Vaccine Used For Preventing Toxoplasma Gondii Infection And Preparation Method Therefor

Abstract

Provided is a protein having Toxoplasma immunogenicity, the protein being a cyclophilin mutant protein and consisting of the amino acid sequence as shown in SED 2. Further provided is a nucleic acid that may encode a protein having Toxoplasma immunogenicity, which has the nucleic acid sequence as shown in SEQ ID NO. 1. Further provided is a vaccine, which is obtained by double-digesting a Toxoplasma antigen gene and then linking the same to a prokaryotic expression vector such as pET28a, and transforming the same into a prokaryotic expression engineering strain such as BL21(DE3), thereby inducing the high-efficiency expression thereof, wherein the inducing the high-efficiency expression thereof, wherein the purified protein is a soluble protein which maintains specific immunogenicity thereof.

Claims

1. A protein having Toxoplasma gondii immunogenicity, wherein the protein is a cyclophilin mutant protein comprising the amino acid sequence represented by SEQ ID NO. 2.

2. (canceled)

3. (canceled)

4. A nucleic acid encoding a protein having Toxoplasma gondii immunogenicity of claim 1, wherein the amino acid sequence represented by SEQ ID NO. 2 is encoded.

5. A method for preparing a protein having Toxoplasma gondii immunogenicity of claim 1, comprising (1) cloning a gene encoding a protein having amino acid sequence represented by SEQ ID NO. 2 or a nucleotide sequence represented by SEQ ID NO. 1 into an expression vector plasmid to obtain recombinant expression vector; (2) transforming Escherichia coli with the recombinant expression vector to obtain genetic engineering bacteria; (3) carrying out fermentation culture on the genetic engineering bacteria to express cyclophilin mutant protein; (4) recovering the supernatant of the crushed genetic engineering bacteria, and separating and purifying the Toxoplasma gondii cyclophilin mutant protein.

6. The method of claim 5, wherein the vector in step (1) is PET-28a and the Escherichia coli in step (2) is BL21 (DE3).

7. (canceled)

8. The method of claim 5, wherein the expression of Toxoplasma gondii cyclophilin mutant protein by the genetic engineering bacteria in step (3) is constitutive expression.

9. (canceled)

10. (canceled)

11. A soluble fusion protein, comprising the Toxoplasma gondii cyclophilin mutant protein of claim 1 and a purified label.

12. The protein of claim 11, wherein the amino acid sequence of the purified label is shown in SEQ ID NO. 3.

13. (canceled)

14. (canceled)

15. (canceled)

16. A Toxoplasma gondii subunit inactivated vaccine, comprising a protein having Toxoplasma gondii immunogenicity which is a cyclophilin mutant protein consisting of the amino acid sequence represented by SEQ ID NO. 2, or a nucleic acid encoding a protein having Toxoplasma gondii immunogenicity in which the amino acid sequence represented by SEQ ID NO. 2 is encoded, or a nucleic acid encoding a protein having Toxoplasma gondii immunogenicity in which the nucleic acid has the nucleotide sequence represented by SEQ ID NO. 1, and a medically acceptable vector.

17. (canceled)

18. A method for preparing the subunit inactivated vaccine of claim 16, comprising transforming the expression of vector having the coded sequence of the soluble fusion protein comprising the Toxoplasma gondii cyclophilin mutant protein consisting of the amino acid sequence represented by SEQ ID NO. 2 and a purified label into prokaryotic expression engineering bacteria, inducing its high-efficiency expression, purifying it to obtain soluble fusion protein, and adding therein vaccine adjuvant to obtain the vaccine.

19. The method of claim 18, wherein the concentration of the protein is at least 10 μg/ml to 300 μg/ml.

20. (canceled)

21. A host cell, comprising a nucleic acid encoding a protein having Toxoplasma gondii immunogenicity and wherein the amino acid sequence represented by SEQ ID NO. 2 is encoded, and a biological vector.

