a fluorescence microscope (immersion lens 100×, λ-excitation: 562 nm, λ-emission: 624 nm, Eclipse Ti microscope; Nikon, France) then analysed using the NIS-Elements BR software from Nikon. A red fluorescence point reflects an interaction between two proteins (separation of less than 40 nm; quantitative method).
[0159] The marking of the micro-array tissues was carried out using the PLA Brightfield kit (SigmaAldrich) according to the manufacturer's recommendations. The images were acquired using the Eclipse TiU microscope, Nikon (lens 100×).
[0160] The antibody against EphA2 was AF-3035 (R&D Systems), the antibody against sortilin was AF 3154 (R&D Systems), the antibody against TrkA was Alomone labs ANT-018.
In Vitro Invasion Test
[0161] The Boyden Chambers (Transwell®; BD Biosciences; France) were recovered from a biological matrix (type 1 collagen from rats diluted to 400 μg.Math.mL-1 in EMEM-0.1% FCS medium; Millipore). The cells were then seeded with 100,000 cells/well on PET membranes (polyethylene terephtalate; dia.: 10.5 mm; porosity: 8 μm) of Boyden Chambers and held in an EMEM-0.1% FCS medium. The cells were treated with K252a (10 nM) in the upper part of the Transwell®, with or without NGF (16 nM) or proNGF N.C. (0.5 nM) in the lower part. After 20 hours of culture, they were washed twice with PBS 1× and fixed (ice cold methanol; 15 min; −20° C.). The non-invasive cells (upper face of the Transwell®) were eliminated by scraping. The number of cells was estimated after staining with Hoechst 33 258 (1 mM; 30 min; 20° C.) by counting the nuclei thereof using fluorescence microscopy on a total of 5 five randomly chosen fields (lens 10×; λ-excitation: 345 nm; λ-emission: 478 nm; Eclipse Ti) using the ImageJ software. Each experiment was performed in triplicate. Statistical analysis of the results was performed by analysis of variance ANOVA (Bonferroni post-hoc test).
Staining of the Gels with Colloidal Coomassie Blue
[0162] After migration, the gels were fixed (16 h, 20° C.) (25% ethanol (v/v) and 2% H3PO4 at 85% (v/v)), washed three times (2% H3PO4 at 85% (v/v); 20 min, 20° C.) and pre-soaked in a 2% solution of H3PO4 at 85% (v/v), 1.1 M (NH4)2SO4, 17% ethanol (30 min, 20° C.). They were then stained in the same solution supplemented with 0.05 g of Coomassie blue G250 (48 h, 20° C., under agitation).
Destaining of the Gels and Trypsin Digestion
[0163] The spots of interest were excised, rinsed with ultra-pure water and destained by successive baths of an acetonitrile solution (ACN)/NH4HCO3 at 50 mM (50/50, v/v, 20° C., under agitation). After total destaining, the spots were dehydrated (ACN 100%, 3×10 min, 20° C.) then rehydrated (NH4HCO3 100 mM, 10 min, 20° C.). They were then reduced (45 min, 56° C. with 10 mM DTT in 100 mM NH4HCO3) and alkylated (30 min, 20° C., to obscurity with 55 mM iodoacetamide in 100 mM NH4HCO3). After drying with Speed-Vac (30 min, 20° C.), the spots were rehydrated and incubated with trypsin (NH4HCO3 25 mM, 12.5 μg/ml of trypsin (Promega; Charbonnières les bains, France), 1 h, 4° C.). This solution was then renewed, without trypsin and the tubes were incubated (12 h, 37° C.). After recovering the supernatant, the pieces of gel were cleaned successively in a solution of ACN/formic acid (45/10, v/v) (two washings) then in a solution of ACN/formic acid (95/5, v/v). The supernatants were collected, grouped together with the previous, and all evaporated with the Speed-Vac.
