Method for rescuing influenza virus and composition therefor

20220041997 · 2022-02-10

    Inventors

    Cpc classification

    International classification

    Abstract

    The present invention relates to a new method for rescuing an influenza virus and a composition therefor. The method comprises providing a host cell stably integrated with and expressing influenza virus PA, PB1, PB2 and NP genes, and introducing an influenza virus rescue system in which a stop codon is introduced into the PA, PB1, PB2 and NP genes respectively into the host cell to achieve virus rescue. The produced virus particles can be used as a live attenuated influenza vaccine, which is characterized in that, since the genes encoding the related proteins are mutated, it has no replication and proliferation ability in human and normal animal cells, and replication and proliferation can be achieved only in the host cells constructed above and it can fully stimulate the body immunity and effectively protect the body while ensuring the safety.

    Claims

    1. A method for rescuing an influenza virus, characterized in that a mammalian host cell stably expressing influenza virus PA, PB1, PB2 and NP genes is provided, and an influenza virus rescue system comprising mutant PA, PB1, PB2 and NP genes is introduced into the aforementioned host cell to achieve rescue, wherein the mutations make the influenza virus rescue system unable to rescue intact virus in natural mammalian cells.

    2. The method according to claim 1, wherein the method comprises the following steps: (1) constructing a single- or multiple-plasmid system encoding the PA, PB1, PB2 and NP genes; (2) introducing the single- or multiple-plasmid system of step (1) into a mammalian cell, and screening a host cell stably expressing the four genes; (3) constructing recombinant plasmids for the mutant PA, PB1, PB2 and NP genes and recombinant plasmids encoding the four genes HA, NA, M and NS respectively to form an influenza virus rescue system, the mutations are achieved by introducing a TAG codon into each of the four gene sequences; (4) co-transfecting the influenza virus rescue system constructed in step (3) into the host cell of step (2); (5) culturing the cell obtained in step (4) and harvesting the particles of the influenza virus.

    3. The method according to claim 2, wherein the nucleotide sequences of the PA, PB1, PB2 and NP genes in step (1) are as shown in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO:3 and SEQ ID NO: 4, respectively.

    4. An influenza virus prepared by the method according to claim 1.

    5. A method for preventing or treating influenza, comprising administering the influenza virus according to claim 4.

    6. The method according to claim 2, wherein in step (2), the single- or multiple-plasmid system of step (1) is introduced into a mammalian cell by electrotransformation.

    7. The method according to claim 2, wherein the PA, PB1, PB2 and NP genes introduced into the host cell and the HA, NA, M and NS genes in the influenza virus rescue system are all derived from the A/WSN/1933 strain of influenza virus H1N1.

    8. The method according to claim 2, wherein the influenza virus rescue system comprises the following eight plasmids: pPolI-M-PB2, pPolI-M-PB1, pPolI-M-PA, pPolI-M-NP, pPolI-WSN-HA, pPolI-WSN-NA, pPolI-WSN-M and pPolI-WSN-NS, wherein, the PA gene contained has a mutation at R266 codon to TAG, the PB1 gene contained has a mutation at R52 codon to TAG, the PB2 gene contained has a mutation at K33 codon to TAG, and the NP gene contained has a mutation at D101 codon to TAG.

    9. The method according to claim 2, wherein the mammalian cell is selected from the group consisting of Vero cells, MDCK cells, 293 cells or MRCS cells.

    10. The method according to claim 1, wherein, the PA, PB1, PB2 and NP genes are all derived from the A/WSN/1933 strain of influenza virus H1N1.

    11. The method according to claim 1, wherein the nucleotide sequences of the PA, PB1, PB2 and NP genes are as shown in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO:3 and SEQ ID NO: 4, respectively.

    12. The method according to claim 1, wherein the influenza virus rescue system comprises the following eight plasmids: pPolI-M-PB2, pPolI-M-PB1, pPolI-M-PA, pPolI-M-NP, pPolI-WSN-HA, pPolI-WSN-NA, pPolI-WSN-M and pPolI-WSN-NS, wherein, the PA gene contained has a mutation at R266 codon to TAG, the PB1 gene contained has a mutation at R52 codon to TAG, the PB2 gene contained has a mutation at K33 codon to TAG, and the NP gene contained has a mutation at D101 codon to TAG.