22. The host cell of claim 21, wherein the nucleic acid has the nucleotide sequence represented by SEQ ID NO. 1.

23. The nucleic acid of claim 4, wherein the nucleic acid has the nucleotide sequence represented by SEQ ID NO. 1.

24. The method of claim 18, wherein the amino acid sequence of the purified label is shown in SEQ ID NO. 3.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

[0045] FIG. 1 shows an ORF amplification results of SEQ ID NO. 2 gene.

[0046] In the drawing, M is DL2000 marker; C18 is target gene fragment.

[0047] FIG. 2 shows an SDS-PAGE result of Toxoplasma gondii cyclophilin protein and Toxoplasma gondii cyclophilin mutant protein.

[0048] In the drawing, M is protein marker; r1 is soluble expression of Toxoplasma gondii cyclophilin protein; r2 is soluble expression of Toxoplasma gondii cyclophilin mutant protein.

[0049] FIG. 3 shows a purified SDS-PAGE result of recombinant mutant expression protein of Toxoplasma gondii cyclophilin.

[0050] In the drawing, M is protein marker; r is recombinant cyclophilin mutant protein.

[0051] FIG. 4 shows a result of Western-blot identification of the specificity of recombinant protein expressed in vitro.

[0052] In the drawing, M is protein marker; r is recombinant cyclophilin mutant protein.

[0053] FIG. 5 shows a TNF-α level produced by mouse RAW264.7 cells under the stimulation of Toxoplasma gondii cyclophilin recombinant mutant protein.

[0054] FIG. 6. shows an IL-12 level produced by mouse dendritic cells under the stimulation of Toxoplasma gondii cyclophilin recombinant mutant protein.

[0055] FIG. 7 shows an antibody titer diagram of mouse injected with Toxoplasma gondii cyclophilin recombinant mutant protein vaccine.

[0056] FIG. 8 shows a protective effect of Toxoplasma gondii recombinant mutant protein vaccine against Toxoplasma gondii infection in mouse.

[0057] FIG. 9 shows an antibody titer diagram produced by dogs vaccinated with Toxoplasma gondii cyclophilin recombinant mutant protein vaccine.

DETAILED DESCRIPTION OF THE INVENTION

[0058] The technical solution of the present invention will be represented by detail with examples hereinafter. The described examples are some but not all examples of the present invention. Based on the examples of the present invention, all other examples can be obtained by those skilled in the art without creative effort, all of which fall within the scope of protection of the present invention.

Example 1: Construction of Prokaryotic Expression Vector of Toxoplasma gondii Recombinant Cyclophilin Mutant Protein

[0059] According to the nucleic acid sequence SEQ ID NO. 1, at the same time, according to the physical map of prokaryotic expression vector pET28a, primers were designed and restriction sites were introduced.

[0060] Upstream primer: ATGGAATTC ATGGAAAACGCGGGCGTGCGCAAA

[0061] Downstream primer: AAGCTT TTCTTTTTTGCCAATATCGGTAA

[0062] The gene sequence represented by SEQ ID NO. 1 was artificially synthesized, and then amplified by the above primers. The purified PCR product was cloned into pMD-18-T, and then digested and sequencing identified for the positive clone bacteria. The purified target fragment of the positive plasmid was double digested by EcoRI and Hind III, and then connected to the prokaryotic expression vector pET28a. The ligation product was transformed into E. coli DH5a competent cells and then the recombinant plasmid was screened. The prokaryotic expression plasmid pET28a-C18 was obtained by double-digesting reaction identification with EcoRI and Hind III. The pET28a-C18 was transformed into BL21(DE3) engineering bacteria, and a single colony was inoculated into 5 ml LB liquid culture medium (containing 100 μg/ml kanamycin), which was cultured overnight at 37° C. and 220 rpm. The amplification results of cyclophilin mutant ORF are shown in FIG. 1.