Analysis by MS/MS Mass Spectrometry
[0164] The nanoLC-nanoESl-MS/MS analyses were carried out on an ion trap (LCQ Deca XP+, Thermo Electron; Brebières, France) equipped with a nano-electrospray source coupled to a nano-high-performance liquid chromatography (LC Packings Dionex; Voisins le Bretonneux, France). The tryptic digestates were recovered in 4 μl of a solution with 0.1% formic acid and 1.4 μl was injected by using a Famos auto sampler (LC Packings Dionex). The samples were initially desalinated then concentrated on an inverse phase C18 pre-column (length 5 mm and internal dia. 0.3 mm, LC Packings Dionex) by a solvent A (H2O/ACN, 95/5, v/v; 0.1% formic acid), delivered by the Switchos® pumping system (LC Packings Dionex) at a flow rate of 10 μl/min for 3 minutes. The peptides were separated on a C18 Pepmap column (15 cm×75 μm internal dia., LC Packings Dionex). A constant flow rate was applied (200 nL/min). Les peptides were eluted for 45 min using a linear gradient of 5 to 70% of a solvent B (H2O/ACN, 20/80, v/v; 0.08% formic acid). A voltage of 1.5 kV was applied to the nano-electrospray needle (external dia.: 360 μm, internal dia.: 20 μm, internal dia. of the needle point: 10 μm, covered with a conductive alloy, New Objective, Wil, Switzerland). The analyses were carried out in positive mode. The data acquisition was performed in automatic peptide sequencing mode which consists of alternating an MS spectrum between m/z 500-2000 and an MS/MS spectrum of the most intense ion from the previous MS spectrum. The MS/MS spectra were acquired with an isolation window of the parent ion of 2 uma and with a collision energy of 35%. The MS/MS.raw files were transformed into .dta files using the Bioworks 3.1 software (Thermo Electron). The .dta files were then compiled using the merge.bat software downloadable via the Mascot Daemon software version 2.1.6 (www.matrixscience.com) in order to interrogate the databases on SwissProt 51.4 (252616 sequences). The search parameters were as follows: Homo sapiens (taxonomy), an authorized site “missed cleavage” by the trypsin, carbamidomethylation, oxidation of methionines and phosphorylation of the Ser, Thr and Tyr residues (variable modifications), 2 Da (peptide mass tolerance) and 0.8 Da (MS/MS mass tolerance).
Analysis of the Expression of Genes in Breast Tumour Samples.
[0165] The expressions of sortilin (SORT1), EphA2 and TrkA (NTRK1) were analysed on samples of tumours and breasts. The analysis was carried out on the basis of data collected from 35 cohorts published on the site of the National Center for Biotechnology Information (NCBI)/Genbank GEO database, from the European Bioinformatics Institute (EBI) ArrayExpress database and from the Institut Paoli Calmettes (Marseilles). 6183 cases of non-invasive breast cancer were analysed for the expression of NTRK1 and correlated with clinicopathological data. Pre-analytical processing of the data was then applied. The datasets coming from Agilent DNA chips were normalized by the quantiles to be applied in order to obtain the processed data. For the data generated by the Affimetrix DNA chips, the RMA normalization method (Robust Multichip Average) (48) was used with the algorithm for non-parametric calculating of the quantiles. In order to make all of the data comparable and to exclude any bias arising from the heterogeneity of the populations, the level of NTRK1 expression was standardized inside each data set by taking the luminal A population as the reference, the molecular subtype of the tumours being defined by the PAM50 “Predictor” (49). When several probes were studied with NTRK1, those with the highest variants in a particular dataset were selected. The over-regulation of NTRK1 was defined by the increase in expression above the median level. The correlations between NTRK1 expression and the histochemical variables include the age of the patients at the time of diagnosis (≦50 years vs. >50), pathological state of the axillary lymph node (pN: negative vs. positive), the size of the tumour (pT: pT1 vs. pT2-3), the stage (I vs. 2-3), immunocytochemistry (IHC) of the estrogen receptor alpha (ER), of the progesterone receptor (PR), the status of the ERBB2 receptor (positive vs. negative) for each patient, and the duration of metastases free survival (MFS) for patients not exhibiting metastasis at the time of diagnosis, were investigated. The metastases free survival was calculated from the date of diagnosis to the date of the first metastases discovered. The survival of the patient was measured from the date of diagnosis to the date of first recurrence (follow-up). Survival is calculated by the Kaplan Meier method and the curves are analysed by a log-rank test. Distributions were analysed by Fisher test. Significance was considered with a threshold of 5%. All the analyses were carried out following the “REcommendations for tumor MARKer prognostic studies” (REMARK criteria) (50).
RESULTS
Cell Invasion Tests
[0166] After 24 hours of treatment, it was observed that NGF and proNGF increased cell invasion for cancer lines CAL33, DU145, PC3 and MDA-MB-231. In contrast, tumour cells FaDu and CAL27 did not respond to any growth factors, while the cell invasion of SQ20B was induced uniquely during treatment with NGF (
[0167] Analyses using the Western Blot method were then carried out in order to evaluate the levels of EhA2, sortilin and TrkA in the cells responding to proNGF (CAL33, DU145, PC3 and MDA-MB-231) (
[0168] The involvement of EphA2 in the pro-invasive effects of proNGF was evaluated using a Boyden chamber on the cells overexpressing EphA2 (DU145, PC3 and MDA-MB-231). As shown in
Analysis of the Expression of Genes in Breast Tumour Samples
[0169] In addition, a retrospective analysis carried out on a cohort of 588 patients on DNA micro-arrays (DNA chips) made it possible to correlate the expression of the receptors sortilin, TrkA and EphA2 with a poor prognosis in breast cancer (
[0170] The detection of TrkA/EphA2 complexes in the breast tumours was also affected by using two microarray tissues (ref CBA4 (superbiochips) and ref Hbre-Duc 150Sur-01 (US Biomax)) i.e. a total of 182 tumour samples (n=182). The intensity of the PLA marking was scored as absence of signal, very weak/weak signal, medium/strong signal. The results are presented in the form of a Kaplan Meier graph. The results show that an association of the TrkA and EphA2 receptors revealed by the Duolink® technique is correlated with a significant reduction (log-rank test, p<0.0001) in the overall survival of patients. The detection of the TrkA/EphA2 complex is therefore correlated with a poor prognosis in breast cancer.
