METHOD FOR DETERMINING LEVELS OF INTERACTIONS BETWEEN BIOMOLECULES

Abstract

The invention relates to a method for determining levels of interactions between biomolecules, such as proteins, in a sample, comprising providing a first and a second information carrying (IC) oligonucleotide, wherein the first and second IC oligonucleotide are attached, covalently or non-covalently, to a first and a second affinity reagent, such as antibodies, that have the capacity to bind to a first and a second biomolecule, wherein the first and second IC oligonucleotide each comprises at least one single-stranded stretch that is complementary to a part of another oligonucleotide, thereby, upon hybridisation of the at least one single-stranded stretch in at least one of the first and second IC oligonucleotides to its complementary part of another oligonucleotide, enabling measurement of the relative proportion of interacting and non-interacting first and second biomolecules in the sample at a single cell or single molecular level. Further, the invention relates to kits including necessary oligonucleotides and reagents to carry out the method of the invention.

Claims

1. Method for determining levels of interactions between biomolecules, such as proteins, in a sample, comprising providing a first and a second information carrying (IC) oligonucleotide, wherein the first and second IC oligonucleotide are attached, covalently or non-covalently, to a first and a second affinity reagent, such as antibodies, that have the capacity to bind to a first and a second biomolecule, wherein the first and second IC oligonucleotide each comprises at least one single-stranded stretch that is complementary to a part of another oligonucleotide, thereby, upon hybridisation of the at least one single-stranded stretch in at least one of the first and second IC oligonucleotides to its complementary part of another oligonucleotide, enables measurement of the relative proportion of interacting and non-interacting first and second biomolecules in the sample at a single cell or single molecular level.

2. Method according to claim 1, wherein the single-stranded stretch of the first and second IC oligonucleotides enables interaction (a) between the first and/or second IC oligonucleotide and an information receiving (IR) oligonucleotide, (b) between the first and/or second IC oligonucleotide and an activating oligonucleotide, or (c) directly between the first and second IC oligonucleotide.

3. Method according to claim 1, comprising the steps of: a. providing the single-stranded information receiving (IR) DNA molecule, wherein the IR DNA molecule is circular or linear, carrying at least a first and a second cleavage motif, wherein the cleavage motifs are chosen so that the cleavage motif sites must become double-stranded in order to allow cleavage; b. providing the first information carrying (IC) DNA molecule, comprising a single-stranded stretch that is complementary to the part of the IR DNA molecule carrying the first cleavage motif, wherein the occurrence of the first IC DNA molecule reflects the amount of a first biomolecule in the sample; c. providing the second information carrying (IC) DNA molecule, comprising a single-stranded stretch that is complementary to the part of the JR DNA molecule carrying the second cleavage motif, wherein the occurrence of the second IC DNA molecule reflects the amount of a second biomolecule in the sample; d. mixing the DNA molecules of step a-c under conditions that allow binding of complementary single-stranded stretches; e. adding digestion enzyme(s) to create nick(s) at the cleavage motif site(s) that has/have become double-stranded, thereby forming i. a first reporter tag binding site that will allow binding of a first reporter tag DNA molecule or sequence, comprising a single-stranded stretch that is complementary to a part of the first IC DNA molecule, and/or ii. a second reporter tag binding site that will allow binding of a second reporter tag DNA molecule or sequence comprising a single-stranded stretch that that is complementary to a part of the second IC DNA molecule; f. incorporating reporter tag DNA sequences by any one of the following alternatives: i. adding the first reporter tag DNA molecule and the second reporter tag DNA molecule, whereby the first reporter tag DNA molecule is incorporated in the IR DNA molecule at the first reporter tag binding site if a nick has been created at the first cleavage motif site, and/or the second reporter tag DNA molecule is incorporated in the IR DNA molecule at the second reporter tag binding site if a nick has been created at the second cleavage motif site; or ii. using a DNA polymerase and nucleotides to incorporate the first reporter tag DNA sequence in the IR DNA molecule by filling the gap complementary to the first reporter tag binding site on the first IC oligonucleotide if a nick has been created at the first cleavage motif site, and/or to incorporate the second reporter tag DNA sequence in the IR DNA molecule by filling the gap complementary to the second reporter tag binding site on the second IC oligonucleotide if a nick has been created at the second cleavage motif site; and adding a ligation enzyme ligating the IR DNA molecule, thereby providing a recreated IR DNA molecule; g. optionally amplifying the recreated IR DNA molecule of step f; h. monitoring the incorporation of the first and/or second reporter tag(s) in the recreated IR DNA molecule, as a measurement of the occurrence of and/or interaction between the first and/or the second biomolecule(s) in the sample.

