Methods for Predicting and Monitoring Cancer Patients' Response to Teatment by Measuring Myeloid Derived Suppressor Cells (MDSCs)
20170261507 · 2017-09-14
Inventors
- Michal Baniyash (Mevasseret Zion, IL)
- Michal LOTEM (Makabim-Re'ut, IL)
- Moshe SADE-FELDMAN (Modiin, IL)
- Julia KANTERMAN (Modiin, IL)
Cpc classification
G01N2800/52
PHYSICS
G01N2333/70553
PHYSICS
C07K2317/76
CHEMISTRY; METALLURGY
C12Q2600/106
CHEMISTRY; METALLURGY
International classification
C07K16/28
CHEMISTRY; METALLURGY
Abstract
Provided herein are methods and kits for predicting and monitoring a cancer patient's response to treatment with a therapeutic agent by measuring the amount of myeloid derived suppressor cells (MDSC) having the profile CDl11b.sup.+CD33.sup.+HLA-DR.sup.− and/or CDl11b.sup.+CD33.sup.+HLA-DR.sup.low, and optionally by further measuring various suppressive features of the patient's immune system. Also provided herein are methods of treating a cancer patient comprising as an initial step determining whether the cancer patient would be responsive to treatment with the therapeutic agent as described above and wherein the patient is found to be responsive, administering the therapeutic agent.
Claims
1-27. (canceled)
28. A method for predicting a cancer patient's response to treatment with an immunotherapeutic agent, said method comprising the steps of: (a) measuring the amount of myeloid derived suppressor cells (MDSC) having the profile CD11b+CD33+HLA-DR− and/or CD11b+CD33+HLA-DRlow, in at least one biological sample being a whole blood sample obtained from the patient, wherein said whole blood sample is a fresh sample, a frozen sample, a preserved sample or a cryopreserved sample; (b) determining whether the amount of MDSC of said profile is higher than a predetermined standard value or higher than a control sample; wherein detection of a high amount of MDSC of the above profile in the at least one biological sample as compared with the predetermined standard value or the control sample indicates that the patient will not respond or will poorly respond to treatment with said agent; and (c) if the patient was not found to be irresponsive or poorly responsive to treatment with said agent, at least one of the following steps are performed: i) including said patient in a clinical study; ii) starting or continuing treatment of said patient with said immunotherapeutic agent; or if the patient was found to be irresponsive or poorly responsive to treatment with said agent, at least one of the following steps are performed: iii) excluding said patient from a clinical study; and iv) ceasing treatment of said patient with said immunotherapeutic agent.
29. A method according to claim 28, wherein said method is for at least one of the following: (a) including or excluding patients in a clinical study; (b) deciding whether the patient should start, continue or cease therapy with said immunotherapeutic agent; or (c) deciding which combination of immunotherapeutic agents should be used.
30. A method for monitoring a cancer patient's response to treatment with an immunotherapeutic agent, said method comprising the steps of: (a) measuring the amount of myeloid derived suppressor cells (MDSC) having the profile CD11b+CD33+HLA-DR− and/or CD11b+CD33+HLA-DRlow, in at least one biological sample being a whole blood sample obtained from the patient, wherein said whole blood sample is a fresh sample, a frozen sample, a preserved sample or a cryopreserved sample; (b) determining whether the amount of MDSC of said profile is higher than a predetermined standard value or higher than a control sample; wherein detection of a high amount of MDSC of the above profile in the at least one biological sample as compared with the predetermined standard value or the control sample indicates that the patient is not responding or is poorly responding to treatment; and (c) if the patient was not found to be irresponsive or poorly responsive to treatment with said agent, continuing treatment of said patient with said immunotherapeutic agent; or if the patient was found to be irresponsive or poorly responsive to treatment with said agent, at least one of the following steps are performed: i) discontinuing treatment with said immunotherapeutic agent; or ii) combining the treatment with said immunotherapeutic agent with at least one additional compound being an anti-inflammatory and/or an anti-MDSC therapeutic agent.
31. A method according to claim 30, wherein said method is used for determining the patient's therapeutic regime by at least one of the following: (a) discontinuing treatment with said immunotherapeutic agent; or (b) combining the treatment with said immunotherapeutic agent with at least one additional compound being an anti-inflammatory and/or an anti-MDSC therapeutic agent.
32. The method of claim 28, wherein said measuring of step (a) is performed prior to treatment with said immunotherapeutic agent.
33. The method of claim 30, wherein said measuring of step (a) is performed at least once, preferably more than once, during treatment with said immunotherapeutic agent.
34. A method according to claim 28, wherein said immunotherapeutic agent is selected from the group consisting of therapeutic antibodies, immune checkpoints inhibitors, cytokines, tumor infiltrating lymphocytes (TIL) and cancer vaccines.
35. A method according to claim 28, wherein the cancer is selected from the group consisting of adrenal cancer, bladder cancer, brain cancer, breast cancer, cervical cancer, colorectal carcinoma, endometrial cancer, gastro-intestinal cancers, head and neck squamous cell carcinoma, leukemia, malignant lymphoma, including Hodgkin's lymphoma, liver cancer, melanoma, ovarian cancer, pancreatic cancer, prostate cancer, renal cancer, sarcoma, small cell lung cancer, non-small cell lung cancer, and thyroid cancer.
36. A method according to claim 35, wherein the cancer is melanoma or colorectal carcinoma.
37. The method of claim 28, wherein said measuring of step (a) is performed by a method comprising the step of contacting detecting molecules specific for MDSC with the biological sample.
38. The method of claim 37, wherein said detecting molecules are labeled detecting molecules.
39. The method of claim 37, wherein said detecting molecules are attached to a substrate.
40. The method of claim 37, wherein said detecting molecules are antibodies that specifically recognize and bind MDSC having the profile CD11b.sup.+CD33.sup.+HLA-DR.sup.− and/or CD11b.sup.+CD33.sup.+HLA-DR.sup.low.
41. The method of claim 28, wherein said method further comprises after step (b) the step of at least one of: (A) determining the expression levels of S100A8 and/or S100A9 proteins or encoding mRNA in said biological sample; (B) determining the levels of cleaved caspase 3 in said biological sample; (C) determining at least one of the level and/or activity of arginase 1 and iNOS in said biological sample; (D) determining at least one of intracellular nitric oxide (NO) and reactive oxygen species (ROS) in said biological sample; (E) determining the level of lactate dehydrogynase (LDH) in said biological sample; and (F) determining the level of MDSC suppressive activity on T cells in said biological sample, wherein determining elevated levels of NO, elevated levels of ROS, elevated levels of S100A8 and/or S100A9 proteins, low levels of cleaved caspase 3, and MDSC suppressive activity on T cells indicates that the patient will not respond to treatment with said immunotherapeutic agent, or that the therapeutic regimen of said patient should be altered.
42. A method of treating a cancer patient with an immunotherapeutic agent, said method comprising the steps of: (a) determining whether said patient is responsive to the immunotherapeutic agent in accordance with the method of claim 28; and (b) wherein the patient was determined to be responsive, administering to the patient an effective amount of said immunotherapeutic agent.
43. A method for selecting a melanoma patient suitable for receiving treatment with an immunotherapeutic agent, said method comprising the steps of: (a) measuring the amount of myeloid derived suppressor cells (MDSC) having the profile CD11b+CD33+HLA-DR− and/or CD11b+CD33+HLA-DRlow, in at least one biological sample being a whole blood sample obtained from the patient, wherein said whole blood sample is a fresh sample, a frozen sample, a preserved sample or a cryopreserved sample; and (b) determining whether the amount of MDSC is lower than a predetermined standard value or lower than a control sample; wherein (i) said therapeutic agent is Ipilimumab or lambrolizumab or a combination thereof, and wherein (ii) detection of a low amount of MDSC in the at least one biological sample as compared with the predetermined standard value or the control sample, indicates that the patient is suitable for receiving treatment with Ipilimumab or lambrolizumab or a combination thereof; and (c) treating said patient with Ipilimumab or lambrolizumab or a combination thereof if the patient was found to be suitable for receiving said treatment.
44. A kit comprising: (a) detecting molecules specific for MDSC having the profile CD11b+CD33+HLA-DR− and/or CD11b+CD33+HLA-DRlow; and optionally further comprising at least one of the following: i) at least one detecting molecule for determining LDH levels; ii) at least one detecting molecule specific for at least one of S100A8, S100A9, cleaved caspase 3, iNOS, arginase 1, NO, ROS, CD247 or SNX9; iii) secondary agents and/or buffers for performing detection of MDSC, LDH and at least one of S100A8, S100A9, cleaved caspase 3, iNOS, arginase 1, NO or ROS; and (b) instructions for use comprising instructions for carrying out the detection in at least one biological sample being a whole blood sample, wherein said whole blood sample is a fresh sample, a frozen sample, a preserved sample or a cryopreserved sample, wherein said kit is for use in a method for predicting a cancer patient's response to treatment with an immunotherapeutic agent, or for use in a method for determining whether the therapeutic regimen of a cancer patient should be altered.
45. The kit of claim 44, wherein said detecting molecules are labeled detecting molecules.
46. The kit of claim 44, wherein said detecting molecules are attached to a substrate.
47. The kit of claim 46, wherein said detecting molecules comprise antibodies that specifically recognize and bind MDSC having the profile CD11b.sup.+CD33.sup.+HLA-DR.sup.− and/or CD11b.sup.+CD33.sup.+HLA-DR.sup.low.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0095] In order to better understand the subject matter that is disclosed herein and to exemplify how it may be carried out in practice, embodiments will now be described, by way of non-limiting example only, with reference to the accompanying drawings, in which:
[0096]
[0097]
[0098]
[0099]
[0100]
[0101]
[0102]
[0103]
[0104]
[0105]
[0106]
[0107]
[0108]
DETAILED DESCRIPTION OF EMBODIMENTS
[0109] The present invention is based on the surprising finding that the levels of myeloid derived suppressor cells (MDSC) having the profile CD11b.sup.+CD33.sup.+HLA-DR.sup.− and/or CD11b.sup.+CD33.sup.+HLA-DR.sup.low in a cancer patient's sample, as measured prior to commencing therapy, can serve as a predictor for the patient's response to therapy.
[0110] The present invention therefore provides a combinatorial analysis to evaluate the immune status of cancer patients prior to and following a given therapy, measuring MDSC levels or MDSC levels and their suppressive characteristics. Moreover, testing the patient prior to treatment will depict predictive criteria of whether the patient will respond to the therapy. As will be shown in Example 1 below, based on data on melanoma patients subjected to Ipilimumab treatment, it was shown that if high levels of MDSCs (more then 55%) are detected in the blood, this indicates immunosuppression and predicts, with very high significance, non-responsiveness to treatment and very low survival. Testing MDSCs prior to the given therapy also provides a tool to suggest pre or combined treatment with additional drugs that neutralize the inflammatory and immunosuppressive environment prior to or in conjunction with a given chemo or immune based therapy. This analysis is also performed in different intervals during the therapy to monitor changes in the immune status during treatment to evaluate whether the immune system functions properly; if an increase in MDSC levels (or the levels of their suppressive characteristics) is detected during treatment this indicates that the response to treatment may be reduced and hence the type of treatment, or its continuation can be reconsidered.
[0111] Chemotherapeutic treatments, and in particular immunotherapeutic treatments are costly and their success rates are currently poor, partly due to the fact that evaluations of the patients' immune status are not performed prior to and during treatment.
[0112] As demonstrated in Example 1 below, showing a clinical experiment analyzing 56 patients with melanoma (stage 4) subjected to Ipilimumab treatment, a significant correlation was found between high levels of MDSCs and low responsiveness to Ipilimumab treatment as reflected by poor survival.
[0113] The predictive value of MDSC measurements was also demonstrated in colorectal cancer as shown in Example 2 below. Colorectal cancer (CRC) is associated with chronic inflammation and immunosuppression mediated by myeloid-derived suppressor cells (MDSC). Although chemotherapy reduces tumor burden at early stages, it tends to have limited effect on progressive disease, possibly due to adverse effects on the immune system in dictating disease outcome. As shown in Example 2 advanced CRC patients display enhanced MDSC levels and reduced CD247 expression.