    13. The method according to claim 1, wherein the mammalian host cell is selected from the group consisting of Vero cells, MDCK cells, 293 cells or MRCS cells.

    Description

    DESCRIPTION OF THE DRAWINGS

    [0050] FIG. 1 is a map of the constructed plasmid pBudCE4.1_NP_IRES_PA_PB2_IRES_PB1.

    [0051] FIG. 2 is a map of the constructed plasmid pcDNA3.1_PA_PB1 of the double-plasmid system.

    [0052] FIG. 3 is a map of the constructed plasmid pBudCE4.1_Puro_NP_PB2 of the double-plasmid system.

    [0053] FIG. 4 is an electron micrograph of the virus formed by rescue (transmission electron microscope (Spirit 120 KV), 100 kv, magnified 150,000 times).

    [0054] FIG. 5 is the sequencing result of the verification of the mutation sites of the virus produced by rescue, wherein the gene loci 1-4 correspond to the corresponding loci of NP, PA, PB1 and PB2, respectively, and in the comparison map of the same gene locus, the upper sequence is the measured sequence, and the lower sequence is the reference sequence.

    [0055] FIG. 6 is the safety comparison experiment for transfected cells for rescuing the virus, wherein A1 is the electron micrograph of the transfected normal cells after plating overnight, A2 is the electron micrograph of the transfected normal cells after 3 days of culture; B1 is the electron micrograph of the transfected cells with the single-plasmid constructed according to Example 1 after plating overnight, B2 is the cell electron micrograph after 3 days of culture. The virus solutions used was obtained by using the cells of Example 3-1 to participate in rescue.

    DETAILED DESCRIPTION OF THE INVENTION

    [0056] The technical solutions in the examples of the present invention are clearly and completely described below. It is obvious that the described examples are only a part of the examples of the present invention, but not all of the examples. All other examples obtained by those of ordinary skill in the art based on the examples of the present invention without paying creative work are within the protection scope of the present invention.

    [0057] It should be noted that the terms “comprising” and “having” and any of their variations of the examples of the present invention are intended to cover a non-exclusive inclusion, for example, a process, method, system, product or device that comprises a series of steps or units which are not necessarily limited to those clearly listed steps or units, but may include other steps or units not clearly listed or inherent to those processes, methods, products or devices.

    EXPERIMENTAL MATERIALS

    [0058] The codon-optimized NP, PA, PB1 and PB2 gene sequences of the present invention are all derived from artificial synthesis, and all primers for sequence cloning and selectable markers are also artificially synthesized according to the sequences disclosed in the present invention. The vector pBudCE4.1 (SEQ ID NO: 5) was synthesized artificially.

    [0059] The host cells in the examples are Vero cells from ATCC® CCL-81™ and belong to commercially available Vero cell line.

    Example 1 Construction of Plasmid pBudCE4.1_NP_IRES_PA_PB2_IRES_PB1

    [0060] According to the gene sequence of influenza virus A/WSN/1933 (Taxonomy ID: 382835) published by Pubmed, the expression gene sequences of PA, PB1, PB2 and NP which are preferred for Vero cells were obtained by codon optimization, respectively. After the whole gene synthesis, the obtained gene fragments were named as Q_PA (SEQ ID NO: 1), Q_PB1 (SEQ ID NO: 2), Q_PB2 (SEQ ID NO: 3) and Q_NP (SEQ ID NO: 4) genes, respectively.

    [0061] pBudCE4.1 and Q PURO (puromycin resistance gene, SEQ ID NO: 6) were double-digested (EcoRI, AvrII), and ligated using T4 DNA ligase. The resulting plasmid was transformed into E. coli DH5a by heat shock, screened, cultured and amplified, and purified to obtain pBudCE4.1+puro.

    [0062] pBudCE4.1+puro and Q_NP were double-digested (HindIII, SalI), and ligated using T4 DNA ligase. The resulting plasmid was transformed into E. coli DH5a by heat shock, screened, cultured and amplified, and purified to obtain pBudCE4.1+puro_NP.