4. Method according to claim 3, wherein cleavage motifs are chosen from uracils or restriction sites.

5. Method according to claim 3, wherein the digestion enzyme(s) used to create nicks at the cleavage motif sites is/are chosen from i. nicking endonuclease 3′ Nb.Bsr.DI nicking 3′ of a double stranded restriction site, ii. nicking endonuclease 5′ Nt.BsmAI nicking 5′ of a double stranded restriction site, or iii. a combination of Uracil-DNA glycolsylase (UDG), removing a uracil base at a double stranded site, and EndolV, removing the apyrimidinic site.

6. Method according to claim 3, wherein the monitoring is performed by a. providing a first labeled detection oligonucleotide that is complementary to at least a part of the first reporter tag DNA molecule, and a second labeled detection oligonucleotide that is complementary to at least a part of the second reporter tag DNA molecule, and b. hybridizing the first and second labeled detection oligonucleotides to the recreated IR DNA molecule, which optionally is amplified.

7. Method according to claim 3, wherein a linear recreated IR DNA molecule is amplified and thereafter separated by a separation method, such as electrophoresis or chromatography, wherein separation products having different sizes indicate incorporation of different reporter tags.

8. Method according to claim 3, wherein the identities of different reporter tags are monitored by sequencing.

9. Method according to claim 3, wherein the recreated IR DNA molecule is monitored in the sample where it has been formed, such as by microscopy, or wherein the recreated IR DNA molecule is collected from the sample where it has been formed followed by sorting and analysis of single molecules, such as by microscopy.

10. Method according to claim 3, for removing abasic sites and improving detection efficiency, wherein after the reporter tag molecules have been added and the first and/or second reporter tag have/has been incorporated into the IR, the following steps are performed: i. hybridizing a digestion template to the IR DNA molecule making the area around the remaining abasic site double stranded; ii. removing the abasic site by digesting the double stranded area by a suitable restriction enzyme, such as EndoIV; iii. gap-filling the digested area with a suitable polymerase, such as T4 DNA polymerase, to add the missing base, such as thymidine; and ligating the IR DNA molecule with a ligase, such as T4 ligase, to provide a recreated IR DNA molecule.

11. Method according to claim 1, a. wherein the first and second IC oligonucleotides comprise hairpin structures in which fluorophores and quenchers are positioned, wherein the hairpin structures are designed so that only one fluorophore per oligonucleotide can emit light, and wherein each fluorophore has a unique signal; b. wherein the hairpins in the first and second IC oligonucleotides are disrupted or destabilized by either i. providing an activating oligonucleotide that is complementary to the first or the second IC oligonucleotide thereby binding to the first or second IC oligonucleotide, or ii. degrading one of the strands in the hairpins of one or both IC oligonucleotides, thereby liberating a single-stranded stretch of DNA in the first and/or second IC oligonucleotide, so that the first and second IC oligonucleotides can interact with each other causing a repositioning of fluorophores and quenchers; c. wherein pairs of conjugates, comprising affinity reagents coupled to the first or second IC oligonucleotide, are used to interrogate proximity between two biomolecules to which the affinity reagents bind, wherein a first fluorophore signal pattern will be exhibited upon interaction between the first and second biomolecule, and a second fluorophore signal pattern will be exhibited upon lack of interaction between the first and second biomolecule, as a result of the oligonucleotides hybridizing to each other upon interaction between the first and second biomolecule causing restructuring of the positions of fluorophores and quenchers.