[0114] Monitoring the immune status of stage IV CRC patients, prior to and following FOLFOX or FOLFIRI treatments revealed that prior to therapy the patients displayed a suppressed immune status as indicated by the elevated MDSC levels and down-regulated CD247, which is a key molecule that “senses” immune functionality and regulates T- and NK-cell immune responses (10). Recent data demonstrated that 5FU treatment leads to a selective MDSC apoptosis and tumor regression in mice (11).
[0115] During chemotherapeutic treatments, while FOLFOX reduced accumulation of circulating MDSCs that was accompanied by up-regulated CD247 expression, FOLFIRI displayed opposite effects, enhancing the suppressive environment.
[0116] To gain better understanding of 5-fluoruracil (5FU) and Irinotecan (CPT11) adverse effects on host immunity, a mouse CRC model that mimics the human disease was used (1). Similar to the patients, CRC-mice displayed an immunosuppressive status. As shown in Example 2, CPT11 but not 5FU increases immunosuppression by inducing MDSC insensitivity to apoptosis, arresting their differentiation and retaining their suppressive features. Moreover, 5FU/CPT11 combined treatment displays harmful effects, resulting in a dysfunctional immune response associated with cancer progression and short survival, showing that CPT11 antagonizes the anti-cancer activity of 5FU by exerting its detrimental immunoregulatory effects.
[0117] These results highlight the importance of developing therapeutic regimens that can target both the immune system and the tumor in developing improved personalized treatments for cancer.
[0118] As used in the specification and claims, the singular forms “a”, “an” and “the” include plural references unless the context clearly dictates otherwise.
[0119] The invention therefore provides in one of its aspects a method for predicting a cancer patient's response to treatment with a therapeutic agent, said method comprising the steps of: [0120] (a) Measuring the amount of myeloid derived suppressor cells (MDSC) having the profile CD11b.sup.+CD33.sup.+HLA-DR.sup.− and/or CD11b.sup.+CD33.sup.+HLA-DR.sup.low, in at least one biological sample obtained from the patient; and [0121] (b) Determining whether the amount of MDSC of said profile is higher than a predetermined standard value or higher than a control sample;
wherein [0122] (i) said therapeutic agent is a chemotherapeutic agent or an immunotherapeutic agent or a combination thereof, and wherein [0123] (ii) detection of a high amount of MDSC of the above profile in the at least one biological sample as compared with the predetermined standard value or the control sample indicates that the patient will not respond or will poorly respond to treatment with said agent.
[0124] In another aspect, the present invention provides a method for monitoring a cancer patient's response to treatment with a therapeutic agent, said method comprising the steps of: [0125] (a) Measuring the amount of myeloid derived suppressor cells (MDSC) having the profile CD11b.sup.+CD33.sup.+HLA-DR.sup.− and/or CD11b.sup.+CD33.sup.+HLA-DR.sup.low, in at least one biological sample obtained from the patient; and [0126] (b) Determining whether the amount of MDSC of said profile is higher than a predetermined standard value or higher than a control sample;
wherein [0127] (i) said therapeutic agent is a chemotherapeutic or immunotherapeutic agent or a combination thereof, and wherein detection of a high amount of MDSC of the above profile in the at least one biological sample as compared with the predetermined standard value or the control sample indicates that the patient is not responding or is poorly responding to treatment.
[0128] The methods disclosed herein are applicable to any type of cancer patient. Cancers in accordance with the invention include, but are not limited to adrenal cancer, bladder cancer, brain cancer, breast cancer, cervical cancer, colorectal carcinoma, endometrial cancer, gastro-intestinal cancers, head and neck squamous cell carcinoma, leukemia, malignant lymphoma, including Hodgkin's lymphoma, liver cancer, melanoma, ovarian cancer, pancreatic cancer, prostate cancer, renal cancer, sarcoma, small cell lung cancer, non-small cell lung cancer, and thyroid cancer.
[0129] In a specific embodiment the cancer is melanoma.
[0130] In a specific embodiment, the present invention provides a method for predicting a melanoma patient's response to treatment with ipilimumab.
[0131] In another specific embodiment the cancer is colorectal carcinoma.
[0132] As used herein the term “treating” or “treatment” of a disease in a patient refers to administration of a “therapeutic agent” intended for preventing one or more of the disease symptoms, inhibiting disease development, stabilizing its progression, or ameliorating or delaying the appearance of one or more of its symptoms.
[0133] The “therapeutic agent” in the context of the present invention is a chemotherapeutic agent or an immunotherapeutic agent. Chemotherapeutic agents and immunotherapeutic agents are compounds that are well known in the art and their selection depends on the cancer being treated. This selection is well within the skill of an attending doctor.
[0134] Suitable chemotherapeutic agents include, but are not limited to, antimetabolite drugs, DNA alkylating agents, platinum compounds, enzyme inhibitors (e.g. topoisomerase inhibitors, tyrosine kinase inhibitors), vincalkaloids, taxanes, receptor antagonists, and antibiotics. The invention also pertains to chemotherapeutic combination therapies. Including by not limited to the combinations FOLFOX and FOLFIRI.
[0135] FOLFOX is a chemotherapy regimen for treatment of colorectal cancer, made up of the drugs folinic acid (leucovorin), fluorouracil (5-FU) and Oxaliplatin.
[0136] FOLFIRI is a chemotherapy regimen for treatment of colorectal cancer, made up of the drugs folinic acid (leucovorin), fluorouracil (5-FU) and irinotecan.
[0137] Studies comparing the FOLFOX and the FOLFIRI regimens indicated that in some cases FOLFOX is superior since it leads to higher overall survival rates (12, 13). However, other studies have demonstrated equal efficacy for these treatments (14).
[0138] A “DNA alkylating agent” is an agent which attaches an alkyl group to DNA and thereby prevents its replication. Such agents are well known in the art and are used to treat a variety of tumors. Non-limiting examples of DNA alkylating agents are Nitrogen mustards, such as Cyclophosphamide, Mechlorethamine, Uramustine, Melphalan, Chlorambucil, Ifosfamide, Bendamustine; Nitrosoureas, such as Carmustine, Lomustine, Streptozocin; Alkyl sulfonates, such as Busulfan; and ThioTEPA.
[0139] “Platinum compounds” are a subclass of the DNA alkylating agents. Non-limiting examples of such compounds include Cisplatin, Carboplatin, Nedaplatin, Oxaliplatin, Satraplatin, and Triplatin tetranitrate.
[0140] “Topoisomerase inhibitors” are agents that interfere with the action of topoisomerase enzymes (topoisomerase I and II). Topoisomerases are enzymes that control the changes in DNA structure by catalyzing the breaking and rejoining of the phosphodiester backbone of DNA. Such agents are well known in the art. Non-limiting examples of Topoisomerase I inhibitors include CPT-11/Irinotecan, topotecan, camptothecin, and lamellarin D.
[0141] Irinotecan (CPT-11, CPT11) is a semi-synthetic analogue of the alkaloid camptothecin, which is activated by hydrolysis to SN-38 and targets topoisomerase I. Chemical equivalents are those that inhibit the interaction of topoisomerase I and DNA to form a catalytically active topoisomerase I-DNA complex. Chemical equivalents inhibit cell cycle progression at G2-M phase resulting in the disruption of cell proliferation.
[0142] Non-limiting examples of Topoisomerase II inhibitors include, but are not limited to, Etoposide, Teniposide, Anthracyclines (e.g. Doxorubicin, Daunorubicin), Mitoxantrone, amsacrine, aurintricarboxylic acid, ellipticines and HU-331 a quinolone synthesized from cannabidinol.
[0143] “Tyrosine kinase inhibitors” (TKIs) are a class of chemotherapy medications that inhibit, or block, the enzyme tyrosine kinase. Non limiting examples of TKI chemotherapeutic agents include: Imatinib (brand name: Gleevac), gefinitib (Iressa) [which have been approved by the Food and Drug Administration for use in humans] Erlotinib (Tarceva), Lapatinib (Tykerb), Sunitinib (Sutent), Sorafenib (Nexavar), Nilotinib (Tasinga), Bosutinib, Neratinib, and Vatalanib.
[0144] “Antimetabolite drugs” include pyrimidine antagonists, purine antagonists and folic acid analogues.
[0145] Non limiting examples of pyrimidine antagonists include: 5-fluoruracil (5-FU, 5FU), arabinosylcytosine (cytarabine), capecitabine (an oral 5-FU pro-drug), gemcitabine and decitabine.
[0146] 5-FU is a pyrimidine base containing a fluoride atom at the 5 carbon position on the ring. Uracil is a naturally occurring pyramidine base used in nucleic acid synthesis. It is converted to thymidine by enzyme action. 5-FU is similar in structure to uracil and is converted to two active metabolites (FdUMP and FUTP) that inhibit the activity of the enzyme thymidylate synthetase. The enzyme normally converts uracil to thymidine by adding a methyl group at the fifth carbon of the pyrimidine ring. 5-FU mimics the natural base and functions to inhibit DNA synthesis. The carbon group cannot be added because of the fluoride atom at position 5. Normal DNA synthesis fails. dUTP and FdUTP are incorporated into DNA so that it cannot function normally. In addition, FUTP is incorporated into RNA leading to faulty translation of the RNA. Thus, the synthesis of multiple forms of RNA (messenger, ribosomal, transfer and small nuclear RNAs) is blocked. These combined actions on DNA and RNA are cytotoxic to the rapidly dividing cancer cells.
[0147] 5-FU is used for the treatment of many malignancies: breast, head and neck, adrenal, pancreatic, gastric, colon, rectal, esophageal, liver and G-U (bladder, penile, vulva, prostate).
[0148] Non limiting examples of purine class antimetabolites include: Fludarabine or 2-fluoro-ara-amp, and 6-Mercaptopurine (6-MP).
[0149] Folate antagonists generally function by impeding enzyme action. Non limiting examples of the folic acid class antimetabolites include: methotrexate and Pemetrexed.
[0150] Leucovorin (Folinic acid) is a reduced folic acid and is used as an adjuvant in cancer therapy, for example in combination with other chemotherapy drugs (e.g. 5-FU) to improve efficacy of the chemotherapeutic agent or as a “chemoprotectant”. This compound has the chemical designation of L-Glutamic acid N[4[[(2-amino-5-formyl1,4,5,6,7,8hexahydro4oxo6-pteridinyl)methyl]amino]b-enzoyl]-, calcium salt (1:1).
[0151] Information regarding cancer therapeutic agents and known therapeutic combinations can be found in the US National Cancer Institute's web site http://www.cancer.gov/ or in the US National Comprehensive Cancer Network's web site, http://www.nccn.org/.
[0152] Cancer patients are subjected to various types of immune-based therapies since most tumors display immunogenic features. The aim of such therapies is to increase the function of the patients' immune system by blocking inhibitory and/or apoptotic receptors expressed on immune cells such as T cells or by controlling inhibitory signaling pathways and also to boost the immune system by immunization protocols or transfer of ‘educated’ anti-tumor T lymphocytes. Examples for the first strategy are the Ipilimumab treatment (for example in melanoma), which is an anti-CTLA4 antibody that neutralizes the inhibitory stage of the T lymphocytes aiming at increasing the immune system functionality, the lambrolizumab treatment, which is an anti-PD1 antibody and the MPDL3280A treatment which is an anti-PD-L1 (the ligand of PD1) antibody. PD1-PD-L1 interactions also provide negative/apoptotic signals that dampened response of the immune system against the tumor. Blocking the harmful effects of these inhibitory receptors is supposed to induce recovery of the patient's immune function. However, if there are additional key factors that suppress the immune system, which dominate the environment, the suggested treatment will not succeed. Examples for the second strategy include immunization protocols using autologous or heterologous tumor cells with or without dendritic cells, and boosting the patient's immune system by transferring activated ‘educated’ anti-cancer T cells (TILs) in the presence or absence of cytokines and/or reagents used in the first strategy (adoptive T cell transfer). Again, a suppressive environment generated in the patient during tumor development will inhibit efficient responses to such immune boosting therapies.