    [0063] pBudCE4.1+puro_NP and Q_PA were double-digested (SalI, BamHI), and ligated using T4 DNA ligase. The resulting plasmid was transformed into E. coli DH5a by heat shock, screened, cultured and amplified, and purified to obtain pBudCE4.1 +puro_NP_PA.

    [0064] pBudCE4.1+puro_NP_PA and Q_PB2 were double-digested (NotI, XhoI), and ligated using T4 DNA ligase. The resulting plasmid was transformed into E. coli DH5a by heat shock, screened, cultured and amplified, and purified to obtain pBudCE4.1+puro_NP_PA_PB2.

    [0065] pBudCE4.1+puro_NP_PA_PB2 and Q_PB1 were double-digested (XhoI, BglII), and ligated using T4 DNA ligase. The resulting plasmid was transformed into E. coli DH5a by heat shock, screened, cultured and amplified, and purified to obtain pBudCE4.1+puro_NP_PA_PB2_PB1.

    [0066] In the above construction process, the solid medium used in the screening steps was: low sodium LB solid medium (1% peptone, 0.5% sodium chloride, 0.5% yeast extract, 1.8% agarose) containing 25 μg/ml bleomycin. The liquid medium used in the amplification steps was: low sodium LB liquid medium (1% peptone, 0.5% sodium chloride, 0.5% yeast extract) containing 25 μg/ml bleomycin.

    [0067] The map of this constructed plasmid is shown in FIG. 1. The nucleotide sequence of the Q PURO gene (SEQ ID NO: 6) is as follows:

    TABLE-US-00006 atgaccgagtacaagcccacggtgcgcctcgccacccgcgacgacgtccc ccgggccgtacgcaccctcgccgccgcgttcgccgactaccccgccacgc gccacaccgtcgacccggaccgccacatcgagcgggtcaccgagctgcaa gaactcttcctcacgcgcgtcgggctcgacatcggcaaggtgtgggtcgc ggacgacggcgccgcggtggcggtctggaccacgccggagagcgtcgaag cgggggcggtgttcgccgagatcggcccgcgcatggccgagttgagcggt tcccggctggccgcgcagcaacagatggaaggcctcctggcgccgcaccg gcccaaggagcccgcgtggttcctggccaccgtcggcgtctcgcccgacc accagggcaagggtctgggcagcgccgtcgtgctccccggagtggaggcg gccgagcgcgccggggtgcccgccttcctggagacctccgcgccccgcaa cctccccttctacgagcggctcggcttcaccgtcaccgccgacgtcgagg tgcccgaaggaccgcgcacctggtgcatgacccgcaagcccggtgcctag

    Example 2 Construction of Double-Plasmid System

    [0068] The construction process of pcDNA3.1_PA_PB1 vector is shown in FIG. 2, and is specifically as follows: pcDNA3.1/Hygro(+) plasmid (purchased from Biofeng, source: Invitrogene) and the vector (pUC57, purchased from Biofeng) containing PA protein gene (Q_PA,synthesized by GenScript) (the vector was obtained by double digesting the PA gene and pUC57 with HindIII and BamHI and ligating them for amplification) were simultaneous subjected to double digestion with HindIII and BamHI and 1% agarose gel electrophoresis. pcDNA3.1/Hygro(+) plasmid and PA protein gene fragment (Q_PA) were recovered from the gels and the above recovered fragments were ligated using T4 DNA ligase (the molar ratio of the vector to the insert was 1:3) and transformed into E. coli DH5a by heat shock method to construct pcDNA3.1_PA plasmid.

    [0069] The pcDNA3.1_PA plasmid and the vector (pUC57, purchased from Biofeng) containing the PB1 protein gene (Q_PB1, synthesized by GenScript) (the vector was obtained by double digesting the PB1 gene and pUC57 with HindIII and BamHI and ligating them for amplification) were simultaneous subjected to double digestion with BamHI and NotI and 1% agarose gel electrophoresis. pcDNA3.1_PA plasmid and PB1 protein gene fragment (Q_PB1) were recovered from the gels and the above recovered fragments were ligated using T4 DNA ligase (the molar ratio of the vector to the insert was 1:3) and transformed into E. coli DH5a by heat shock method to construct pcDNA3.1_PA_PB1 plasmid.