12. Method according to claim 1, wherein the first and the second biomolecules are proteins or polypeptides.

13. Method according to claim 1, wherein the sample is a biological sample of one or more cells, or a mixture of proteins.

14. Method according to claim 1, wherein the first IC DNA molecule is conjugated to a first antibody molecule being equal to or targeting the first biomolecule, and the second IC DNA molecule is conjugated to the second antibody molecule being equal to or targeting the second biomolecule.

15. Method for analysing protein-protein interactions in single cells or single molecules comprising sing the method of claim 1.

16. Kit for use in the method of claim 1, comprising c. a single-stranded information receiving (IR) DNA molecule, carrying a first and a second cleavage motif; d. a first and a second information carrying (IC) DNA molecule, reflecting the amounts of a first and a second biomolecule in a sample, wherein the first and second IC DNA molecules are conjugated to affinity reagents or provided with chemical moieties to be conjugated by a kit user; e. optionally enzymes for creating nicks at the cleavage motif sites in the IR DNA molecule; f. a first and a second reporter tag DNA molecule; g. optionally reagents for amplification of a recreated IR DNA molecule; h. optionally a first and a second labelled detection oligonucleotide; and i. optionally DNA molecule(s) and enzymes to remove abasic sites.

17. Kit for use in the method of claim 1, comprising a. a first and a second information carrying (IC) DNA molecule comprising hairpin structures in which fluorophores and quenchers are positioned, wherein the hairpin structures are designed so that only one fluorophore per oligonucleotide can emit light, and wherein each fluorophore has a unique signal, thereby having the ability to reflect the amounts of a first and a second biomolecule in a sample, wherein the first and second IC DNA molecules are conjugated to affinity reagent or are provided with chemical moieties to be conjugated by a kit user; and b. an activating oligonucleotide that is complementary to the first or the second IC DNA molecule thereby having the ability to bind to the first or second IC DNA molecule.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

[0096] FIG. 1: A Schematic presentation of the oligonucleotide designs. The IR circle is hybridized to two (top row) respectively one IC probe (bottom rows), consisting of IC oligonucleotides conjugate to antibodies (indicated as A and B) (left panel). The IR circle is digested by enzyme treatment, where the IR circle hybridizes to an IC probe, and the tag oligonucleotide invades the IC probes (middle panel). The IR circles are religated and the tag sequence gets incorporated (right panel)

[0097] FIG. 2: A schematic presentation of the different designs for enzymatic digestion of IR circles, indicating positions of the uracil bases and restriction sites.

[0098] FIG. 3: Quantification of mean numbers of signals +/−SD from three separate images using the MolBoolean method for detection of β-catenin, E-cadherin and β-catenin-E-cadherin interactions. Images showing cells labeled for β-catenin, E-cadherin and β-catenin-E-cadherin interactions. The borders of the cell nuclei are marked out in the images.

[0099] FIG. 4: A schematic presentation of a design for Invader-MolBoolean, using three Alexa dyes and two Black hole quenchers. (A) When the proximity probes (antibodies conjugated to IC oligonucleotide 1 or 2 (see Table)) bind individual antigens one fluorophore per probe will be able to emit light: Alexa555 (A555) and Alexa647 (A647), while the Alexa488 (A488) will be quenched as it is located close to a quencher (BHQ1). (B) When an activator oligonucleotide is added, it will invade IC oligonucleotide 1. If the proximity probes are in close proximity the opened IC oligonucleotide 1 will hybridize to IC oligonucleotide 2 thereby restructuring the positions of fluorophores and quenchers. Now the A555 will be located close to BHQ1 and A647 close to the quencher (BHQ3)—both of these fluorophores will be quenched, while A488 now is separated from the quencher BHQ1 and will emit light.

[0100] FIG. 5: A schematic presentation of the gap-fill process. At first, a digestion template is hybridized over the AP site allowing the circle to be digested by EndolV. Thereafter, the nick created (arrow) can be filled by T4 DNA polymerase, which will incorporate a thymidine. A ligase will seal the nicked circle, so that it can be amplified in the next step of the protocol.