Immunoprecipitation Tests
[0171] The formation of a complex between TrkA, EphA2 and sortilin was analysed by immunoprecipitation in cells MDA-MB-231 HA-TrkA as well as the PLA tests (Proximity Ligation Assay).
[0172] The association of the 3 receptors in the complex was first highlighted by mass spectrometry, the proteins immunoprecipitated by an antibody against HA-TrkA were identified (
[0173] The immunoprecipitation tests were carried out using antibodies against HA, against sortilin and against EphA2 in cells MDA-MB-231 HA-TrkA (
[0174] In the absence of proNGF, no complex was observed between said three receptors. In contrast, with treatment by proNGF, sortilin and EphA2 were co-immunoprecipitated with TrkA.
[0175] By comparison, in the presence of NGF, the sortilin/TrkA Bond was only detected after 30 minutes of treatment, however the bond with EphA2 has not been observed, neither after 5 minutes of treatment nor after 30 minutes. These results have been confirmed by inverse immunoprecipitation of sortilin and EphA2. Hence, the NGF treatment appears to induce a delayed association of TrkA and sortilin but does not induce bonding with EphA2. These data confirm the results found in the literature, in that in the presence of NGF, sortilin acts as an endocytosis receptor in the neuron cell models.
PLA Tests (Proximity Ligation Assay)
[0176] The PLA tests carried out on cells MDA-MB-231 were performed to confirm the interaction between sortilin and HA-TrkA and between HA-TrkA and EphA2 in cells MDA-MB-231 HA-TrkA (results not shown).
[0177] In the absence of proNGF, no PLA signal was displayed, which suggests that these receptors do not form a pre-existing complex.
[0178] In contrast, under treatment with proNGF, the PLA tests show an interaction between sortilin and TrkA and between EphA2 and TrkA, which indicates that TrkA interacts directly with sortilin and EphA2, and does so at a distance less than 40 nm (results not shown).
[0179] No PLA signal was detected in the tests between sortilin and EphA2, which suggests that proNGF does not introduce direct interaction between these two receptors (results not shown).
[0180] Moreover, the PLA tests in native cells MDA-MB-231, DU145, PC3 confirm that TrkA and EphA2 are engaged in a complex under treatment with proNGF, in the same way as cells MDA-MB-231 HA-TrkA (results not shown).
[0181] In comparison with proNGF, NGF induces no PLA signal in the cells MDA-MB-231, revealing the absence of receptor complex (results not shown).
Sequential Invalidation Tests
[0182] The impact of a sequential invalidation of each of the receptors in the formation of this complex was then analysed.
[0183] The expression of TrkA was inhibited by interfering RNA (siTrkA) (
[0184] Interestingly, in the cells which stably express kinase-dead TrkA and in which phosphorylation of TrkA has been abolished (
[0185] The involvement of sortilin in the sortilin/TrkA/EphA2 complex was then evaluated using neurotensin which inhibits by competition the bonding of proNGF to sortilin (
[0186] In the presence of neurotensin, TrkA precipitates neither sortilin nor EphA2. Thus, the proNGF/sortilin bonding would appear to be indispensable for the formation of the TrkA/sortilin/EphA2 complex.
[0187] Finally, the involvement of EphA2 in the association of the receptors complex has been studied using an anti-EphA2 interfering RNA (
[0188] The transient inhibition of EphA2 completely abolished the expression of this protein and consequently no bond was observed between EphA2 and TrkA.
[0189] Nevertheless, in the absence of EphA2, proNGF always induced an association between TrkA and sortilin. Consequently, TrkA associates with sortilin after treatment with proNGF in a manner independent of EphA2.
[0190] These results demonstrate the following points:
[0191] 1. TrkA, sortilin and EphA2 do not form a pre-existing complex;
[0192] 2. the TrkA/EphA2 requires the association of proNGF and sortilin as a prerequisite;
[0193] 3. TrkA is necessary for the formation of this receptor complex, independently of the phosphorylation state thereof;
[0194] 4. inhibition of EphA2 does not alter the TrkA/sortilin complex.
[0195] These results suggest that proNGF induces the association between sortilin and TrkA, then causes the recruitment of EphA2 on the sortilin/TrkA complex.
Example 2
[0196] TrkA and EphA2 are involved differently in the activation of proteins Akt and Src, induced by proNGF.