    [0070] The construction process of pBudCE4.1_Puro_NP_PB2 vector expressing NP and PB2 proteins simultaneously with pBudCE4.1 as the backbone can be referred to Example 1, except that the PB2 gene was directly introduced after introduction of the NP gene. The map of this constructed plasmid is shown in FIG. 3.

    Example 3 Vero Cell Culture and Electrotransformation

    Example 3-1 Electrotransformation of Vero Cells with Single-Plasmid

    [0071] The thawed Vero cells were transferred to a T25 cell culture flask at a cell concentration of 9×10.sup.6 cells/vial, and the cell culture medium used was MEM containing L-glutamine, non-essential amino acids and 10% FBS. On the second day of culture, after trypsinization, the cells were collected and resuspended in 50 ml of PBS, centrifuged at 4000 rpm for 10 min, and resuspended in 0.5 mL of optiMEM (purchased from Sigma, USA). The cells were counted by FCM (1:40), and every 5×10.sup.6 cells were added to a 0.4 cm electroporation cuvette containing 400 μL of optiMEMI (purchased from Sigma, USA).

    [0072] 1 μg of plasmid pBudCE4.1+puro_NP_PA_PB2_PB1 was transferred into Vero cells (1.67E+04 cells/μg plasmid) by electrotransformation. The electrotransformation conditions were: voltage: 120 V, pulse: 500 μs, number of electric shocks: 6 times, time interval: 100 ms.

    Example 3-2 Electrotransformation of MDCK Cells with Single-Plasmid

    [0073] As another alternative solution, MDCK cells were seeded in a T75 cell culture flask at a concentration of 1.0×10.sup.6 cells/vial, and the cell culture medium used was MEM containing 4 mmol/L L-glutamine, non-essential amino acids and 10% FBS. On the second day of culture, the cells were collected and resuspended in 5 ml of MEM, counted, centrifuged, and washed by adding 3 mL of EK buffer, centrifuged again, and resuspended in EK buffer to a cell density of 2.5E+06 cells/mL, and transferred to a 96 well-plate with 60 μL in each well. 9 μg of plasmid (1.2 μg/μL, 4.1 μL) pBudCE4.1+puro_NP_PA_PB2_PB1 was transferred into MDCK cells in the well by electrotransformation. The electrotransformation conditions were: voltage: 175 V, pulse: 100 μs, number of electric shocks: 6 times, time interval: 1000 ms.

    Example 3-3 Double-Plasmid Electrotransformation

    [0074] The Vero cells were seeded in a T75 cell culture flask at a concentration of 1.0×10.sup.6 cells/vial, and the cell culture medium used was DMEM containing 4 mmol/L L-glutamine, non-essential amino acids and 20% FBS DMEM. On the second day of culture, the cells were collected and resuspended in 5 ml of DMEM, counted, centrifuged, and washed by adding 3 mL of EK buffer, centrifuged again, and resuspended in EK buffer to a cell density of 2.5E+06 cells/mL, and transferred to a 96 well-plate with 60 μL in each well. 5 μg of plasmid (1.2 μg/μL, 4.1 μL) pcDNA3.1_PA_PB1 and 5 μg of plasmid pBudCE4.1_Puro_NP_PB2 were transferred into Vero cells in the wells by electrotransformation, respectively. The electrotransformation conditions were: voltage: 175 V, pulse: 100 μs, number of electric shocks: 6 times, time interval: 1000 ms.

    Example 3-4 Culture after Electrotransformation

    [0075] After electrotransformation, 3-5 cell pools with better growth conditions were taken and the culture was enlarged.

    [0076] Vero cell culture conditions: 250 μg/ml hygromycin, 2 μg/ml puromycin, and the cell culture medium was DMEM containing 4 mmol/L L-glutamine, non-essential amino acids and 20% FBS. The culture was statically maintained at 37° C., 5% carbon dioxide; the medium was changed every 2 days.

    [0077] MDCK cell culture conditions: 100 μg/ml hygromycin, 0.5 μg/ml puromycin, and the cell culture medium was DMEM containing 4 mmol/L L-glutamine, non-essential amino acids and 20% FBS. The culture was statically maintained at 37° C., 5% carbon dioxide; the medium was changed every 2 days.