[0101] FIG. 6: In situ protein detection with gap-fill design. The probes were incubated on HaCat cells under four different conditions: with both anti-E-cadherin antibodies and anti-β-catenin antibodies, with anti-E-cadherin antibodies, with anti-β-catenin antibodies or without any primary antibodies (background). All conditions showed were normalized by subtracting the background condition. Error bar represent standard error of the mean (SEM).

DETAILED DESCRIPTION OF INVENTION

[0102] The inventors of the present invention have developed a general method for determining levels of interactions between biomolecules, such as proteins, in a sample, comprising providing a first and a second information carrying (IC) oligonucleotide, wherein the first and second IC oligonucleotide are attached, covalently or non-covalently, to a first and a second affinity reagent, such as antibodies, that have the capacity to bind to a first and a second biomolecule, wherein the first and second IC oligonucleotide, each comprises at least one single-stranded stretch that is complementary to a part of another oligonucleotide, thereby, upon hybridisation of the at least one single-stranded stretch in at least one of the first and second IC oligonucleotides to its complementary part of another oligonucleotide, enabling measurement of the relative proportion of interacting and non-interacting first and second biomolecules in the sample at a single cell or single molecular level.

[0103] The method will be exemplified in the present description by two alternative approaches; one that uses fluorophore/quencher technology in combination with hairpin structures in the IC oligonucleotides that are designed so that only one fluorophore per IC oligonucleotide can emit light, and one that, in addition to the IC oligonucleotides, uses an IR (information-receiving) oligonucleotide that carries at least two cleavage motif sites that must become double-stranded in order to allow cleavage. By using any of these approaches measurement of the relative proportion of interacting and non-interacting biomolecules in a sample can be measured at a single cell or single molecular level.

[0104] Thus, for one of the aspects of the method of the invention, the inventors of the present invention designed an oligonucleotide system consisting of a single-stranded circular DNA molecule (information receiver (IR)), which carries a motive for cleavage, e.g. uracils or restriction sites. The oligonucleotide system was created so that the cleavage would require the sites to be double-stranded, which it only will be if it binds a complementary oligonucleotide. These complementary oligonucleotides (information carrier (IC)) were designed so that they consist of a hairpin structure flanked with stretches of single-stranded DNA that would be complementary to the IR circle. The nicks created in the IR circles will facilitate a subsequently added short tag oligonucleotide complementary to part of the IC probes to invade the hairpins of the IC oligonucleotides and be ligated into the IR circle. Alternatively, gap filling can be made with a DNA-polymerase, with template from the IC probes. To seal the gaps and recreate a circular DNA molecule, DNA ligase is added. Unique tags and hairpins of the IC oligonucleotides can be used to transfer information to the IR circle of which IC oligonucleotide it has bound. When an IR circle binds two different IC oligonucleotides both corresponding tags will be incorporated. By conjugating the IC oligonucleotides to antibodies, as in one embodiment, the inventors have created a method where the IR circles can be used to monitor if two proteins are interacting, i.e. if both tags are incorporated into the IR circle. The antibodies are chosen against the proteins one intends to study. For the proteins that are not interacting only one tag will be incorporated into the IR circle (FIG. 1).

[0105] Different approaches for cutting open the circle and integrating the tag were tested. The IR circle can be cut open by either a nicking endonuclease that only cleaves one of the strands in its double stranded target. Alternatively, a nick could be created by removing a uracil base with the help of the enzyme combination UNG and EndolV. For the nicking endonucleases the inventors tested two different enzymes: Nb.BsrDI, which will make a cut on the 3′ side of the hairpin (3′ Nb.BsrDI), and Nt.BsmAI, which cuts on the 5′ side (5′ Nt.BsmAI). The inventors also tested the efficiency in cleavage by incorporating the uracil base in either the 3′ side or the 5′ side (3′Uracil and 5′Uracil) in relation to the hairpin. (FIG. 2). With the help of Nupack.org, the inventors designed and analyzed all the oligonucleotide sequences to ensure correct secondary structures and hybridizations (Table 1).