Example 2: Purification of Expressed Protein

[0063] (1) Extraction and Solubility Verification of Expressed Protein

[0064] E. coli BL21(DE3) single colony transformed with recombinant plasmid pET-28a(+)-C18 was selected to be inoculated in 5 ml LB liquid culture medium, and cultured overnight at 37° C. On the next day, the seed solution was transferred to 800 ml LB liquid medium for propagation at 37° C. When OD600 of bacterial liquid is monitored to 0.6˜0.7. The expression was induced under the optimum conditions. Bacteria were collected by centrifugation, suspended in 20 ml PBS, frozen and thawed 5 times (−80° C., 1 h/37° C., 10 min), and then treated by ultrasound. The supernatant obtained by centrifugation was soluble protein (active protein). The precipitate was suspended in 10 ml denaturing buffer and shaken for 1 h at room temperature. The supernatant obtained by centrifugation is insoluble protein (denatured protein). SDS-PAGE detection was carried out to verify the solubility of the target protein. If the target protein is mainly located in the supernatant of soluble protein, it is soluble expression. If the target protein is mostly located in the supernatant of insoluble protein, it is expressed as inclusion body. The results showed that the modified Toxoplasma gondii cyclophilin mutant protein was soluble, with the expression level of 120 mg/1, while the unmodified cyclophilin protein was soluble (the preparation method is the same as literature: Cloning and Prokaryotic Expression of Toxoplasma gondii Cyclophilin Gene, Li Yunna, 2010), with the expression level of 60 mg/1, and the results are shown in FIG. 2.

[0065] (2) Purification of Fusion Expressed Protein

[0066] Balance the nickel column to stable status with solution A (PBS), and flush the system with solution A at a flow rate of 20 ml/min for 2 min. Connect the balanced nickel column to the sample loading interface, and flow through the sample at a flow rate of 1 ml/min to make the target protein hang on the column. After the flow-through, connect the nickel column with the target protein to the elution interface. At first, the nickel column was balanced with solution A at a flow rate of 1 ml/min, and the unbound foreign proteins were washed away. Keep the flow rate constant and set gradient impurity washing conditions. The concentration of B solution (PBS, containing 1 M imidazole) is 10%, that is, the concentration of imidazole is 100 mM, and time is 30 min, and the nonspecific adsorbed foreign protein is washed away. Keep the flow rate constant and set the elution conditions. The concentration of B solution is 30%, that is, the imidazole concentration is 300 mM, time is 120 min, the target protein is eluted, and the purity of the collected target protein is observed by SDS-PAGE. The results are shown in FIG. 3. The results of identifying the specificity of recombinant mutant protein expressed in vitro by Western-blot are shown in FIG. 4.

Example 3: Detection of Immunogenicity of the Expression Product on Mouse Macrophage

[0067] The RAW264.7 cells were inoculated into a 24-well culture plate at 0.5×10.sup.6/ml, each well was cultured at 37° C. for 24 hours with 0.5 ml of 5% CO.sub.2. The recombinant cyclophilin mutant protein of Toxoplasma gondii was dissolved in RAW264.7 cell culture medium after the supernatant was sucked out. According to the concentration of 1 μg/ml, 0.1 μg/ml, 0.01 μg/ml, was added to the 24-well plate at an amount of 0.5 ml/well, and the same volume of PBS was used as negative control. The cell culture plate was cultured in an incubator with 5% CO.sub.2 and 37° C. for 48 hours. The supernatant was collected and the TNF-α level was detected by ELISA. The results showed that the production of TNF-α increased with the increase of protein concentration, ranging from 40 pg to 310 pg. The results are shown in FIG. 5. Therefore, Toxoplasma gondii recombinant cyclophilin mutant protein can stimulate RAW264.7 cells to produce TNF-α.

Example 4: Detection of Immunogenicity of Expression Product on Mouse Dendritic Cells

[0068] The mouse dendritic cells were isolated, the cell concentration was adjusted to 0.5×10.sup.6 cells/ml, and then inoculated into a 24-well tissue cell culture plate with 0.5 ml per well. The treated recombinant cyclophilin mutant protein of Toxoplasma gondii was added into the cell culture plate at the concentrations of 100 μg/ml, 50 μg/ml, 10 μg/ml, 1 μg/ml, 0.1 μg/ml and 0.01 μg/ml per well, respectively, with an amount of 0.5 ml per well. The cell culture plate was cultured in an incubator with 5% CO.sub.2 and 37° C. for 24 hours, and the supernatant was collected. The level of IL-12 in the supernatant was detected by ELISA. The results show that the content of IL-12 produced by each group is protein concentration dependent, that is, it increases with the increase of protein concentration, and the results are shown in FIG. 6. The results indicated that Toxoplasma gondii recombinant cyclophilin mutant protein could stimulate mouse dendritic immune cells to produce a large amount of IL-12.