[0153] Therefore, suitable immunotherapeutic agents according to the invention include, but are not limited to immunomodulatory agents including for example, therapeutic antibodies, immune checkpoints inhibitors, cytokines (e.g. IL-2 or interferon α), T cell modulators, tumor infiltrating lymphocytes (TIL), and therapeutic or preventive cancer vaccines.
[0154] “Therapeutic antibodies” in the context of the present invention relate to different types of monoclonal antibodies that are used in cancer treatment. Such antibodies are directed against tumor markers or antigens and exert their activity either by inducing antibody-dependent cell cytotoxicity (ADCC), or by association with a toxic agent. Non limiting example of therapeutic antibodies include: Anti-CD52 (Alemtuzumab, Campath®), Anti-HER2/neu (erbB2) receptor (Trastuzumab, Herceptin®), anti-HER1/EGFR (Cetuximab, Panitumumab); Anti-VEGF-A (Bevacizumab); Anti-CD20 (Rituximab, Tositumomab, Ibritumomab); and Anti-CD33 (Gemtuzumab).
[0155] The therapeutic antibodies also include immune checkpoint blocking antibodies such as anti-CTLA4 (e.g. Ipilimumab), anti-PD-1 (e.g. lambrolizumab) and anti-PD-L1 (the ligand of PD1) (e.g. MPDL3280A).
[0156] “Immune checkpoints inhibitors” are compounds that interfere in pathways that regulate the immune status of a patient. The immune system depends on several checkpoints to avoid activity of the immune system on healthy cells. Tumor cells often take advantage of these checkpoints to escape detection by the immune system. Examples of immune checkpoints are CTLA-4 and PD-1.
[0157] In specific embodiments said immunotherapeutic agent is Ipilimumab, lambrolizumab or their combination.
[0158] “Ipilimumab” (also known as MDX-010, MDX-101 or Yervoy) relates to a humanized anti-CTLA4 monoclonal antibody. By targeting CTLA4, Ipilimumab neutralizes the inhibitory stage of cytotoxic T lymphocytes and thereby activates these cells of the immune system and allows them to successfully target and destroy cancer cells. Ipilimumab is presently used in the treatment of melanoma patients.
[0159] “lambrolizumab” relates to a humanized anti-PD1 monoclonal antibody.
[0160] “Tumor infiltrating lymphocytes” (TILs) are a type of white blood cells found in tumors. TILs are implicated in killing tumor cells, and the presence of lymphocytes in tumors is often associated with better clinical outcomes. TILs may be used as an adoptive cell transfer therapy to treat cancer. For example, autologous lymphocytes are isolated from patients' tumors and grown to very large numbers of cells in vitro. Prior to TIL treatment, patients are given nonmyeloablative chemotherapy to deplete native lymphocytes that can suppress tumor killing. Once lymphodepletion is completed, patients are then infused with TILs in combination with interleukin 2 (IL-2).
[0161] “Cancer vaccines” stimulate the immune system's ability to fight cancer. Preventive (or prophylactic) vaccines are intended to prevent cancer from developing in healthy subjects, while treatment (or therapeutic) vaccines are intended to treat an existing cancer. A non-limiting example of a cancer vaccine is the antigen presenting cells (APC)-based sipuleucel-T (Provenge®) for treating metastatic prostate cancer.
[0162] The invention also provides methods for treating a cancer patient comprising as an initial step determining whether the cancer patient would be responsive to treatment with the therapeutic agent as described above. If the patient is found to be responsive, the therapeutic agent is administered.
[0163] Therefore, the present invention provides a method of treating a cancer patient with a therapeutic agent, said method comprising, or alternatively, said method consisting of, the steps of: [0164] (a) Determining whether said patient is responsive to the therapeutic agent as described above; wherein said therapeutic agent is a chemotherapeutic agent or an immunotherapeutic agent or a combination thereof; and [0165] (b) wherein the patient was determined to be responsive, administering to the patient an effective amount of said chemotherapeutic agent or said immunotherapeutic agent or a combination thereof.
[0166] An “effective amount” of a chemotherapeutic agent or an immunotherapeutic agent or a combination thereof is an amount sufficient to effect beneficial or desired results, i.e. an amount sufficient to treat, ameliorate, alleviate, inhibit disease development, stabilize disease, prevent or reduce symptoms of cancer in a cancer patient. An effective amount can be administered in one or more administrations, applications or dosages. Such delivery is dependent on a number of variables including the time period for which the individual dosage unit is to be used, the bioavailability of the chemotherapeutic or immunotherapeutic agent, the route of administration, etc. It is understood however that specific dose levels of the chemotherapeutic or immunotherapeutic agents in accordance with this aspect of the invention for any particular patient depends upon a variety of factors including the activity of the specific compound employed, the route of administration, the age of the patient, its gender, body weight, general health, additional drugs that the patients receives etc. Determining the precise dosages is well within the physician's skill.
[0167] The chemotherapeutic or immunotherapeutic agent can be administered by any route as known in the art, for example by oral administration or by parenteral administration including intramuscular, intravenous or subcutaneous administration. In some embodiments, when oral administration is employed the agent is administered using a convenient daily dosage regimen, and may be in the form of tablets, pills, capsules, semisolids, powders, sustained release formulations, solutions, suspensions, aerosols or any other appropriate composition.
[0168] The chemotherapeutic or immunotherapeutic agent is preferably administered in a pharmaceutical composition that may further comprise suitable pharmaceutical grade excipients and carriers. Such excipients and carriers include, but are not limited to, starch, cellulose, talc, glucose, lactose, sucrose, gelatin, malt, glycerol, propylene glycol, water, ethanol, oils of various origins, sodium chloride, saline, aqueous dextrose, and the like.
[0169] In one embodiment the method of the invention is used for determining the patient's therapeutic regime by at least one of the following: [0170] (a) Refraining from treatment with said chemotherapeutic agent, said immunotherapeutic agent or the combination thereof; [0171] (b) Discontinuing treatment with said chemotherapeutic agent, said immunotherapeutic agent or the combination thereof; or [0172] (c) Combining the treatment with said chemotherapeutic agent, said immunotherapeutic agent or the combination thereof with at least one additional compound being an anti-inflammatory and/or an anti-MDSC therapeutic agent.
[0173] As used herein an “anti-inflammatory agent” relates to a compound that reduces inflammation. Anti inflammatory agents include, but are not limited to, NSAIDs (non-steroidal anti-inflammatory drugs) including broad-spectrum NSAIDs (which non-specifically inhibit both COX-1 and COX-2) e.g. aspirin, sulindac, ibuprofen, piroxicam, and COX-2 specific agents, such as celecoxib, corticosteroids (e.g. the glucocorticoids dexamethasone, hydrocortisone and prednisone), and antibodies directed against cytokines associated with inflammation, e.g. TNFα.
[0174] As used herein an “anti-MDSC therapeutic agent” relates to a compound that inhibits MDSC. Such a compound may act by deactivation of MDSC, differentiation of MDSC into mature cells, blocking development of MDSC, or depletion of MDSC. Deactivation of MDSC may be achieved by using nitric oxide (NO) inhibitors, phosphodiesterase-5 (PDE-5) inhibitors, Nitro-aspirins, L-NAME (N (G)-Nitro-L-Arginine Methyl Ester), Arginase inhibitors, COX2 inhbitors, NOHA, ROS inhibitors (e.g. synthetic triterpenoids), MDSC migration inhibitors (e.g. anti glycan antibodies and CSF-1R inhibitors), histamine inhibitors or anti IL-17 antibodies. Differentiation of MDSC into mature cells can be achieved by using vitamins (e.g. ATRA (all trans retinoic acid), Vitamin A, vitaminD3, IL-12 or CpG. Blocking development of MDSC can be achieved by using bisphosphonates (e.g. zoledronic acid), or by modulating cell signaling using JAK2/STAT3 inhibitors, multi-kinase inhibitors or VEGF inhibitors. Depletion of MDSC can be achieved for example by using cytotoxic agents (e.g. gemcitabine, cisplatin, paclitaxel or 5-FU), HSP 90 inhibitors (e.g. 17-DMAG), IL-6R blockers or antibody drug conjugates (Wesolowsli et al., J. for Immuno Therapy of Cancer 2013 1:10). In addition, MDSC depletion can be achieved using antibodies directed against MDSC cell markers, for example anti CD33 antibodies. For research purposes MDSC depletion in mouse models can be achieved for example by using anti Gr1 antibodies.
[0175] As used herein the term “therapeutic regimen” or “therapeutic regime” relates to a regulated scheme of treatment. This scheme of treatment comprises for example administering a therapeutic agent to a patient at specific intervals, either alone or in combination with additional therapeutic agents or treatment modalities (e.g. irradiation). In the context of the present invention, an “altered” therapeutic regimen or “altering” the therapeutic regimen relates herein to a change in the schedule of treatment which is brought about by the acquired information on the immune status of the patient, as exemplified in the levels of MDSC in a patient's biological sample. The change in schedule of treatment may be a decision to refrain from treating the patient with a chemotherapeutic or immunotherapeutic agent (e.g. Ipilimumab), or, in case that the patient is already being treated with a chemotherapeutic or immunotherapeutic agent, the change may be a decision to cease treatment. Alternatively, an altered therapeutic regimen may relate to a decision to include at least one additional therapeutic agent in the therapeutic regimen, a therapeutic agent which is directed to enhancing the patient's immune system and may be an anti inflammatory drug and/or a drug directed at the elimination of MDSC.
[0176] As used herein the terms “response”, “responsiveness”, “responsive” or “responder” to treatment with a chemotherapeutic or immunotherapeutic agent refers to an improvement in at least one relevant clinical parameter as compared to an untreated subject diagnosed with cancer, or as compared to the clinical parameters of the same subject prior to said treatment.
[0177] The term “therapeutic failure”, “non responder”, “non-responsive” or “not respond” to treatment with a chemotherapeutic or immunotherapeutic agent, refers to a treated cancer patient not experiencing an improvement in at least one of the clinical parameters. This term also encompasses a poor response to therapy which indicates a very low level of response which is not clinically significant or sufficient. For example, low responsiveness to a chemotherapeutic or immunotherapeutic agent treatment may be reflected by poor survival.
[0178] The methods of the invention include the step of measuring the amount of myeloid-derived suppressor cells (MDSC) having the profile HLA DR.sup.− CD33.sup.+CD11b.sup.+ or HLA DR.sup.low CD33.sup.+CD11b.sup.+ in a biological sample obtained from the patient.
[0179] “MDSC” are a heterogeneous population of early myeloid progenitors, immature granulocytes, macrophages, and dendritic cells at different stages of differentiation. These cells have the capacity to suppress both the cytotoxic activities of natural killer (NK) and NKT cells, and the adaptive immune response mediated by CD4.sup.+ and CD8.sup.+ T cells. Human MDSCs commonly express Siglec-3/CD33 and lack lineage markers and HLA-DR, but heterogeneous expression of other cellular markers indicate that multiple subsets exist. Multiple positive markers used to identify MDSC are known in the art. These include, as non limiting examples, expression of CD33, CD14, CD15, CD66b, or CD11b.
[0180] The MDSC of the present invention are characterized as having the phenotype HLA DR.sup.− CD33.sup.+CD11b.sup.+ or HLA DR.sup.low CD33.sup.+CD11b.sup.+.
[0181] “HLA-DR” is a MHC class II cell surface receptor encoded by the human leukocyte antigen complex.
[0182] “CD11b” is expressed on the surface of many leukocytes including monocytes, granulocytes, macrophages, and natural killer cells.