[0106] The recreated IR circles, containing the incorporated tags, can then be amplified by rolling circle amplification (RCA), primed from one of the IC probes. The RCA products contain several hundred complementary repeats of the IR. The identities of the RCA products can then be decoded by hybridization of labeled detection oligonucleotides, complementary to the parts of the RCA product where the tags have been incorporated. The labeling of the detection oligonucleotides could be e.g. different fluorophores, enzymes or molecules with different masses, depending upon which read-out will be used. Single labeled RCA product will be a result of only one incorporated tag while dual labeled RCA products will be a consequence of incorporation of two tags.

[0107] An example of how the result can look like is shown in FIG. 3. Here the inventors used 5′ uracil design, conjugating the IC oligonucleotides to anti-mouse and anti-rabbit antibodies. These IC probes were tested on the MCF10 cell line labeled with a mouse antibody targeting E-cadherin and a rabbit antibody targeting β-Catenin. Complexes containing β-catenin and E-cadherin will result in RCA products detected with both Cy3 and FITC, while the non-interacting proteins gave rise to RCA products labeled with either Cy3 or FITC. The different identities of RCA products were determined using the software CellProfiler and the different types of RCA products were pseudo-colored to visualize interaction between β-catenin and E-cadherin as well as the individual proteins, β-Catenin and E-Cadherin.

[0108] An alternative approach to extract the information is to use an IR circle or linear IR molecule to interrogate proximity between IC probes. After ligation of tag sequences the recreated IR molecule can be amplified by PCR and separated by gel electrophoresis. Differences in size will indicate incorporation of different tags. It would also be possible to amplify single IR molecules and decode the identities of different tags by sequencing of the amplicons.

[0109] The MolBoolean analyses can be performed in cells, in mixtures of proteins (either in bulk mixtures or separated e.g. by gel electrophoresis). The recreated IR molecules can either be interrogated directly in the sample where they have been formed (e.g. by microscopy, as shown in FIG. 3) if the read-out platform supports single molecule detection, or the recreated IR molecules can be collected and single molecules can subsequently be sorted and analyzed individually.

[0110] In some instances, remaining abasic sites (AP sites) in the IR molecule can interfere with the amplification and/or detection efficiency. As a means for improving the detection efficiency, and to reduce the risk of undigested abasic sites (AP sites) of the circular IR molecules to prevent detection of signal, the inventors modified the design with an alternative design version (FIG. 5). In order to remove the abasic sites two steps were added after the step where the tags are incorporated. In the first additional step a digestion template was hybridized to the DNA circle, making the area around the AP site double stranded. The abasic site was thereafter removed by digestion by EndolV. In the next step the gap-fill was performed with T4 DNA polymerase to add the missing thymidine and with T4 ligase to close the nick by ligation.

[0111] The gap-fill design was evaluated using the previously described E-cadherin and β-catenin interaction assay (FIG. 6). E-cadherin and β-catenin interaction was detected together with a noticeably higher amount of total E-cadherin, which was equal to the total amount E-cadherin when only that antibody was present. Likewise, the total amount of β-catenin remains on a comparable level in both conditions where that antibody was used.

[0112] For the other aspect of the method of the invention, the inventors developed an alternative approach to monitor both free and interacting proteins. In this approach, the IC oligonucleotides that are connected to the antibodies can be designed to contain hairpin structures. By attaching fluorophores and quenchers to such hairpins the fluorophores will be allowed to emit light only if they are separated in distance from the quenchers. The positioning of fluorophores and quenchers will facilitate that only one fluorophore of each such IC oligonucleotide will be allowed to emit light. Once the IC oligonucleotide has bound their targets, guided by the antibodies connected to them, one of the hairpin structures will be destabilized by invasion of an activator oligonucleotide. This will change the conformation of the IC oligonucleotide and will reveal a stretch of DNA that previously was hidden in the stem, which is reverse complementary to a stretch of the second IC oligonucleotide. The destabilized/activated first IC oligonucleotide will hybridize to the second IC oligonucleotide, only if they are bound to target molecules in close proximity, which will reposition the fluorophores and quenchers so that the ones that previously emitted light now are quenched and one fluorophores that was quenched in one of the IC oligonucleotide gets separated from the quencher. This fluorophore will only be able to emit light if a pair of IC oligonucleotides is hybridized to each other. Hence, the fluorescence of free and interacting proteins can be recorded simultaneously at different wavelengths. This method, herein called Invader-MolBoolean is described in FIG. 4. With the help of Nupack.org, the inventors designed and analyzed all the oligonucleotide sequences to ensure correct secondary structures and hybridizations (Table 1).