    Example 3-5 RT-PCR

    [0078] The total RNA in the above cultured cells was extracted by TRIzol, and reverse-transcribed into cDNA by M-MLV reverse transcriptase using random primers, and the expression of the target gene was detected by PCR amplification using the reverse transcribed cDNA as a template. RT-PCR results demonstrated stable expression of mRNA levels of PA, PB2, PB1 and NP genes in single-plasmid or double-plasmid transformed Vero cells and single-plasmid transformed MDCK cells.

    Example 4 Construction of Mutant Virus RNA Rescue System

    [0079] According to the gene sequence of influenza virus A/WSN/1933 (Taxonomy ID: 382835) published by Pubmed, the genes of the eight gene fragments of the influenza virus were obtained by whole gene synthesis. The GeneBank accession numbers of the influenza virus gene sequences are: PB2: LC333182.1, PB1: LC333183.1, PA: LC333184.1, NP: LC333186.1, HA: LC333185.1, NA: LC333187.1, M: LC333188.1, NS: LC333189.1, respectively. Then, they were respectively ligated to the vector PHH21 (purchased from Biovector Science Lab, Inc.) to obtain plasmids for rescuing the wild-type influenza virus WSN. The obtained plasmids were named: pPolI-WSN-PB2, pPolI-WSN-PB1, pPolI-WSN-PA, pPolI-WSN-NP, pPolI-WSN-HA, pPolI-WSN-NA, pPolI-WSN-M and pPolI-WSN-NS, respectively. The method of constructing the 8-plasmid system is an existing technology, and can also be constructed and used with reference to the related patent documents, for example, the construction method in Chinese Patent Application No. 201511029463.1.

    [0080] The amino acid conservation of the influenza virus A/WSN/1933 proteins was analyzed by the bioinformatics tool, Consurf, and based on the crystal structures of the influenza virus proteins that have been resolved, conservative, relatively conservative, relatively non-conservative, non-conservative amino acid sites were selected for mutation, and selectable mutations for PA, PB1, PB2 and NP were finally screened and obtained, i.e., PA (R266 codon was mutated to TAG), PB1 (R52 codon was mutated to TAG), PB2 (K33 codon was mutated to TAG) and NP (D101 codon was mutated to TAG) mutations.

    [0081] For the above selected mutation sites, primers capable of mutating the codons encoding the above amino acids to TAG were designed, and the specific primers are as follows:

    TABLE-US-00007 TABLE 1 Point Mutation Primers for Selected Sites  on Four Proteins SEQ Primer ID Name Primer Sequence (5′-3′) NO: Site NP 5′-ggacctatatacaggagagtatag SEQ D101 ggaaagtggaggagaga-3′ ID NO: 7 5′-tctctcctccactttccctatact SEQ ctcctgtatataggtcc-3′ ID NO: 8 PA 5′-gcccatccggaagtctaagtggct SEQ R266 atggtgttgatttcaaaaaaggttca-3′ ID NO: 9 5′-tgaaccttttttgaaatcaacacca SEQ tagccacttagacttccggatgggc-3′ ID NO: 10 PB2 5′-ctgtcttcctgatgtgtactacttg SEQ K33 attatggccatatg-3′ ID NO: 11 5′-catatggccataatcaagtagtacac SEQ atcaggaagacag-3′ ID NO: 12 PB1 5′-gtttgttgtccatcttccctattct SEQ gagtactgatgtgtcct-3′ ID NO: 13 5′-aggacacatcagtactcagaatagg SEQ R52 gaagatggacaacaaac-3′ ID NO: 14

    [0082] Using pPolI-WSN-PB2, pPolI-WSN-PB1, pPolI-WSN-PA, pPolI-WSN-NP as template plasmids and the site-directed mutagenesis kit (Lightning Site-Directed Mutagenesis Kits Catalog#210518), the amino acid codon of the selected sites on each protein was mutated to the amber stop codon TAG by the above primer sites according to the instructions, and the mutations were successful as verified by sequencing. The resulting vectors containing the mutant genes were named as pPolI-M-PB, pPolI-M-PB1, pPolI-M-PA and pPolI-M-NP, respectively.