[0183] “CD33” or Siglec-3 is a trans-membrane receptor expressed on cells of myeloid lineage. CD33 is usually considered myeloid-specific, but it can also be found on some lymphoid cells.
[0184] The presence of HLA DR CD33.sup.+CD11b MDSC in the biological sample is determined using detecting agents which can be antibodies, specifically, anti HLA-DR antibodies, anti CD11b antibodies and anti CD33 antibodies. Wherein the presence or absence of each of the cell markers is denoted by a + or a − sign, respectively. Thereby HLA DR CD33.sup.+CD11b MDSC are MDSC which lack HLA-DR, and express CD33 and CD11b. The designation HLA DR.sup.low relates to MDSC which show a relatively low expression level of HLA-DR. When staining a cell population that comprises MDSC with anti-HLA DR antibodies, three cell populations can be identified according to the intensity of staining—HLA DR.sup.high, HLA DR.sup.low and HLA DR.sup.negative. The present invention relates to the cell populations that show negative and/or low staining with anti HLA-DR antibodies. The definitions of “high”, “low” and “negative” staining levels are relative in each tested sample and are well within the knowledge of the skilled person in the art of the invention.
[0185] As indicated above, in certain embodiments the detecting agents can be antibodies. Antibodies may be prepared using methods well known in the art (see for example Harlow and Lane, Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory, New York (1988)).
[0186] The term “Antibody” as used herein refers to IgG, IgM, IgD, and IgA antibodies. This term refers to whole antibodies or fragments of the antibodies comprising the antigen-binding domain, e.g. scFv, Fab, F (ab′) 2, bi-specific antibodies, diabodies, and other fragments capable of binding to the target molecule. The definition includes polyclonal antibodies and monoclonal antibodies. The monoclonal antibodies can be derived from various species such as murine, rabbit, goat or rat. Non limiting examples of commercial antibodies that can be used to identify the HLA DR.sup.− CD33.sup.+CD11b MDSC of the invention are provided in the Examples section below.
[0187] As used herein a “high level” or “higher amount” of MDSC detected in a patient's sample relates to a percent of cells that is significantly (e.g. as determined by statistical determination) higher than a predetermined standard value or significantly higher than a control sample. A “control sample” relates to a sample obtained from a healthy subject, i.e. a subject that does not suffer from a disease associated with chronic inflammation and is known to have a functional immune system. “Standard” or a “predetermined standard” as used herein, denotes either a single standard value or a plurality of standards with which the level (percent of) MDSC in the tested sample is compared. The standards may be prepared by determining the level of MDSC present in a sample obtained from a plurality of healthy subjects. After such standards are prepared, it is possible to compare the level of MDSC obtained from a specific tested subject to the corresponding value of the standards, and thus obtain an assaying tool.
[0188] More specifically, in certain embodiments, wherein “higher” or “high” levels of MDSC are indicated, it is meant that MDSC are present in between about 5% to 100%, more specifically about 10%, or about 20%, or about 30%, or about 40%, or about 50%, or about 60%, or about 70%, or about 80%, or about 90%, higher amounts than in the control sample or the predetermined standard.
[0189] Non limiting examples of higher levels of MDSC in patients' samples are demonstrated in the Examples below. In a specific embodiment a high level of MDSC in a sample relates to a percent value of above 50% MDSC per total cells in the sample, preferably above 55% of the cells in the sample.
[0190] As used herein the percent of MDSC relates to the percent of MDSC having the profile CD33.sup.+CD11b.sup.+ within the HLA DR population of cells in the tested biological sample, or the percent of MDSC having the profile CD33.sup.+CD11b.sup.+ within the HLA DR.sup.− and the HLA DR.sup.low population of cells in the tested biological sample
[0191] The presence of a high level of MDSC in the cancer patient's sample indicates that the patient is immune suppressed and therefore predicts a poor response to treatment with the therapeutic agent, at least as a single agent. However, since the patient is identified as being immune suppressed the therapeutic regimen offered to the patient may be altered by including therein in addition to the cancer therapeutic agent, additional therapeutic agents capable of counteracting the detrimental effects of MDSC.
[0192] Additional parameters may be measured and combined with the level of MDSC in order to determine the patient's response to therapy.
[0193] The additional parameters include measuring the level of LDH (lactate dehydrogenase) prior to or during therapy, measuring the level of various suppressive characteristics of the patient and assessing the metastatic status of the patient.
[0194] “LDH” (lactate dehydrogenase) is an enzyme found in nearly all living cells. LDH catalyzes the conversion of pyruvate to lactate and back, as it converts NADH to NAD.sup.+ and back. Detection techniques for LDH are well known in the art, using for example enzymatic reactions performed on patients' serum samples or assays that are commercially available.
[0195] Relatively high levels of LDH (e.g. levels higher than 450 U/I, 480 U/I, or 500 U/I, preferably higher than 480 U/I) are predictors of a shorter survival time of the cancer patient.
[0196] Similarly, a more advanced metastatic state of the patient is a predictor of a shorter survival time of the cancer patient.
[0197] As used herein “suppressive characteristics” of MDSC denote various measurable features or molecules that can be used as surrogates to determine the suppressive state of the MDSC. Such characteristics include, but are not limited to the expression levels of LDH, S100A8 and/or S100A9 proteins, the levels of cleaved caspase 3, intracellular nitric oxide (NO), reactive oxygen species (ROS), iNOS, and arginase 1, levels and activity in said biological sample; and suppressive activity of the MDSC on T cells. In certain embodiments, MDSC suppressive activity on T cells is measured by assessing down regulation of CD247 and/or SNX9 expression, and/or impaired T cell proliferation.
[0198] “S100A8” is a calcium- and zinc-binding protein which plays a prominent role in the regulation of inflammatory processes and immune response. It can induce neutrophil chemotaxis and adhesion. S100A8 functions involve proinfammatory, antimicrobial, oxidant-scavenging and apoptosis-inducing activities.
[0199] “S100A9” is a calcium-binding protein also known as migration inhibitory factor-related protein 14 (MRP14) or calgranulin B. It is encoded by the S100A9gene.
[0200] These proteins are predominantly found as calprotectin (a complex of S100A8/A9) which has a wide plethora of intra- and extracellular functions. Detection of S100A8 and/or S100A9 can be done using antibodies which are specific for these proteins. Such antibodies are commercially available for example from R&D Systems. mRNA encoding these proteins can be detected using appropriate probes, e.g. as shown in the Examples.
[0201] “Caspase-3” (CASP3) is a caspase protein that interacts with caspase-8 and caspase-9. It is encoded by the CASP3 gene. The CASP3 protein is a member of the cysteine-aspartic acid protease (caspase) family. Sequential activation of caspases plays a central role in the execution-phase of cell apoptosis. Caspases exist as inactive proenzymes that undergo proteolytic processing at conserved aspartic residues to produce two subunits, large and small, that dimerize to form the active enzyme. This protein cleaves and activates caspases 6 and 7; and the protein itself is processed and activated by caspases 8, 9, and 10. Detection of the cleaved form of caspase 3 hence indicates that the cell is undergoing apoptosis. Detection of cleaved caspase 3 can be done using antibodies which are specific for the cleaved form. Such antibodies are commercially available for example from R&D Systems, sigmaAldrich etc.
[0202] “Intracellular Nitric oxide” (NO) is an important cellular signaling molecule involved in many physiological and pathological processes. “Reactive oxygen species” (ROS) are chemically reactive molecules containing oxygen. Examples include oxygen ions and peroxides. ROS are formed as a natural byproduct of the normal metabolism of oxygen and have important roles in cell signaling and homeostasis. An increase in ROS levels may result in significant damage to cell structures.
[0203] Detection techniques for NO or ROS are well known in the art, using for example assays that are commercially available. For example, ROS may be detected using ROS Brite™ APF which is a fluorogenic probe to measure hydroxyly radical in cells using conventional fluorescence microscopy, high-content imaging, microplate fluorometry, or flow cytometry. The cell-permeant ROS Brite™ APF reagent is nonfluorescent and produces bright green fluorescence upon reaction with hydroxyl radical. The resulting fluorescence can be measured using fluorescence imaging, high-content imaging, microplate fluorometry, or flow cytometry. NO may be detected using a cell permeable analog of DAF-2 that is hydrolyzed to DAF-2 by intracellular esterases. This agent can be used in fluorescence microscopy to measure real-time changes in nitric oxide (NO) levels. Exemplary protocols for measuring NO and ROS are provided in the Examples.
[0204] “iNOS” (inducible NO Synthase) is an enzyme catalyzing the production of NO from L-arginine and is a member of the Nitric oxide synthases family. It is an inducible NO synthase and is involved in immune response, binds calmodulin at physiologically relevant concentrations, and produces NO as an immune defense mechanism, as NO is a free radical with an unpaired electron. Detection of iNOS can be done for example using antibodies which are specific for this enzyme. Such antibodies are commercially available (e.g. by R&D Systems).
[0205] “Arginase” (also termed arginine amidinase, canavanase, L-arginase, arginine transamidinase) is a manganese-containing enzyme. It is the final enzyme of the urea cycle. Detection of Arginase 1 can be done for example using antibodies which are specific for this enzyme. Such antibodies are commercially available (e.g. by SigmaAldrich).
[0206] “CD247” (Cluster of Differentiation 247) refers to T-cell surface glycoprotein CD3 zeta chain also known as T-cell receptor T3 zeta chain. Detection of CD247 on the surface of T cells can be done using antibodies which are specific for this marker. Such antibodies are commercially available. An example for CD247 detection technique is provided in the Examples.
[0207] The “SNX9” (Sorting nexin-9) protein is a member of the sorting nexin family. Members of this family contain a phox (PX) domain, which is a phosphoinositide binding domain, and are involved in intracellular trafficking. Detection of SNX9 in T cells can be done using antibodies which are specific for this marker. Such antibodies are commercially available. An example for SNX9 detection technique is provided in the Examples.
[0208] Elevated levels of NO, elevated levels of ROS, elevated levels of S100A8 and/or S100A9 proteins, low levels of cleaved caspase 3, and MDSC suppressive activity on T cells indicate that the patient suffers from an immune compromised state which affects or will affect the patient's responsiveness to therapy.
[0209] As used herein a “biological sample” refers to any cell containing sample obtained from the patient. The sample can be a peripheral blood sample including whole blood or fractionated blood, a spleen biopsy, cells obtained from lymph nodes, tissue biopsy, tissue sections (e.g. a colon tissue section) or a tumor sample. The sample may be fresh, previously frozen, preserved or cryopreserved.
[0210] Preferably, fresh whole blood samples are analyzed upon lysing the erythrocytes. Methods for cryopreservation of cells and tissues are well known in the art, e.g. by mixing the cells with dimethyl sulfoxide (DMSO). One example of a cryopreservation protocol is provided in the Examples below.
[0211] The HLA DR.sup.− CD33.sup.+CD11b MDSC in the biological sample can be detected using fluorescence activated cell sorter (FACS), immunohistology (immunohistochemistry of tissue sections), as well as ELISA, RIA or Western blotting of the suitable MDSC cell markers i.e. CD33, CD11b. In addition, the MDSC in the biological sample can be detected using nucleic acid-based detection assays including in situ hybridization, RT-PCR (real-time polymerase chain reaction) and Northern blotting with probes specific for the MDSC markers, i.e. CD33, CD11b.
[0212] A first step in some of the detection methods requires staining of the cells with the relevant antibodies. Methods for staining cells with antibodies are well known in the art and usually the appropriate protocols are included in the instructions that accompany any commercially available antibody. An example of a staining procedure is provided in the Examples below. Briefly, the cells (e.g. in the whole blood sample) are placed in suitable plates, washed with staining buffer, incubated with the antibodies (preferably labeled antibodies), followed by additional washing. For intracellular markers, the cells are fixed prior to staining (e.g. with paraformaldehyde) and permeabilized (with a permeabilization buffer, comprising e.g. PB-0.1% saponin, and 1% human serum.