[0197] Unless stated otherwise, the products, reagents and cell cultures are the same as those for example 1.
[0198] Proteins Akt and Src were both involved in the pro-invasive effect of proNGF. In order to identify the role of TrkA and EphA2 in the activation of proteins Akt and Src, cells MDA-MB-231 were treated respectively with a TrkA inhibitor (K252a), an anti-EphA2 siRNA (siEphA2) the sequence of which is presented in table 1, a PI3-K inhibitor (LY294002) (the activation of Akt in effect underlies that of PI3-K) and an inhibitor of Src (SKI-1).
[0199] The transfections of siRNA are produced by means of INTERFERin™ according to the manufacturers instructions (POL409-10, Polyplus transfection, Ozyme, Saint Quentin en Yvelines, France).
RESULTS
[0200] As demonstrated in
[0201] Inhibition of the phosphorylation of TrkA through the use of K252a abolished the activation of Akt but not that of Src. Similar results were obtained through the use of a kinase-dead mutant of TrkA (
[0202] The inhibition of Akt activation using LY294002 does not modify the phosphorylation of Src. Similarly, the inhibition of Src with SKI-1 does not affect the phosphorylation of Akt. Consequently, the activation of Akt and Src by proNGF represents two different signalling channels.
[0203] The involvement of EphA2 in the activation of Akt and Src was determined by transient transfection of the cells having an EphA2 interference RNA (
[0204] It has therefore been shown that protein Akt is activated by proNGF via phosphorylation of TrkA, while protein Src is activated by EphA2 independently of the phosphorylation of TrkA
[0205] The effects of the NGF were determined for comparison (
[0206] NGF increased the phosphorylations of Akt and Src, while the TrkA inhibitor, K252a, inhibited this activation (
[0207] These results also show that the activation of Src induced by proNGF requires both TrkA and EphA2, but that it is independent of the phosphorylation of TrkA. In contrast, the activation of Akt induced by proNGF is dependent on the phosphorylation of TrkA but not EphA2. Unlike proNGF, the signalling of NGF only requires TrkA in order to activate Akt and Src without any EphA2 involvement.
Example 3
[0208] The TrkA/EphA2 complex is involved in the development and aggressiveness of in vivo tumours
[0209] Unless stated otherwise, the products, reagents and cell cultures were the same as those for example 1.
[0210] Tests of xenografts of tumour lines on immune deficient mice were carried out using cells MDA-MB-231.
Xenografts of Tumour Lines in Immunodeficient Nice.
[0211] Experiment 1: the mice used were six-week old SCID females. Cells MDA-MB-231 HA-TrkA (3×10.sup.6) were injected subcutaneously into the flank of the mice. The mice with then randomly distributed into experimental groups (7 mice in the control group and 6 in the others). Fourteen days after inoculation with the cells, the animals were treated three times with an interval of 3 days between each injection. CEP-701 (Calbiochem) was dissolved in a mixture (40% polyethylene glycol 1000, 10% povidone C30 and 2% benzyl alcohol in distilled water) and injected by the intraperitoneal route (10 mg/kg). The EphA2 siRNA (7.5 microg/mouse) was injected close to the tumour mass using the in vivo jetPEI® (Polyplus transfection) according to the manufacturer's recommendations. The tumour volume was measured according to the following formula: π/6×length×width×(width+length)/2. The statistical analyses were carried out using the Mann and Whitney test and the GraphPad Prism 5.01 software.
[0212] Experiment 2: The mice used were six-week old SCID females. Cells MDA-MB-231 HA-TrkA (3×106) were injected subcutaneously into the flank of the mice. The mice were then randomly distributed into the experimental groups (10 mice/group). Fourteen days after inoculation with the cells, the animals were treated five times with an interval of 3 days between each injection. The EphA2 and TrkA siRNA (7.5 microg/mouse) were injected close to the tumour mass using the in vivo jetPEI® (Polyplus transfection)according to the manufacturer's recommendations. The tumour volume was measured according to the following formula: π/6×length×width×(width+length)/2. Survival is presented in the form of a Kaplan Meier graph.
RESULTS
[0213] It had previously been demonstrated that K252a (TrkA inhibitor) reduces the growth of tumours xenografted with cells MDA-MB-231 overexpressing TrkA (34).
[0214] Here, a lesser dose of analogue of K252a (CEP-701 at 10 mg/kg) was used in order to guarantee a moderate reduction in tumour growth.
[0215] As shown in
[0216] In a particularly interesting way, the combined CEP-701/siEphA2 treatment induced a significant reduction in the tumour load in comparison to CEP-701 only or siEphA2 only. These results indicate that TrkA and EphA2 cooperate in vivo in order to increase tumour growth.