[0113] The invention will now be described with reference to the following non-limiting examples.

EXAMPLES

Example 1—In Situ Detection of Beta-Catenin and E-Cadherin Interaction

[0114] The information receiving DNA circle was created by ligating two single stranded pieces (i.e. IR circle piece 1 and 2 (see Table1)), which carries motifs that will ensure proper hybridization, i.e. the two hairpin structures in the circle. The two oligonucleotides were mixed together at a final concentration of 1 μM in T4 Ligation buffer. Thereafter 0.02 U/μl of T4 ligase was added in the mix and it was incubated for 2 h at 37° C. followed by 48 h incubation at 4° C.

[0115] 350 μg antibody, donkey-anti-rabbit or donkey-anti-mouse (Jackson ImmunoResearch, West Grove, USA) per conjugated PLA probe, were concentrated using the Amicon Ultra 10K centrifugal filter unit (Merck Millipore, Massachusetts, USA, according to manufacturer's instructions to the concentration 3 mg/ml in PBS. S-HyNic Crosslinker (Solulink, San Diego, USA) was dissolved in DMSO to 20 mM and the crosslinker and antibody was mixed with a 25× molar excess of crosslinker over antibody. The mix was incubated with gentle agitation at room temperature, and protected from light, for 2 hours. After activation of the antibodies the buffer was exchanged to 100 mM NaHPO4, 150 mM NaCl, pH 6.0 buffer by prewashed Zeba Spin Desalting Columns 7K MWCO (Thermo Scientific). Subsequently to the buffer exchange the antibody was mixed with an aldehyde modified oligonucleotide (Table 1) at an antibody:oligonucleotide ratio of 1:3. Aniline was added, at a final concentration of 10 mM, to catalyze the reaction. The antibody oligonucleotide mix was incubated with gentle agitation at room temperature, and protected from light, for 2 hours. Immediately after the incubation the buffer were exchanged to PBS using prewashed Zeba Spin Desalting Columns 7K MWCO (Life Technologies). After conjugation the conjugates were purified from unconjugated antibody and oligonucleotide by ÄKTA Pure HPLC (GE Healthcare, Uppsala, Sweden) using Superdex 200 10/300 column (GE Healthcare). The collected fractions from the HPLC purification were concentrated to 80 μl by Amicon Ultra 10K centrifugal filter unit (Merck Millipore) according to manufacturer's instructions and validated by electrophoresis. The conjugates were mixed with Novex TBE-Urea Sample buffer (Life Technologies) and separated on Novex TBE-Urea Gel 10% (Life Technologies) by 180 V for 50 minutes. DNA was visualized using SYBR Gold Nucleic Acid Gel Stain (Life Technologies) and protein using Coomassie stain (Bio-Rad, Hercules, USA). The gel was visualized with Bio-Rad Gel-Doc XR (Bio-Rad). The concentrations of the conjugates were determined using the Pierce BCA protein assay kit (Life Technologies).

[0116] Cells on a microscope slide was fixated by 3.7% PFA for 10 minutes and then permeabilized in 1×PBS with 0.2% triton X100, and thereafter washed twice in 1×PBS before adding blocking solution; 50% Odyssey blocking buffer (cat. #927-50000, LiCor) in 1×TBS. After 30 min of blocking at 37° C. in a moister chamber, the cells were incubated with anti E-cadherin (cat. #BD610182, BD biosciences, diluted 1:100) and anti-Beta-catenin (cat. #sc7199, santacruz, diluted 1:200) in blocking solution overnight at 4° C. Each slide was washed three times for three minutes in 1×TBS with 0.05% Tween 20 (TBST).