[0213] The detection of the HLA DR.sup.− CD33.sup.+CD11b MDSC in accordance with the invention may be performed by flow cytometry in a fluorescence activated cell sorter (FACS). Protocols for carrying out FACS analysis are well known in the art. FACS provides a method for analysis and sorting a heterogeneous mixture of cells in a biological sample, one cell at a time, based upon the specific light scattering and fluorescent characteristics of each cell. In general, a first step in flow cytometry is obtaining cells in suspension, labeling the cells with fluorescently labeled agents (preferably antibodies) which bind specifically the desired markers. The cell may be labeled as a whole living cell, or permeabilized prior to labeling (using a fixative) in order to allow labeling of intracellular molecules. The labeled cells are than subjected to flow analysis in the FACS. A non-limiting example of a protocol for carrying out a FACS analysis is provided in the Examples below.
[0214] The detection of the HLA DR.sup.− CD33.sup.+CD11b MDSC in accordance with the invention may be also performed by immunohistochemistry of tissue sections. Protocols for carrying out immunohistochemistry are well known in the art. In general, a first step in immunohistochemistry is the preparation of tissue sections. For example, a tissue biopsy potentially comprising the cells is fixed (e.g. using formalin or paraformaldehyde), the fixed biopsy is embedded in a paraffin block and thin tissue sections or slices are prepared (e.g. in a microtome). Alternatively, the tissue biopsy is frozen in liquid nitrogen and thin tissue sections or slices are prepared (e.g. using a cryostat). The tissue sections are than stained with labeled detecting agents (e.g. antibodies). The label in such cases may be enzymatic. A non-limiting example of a protocol for carrying out immunohistochemistry is provided in the Examples below.
[0215] Dot blot, slot blot, Western blot and ELISA analyses are commonly used assays for detecting the presence and amount of target molecules (usually proteins) in a sample. In a dot blot assay the whole sample which putatively includes the target molecule is placed as such onto a porous substance (e.g. a nitrocellulose membrane) and the proteins within the sample are immobilized in the membrane in the form of a dot.
[0216] In a Western blot assay, the sample which putatively includes the target molecule is first run on a separating gel thereby the proteins are separated one from the other and form a gradient according to their size. Next, the separated proteins are blotted onto a nitrocellulose membrane and immobilized onto the membrane according to their respective position in the gel.
[0217] In an ELISA (Enzyme-linked immunosorbent assay) the whole sample which putatively includes the target molecule is placed as such onto a non-porous substance (e.g. a well of a standard 96 well plate) and the proteins within the sample coat the bottom of the well. Alternatively, sandwich ELISA assay may be performed. In such case, the bottom of the well is pre-coated with specific primary antibodies directed against a target molecule. Hence the target molecule is immobilized onto the surface via specific binding to these antibodies. Next, the presence and amount of the target molecule is assessed by an immunoassay conventionally employing a first and a second antibody, whereby the second antibody is detectably labeled so as to detect the presence of the target molecule and its amount.
[0218] The detection in accordance with the invention is performed using detecting molecules. The term “detecting molecules” as used herein refers to any molecule that can specifically recognize the MDSC markers of the invention or any one of the suppressive molecules. The detecting molecules may be amino acid molecules or nucleic acid molecules. Non limiting examples of detecting molecules include antibodies, receptors, ligands, substrates or nucleic acid probes. The detecting molecules may be detectably labeled.
[0219] The term “detectably labeled” as used herein refers to a detecting molecule which is associated with a compound that may be detected by an appropriate reaction (enzymatic or color reaction) or by fluorescent excitation and assists in visualizing, quantifying or detecting the target molecule (the labeling agent).
[0220] The labeling agent may be a fluorescent compound, e.g. fluorescein (or a fluorescein derivative such as FITC) or phycoerythrin (PE), a fluorescent particle such as quantum dot, an enzyme such as horseradish peroxidase (HRP) or alkaline phosphatase (AP), a chromophore, or an electrochemically active or a radioactive molecule.
[0221] It should be emphasized that the detectably labeled detecting molecules are non-naturally occurring molecules.
[0222] The term “Association” or “associated” as used herein refers to any physical or chemical forces such as Van-der-Walls, coordinative, covalent, ionic, electrostatic, dipole-dipole, or hydrogen association (bond or interaction). The association may occur directly or indirectly (i.e. comprising one or more intermediate agents). In some embodiments the intermediate agent is another protein, ligand or spacer. For example, the intermediate agent may be streptavidin, biotin, immunoglobulin binding protein (e.g. protein A, protein G, Protein A/G, protein L, etc.), DNA or RNA molecule, peptide tag or its chelating complex (e.g. polyhistidine tag or metal complex of nitrilotriacetic acid such as Ni-NTA).
[0223] The detecting molecules in accordance with the present invention may also be immobilized on a substrate, e.g. a membrane, a filter, beads.
[0224] The substrate may be a porous substrate. As used herein, the term “porous substrate” refers to a substrate having a plurality of pores (depressions). These pores have inner voids of the same or varying volume and shape, defined by inner surface. In certain embodiments the substrate pores are nanometric in size, namely having a mean size smaller than 1,000 nm. In some embodiments, the mean pore size is below 500 nm. In other embodiments, the mean pore size is below 300 nm. In further embodiments, the mean pore size is below 200 nm. In other embodiments, the mean pore size is below 100 nm. In other embodiments, the mean pore size is below 50 nm. In further embodiments, the mean pore size is between 300 nm and 50 nm. In specific embodiments the porous substrate is a membrane having 200 nm or 450 nm pores.
[0225] The substrate may also be a non-porous substrate.
[0226] The substrate may be a flexible or a rigid or a soft substrate, and may be composed of any material. In some embodiments the substrate is a layered substrate, e.g., a porous layer on a non-porous layer or soft layer (such as gel or tissue) on metal layer (holder). The substrate (or one of its layers) may be composed of insulating, conducting or semiconducting material. In some embodiments the substrate may be composed of glassy, polymeric, ceramic, fibrous material, or any combination thereof. In some embodiments the substrate's material may be composed of glass, paper, wool, fleece, gel, cellulose, or any combination thereof. In some embodiments the substrate is composed of a nitrocellulose or PVDF membrane. The nitrocellulose or PVDF membrane may have varying pore sizes, e.g. 0.2 m (200 nm) or 0.45 m (450 nm).
[0227] As indicated above, in certain embodiments the method further comprises measuring the expression level of certain suppressive features or markers. These include, but are not limited to LDH, S100A8 and/or S100A9 proteins, cleaved caspase 3, intracellular nitric oxide (NO), reactive oxygen species (ROS), iNOS, and arginase 1, CD247 and/or SNX9. The expression levels of the above noted suppressive markers in the biological sample can be detected using fluorescence activated cell sorter (FACS), immunohistology (immunohistochemistry of tissue sections), as well as substrate based detection assays such as ELISA, RIA or Western blotting or by using nucleic acid-based detection assays including in situ hybridization, RT-PCR and Northern blotting with probes specific for these markers.
[0228] The terms “level of expression” or “expression level” are used interchangeably and generally refer to the amount of a polynucleotide or a protein in a biological sample. According to the invention “expression” of a polypeptide, for example S100A8 and/or S100A9 proteins, may refer to transcription into a polynucleotide, translation into a protein, or even posttranslational modification of the protein.
[0229] It should be noted that the expression level is reflected by measurement and determination of an expression value. As used herein, the term “expression value”, “level of expression” or “expression level” refers to numerical representation of a quantity of a gene product, which herein is a protein, but may also be an mRNA.
[0230] As used herein the term “comparing” denotes any examination of the amount or percent of MDSC or the expression level of any one of the suppressive characteristics of MDSC obtained in the samples of the invention as detailed throughout in order to discover similarities or differences between the measured values and a predetermined standard value or a value obtained in a control sample. It should be noted that comparing according to the present invention encompasses the possibility to use a computer based approach.
[0231] In one embodiment the present invention provides a method for predicting a cancer patient's response to treatment with a therapeutic agent, said method consisting of the steps of: [0232] (a) Measuring the amount of myeloid derived suppressor cells (MDSC) having the profile CD11b.sup.+CD33.sup.+HLA-DR.sup.− and/or CD11b.sup.+CD33.sup.+HLA-DR.sup.low, in at least one biological sample obtained from the patient; and [0233] (b) Determining whether the amount of MDSC of said profile is higher than a predetermined standard value or higher than a control sample; wherein [0234] (i) said therapeutic agent is a chemotherapeutic agent or an immunotherapeutic agent or a combination thereof, and wherein [0235] (ii) detection of a high amount of MDSC of the above profile in the at least one biological sample as compared with the predetermined standard value or the control sample indicates that the patient will not respond or will poorly respond to treatment with said agent.
[0236] In another embodiment, the present invention provides a method for monitoring a cancer patient's response to treatment with a therapeutic agent, said method consisting of the steps of: [0237] (a) Measuring the amount of myeloid derived suppressor cells (MDSC) having the profile CD11b.sup.+CD33.sup.+HLA-DR.sup.− and/or CD11b.sup.+CD33.sup.+HLA-DR.sup.low, in at least one biological sample obtained from the patient; and [0238] (b) Determining whether the amount of MDSC of said profile is higher than a predetermined standard value or higher than a control sample; wherein [0239] (i) said therapeutic agent is a chemotherapeutic or immunotherapeutic agent or a combination thereof, and wherein [0240] (ii) detection of a high amount of MDSC of the above profile in the at least one biological sample as compared with the predetermined standard value or the control sample indicates that the patient is not responding or is poorly responding to treatment.
[0241] The invention further encompasses kits, e.g. pre-packages diagnostic kits, such as those described below comprising ampoules or vessels containing: [0242] (a) Detecting molecules specific for MDSC having the profile CD11b.sup.+CD33.sup.+HLA-DR.sup.− and/or CD11b.sup.+CD33.sup.+HLA-DR.sup.low; and optionally further comprising at lease one of the following: [0243] i) detecting molecules for determining LDH levels; [0244] ii) detecting molecules specific for at least one of S100A8, S100A9, cleaved caspase 3, iNOS, arginase 1, NO, ROS, CD247 or SNX9; [0245] iii) secondary agents and/or buffers for performing detection of MDSC, LDH and at least one of S100A8, S100A9, cleaved caspase 3, iNOS, arginase 1, NO or ROS; and [0246] (b) instructions for use.
wherein said kit is for use in a method for predicting a cancer patient's response to treatment with a chemotherapeutic agent or an immunotherapeutic agent or a combination thereof, or for use in a method for determining whether the therapeutic regimen of a cancer patient should be altered.
[0247] In a specific embodiment, the detecting molecules specific for MDSC having the profile CD11b.sup.+CD33.sup.+HLA-DR.sup.− and/or CD11b.sup.+CD33.sup.+HLA-DR.sup.low comprise at least one antibody directed against each one of CD11b.sup.+, CD33.sup.+ and HLA-DR. The antibody may be but is not limited to a mouse antibody, a rabbit antibody, a goat antibody etc.
[0248] In a specific embodiment, the detecting molecules specific for MDSC having the profile CD11b.sup.+CD33.sup.+HLA-DR.sup.− and/or CD11b.sup.+CD33.sup.+HLA-DR.sup.low comprise at least one probe or primer nucleic acid capable of recognizing each one of the nucleic acids encoding CD11b.sup.+, CD33.sup.+ and HLA-DR.
[0249] Optionally, the kit further comprises detecting molecules specific for at least one of LDH, S100A8, S100A9, cleaved caspase 3, iNOS, arginase 1, NO or ROS.
[0250] In a specific embodiment, the detecting molecules specific for at least one of LDH, S100A8, S100A9, cleaved caspase 3, iNOS, or arginase 1 comprise at least one antibody directed against each one of these molecules.
[0251] In a specific embodiment, the detecting molecules specific for at least one of LDH, S100A8, S100A9, cleaved caspase 3, iNOS, or arginase 1, comprise at least one probe or primer nucleic acid capable of recognizing each one of the nucleic acids encoding each one of these molecules.