[0217] In order to validate the involvement of TrkA in tumour development, a second animal experiment was carried out by replacing CEP-701 with an siRNA against TrkA, which specifically invalidated its expression. The results are shown in terms of survival. The median survivals are respectively 40 days in the control, 53 days in the presence of siTrkA, 49 days in the presence of siEphA2 and 57.5 days in the presence of siTrkA and siEphA2. These results are significantly different as indicated by the log-rank test (P=0.0022). These results indicate that CEP-701 and an siRNA against TrkA have the same effects on tumour growth and confirm the observations made by the western blot method on tumour cells. In total, the data also shows that the inhibition of growth observed by the treatment with CEP-701 depends on its effects on the TrkA receptor.
Example 4
[0218] A treatment combining a TrkA inhibitor (lestaurtinib) and an EphA2 inhibitor (EphrinA1-Fc) reduces the invasion of breast cancer cells
[0219] Unless stated otherwise, the products, reagents and cell cultures were the same as those for example 1.
[0220] The invasion test was carried out on the cells MDA-MB-231. Non-stimulated cells of proNGF served as the control and determine a base invasion of 100% (white bar in
RESULTS
[0221] As can be seen in
Example 5
[0222] The TrkA/EphA2 complex is also found in several types of tumour.
[0223] Unless stated otherwise, the products, reagents and cell cultures were the same as those for example 1.
Proximity Ligation Assay on Paraffined Tumour Samples from the Buccal Cavity.
[0224] The paraffin is removed from the stage T4 buccal cavity tumour samples (N0, M0) with bone infiltration (obtained from the anatomopathology department of the CHRU in Lille) in baths of ClaRal (derivative of xylene) (for 1×12 h and 1×5 h). The sections are then rehydrated by successive baths: ClaRal/ethanol 100% (1:1) (1×5 min), ethanol 100% (2×5 min), ethanol 96% (2×5 min), ethanol 70% (2×5 min), distilled water (1×5 min). The blocking of endogenous peroxidases is achieved by a solution of hydrogen peroxide supplied in the Duolink kit, In Situ® Detection Reagents Brightfield (DU092012; Sigma-Aldrich) 10 min at 20° C. The sections are then washed with TBS (20 mM Tris base, 137 mM NaCl) (2×5 min) then incubated with a blocking solution supplied in the Duolink® kit (Blocking solution; 1 h; 20° C.). The samples are then incubated, the primary antibodies anti-TrkA diluted to 1/25 th (ANT-018; Alomone Labs) and anti-EphA2 diluted to 1/50 th (AF3035; RD systems), in the blocking solution at 4° C. overnight. The sections are then washed three times with solution A (0.01 M Tris, 0.15 M NaCl, 0.05% Tween 20) for 5 minutes and then incubated for 1 hour at 37° C. with the PLA probes: oligo-marked anti-rabbit “plus” (DU092006; Sigma-Aldrich) and anti-goat “minus” (DU092002; Sigma-Aldrich) diluted to ⅕ th in a solution of PBS 1× 1% SVP (Phosphate Buffered Saline: 2.7 mM KCl, 8 mM Na2HPO4, 1.8 mM KH2PO4, 137 mM NaCl, pH 7.4; 1% foetal calf serum). The ligation step is carried out according to the manufacturer's recommendations. After two washes of 5 minutes with solution A, the probes were amplified using a polymerase ( 1/80 th in amplification buffer 1×; 2 hours at 37° C.). The signal detection and the counter staining are carried out according to the protocol established by the supplier. The sections are then washed three times for 5 minutes in distilled water and then dehydrated by successive ethanol baths 70% (2×5 min), ethanol 96% (2×5 min), ethanol 100% (2×5 min), ClaRal/ethanol 100% (1:1) (1×5 min) and ClaRal (2×10 min). The slides are dried and then mounting between the slide and cover is carried out using Duolink® mounting medium (DU092012; Sigma-Aldrich). The PLA images (brown points) are obtained using a microscope coupled to a camera (lens 40×, microscope Eclipse Ti; Nikon, France) then analysed using the NIS-Elements BR software from Nikon. A brown point reflects an interaction between two proteins (separation of less than 40 nm; quantitative method).
RESULTS
[0225] The expression of TrkA and EphA2 was detected by immunohistochemical staining and TrkA/EphA2 association was detected by PLA (Duolink®) in a buccal cavity tumour. Although the adjacent epithelium and the tumour masses showed a TrkA and EphA2 marking, only the tumour mass was positive (dot-shaped marking) for the PLA (results not shown). This demonstrates an action mechanism of TrkA and EphA2 in the buccal cavity tumours similar to that in the breast tumours.
[0226] It has therefore been shown by in vitro and in vivo experiments that TrkA and EphA2 have an effect on the invasion and growth of cancer cells, justifying the interest in combining a TrkA inhibitor and an EphA2 inhibitor in order to combat these forms of solid cancer.