[0117] The Molboolean IC probes were mixed in blocking solution, at a final concentration of 100 ng/ml, and incubated with the cells for 60 minutes at 37° C. The slides were then washed three times, for three minutes, in TBST. The Molboolean IR circle was diluted to 0.025 μM in T4 ligation buffer supplemented with 0.25 mg/ml of BSA to allow for hybridization of the circle to the IC probes while incubating it for 30 minutes at 37° C. with the cells. The cells are thereafter washed twice in TBST for three minutes each and are then incubated with digestion enzymes dependent on the design at 37° C. The 5′Uracil design is digested by 0.1 U/μl of Endo IV and 0.05 U/μl UNG in 20 mM Tris-HCl (pH 7,6) buffer with 30 mM NaCl, 1 mM EDTA, 100 mM KCl, 1 mM DTT and 0.25 mg/ml of BSA for 45 min before washing. While, the 5′ Nt.BsmAI design is incubated with 0.125 U/μl Nt.BsmAI enzyme diluted in 1×NEBuffer Cut smart supplemented with 0.25 mg/ml BSA for 1 h. The cells were washed for 3 min twice in TBST and were thereafter incubated for 30 min at 37° C. with Tag 1 and 2 both at 0.125 μM in the presence of 0.05 U/μL T4 Ligase in T4 ligation buffer supplemented with 0.25 mg/ml BSA. After ligation, there is another wash in TBST (2×3 min).

[0118] The gap-fill design introduces two extra steps. The slides were incubated with 0.05 μM of digestion template together with 0.01 U/μl of Endo IV in 20 mM Tris-HCl (pH 7,6) buffer with 30 mM NaCl, 1 mM EDTA, 100 mM KCl, 1 mM DTT and 0.25 mg/ml of BSA for 60 min at RT.

[0119] The slides were washed three times for 3 min in TBST. To fill the gap, the slides were incubated with 0.025 U/μl T4 DNA polymerase and 0.05 U/μl T4 ligase in 1×T4 ligase buffer supplemented with 0.25 mg/ml BSA and 0.1 mM dNTP for 30 min at RT. The cells were thereafter washed twice in TBST for 3 min each.

[0120] Thereafter, a RCA reaction is performed on the newly formed circles to amplify the signal for 60 min at 37° C. The RCA is catalyzed by 0.5 U/μl phi29 in the following solution: 33 mM Tris-, 10 mM Mg-acetate, 66 mM K-acetate, 0.1% Tween 20, 1 mM DTT, 7.5 ng/ml PolyA, and 0.25 mM dNTP. It was washed twice for three minutes in TBST. The RCA products were detected by hybridizing 0.025 μM DO1 and 2 to it in PBS supplemented with 0.0025 μg/ml salmon sperm DNA and 0.25 mg/ml BSA, and the mixture also contained 0.04 mg/ml Hoechst 33342 for nuclei staining.

[0121] The staining was followed by two 10 min washes in 1×TBS and a 15 min wash in 0.2×TBS and the slide was thereafter dried with 70% etOH and mounted using Vectasheld.