[0252] In a specific embodiment, the detecting molecules specific for at least one of LDH, NO or ROS comprise suitable reagents for functional detection of each one of these molecules.
[0253] The term “secondary agent” as used herein refers to an agent that binds to a detecting molecule and as such it binds indirectly to the target molecule via the detecting molecule, or to an agent that is necessary for performing the detection assay e.g. an enzymatic detection assay.
[0254] Non-limiting examples of secondary agents include antibodies, immunoglobulin binding proteins (e.g. protein A, protein G, Protein A/G, protein L), streptavidin (that binds to biotin and biotin labeled compounds), DNA or RNA strands that bind to complementary DNA or RNA strands, and chelating complexes (such as Ni-NTA) that bind to specific peptide tags (e.g. polyhistidine tag).
[0255] In the case of detecting molecules which are antibodies (primary antibodies), the selection of the type of secondary agent (e.g. a secondary antibody) is dependent on the class of the primary antibody (e.g. IgG or IgD), and on the source of the primary antibody, e.g. if the detecting antibody is a mouse antibody, the secondary antibody would be an anti-mouse antibody. The secondary antibody may be detectably labeled. Non-limiting examples of labels include an enzyme (e.g. HRP or AP), a fluorescent compounds (e.g. fluorescein or phycoerythrin), a chromophore, or an electrochemically active or a radioactive molecule.
[0256] In a specific embodiment, the invention provides a kit comprising: [0257] an ampoule containing anti CD11b antibodies, and [0258] an ampoule containing anti CD33 antibodies, or an ampoule containing a mixture of anti CD11b antibodies and anti CD33 antibodies; and [0259] at least one additional ampoule containing a detecting agent specific for at least one of LDH, S100A8, S100A9, cleaved caspase 3, iNOS, arginase 1, NO, ROS, CD247 or SNX9; and [0260] instructions for use.
[0261] In a further embodiment the anti CD11b antibodies, the anti CD33 antibodies and the at least one additional detecting agent specific for at least one of LDH, S100A8, S100A9, cleaved caspase 3, iNOS, arginase 1, NO, ROS, CD247 or SNX9 are detectably labeled.
[0262] In a further embodiment the anti CD11b antibodies, and/or the anti CD33 antibodies and/or the at least one additional detecting agent specific for at least one of LDH, S100A8, S100A9, cleaved caspase 3, iNOS, arginase 1, NO, ROS, CD247 or SNX9 are mobilized onto a substrate, e.g. a membrane, a filter or a bead.
[0263] In another embodiment the invention provides a kit consisting of: [0264] (a) Detecting molecules specific for MDSC having the profile CD11b.sup.+CD33.sup.+HLA-DR.sup.− and/or CD11b.sup.+CD33.sup.+HLA-DR.sup.low; and optionally further comprising at lease one of the following: [0265] i) detecting molecules for determining LDH levels; [0266] ii) detecting molecules specific for at least one of S100A8, S100A9, cleaved caspase 3, iNOS, arginase 1, NO, ROS, CD247 or SNX9; [0267] iii) secondary agents and/or buffers for performing detection of MDSC, LDH and at least one of iNOS, arginase 1, NO or ROS; and [0268] (b) instructions for use.
wherein said kit is for use in a method for predicting a cancer patient's response to treatment with a chemotherapeutic agent or an immunotherapeutic agent or a combination thereof, or for use in a method for determining whether the therapeutic regimen of a cancer patient should be altered.
[0269] As used herein, the term “comprising” is intended to mean that the methods and kits include the recited elements, but not excluding others.
[0270] The term “consisting of” when used to define methods or kits, shall mean excluding other elements of any essential significance to the method or kit.
[0271] In accordance with the present invention, there may be employed conventional molecular biology, microbiology, recombinant DNA, immunology, cell biology and other related techniques within the skill of the art. See, e.g., Sambrook et al., (2001) Molecular Cloning: A Laboratory Manual. 3rd ed. Cold Spring Harbor Laboratory Press: Cold Spring Harbor, N.Y.; Sambrook et al., (1989) Molecular Cloning: A Laboratory Manual. 2nd ed. Cold Spring Harbor Laboratory Press: Cold Spring Harbor, N.Y.; Ausubel et al., eds. (2005) Current Protocols in Molecular Biology. John Wiley and Sons, Inc.: Hoboken, N.J.; Bonifacino et al., eds. (2005) Current Protocols in Cell Biology. John Wiley and Sons, Inc.: Hoboken, N.J.; Coligan et al., eds. (2005) Current Protocols in Immunology, John Wiley and Sons, Inc.: Hoboken, N.J.; Coico et al., eds. (2005) Current Protocols in Microbiology, John Wiley and Sons, Inc.: Hoboken, N.J.; Coligan et al., eds. (2005) Current Protocols in Protein Science, John Wiley and Sons, Inc.: Hoboken, N.J.; Enna et al., eds. (2005) Current Protocols in Pharmacology John Wiley and Sons, Inc.: Hoboken, N.J.; Hames et al., eds. (1999) Protein Expression: A Practical Approach. Oxford University Press: Oxford; Freshney (2000) Culture of Animal Cells: A Manual of Basic Technique. 4th ed. Wiley-Liss; among others.
EXAMPLES
[0272] The present invention is described further below in working examples which are intended to further describe the invention without limiting the scope therein.
Example 1: Analysis of Melanoma Patients
[0273] Material and Methods
[0274] MDSC Analyses:
[0275] The human MDCS phenotype as described herein, HLADR-CD33.sup.+CD11b.sup.+, was determined using flow cytometry of blood samples, immunohistology of tumor sections, and ELISA. Suppressive features of MDSC were analyzed by measuring NO, ROS, the S100A8/9 pro-inflammatory proteins, cleaved caspase 3 and MDSC suppressive activity on T cells (down regulating CD247 and SNX9 expression and impairing T cell proliferation). Suppressive features are characterized by elevated levels of NO and ROS, increased levels of the S100A8/9 pro-inflammatory proteins, low levels of cleaved caspase 3 and MDSC suppressive activity on T cells (down regulating CD247 and SNX9 expression and impairing T cell proliferation).
[0276] Cryopreservation and Thawing Procedure:
[0277] Peripheral blood (whole blood) samples were tested as fresh upon lysing the erythrocytes, or were cryopreserved by mixing the sample with DMSO/FCS (freezing medium) and were transferred into cryovial tubes at different volumes (100, 200, 300 and 500 μl/vial). The cryovial tubes were first stored in liquid N.sub.2 containers. For analysis, whole blood samples were then thawed into 15 ml tubes containing preheated medium (RPMI-1640). After one wash whole blood samples were resuspended in PBSX1 (50-100 μl whole blood in 200 μl PBSX1) and stored in 4° C. refrigerators for maximum 1 h prior to staining and flow-cytometry analysis or functional assays.
[0278] Antibodies for Surface and Intracellular Markers:
[0279] the following labeled anti-human monoclonal antibodies (mAbs) were used for staining: anti-HLA-DR-FITC, anti-CD27-FITC, anti-CD33-PE, anti-CD56-PE, anti-CD11b-APC, anti-CD3ε-APC, anti-HLA-DR-Pacific-blue (Biolegend). Rabbit polyclonal anti-human Cleaved caspase-3-Alexa Fluor 488 was purchased from Cell Signaling Technology. Prior to staining, each antibody was tittered to determine its optimal dilution using cryopreserved whole blood samples obtained from healthy donors.
[0280] Staining Whole Blood Samples:
[0281] for human myeloid derived suppressor cells (MDSCs) staining, whole blood samples were loaded on a 96U shape plates and washed twice with a flow stain buffer (PBSX1, 1% human serum). After adding anti-CD11b, CD33 and HLA-DR mAb (50 μl/well in flow stain buffer), whole blood samples were incubated for 30 min at room temperature (RT) in the dark. After incubation with mAb 200 μl of 1X eBioscience-Step Fix/Lyse solution was added, mixed thoroughly and incubated for another 30 min at RT in the dark, washed twice and resuspended in 200 μl of flow stain buffer. For CD247 or cleaved caspase-3 intracellular detection, whole blood samples were loaded on 96U shape plates and washed twice with PBSX1. Samples were fixed with 2% paraformaldehyde in PBS for 20 min at 4° C. in the dark, washed twice with PBSX1 and permeabilized (with permeabilization buffer, PB-0.1% saponin, and 1% human serum) for 10 min at RT in the dark. After washing the samples twice anti-CD56, CD3ε, CD247 or anti-CD33, CD11b, HLA-DR and Cleaved caspase-3 antibodies were added (50 μl/well in PB) for 30 min at 4° C. in the dark. Samples were then washed twice with PB and were resuspended with 200 μl flow stain buffer.
[0282] Flow Cytometry:
[0283] Samples were analyzed by FACSCalibur using Cell Quest software (BD). For MDSCs detection, after the initial FSC/SSC discrimination, the gate was set on HLA-DR.sup.− cells and then on the CD11b.sup.+CD33.sup.+ population. To evaluate cleaved caspase-3 expression in MDSCs, the gate was first set on HLA-DR.sup.− cells and then the percent and mean fluorescent intensity (MFI) of positive cells in the CD11b.sup.+CD33.sup.+ population was determined. For CD247 expression in T cells, the gate was first set on CD3e+CD56.sup.− cells and then the MFI of CD247 in this population was determined. Cleaved caspase-3 staining was performed using primary Rabbit anti-cleaved caspase-3 (Cell Signaling Technology) and secondary FITC-horse anti-Rabbit antibody (Thermo Scientific).
[0284] ROS Detection:
[0285] APF (Cell Technology) was used to measure ROS production by MDSC. Whole blood samples were incubated at 37° C. in HBSS in the presence of APF and 5 μg/well LPS for 30 min. Un-stimulated and stimulated samples were then stained with labeled anti-CD33, CD11b and HLA-DR mAb in 50 μl HBSS. After 30 min incubation, 200 μl of 1X eBioscience-Step Fix/Lyse solution was added, mixed thoroughly and incubated for another 30 min at RT. Samples were then washed twice with HBSS and analyzed by four color flow cytometry. Gating was the same as used for Cleaved caspase-3. Aliquots of Antibody-stained samples which were not incubated with APF served as controls.
[0286] NO Detection:
[0287] DAF-2DA (cell technology) was used to measure NO production by MDSC. Whole blood samples were incubated at 4° C. in PBSX1 in the presence of DAF-2DA for 30 min. Samples were then stained with labeled anti-CD33, CD11b and HLA-DR mAb in 50 μl PBSX1. After 30 min incubation, 200 μl of 1X eBioscience-Step Fix/Lyse solution was added, mixed thoroughly and incubated for another 30 min at RT. Samples were then washed twice with PBSX1 and analyzed by four color flow cytometry. Gating was the same as used for Cleaved caspase-3. Aliquots of Antibody-stained samples, which were not incubated with DAF-2DA served as controls.
[0288] Isolation of MDSCs:
[0289] Whole blood samples were treated with erythrocyte lysis buffer (ELB-eBioscience) to remove red blood prior to the isolation procedure. White blood cells were first incubated with anti-HLA-DR Ab-coated magnetic beads (Miltenyi) for 30 min and separated using the MACS columns (Miltenyi) according to the manufacturer orders. Negatively selected HLA-DR.sup.− cells were then incubated with anti-CD33 coated magnetic beads for 30 min to positively identify CD33.sup.+HLA-DR.sup.− and was followed with another incubation for 30 min with anti-CD11b coated magnetic beads to positively identify CD33 CD11b.sup.+HLA-DR.sup.− MDSCs.
[0290] Statistical Analysis:
[0291] Statistical analyses were performed using GraphPad Prism 5.04. Averaged values are presented as the mean±s.e.m. When comparing two groups, statistical significance was determined using two-tailed Student's t test. When more than two groups were investigated, we performed an analysis of variance (ANOVA). Survival analyses were assessed using Geham-Breslow-Wilcoxon test. P values of less than <0.05 were considered statistically significant.