REFERENCES
[0227] (1) Magné N, Chargari C, Conforti R, Toillon R A, Bauduceau O, Védrine L, Khayat D, Spano J P. [Mechanisms of resistance to molecular targeted therapies in breast cancer: update and future]. Bull Cancer. 2010 March; 97(3):385-95. [0228] (2) Adriaenssens E, Vanhecke E, Saule P, Mougel A, Page A, Romon R, Nurcombe V, Le Bourhis X, Hondermarck H. Nerve growth factor is a potential therapeutic target in breast cancer. Cancer Res. 2008 Jan. 15; 68(2):346-51. [0229] (3) Demont Y, Corbet C, Page A, Ataman-Ônal Y, Choquet-Kastylevsky G, Fliniaux I, Le Bourhis X, Toillon R A, Bradshaw R A, Hondermarck H. Pro-nerve growth factor induces autocrine stimulation of breast cancer cell invasion through tropomyosin-related kinase A (TrkA) and sortilin protein. J Biol Chem. 2012 Jan. 13; 287(3): 1923-31. [0230] (4) U.S. National Institutes of Health, study NCT00079482), Levis M, Ravandi F, Wang E S, Baer M R, Perl A, Coutre S, Erba H, Stuart R K, Baccarani M, Cripe L D, Tallman M S, Meloni G, Godley L A, Langston A A, Amadori S, Lewis I D, Nagler A, Stone R, Yee K, Advani A, Douer D, Wiktor-Jedrzejczak W, Juliusson G, Litzow M R, Petersdorf S, Sanz M, Kantarjian H M, Sato T, Tremmel L, Bensen-Kennedy D M, Small D, Smith B D. Results from a randomized trial of salvage chemotherapy followed by lestaurtinib for patients with FLT3 mutant AML in first relapse. Blood. 2011 Mar 24; 117(12):3294-301 [0231] (5) Trk kinase inhibitors as new treatments for cancer and pain, Tao Wang, Dingwei Yu & Michelle L Lamb, 2009 Informa UK Ltd ISSN 1354-3776 Cancer Discovery, AstraZeneca R&D Boston, Waltham, Mass., USA; [0232] (6) Angiostatic effects of K252a, a Trk inhibitor, in murine brain capillary endothelial cells, Arien-Zakay H, Kohan M, Lelkes P I, 2010 June;339 (1-2):201-13. doi: 10.1007/s11010-010-0386-9. [0233] (7) Ruggeri B, Miknyoczki S, Singh J, et al. Role of neurotrophin-Trk interactions in oncology: the anti-tumor efficacy of potent and selective Trk tyrosine kinase inhibitors in pre-clinical tumor models. Curr Med Chem 1999; 6:845-57 [0234] (8) Cee V J, Albrecht B K, Geuns-Meyer S, et al. Alkynylpyrimidine amide derivatives as potent, selective, and orally active inhibitors of Tie-2 kinase. J Med Chem 2007; 50:627-40; [0235] (9) Hudkins R L, Josef K A. Pyrazole Trk kinase inhibitors for the treatment of cancer. Expert Opin Ther Patents 2007; 17:351-6; [0236] (10) Das J, Furch J A, Liu C, et al. Discovery and SAR of 2-amino-5-(thioaryl)thiazoles as potent and selective Itk inhibitors. Bioorg Med Chem Lett 2006; 16:3706-12; [0237] (11) Kim S H, Tokarski J S, Leavitt K J, et al. Identification of 2-amino-5-(thioaryl)thiazoles as inhibitors of nerve growth factor receptor TrkA. Bioorg Med Chem Lett 2008;18:634-9 [0238] (12) Ghose A K, Herbertz T, Pippin D A, et al. Knowledge based prediction of ligand binding modes and rational inhibitor design for kinase drug discovery. J Med Chem 2008; 51:5149-71 [0239] (13) Gingrich D E, Yang S X, Gessner G W, et al. Synthesis, modeling, and in vitro activity of (3′ S)-epi-K-252a analogues. Elucidating the stereochemical requirements of the 3′-sugar alcohol on TrkA tyrosine kinase activity. J Med Chem 2005; 48:3776-83. [0240] (14) Tripathy R, Angeles T S, Yang S X, et al. TrkA kinase inhibitors from a library of modified and isosteric staurosporine aglycone. Bioorg Med Chem Lett 2008; 18:3551-5 [0241] (15) Wood E R, Kuyper L, Petrov K G, et al. Discovery and in vitro