    Example 5 Rescue of Replication-Controllable Virus

    [0083] The cells stably expressing genes prepared in Example 3-1 were plated: using a 10 cm dish as an example, the stable strain was plated in a 10 cm dish plate at 1×10.sup.6 cells/ml per dish, mixed, and placed at 37° C., 5% CO.sub.2, cultured for 20-24 hrs to reach 20% -40% cell confluence.

    [0084] The transfection of the viral plasmid and virus rescue were carried out in accordance with a conventional method, and the eight plasmids used to rescue the influenza virus were co-transfected into Vero stable cell lines transformed with single-plasmid or double -plasmid obtained in Example 3. Among them, the plasmids carrying the NP, PA, PB2 and PB1 genes were the four site-directed mutant plasmids obtained in Example 4, and the plasmids carrying the HA, NA, M and NS genes were the four plasmids: pPolI-WSN-HA, pPolI-WSN-NA, pPolI-WSN-M and pPolI-WSN-NS.

    [0085] 1 ml of Opti-MEM was added to a EP tube, eight plasmids (1 μg per plasmid) were added, and transfection reagent was added, mixed, incubated at 37° C., 5% CO.sub.2. After 5.5 hours of culture, the medium was changed, half of the medium was changed on the 4th day after transfection, and 10% of the initial volume was supplemented every two days from the 6th day after transfection. The growth of the cells and the pathological changes of the cells were observed and recorded every day. In the virus rescue involving the stable cell lines produce by single-plasmid or double-plasmid transformation, more than 70% have pathological changes for both of them and viral solutions were harvested.

    [0086] The viruses were negatively stained with phosphotungstic acid for 5 min, and observed by transmission electron microscopy (Spirit 120 KV) (100 kv, magnified 150,000 times). A complete virus image obtained by the rescue involving the single-plasmid transformed Vero cells was photographed, as shown in FIG. 4.

    [0087] The same results were obtained with the double-plasmid-integrated Vero cells as well as the stably integrated MDCK cells.

    Example 6 Confirmation of Mutation Sites of Replication-Controllable Virus

    [0088] The total RNA of the virus obtained in Example 5 (rescue involving the single plasmid-integrated Vero cell line) was extracted using RNAiso plus (TaKaRa Code No.: 9108), and after extraction, it was dissolved in 13 μl of RNase-free dH.sub.2O, and TaKaRaPrimeScript™ One Step RT-PCR Kit Ver. 2 (Code No.: RR055A) was used for RT-PCR, TSINGKE DNA Gel Recovery Kit (Code No.: GE0101-200) was used to recover the above PCR product, and the PCR product was dissolved in 25 μl of Eluent Buffer and subjected to BigDye®Terminator v3.1 sequencing reaction and purification, 3730 sequencer sequencing, and the 3730×1 was used to collect and analyze the data. See FIG. 5 for the results. The primers for the four mutation sites are as follows:

    TABLE-US-00008 TABLE 2 Primer sequence Gene (5′-3′) Length NP GATGGAGAACGCCAGAAT 18 (Gene (SEQ ID NO: 15) locus 1) GCATCGTCACCATTATTAGC (SEQ ID NO: 16) 20 PA ACCAGGCTATTCACCATAAG (Gene (SEQ ID NO: 17) 20 locus 2) CCTTCCATCCAAAGAATGTTC (SEQ ID NO: 18) 21 PB1 GGACAGGAACAGGATACAC (Gene (SEQ ID NO: 19) 19 locus 3) TGCTGAACAACCTCCATC (SEQ ID NO: 20) 18 PB2 CGAAAGCAGGTCAATTATATTCA (Gene (SEQ ID NO: 21) 23 locus 4) TACTTGTCACTGGTCCATTC (SEQ ID NO: 22) 20

    [0089] Experimental results: as shown in FIG. 5, the sequencing results of the four mutation sites were completely consistent with the reference sequences, and no back mutation occurred. The mutation detection was also performed for the virus rescue in which the host cells constructed by the double-plasmid system were involved, and the results were the same.