[0292] Results:
[0293] HLA-DR-CD33.sup.+CD11b.sup.+ MDSC Levels are Increased in Melanoma Patients.
[0294] The percentage of MDSC with the profile CD11b.sup.+CD33.sup.+HLA-DR.sup.− was measured in peripheral blood samples (3-5 ml) of healthy donors (n=40) and stage-4 melanoma patients (n=56) prior to ipilimumab (anti-CTLA4) treatment. All the melanoma patients were diagnosed with metastatic melanoma. The samples were taken according to the Helsinki approval. Clinical parameters were acquired from the medical records of patients.
[0295] The MDSCs were isolated and analyzed by FACS as described in materials and methods above. As can be seen in
[0296] MDSCs Levels are not Affected by Age, Tumor Origin or Chemotherapeutic Treatments Prior to Ipilimumab Treatments.
[0297] In order to evaluate the effects of additional parameters on the level of MDSC in the blood of melanoma patients, various patient groups were analyzed. First, melanoma patients were divided into two age groups, 30-60 years old and 60-90 years old. Peripheral blood was obtained from the patients and the percentage of MDSCs in the blood was evaluated in these two age groups by using flow cytometry analysis as described in Materials and Methods above. As can be seen in
[0298] MDSCs Levels can Distinguish Between Responders and Non-Responders to Ipilimumab Treatment.
[0299] In order to evaluate whether MDSC levels in the blood can predict responsiveness to treatment with the anti CTLA4 antibody ipilimumab, the levels of MDSC in the peripheral blood of melanoma patients were measured, as described above, prior to treatment with ipilimumab. Following treatment with ipilimumab, the melanoma patients were divided into two groups: a group of responders which included patients that manifested stable disease and patients that showed a complete response, and a group of non-responders which included patients with progressive disease. As shown in
[0300] High MDSCs Frequencies Correlate with Poor Survival.
[0301] The following experiment was performed in order to evaluate whether MDSC levels in the blood can predict metastatic severity and patient survival. The levels of MDSC, as well as the levels of LDH, were measured in the peripheral blood of melanoma patients, as described above, prior to treatment with ipilimumab. As shown in
[0302] LDH Levels and Metastatic Severity Correlates with Patient's Survival.
[0303] In this experiment the survival of melanoma patients was correlated with the severity of their metastatic stage and with their LDH levels. The patients were divided into two groups according to their metastatic level prior to ipilimumab treatments; the first group included patients with the relatively lower metastatic severity, namely M1A/B/C, and the second group included patients with the higher, M2, metastatic severity. As shown in
[0304] A Combination of MDSCs, LDH and Metastatic Levels Before Ipilimumab Treatments Distinguishes Between High and Low Survival Rates of Patients.
[0305] In view of the results shown in the two previous sections, in the following experiment the combined predictive value of measuring MDSC levels, LDH levels and metastatic severity on patients' survival was analyzed. Melanoma patients were divided into two groups according to their initial parameters as measured before the first ipilimumab treatment. Group I included patients with low levels of MDSCs, low levels of LDH and had metastatic staging of M1A-C (MDSC↓LDH↓M1A-C); group II included patients with high MDSCs levels, high LDH levels and a metastatic staging of M2 (MDSC↑LDH↑M2). The low and high levels were defined as shown in the above examples. As clearly shown in
[0306] Analysis of Ipilimumab Responders
[0307] Table 1 shows parameters of 14 patients that responded to the ipilimumab treatment out of the 56 patients involved in this study. The Table shows the type of response (SD—stable disease; CR—complete response; PR—partial response; PD—progressive disease). Patient's number 12 and 14 had a very short period of responsiveness in comparison to the other responders, as indicated by their low survival rates (in months). These patients had high LDH levels on the day the first ipilimumab treatment was given and their staging level was M1C.
Example 2: Analysis of Metastatic Colorectal Cancer (CRC) Patients and CRC Mouse Models
[0308] Material and Methods
[0309] Patients:
[0310] Peripheral blood samples were collected from 23 stage IV metastatic CRC-patients prior to and every 2 months in the course of chemotherapy treatments. All patients that were diagnosed with metastatic CRC underwent surgery and were not previously treated with chemotherapy. 20 healthy donors were used as controls. The samples were taken according to the Helsinki approval and analyzed for the indicated immune biomarkers in a “blinded test”, not knowing the therapy specification.
TABLE-US-00001 TABLE 1 MDSC Survival Respond (%) LDH (months) Stage Status 1 SD 55.3 259 12 M1A AWD 2 CR 35.8 275 12 M1B AWD 3 CR 16.5 300 24 M1B AWD 4 CR 48.9 340 20 M1B AWD 5 CR 35 350 16.5 M1B NED 6 SD 9.2 351 24 M1B AWD 7 SD 50.4 353 20 M1B AWD 8 SD 41 371 16.5 M1B AWD 9 SD 11.5 379 24 M1A AWD 10 SD 15.5 390 26 M1A AWD 11 SD 50.8 442 20 M1B AWD 12 SD 25.8 487 5.5 M1C DOD 13 PR 13.8 Normal 26 M1B AWD 14 SD-PD 50.5 530 8.5 M1C DOD
analyses completion, the specific treatment regiments and clinical parameters were acquired from medical records of the patients and correlation tests were performed.
[0311] Mice:
[0312] Female C57BL/6 and BALB/c mice (aged 6-8 weeks) were purchased from Harlan (Jerusalem, Israel) and were grown at the Hebrew University specific-pathogen-free facility. All experiments were done in accordance with pre-approved institutional protocols.
[0313] In Vivo Mouse Models: A Model for Colorectal Cancer (CRC) and a Model for Tumor-Free Chronic Inflammation:
[0314] Mice were injected intraperitoneally with 10 mg/kg body weight of Azoxymethan (AOM, purchased from Sigma-Aldrich (St. Louis, Mo., USA)) dissolved in physiological saline twice in two weeks intervals. Two weeks later, 2% dextran sulfate sodium (DSS, purchased from MP biochemicals Inc. (Santa Ana, Calif., USA)) was given in the drinking water over 7 days, followed by 14 days of regular water (15). This cycle was repeated twice. Animals were sacrificed and analyzed three weeks after the last treatment. To induce a pathology-free chronic inflammation, a previously described protocol subjecting mice to heat-killed Mycobacterium tuberculosis (BCG) treatment (16) was used.
[0315] CFSE Staining and Ex-Vivo T-Cell Proliferation Assay:
[0316] Splenocytes or purified T-cells isolated by a magnetic column separation system (Miltenyi Biotec) were labeled with 5 M CFSE (Invitrogen) and subjected to TCR-mediated activation as previously described (16).
[0317] Ex Vivo Myeloid-Cell Differentiation:
[0318] MDSCs were isolated from CRC and control (normal) mice and cultured in the presence or absence of 10 ng/ml GM-CSF (PeproTech) for 3 days. In some samples, 5-fluoruracil (5FU) and Irinotecan (CPT11) were added to the cells, with or without GM-CSF, followed by phenotyping using flow cytometry.
[0319] Flow Cytometry Analysis:
[0320] Isolated mouse splenocytes and peripheral blood lymphocytes (PBLs) were subjected to cell surface staining as previously described (16), using the following antibodies (Biolegend): FITC-labeled anti-Gr1, and anti-CD11c; PE-labeled anti-F4/80, anti-CD3s, and anti-mNKp46; and biotinylated anti-CD11b detected with streptavidin-Cy5. Intracellular staining for CD247 was performed as previously described (16) by using FITC-labeled anti-CD247 or biotinylated anti-CD247 (lone H146), the latter detected with streptavidin-Cy5. Foxp3 staining was performed according to the manufacturer's instructions (Miltenyi Biotec). Cleaved caspase-3 staining was performed using primary Rabbit anti-cleaved caspase-3 (Cell Signaling Technology, Asp175) and secondary FITC-horse anti-Rabbit antibody (Thermo Scientific). For intracellular NO.sup.− and ROS detection, diaminofluoresciein-2 diacetate (DAF-2DA) reagent (NOS 200-1; Cell Technology) and aminophenyl fluorescein (APF) (4011; Cell Technology) were used respectively and determined by flow cytometry analysis.
[0321] For human whole blood cell phenotyping, intracellular staining of CD247 cells was performed by first fixing the cells with paraformaldehyde 1% followed by washes and permeabilized with 0.1% saponin. APC-labeled anti-CD11b and anti-CD3, PE-labeled anti-CD33, FITC-labeled anti-HLA-DR and anti-CD247 were used, all purchased from BD Pharmingen and used according to the manufacturer's protocol. After surface staining, cells were treated eBioscience-Step Fix/Lyse solution according to the manufacturer's instructions. All samples were analyzed using FACS Calibur with Cell Quest software (BD).
[0322] Cell Isolation from the Colon:
[0323] The preparation of single cell suspensions from colons was performed using a modified version of a previously described protocol (17). Briefly, isolated colons were washed with HBSS 5% FBS (Invitrogen), digested, minced, incubated for 15 min at 37° C. and epithelial cell suspension was washed with RPMI. For lamina propria cells, the retained tissue was transferred to collagenase/DNAse (Roche Diagnostic Corporation) solution, incubated for 1 h at 37° C., filtrated and washed with RPMI.
[0324] Quantitative PCR Analysis:
[0325] Total RNA was recovered from colon cells, splenocytes or isolated MDSCs and subjected to real-time PCR analysis as previously described (16). The sequences of the oligonucleotides used are listed in Table 2.
TABLE-US-00002 TABLE 2 Gene Forward primer Reverse primer S100a8 GGAAATCACCATGCCCTCTACAA ATGCCACACCCACTTTTATCACC SEQ ID NO: 1 SEQ ID NO: 2 S100a9 GGAGCGCAGCATAACCACCATC GCCATCAGCATCATACACTCCTCA SEQ ID NO: 3 SEQ ID NO: 4 Hprt GTTAAGCAGTACAGCCCCAAA AGGGCATATCCAACAACAAACTT Hypoxanthine SEQ ID NO: 5 SEQ ID NO: 6 Phosphoribosyl- transferase TNF-α GCCACCACGCTCTTCTGTCTAC GGGTCTGGGCCATAGAACTGAT SEQ ID NO: 7 SEQ ID NO: 8
[0326] Western Blot Analysis:
[0327] Cells isolated from the spleen or colon were analyzed by Western blotting for the expression of various proteins as previously described (16). The antibodies used for immunoblotting were: anti-S100A9, anti-S100A8, and anti-αTubulin. Specific antibodies were detected by anti-rabbit or anti-goat antibodies conjugated to horseradish peroxidase (Jackson Immunoresearch), followed by enhanced chemiluminescence and exposure at blotting reader (Bio-Rad software).
[0328] Histopathology and Immunohistochemistry:
[0329] Paraffin-embedded colon tissue sections were prepared from CRC, CRC-5FU or CRC-CPT11 treated and control-untreated mice and stained with hemotoxylin and eosin solution. For immunohistochemistry, after antigen retrieval, sections were incubated at 4° C. with primary antibodies: anti-β-catenin (BD) and anti-Gr-1 (Biolegend). For immunohistochemical staining, universal immuno-peroxidase polymer for mouse tissues (414311F; Histofine) was used, based on a horseradish peroxidase (HRP)-labeled polymer conjugated to anti-Rat. After incubation for 30 min, slide staining was completed by 3-5 min incubation with DAB+Chromogen (Lab Vision), followed by counterstaining with hematoxylin. As a control, samples were stained with each antibody and reagent individually.
[0330] Statistical Analysis:
[0331] Statistical analyses were performed using GraphPad Prism 5.04. Averaged values are presented as the mean±s.e.m. When comparing two groups, statistical significance was determined using two-tailed Student's t-test. When more than two groups were investigated, an analysis of variance (ANOVA) was performed. Survival analyses were assessed using Fisher's exact test.