evaluation of potent TrkA kinase inhibitors: oxindole and aza-oxindoles. Bioorg Med Chem Lett 2004; 14:953-71 [0242] (16) Faivre S, Demetri G, Sargent W, et al. Molecular basis for sunitinib efficacy and future clinical development. Nat Rev Drug Discov 2007; 6:734-45 [0243] (17) Fancelli D, Moll J, Varasi M, et al. 1,4,5,6-tetrahydropyrrolo[3,4-c]pyrazoles: Identification of a potent aurora kinase inhibitor with a favorable antitumor kinase inhibition profile. J Med Chem 2006; 49:7247-51 [0244] (18) Lippa B, Morris J, Corbett M, et al. Discovery of novel isothiazole inhibitors of the TrkA kinase: structure-activity relationship, computer modeling, optimization, and identification of highly potent antagonists. Bioorg Med Chem Lett 2006; 16:3444-8 [0245] (19) Albaugh et al. (2012) ACS Med. Chem. Lett., 3(2): 140-145 [0246] (20) Kohler et al. Nature. 1975; 256(5517):495-7 [0247] (21) Cote et al Proc Natl Acad Sei USA. 1983; 80(7):2026-30 [0248] (22) Tuerk et al. (1990) Science, 249, 505-510 [0249] (23) Ljubica Ivanisevic, THE JOURNAL OF BIOLOGICAL CHEMISTRY VOL. 282, 5 NO. 23, pp. 16754-16763, Jun. 8, 2007 [0250] (24) Phase II Study of Dasatinib (BMS-354825) in Patients With Metastatic Adenocarcinoma of the Pancreas, Cheng Ean Chee, Smitha Krishnamurthi, Charles J. Nock et al. The Oncologist 2013; 18:1091-1092 [0251] (25) Enhancing Chemotherapy Response with Sustained EphA2, Silencing Using Multistage Vector Delivery, Haïfa Shen, Cristian Rodriguez-Aguayo, Rong
[0252] Xu et al., Clin Cancer Res 2013; 19:1806-1815 [0253] (26) Katherine R. Amato J Clin Invest. 2014; 124(5):2037-2049 [0254] (27) Zelinski D P, Zantek N D, Stewart J C, Irizarry A R, Kinch M S. EphA2 overexpression causes tumorigenesis of mammary epithelial cells. Cancer Res. 2001; 61:2301-6.
[0255] (28) Hochgrafe F, Zhang L, O'Toole S A, Browne B C, Pinese M, Porta Cubas A, et al. Tyrosine phosphorylation profiling reveals the signaling network characteristics of Basal breast cancer cells. Cancer Res. 2010; 70:9391-401.
[0256] (29) Drake J M, Graham N A, Stoyanova T, Sedghi A, Goldstein A S, Cai H, Smith D A, Zhang H, Komisopoulou E, Huang J, Graeber T G, Witte O N. Oncogene-specific activation of tyrosine kinase networks during prostate cancer progression. Proc Natl Acad Sei USA. 2012 Jan. 31; 109(5):1643-8 [0257] (30) Batson J, Maccarthy-Morrogh L, Archer A, Tanton H, Nobes C D. EphA receptors regulate prostate cancer cell dissemination through Vav2-RhoA mediated cell-cell repulsion. Biol Open. 2014 May 2. [0258] (31) Kotoula V, Lambaki S, Televantou D, Kalogera-Fountzila A, Nikolaou A, Markou K, Misailidou D, Syrigos K N, Fountzilas G. STAT-Related Profiles Are Associated with Patient Response to Targeted Treatments in Locally Advanced SCCHN. Transl Oncol. 2011 Feb. 1; 4(1):47-58 [0259] (32) Bioorganic & Medicinal Chemistry Letters, Volume 8, Issue 16, 18 Aug. 1998, pages 2219-2222 [0260] (33) M. Egholm et al., J. Am. Chem. Soc. (1992), 114, 1895-1897 [0261] (34) Maleck, L., et al., 1994, Methods in Molecular Biology, 28, ch 36, Ed P. G. Isaac, Humana Press, Inc., Totowa, N I [0262] (35) Lagadec C, Meignan S, Adriaenssens E, Foveau B, Vanhecke E, Romon R, et al. TrkA overexpression enhances growth and metastasis of breast cancer cells. Oncogene. 2009; 28:1960-70. [0263] (36) Wykosky J, Debinski W. The EphA2 receptor and ephrinA1 ligand in solid tumors: function and therapeutic targeting. Mol Cancer Res. 2008 Dec; 6(12): 1795-806.