    Example 7 Confirmation of Safety by Viral Cytopathic Experiment

    [0090] The normal Vero cells and the cells constructed in Example 3-1 were taken and plated in 6-well plates at 4*10.sup.5 cells/well, and 2 mL of the culture medium was added to each well. The cells were cultured at 37° C., 5% CO.sub.2 overnight, and then 0.5 mL of virus solution was added (prepared in Example 5) and mixed. The mixture was cultured at 37° C., 5% CO.sub.2 for 3 days, observed under the microscope. The constructed cells were lysed due to viral replication, and normal Vero cells were not lysed. See FIG. 6.

    Example 8 Determination of HA by Virus Hemagglutination Test

    [0091] The replication-controllable virus solution obtained in Example 5 and the virus solution obtained by virus rescue involving MDCK prepared by the method taught in the examples of the present application were taken and divided into three groups of 6 samples for detection. Among them, the samples 1 and 2 were respectively the virus solutions (cultured for 6 days and 7 days, respectively) formed by the rescue involving the cells of Example 3-1, and the samples 3 and 4 were respectively the virus solutions (cultured for 6 days and 7 days, respectively) formed by the rescue involving the cells of Example 3-2, and the samples 5 and 6 were respectively the virus solutions (cultured for 6 days and 7 days, respectively) formed by the rescue involving the cells of Example 3-3. The red blood cell suspension was prepared according to the “1% chicken red blood cell suspension preparation” SOP. The microplate were placed horizontally: the vertical directions were called the columns, for example, the holes A1 to H1 were called the first column; the parallel directions were called the rows, for example, A1 to A12 were called row A. The laboratory number and sequence of loading samples of the virus to be tested were labeled. Adding PBS: an 8-channel sampler was taken and equipped with a 200 μL filter-type dripper; 50 μL of PBS was pipetted from the loading slot and added into the second column of the microplate and 50 μL of PBS was added in sequence until the last column. Adding the virus to be tested: a single-channel pipette was equipped with a 200 μL filter-type dripper, and 100 μL of the virus solution to be tested was pipetted and added to the labeled corresponding well of the first column of the microplate. 100 μL of PBS was added to the last H1 well as a red blood cell control. The 8-channel sampler was equipped with a 200 μL filter-type dripper. 50 μL of virus solution was taken from each well of the first column, and added to the corresponding wells of the second column, and mixed several times. Two-fold serial dilutions were sequentially performed from the second column to the twelfth column of the microplate. In the last column, 50 μL of liquid was discarded per well. The 8-channel sampler was equipped with a 200 μL filter-type dripper and 50 μL of red blood cell suspension was taken from the loading slot. 50 μL of 1% red blood cell suspension was added to each well and the microplate was flicked to mix the red blood cells with the virus. The plate was incubated for 60 minutes at room temperature, the red blood cell agglutination phenomenon was observed and the results were recorded. Determination of results: the determination of the red blood cell agglutination titer was determined by the highest dilution at which the complete agglutination occurred, and the reciprocal of the dilution was the red blood cell agglutination titer of the virus. Complete red blood cells agglutination was record as “+”; no agglutination or partial agglutination was recorded as “−”. The blank control was conducted by replacing 50 μL of virus solution with 50 μL of PBS. The positive control was a wild-type influenza virus A/WSN/1933 sample diluted 100 times by PBS. The negative control 1 was Vero cells that were not transformed with a plasmid or plasmid system containing pBudCE4.1+puro_NP_PA_PB2_PB1 and other plasmids, but transiently transformed with the 8-plasmid system containing the mutations; the negative control 2 was Vero cells that were not transformed with the 8-plasmid system containing the mutations, but transformed with the pBudCE4.1+puro_NP_PA_PB2_PB1 vector.

    TABLE-US-00009 TABLE 3 Red Blood Cell Agglutination Hemagglutination titer Sample number 1:1 1:2 1:4 1:8 1 + + + + 2 + + + − 3 + + − − 4 + + − − 5 + + − − 6 + + + − Positive control + + + + Negative control 1 − − − − Negative control 2 − − − − Blank control − − − −

    [0092] The experimental results showed that Vero and MDCK cell lines stably expressing the four genes constructed by single- or double- plasmid can be used for virus rescue and can produce intact virus hemagglutination activity under undiluted or 2-fold dilution conditions. This result further proves that the virus rescue is successful. Among them, the use of single plasmid-integrated cell using Vero as a host cell has better efficiency as a host cell for virus rescue.