Example 5: Immune Challenge and Protection Experiment of Toxoplasma gondii Recombinant Subunit Vaccine in Mice

[0069] 125 female SPF BALB/c mice aged from 8 to 10 weeks were divided into 5 groups with 25 mice in each group. The first group was cyclophilin experimental group I (adjuvant is MF59, 30 μg per mouse, subcutaneous injection), the second group was cyclophilin experimental group II (adjuvant 206, 30 μg per mouse, subcutaneous injection), the third group was negative control group I (equal volume PBS with adjuvant MF59, subcutaneous injection), the fourth group was negative control group II (equal volume PBS, with adjuvant 206, subcutaneous injection), and the fifth group was blank control group II (equal volume PBS, subcutaneous injection). Injection was conducted three times for each group at an interval of two weeks. Antibody titers were detected weekly. One week after the third immunization, 103 purified Toxoplasma gondii trophozoites were injected intraperitoneally into every mouse, and the status of mice was observed and recorded every day.

[0070] The antibody results showed that the antibody level increased rapidly three weeks after immunization, and reached its peak at six weeks, and FIG. 7 shows the titer of vaccine antibody.

[0071] The results of immune protection test showed that the immune survival rate of experimental group was significantly better than that of negative control group and blank control group, and the effect of MF59 adjuvant vaccine group was better than that of 206 adjuvant vaccine group (see FIG. 8).

Example 6: Experimental Study on Immune Challenge Protection Rate of Toxoplasma gondii Recombinant Subunit Vaccine in Dogs

[0072] Twenty experimental dogs (beagle dogs, sexually mature bitches) without pathogens (including parasitic diseases, viral diseases and bacterial infectious diseases) were selected, especially those without infectious pathogens such as Toxoplasma gondii, neospora, canine distemper, canine infectious hepatitis and parvovirus. The experimental animals were divided into two groups. The first group was cyclophilin experimental group (adjuvant MF59, 300 μg/animal, injected subcutaneously), with 15 dogs in total. The second group was a blank control group (PBS of equal volume, injected subcutaneously), with 5 dogs in total. Injection was conducted three times for each group at an interval of two weeks. Antibody titers were detected weekly. One week after the third immunization, 104 purified Toxoplasma gondii trophozoites were injected intraperitoneally. After 30 days, all dogs were dissected, and the infection of Toxoplasma gondii in brain, heart, liver, spleen, lung, kidney, lymph node, masseter muscle, tongue muscle and abdominal muscle was detected by PCR. If the PCR results of any tissues were positive, the dog was judged as Toxoplasma gondii infected. If the PCR results of all tissues are negative, it is judged as Toxoplasma gondii protection.

[0073] The antibody results showed that the antibody level of the immune group continued to rise after the first immunization, and the titer of the vaccine antibody was shown in FIG. 9.

[0074] After challenge, the results showed that all dogs in the control group were diagnosed as Toxoplasma gondii infection, 13 dogs in the immune group were diagnosed as Toxoplasma gondii protection, and 2 dogs were diagnosed as Toxoplasma gondii infection, indicating a protection rate of 86%.

[0075] Based on the above experimental results, the Toxoplasma subunit inactivated vaccine provided by the present application has high immune protection rate against Toxoplasma gondii in dogs, and can be used as a candidate vaccine for prevention and treatment of Toxoplasma gondii in dogs.

[0076] Finally, it should be noted that, the above embodiments are provided to describe the technical solutions of the disclosure, but are not intended as a limitation. Although the disclosure has been represented by detail with reference to the embodiments, those skilled in the art will appreciate that the technical solutions represented by the foregoing various embodiments can still be modified, or some technical features therein can be equivalently replaced. Such modifications or replacements do not make the essence of corresponding technical solutions depart from the spirit and scope of technical solutions embodiments of the disclosure.