[0264] (37) Arrighi N, Bodei S, Zani D, Simeone C, Cunico SC, Missale C, Spano P, Sigala S. Nerve growth factor signaling in prostate health and disease. Growth Factors. 2010 June; 28(3):191-201 [0265] (38) Anagnostopoulou V, Pediaditakis I, Alkahtani S, Alarifi S A, Schmidt E M, Lang F, Gravanis A, Charalampopoulos I, Stoumaras C. Differential effects of dehydroepiandrosterone and testosterone in prostate and colon cancer cell apoptosis: the role of nerve growth factor (NGF) receptors. Endocrinology. 2013 July; 154(7):2446-56 [0266] (39) Kolokythas A, Cox D P, Dekker N, Schmidt B L. Nerve growth factor and tyrosine kinase A receptor in oral squamous cell carcinoma: is there an association with perineural invasion? J Oral Maxillofac Surg. 2010 June; 68(6):1290-5. [0267] (40) Trovisco V, Soares P, Preto A, Castro P, Maximo V, Sobrinho-Simões M. Molecular genetics of papillary thyroid carcinoma: great expectations. Arq Bras Endocrinol Metabol. 2007 July; 51(5):643-53. [0268] (41) Karidis N P, Giaginis C, Tsourouflis G, Alexandrou P, Delladetsima I, Theocharis S. Eph-A2 and Eph-A4 expression in human benign and malignant thyroid lesions: an immunohistochemical study. Med Sci Monit. 2011 September; 17(9):BR257-65 [0269] (42) Zhu Z, Friess H, diMola F F, Zimmermann A, Graber H U, Korc M, Büchler M W. Nerve growth factor expression correlates with perineural invasion and pain in human pancreatic cancer. J Clin Oncol. 1999 August; 17(8):2419-28. [0270] (43) Nakagawara A, Arima-Nakagawara M, Scavarda N J, Azar C G, Cantor A B, Brodeur G M. Association between high levels of expression of the TRK gene and favorable outcome in human neuroblastoma. N Engl J Med. 1993 Mar. 25; 328(12):847-54. [0271] (44) Wang Y, Hagel C, Hamel W, Müller S, Kluwe L, Westphal M. Trk A, B, and C are commonly expressed in human astrocytes and astrocytic gliomas but not by human oligodendrocytes and oligodendroglioma. Acta Neuropathol. 1998 October; 96(4):357-64. [0272] (45) Truzzi F, Marconi A, Lotti R, Dallaglio K, French L E, Hempstead B L, Pincelli C. Neurotrophins and their receptors stimulate melanoma cell proliferation and migration. J Invest Dermatol. 2008 August; 128(8):2031-40 [0273] (46) Kim M S, Kim G M, Choi Y J, Kim H J, Kim Y J, Jin W. c-Src activation through a TrkA and c-Src interaction is essential for cell proliferation and hematological malignancies. Biochem Biophys Res Commun. 2013 Nov. 15; 441(2):431-7. [0274] (47) Lazarova P, Wu Q, Kvalheim G, Suo Z, Haakenstad K W, Metodiev K, Nesland J M. Growth factor receptors in hematopoietic stem cells: EPH family expression in CD34+ and CD133+ cell populations from mobilized peripheral blood. Int J Immunopathol Pharmacol. 2006 January-March; 19(1):49-56. [0275] (48) Irizarry R A, Hobbs B, Collin F, Beazer-Barclay Y D, Antonellis K J, Scherf U, et al. Exploration, normalization, and summaries of high density oligonucleotide array probe level data. Biostatistics. 2003; 4:249-64. [0276] (49) Parker J S, Mullins M, Cheang M C, Leung S, Voduc D, Vickery T, et al. Supervised risk predictor of breast cancer based on intrinsic subtypes. J Clin Oncol. 2009; 27:1160-7. [0277] (50) McShane L M, Altman D G, Sauerbrei W, Taube S E, Gion M, Clark G M. REporting recommendations for tumor MARKer prognostic studies (REMARK). Breast Cancer Res Treat. 2006; 100:229-35. [0278] (51) Zhu Z, Kleeff J, Kayed H, Wang L, Korc M, Buchler M W, et al. Nerve growth factor and enhancement of proliferation, invasion, and tumorigenicity of pancreatic cancer cells. Mol Carcinog. 2002; 35:138-47. [0279] (52) Festuccia C, Muzi P, Gravina G L, Millimaggi D, Speca S, Dolo V, et al. Tyrosine kinase inhibitor CEP-701 blocks the NTRK1/NGF receptor and limits the invasive capability of prostate cancer cells in vitro. Int J Oncol. 2007; 30:193-200. [0280] (53) Truzzi F, Marconi A, Lotti R, Dallaglio K, French L E, Hempstead B L, et al. Neurotrophins and their receptors stimulate melanoma cell proliferation and migration. J Invest Dermatol. 2008; 128:2031-40. [0281] (54) Kolokythas A, Cox D P, Dekker N, Schmidt B L. Nerve growth factor and tyrosine kinase A receptor in oral squamous cell carcinoma: is there an association with perineural invasion? J Oral Maxillofac Surg. 2010; 68:1290-5. [0282] (55) R&D systems, Recombinant Human Ephrin-A1 Fe Chimera) (Mark S. Duxbury, Biochemical and Biophysical Research Communications 320 (2004) 1096-1102 [0283] (56) Munetaka Hirose, British Journal of Pharmacology (2004) 142, 222-228