[0332] For the human experiments, paired t-test was used to compare samples from the same patients before and after FOLFOX or FOLFIRI treatment. Control and CRC groups were investigated by ANOVA.
[0333] Results:
[0334] FOLFOX and FOLFIRI Therapies of CRC-Patients Display Opposite Effects on CD11b.sup.+CD33.sup.+HLA-DR.sup.−/CD11b.sup.+CD33.sup.+HLA-DR.sup.Low Myeloid Cells and Immune Status
[0335] The immune status of 23 stage IV metastatic CRC patients was assessed prior to receiving chemotherapy and compared with the immune status of 20 healthy donors. Peripheral blood samples were obtained from the healthy donors and the CRC patients and the levels of MDSC were measured using flow cytometry analysis of the cells. The percentage of CD11b.sup.+CD33.sup.+HLA-DR.sup.− MDSCs in the patients' peripheral blood was significantly higher (12.65%+1.35%, p<0.01) as compared to healthy donors (5.35%+1.05%) (
[0336] CPT11 but not 5-Fluoruracil (5FU) Treatment Increases MDSC Accumulation at the Tumor Site and Support CRC Growth
[0337] To further investigate whether 5FU and CPT11 display an adverse effect on the immune system, a mouse inducible CRC model based on AOM-DSS treatments was used (
[0338] Moreover, 5FU and CPT11 were found to display opposite effects on β-catenin localization in CRC colons. Colons isolated from the normal and the untreated CRC-mice untreated or CRC-mice treated with 5FU or CPT11 were subjected to immunohistological staining with anti-β-catenin antibodies, as described in the methods. The immunohistochemical analysis showed a massive β-catenin accumulation in the nuclei of tumor cells both in colons from untreated and CPT11 treated CRC-mice, suggesting tumor progression (15).
[0339] Histological analyses of colons from CPT11 treated CRC-mice demonstrated not only a loss of entire crypts and surface epithelial layer, but also a massive leukocyte infiltration into the mucosa. Importantly, immunohistochemical probing of MDSCs within the colon revealed elevated levels of the cells in untreated and in CPT11 treated but not in 5FU treated CRC-mice. The same correlation between MDSC accumulation and the given treatment was also observed when testing tumors in colons. Analysis of cells generated from the colon lamina propria (LP) (
[0340] CPT11 Treatment Increases Systemic Immunosuppression and Counteracts 5FU Beneficial Effects
[0341] In this experiment, the effects of CPT11 and 5FU on the systemic immunosuppressive state were examined. As shown by the following experiment, a combined 5FU/CPT11 therapy abrogates recovery from immunosuppression during CRC progression. CRC-mice were either subjected to 5FU, CPT11 or a 5FU/CPT11 combination starting at week eight, or were left untreated. Three weeks after the second DSS treatment mice were sacrificed and spleens were analyzed. Untreated, CPT11- and 5FU/CPT11-treated CRC-mice display stronger inflammatory response as indicated by the enlarged spleen size as compared to 5FU treated CRC- or control-mice (
[0342] Moreover, while MDSCs from 5FU treated CRC-mice displayed a significantly reduced NO.sup.− and ROS production, MDSCs from CPT11 or 5FU/CPT11 treated CRC-mice displayed elevated levels, as compared to untreated CRC-mice (
[0343] Next, the effect of the given chemotherapies on the immune status was evaluated. This was performed by testing the function of the whole T-cell population (
[0344] CPT11 Harmful Effects on the Host's Immune Function are Mediated Via MDSCs
[0345] The observed MDSC elevation and increased tumor load in CPT11 treated CRC-mice as described above, suggests an impact of CPT11 on MDSC-induced cancer progression. Therefore, MDSC depletion could reduce the harmful effect of CPT11 on the immune status, and thereby enhance the anti-tumor effect. CRC-mice were subjected to either 5FU, CPT11 or a 5FU/CPT11 combination starting at week eight, or were untreated. At the same day of the second DSS administration, CPT11-treated CRC-mice were randomly separated into two groups; one group continued with CPT11 treatment while the second group was treated with anti-Gr1 mAb for MDSC depletion in addition to CPT11 treatment. A schematic description of the CRC mouse model in which the MDSCs were depleted by Gr1 mAb administration is shown in
[0346] MDSCs are Insensitive to Apoptosis Under CPT11 Treatment but Become Susceptible after 5FU Treatment
[0347] Next, the mechanisms responsible for the opposite effects of 5FU and CPT11 on MDSC accumulation were investigated. One possible explanation for the observed differential effect of these drugs on MDSC levels could be a change in the sensitivity of the MDSCs to apoptosis, as previously reported for 5FU (11). Therefore, Splenic MDSCs from each group were analyzed for the expression of activated (cleaved) caspase-3 by flow cytometry analysis. To assess the direct effect of 5FU and CPT11 on cleaved caspase-3 expression, primary MDSCs isolated from spleens of CRC mice (n=6) were ex-vivo incubated with various doses of the drugs for 3 days and subjected to flow cytometry analysis. To assess which cells are affected by the chemotherapeutic drugs, MDSCs isolated from spleens of CRC mice were cultured ex-vivo with 10 ng/ml of GM-CSF in the absence or presence of scaled-doses (0, 1.25, 2.5, and 5 mol/L) of 5FU or CPT11 for 3 days. Cleaved caspase-3 levels were then evaluated on the primary MDSCs, differentiated CD11c.sup.+CD11b.sup.+DCs and F4/80.sup.+CD11b.sup.+ macrophages. Indeed, a significant increased cleaved caspase-3 expression, an indicator for apoptosis, was observed within spleen MDSCs from 5FU treated CRC-mice, similar to that detected in MDSCs from control-mice (
[0348] In addition, 5FU and CPT11 were found to differently affect monocytic/granulocytic MDSC sensitivity to apoptosis. MDSCs isolated from spleens of CRC-mice (n=5) were cultured ex vivo in the presence of 2.5 mol/L of 5FU, CPT11 or 5FU and CPT11 for 3 days. Cultured MDSCs were analyzed for cleaved caspase-3 expression (MFI) by flow cytometry analysis gaiting on CD11b.sup.+Ly6C.sup.high Ly6G monocytic MDSCs (M-MDSCs) and CD11b.sup.+Ly6C.sup.lowLy6G.sup.+ granulocytic MDSCs (G-MDSCs) sub-populations. It was found that 5FU controls both monocytic and granulocytic purified cultured MDSC populations, with the monocytic population being more sensitive, as indicated by the enhanced cleaved caspase-3 expression upon 5FU addition or when combined with CPT11 (
[0349] The drugs did not affect the apoptotic state of other immune cells such as T (CD3.sup.+) lymphocytes or B (B220.sup.+) lymphocytes (
[0350] 5FU and CPT11 Directly Affect Myeloid Cell Maturation and Suppressive Activity
[0351] Next, the effect of 5FU and CPT11 on MDSC maturation was examined. For that purpose the expression of the S100A8/9 pro-inflammatory proteins was assessed. The S100A8/9 pro-inflammatory proteins are induced in the course of tumorigenesis and chronic inflammation and play a role in controlling MDSC accumulation and retention in their immature suppressive state (7, 16, 19). S100A8/9 mRNA and protein levels were evaluated in MDSCs isolated from the spleen of CRC-mice, or CRC-mice treated with 5FU or CPT11 (n=4), α-Tubulin levels served as a control. While 5FU treatment of CRC-mice induced a significant decrease in S100A8/9 mRNA and protein levels in the spleen as compared to control-mice, increased S100A8/9 levels were observed following CPT11 treatment (
[0352] When testing the ex vivo direct effects of the drugs on GM-CSF mediated CRC-derived MDSC differentiation, it was found that, similar to the in vivo effects, CPT11 prevented cell differentiation after both 48 h (data not shown) and 72 h (
[0353] 5FU and CPT11 Opposing Effects on MDSCs are Tumor Independent
[0354] Next, the immunoregulatory effects of 5FU and CPT11 were examined in a mouse model for chronic inflammation and associated immunosuppression (10), as described in the materials and method section above and in
[0355] Next, it was assessed whether the 5FU and CPT11 opposite effects on MDSCs have different impacts on the host's immune competence. Assessment of the drugs' effects on total T-cell activity, and specifically CD8.sup.+ T-cells revealed a significant recovery of CD247 expression in the spleen and PBLs as well as T-cell proliferation following 5FU but not CPT11 or 5FU/CPT11 treatments (
REFERENCES
[0356] 1. Terzic J, et al. Inflammation and colon cancer. Gastroenterology 2010; 138: 2101-14 e5. [0357] 2. Zhang B, et al. Circulating and tumor-infiltrating myeloid-derived suppressor cells in patients with colorectal carcinoma. PLoS One 2013; 8: e57114. [0358] 3. Sun H L, et al. Increased frequency and clinical significance of myeloid-derived suppressor cells in human colorectal carcinoma. World J Gastroenterol 2012; 18: 3303-9. [0359] 4. Coussens L M and Werb Z. Inflammation and cancer. Nature 2002; 420: 860-7. [0360] 5. Bruchard M, et al. Chemotherapy-triggered cathepsin B release in myeloid-derived suppressor cells activates the Nlrp3 inflammasome and promotes tumor growth. Nat Med 2013; 19: 57-64. [0361] 6. Bunt S K, et al. Inflammation enhances myeloid-derived suppressor cell cross-talk by signaling through Toll-like receptor 4. J Leukoc Biol 2009; 85: 996-1004. [0362] 7. Cheng P, et al. Inhibition of dendritic cell differentiation and accumulation of myeloid-derived suppressor cells in cancer is regulated by S100A9 protein. J Exp Med 2008; 205: 2235-49. [0363] 8. Kanterman J, et al. New insights into chronic inflammation-induced immunosuppression. Semin Cancer Biol 2012; 22: 307-18. [0364] 9. Ramakrishnan R, and Gabrilovich D I. Mechanism of synergistic effect of chemotherapy and immunotherapy of cancer. Cancer Immunol Immunother 2011; 60: 419-23. [0365] 10. Vaknin I, et al. A common pathway mediated through Toll-like receptors leads to T- and natural killer-cell immunosuppression. Blood 2008; 111: 1437-47. [0366] 11. Vincent J, et al. 5-Fluorouracil selectively kills tumor-associated myeloid-derived suppressor cells resulting in enhanced T-cell-dependent antitumor immunity. Cancer Res 2010; 70: 3052-61. [0367] 12. Hillner B E, et al. Cost-effectiveness projections of oxaliplatin and infusional fluorouracil versus irinotecan and bolus fluorouracil in first-line therapy for metastatic colorectal carcinoma. Cancer 2005; 104: 1871-84. [0368] 13. Nelson M A, et al. A comparison of mortality and costs associated with FOLFOX versus FOLFIRI in stage I V colorectal cancer. J Med Econ 2011; 14: 179-86. [0369] 14. Tournigand C, et al. FOLFIRI followed by FOLFOX6 or the reverse sequence in advanced colorectal cancer: a randomized GERCOR study. J Clin Oncol 2004; 22: 229-37. [0370] 15. Popivanova B K, et al. Blocking TNF-alpha in mice reduces colorectal carcinogenesis associated with chronic colitis. J Clin Invest 2008; 118: 560-70. [0371] 16. Sade-Feldman M, et al. Tumor necrosis factor-alpha blocks differentiation and enhances suppressive activity of immature myeloid cells during chronic inflammation. Immunity 2013; 38: 541-54. [0372] 17. Drakes M L, et al. Isolation and purification of colon lamina propria dendritic cells from mice with colitis. Cytotechnology 2004; 46: 151-61. [0373] 18. De Robertis M, et al. The AOM/DSS murine model for the study of colon carcinogenesis: From pathways to diagnosis and therapy studies. J Carcinog 2011; 10: 9. [0374] 19. Sinha P, et al. Proinflammatory S100 proteins regulate the accumulation of myeloid-derived suppressor cells. J Immunol 2008; 181: 4666-75.