TABLE-US-00001 TABLE 1 SEQ ID Design Description NO Sequence Universal IR circle piece 1  1 P- CGAGGTGCTTTTAGCACCTCGAAGTAAAGCCCGTCCCAGTGAATGCGAGTCCGTCTGA TAACCTAGATAAACGTCACACTTTTCGTGTGACG 5′ Uracil IR circle piece 2  2 P- TTTATCTATATCCCTACTTCACCTGCCUCGTCTATTCCACCTCAAAAAGTGTCCACTC CTACCUCTGCCCACTACCTACCTCAAACCTTTACTT Tag 1  3 P-TCTGCAGTTATACGTCCAATCATAA Tag 2  4 P-TCGTACGTAGATCCTGCCATTTCTA IC oligo 1  5 Aldehyde- AAAAAGGTAGGTAGTGGGCAGTTATGATTGGACGTATAACTGCAGAGGTAGGA GTGGACAC IC oligo 2  6 Aldehyde- AAAAAGAGGTGGAATAGACGTAGAAATGGCAGGATCTACGTACGAGGCAGGTG AAGTAGG Gap fill 1  7 TAGGTAGTGGGCAGAGGTAGGAGTGGACA Gap fill 2  8 AGGTGGAATAGACGAGGCAGGTGAAGTAG Nt.BsmAl IR Circle piece 2  9 P- TTTATCTATATCCCTACTTACGTCTCTCGTCTATTCCACCTCAAAAAGTGTCCACTCG TCTCACTGCCCACTACCTACCTCAAACCTTTACTT Tag 1 10 P-CTGCGCAGTTATACGTCCAATCATAA Tag 2 11 P-CGTACGTAGATCCTGCCATTTCTA IC oligo 1 12 Aldehyde- GGTAGGTAGTGGGCAGTTATGATTGGACGTATAACTGCGCAGTGAGACGAGTG GACAC IC oligo 2 13 Aldehyde- GAGGTGGAATAGACGTAGAAATGGCAGGATCTACGTACGAGAGACGTAAGTAG G 5′ Uracil Detection Oligo1 - Cy3 14 Cy3-TCTGCAGTTATACGTCCAATUUU and Detection Oligo2 - 15 FITC-TCGTACGTAGATCCTGCCATUUU Nt.BsmAl FITC 3′ Uracil IR circle piece 2 16 P- TTTATCTATATCCCTACTTCACCTGCCTCGTACGTAGAUCTATTCCACCTCTCTAAAA AAAAT CCACTCCTACCTCTGTAGTTAUACCTACCTCGTGAGGAAACCTTTACTT Tag 1 17 P-TCACGTCCAATCGATAACTACAGTTAT Tag 2 18 P-TTCCTGCCATTATCTACGTGTAGAT IC oligo 1 19 Aldehyde- AACCTCACGAGGTAGGTATAACTGTAGTTATCGATTGGACGTGATAACTACAGAG GTAGGAGTGGA IC oligo 2 20 Aldehyde- AATAGAGAGGTGGAATAGATCTACACGTAGATAATGGCAGGAATCTACGTACGA GGCAGGTGAAG Nb.BsrDl IR circle piece 2 21 P- TTTATCTATATCCCTACTTCACCTGCCTCGTACGTAGATCATTGCACCTCTCTAAAAA ATCCA CTCCTACCTCTGTAGTTATCATTGCCTCGTGAGGAAACCTTTACTT Tag 1 22 P-CACGTCCAATCGATAACTACAGTTAT Tag 2 23 P-TCCTGCCATTATCTACGTGTAGAT IC oligo 1 24 Aldehyde- CCTCACGAGGCAATGATAACTGTAGTTATCGATTGGACGTGATAACTACAGAGGT AGGAGTGGA IC oligo 2 25 Aldehyde- TAGAGAGGTGCAATGATCTACACGTAGATAATGGCAGGAATCTACGTACGAGGC AGGTGAAG 3′ Uracil Detection Oligo1 - Cy3 26 Cy3-TCCAATCGATAACTACAGTTAT and Detection Oligo2 - 27 FITC-TGCCATTATCTACGTGTAGAT Nb.BsrDl FITC IC oligonucleotide1 28 Aldehyde- AAAAAAAAAAGGTCCTGA(T-alexa555)CCACTCCTACTTCCACTC CCATCA(BHQ3)GGTGAAGTGAAGTAGGTAAGTGATGGGAGTGGAAGTAGGAGTGGAT CAGGACC Invader- IC oligonucleotide2 29 alexa488-TCCACTTCTATTTCCACTCCCATCATCGG(T- Molboolean alexa647)GATGGGAGTGGAAGTAGG AGTGGA(T-BHQ1)CAGGACCAAAAAAAAAA-Aldehyde activator 30 CCTACTTCCACTCCCATCACTTACCTACTTCACTTCACC