RECOMBINANT FUSION PROTEINS FOR PREVENTING OR TREATING ADHESIONS OF TISSUES OR ORGANS

Abstract

The invention relates to recombinant fusion proteins comprising a fibrinogenolytic enzyme having an amino acid sequence that is C-terminally and/or N-terminally linked to the amino acid sequence of at least one high-molecular inert stabilization domain with a molecular weight of >50 kDa, for the prevention or treatment of adhesions at tissues or organs, in particular peritoneal adhesions following surgical interventions.

Claims

1-15. (canceled)

16. A recombinant fusion protein comprising a fibrinogenolytic enzyme having an amino acid sequence that is C-terminally and/or N-terminally linked to the amino acid sequence of at least one high-molecular inert stabilization domain with a molecular weight of >50 kDa, for the prevention or treatment of adhesions at tissue or organs, in particular peritoneal adhesions following surgical interventions.

17. The recombinant fusion protein according to claim 16, characterized in that the inert stabilization domain is connected via a linker to the fibrinogenolytic enzyme.

18. The recombinant fusion protein according to claim 17, characterized in that the linker relates to a glycine-serine linker having the sequence (GGGGGS)x, or glycine-alanine linker with the sequence (GGGGA)xR, where A=alanine; G=glycine; R=arginine; S=serine; x=number of repetitions >1.

19. The recombinant fusion protein according to claim 16, characterized in that a plurality of inert stabilization domains are linked to the C-terminus of the fibrinogenolytic enzyme.

20. The recombinant fusion protein according to claim 16, characterized in that a plurality of inert stabilization domains are linked to the N-terminus of the fibrinogenolytic enzyme.

21. The recombinant fusion protein according to claim 16, characterized in that the stabilization domain has a molecular weight between 50 and 150 kDa.

22. The recombinant fusion protein according to claim 16, characterized in that the fibrinogenolytic enzyme relates to a thrombin-like serine protease.

23. The recombinant fusion protein according to claim 16, characterized in that the fibrinogenolytic enzyme relates to ancrod or batroxobin, or a recombinant variant of ancrod or batroxobin.

24. The recombinant fusion protein according to claim 16, characterized in that the high molecular inert stabilization domain relates to a protein or peptide domain, in particular serum albumin, transferrin, a monoclonal or humanized antibody or an antibody fragment, or an artificial domain, e.g. PAS or XTEN.

25. The recombinant fusion protein according to claim 16, characterized in that the amino acid sequence of human serum albumin, or a part of this sequence having a molecular weight of >50 kDa, is linked as inert stabilizing domain to the C terminus or N-terminus of ancrod or batroxobin as fibrinogenolyticec enzyme.

26. The recombinant fusion protein according to claim 25, characterized in that the fusion protein comprises an amino acid sequence set forth in SEQ ID NO. 2 (N-terminal fusion) or SEQ ID NO. 4 (C-terminal fusion), or fibrinogenolytically effective parts of this sequence.

27. The recombinant fusion protein according to claim 16, characterized in that the fusion protein is embedded in a biodegradable matrix for continuous intraperitoneal release.

28. A pharmaceutical composition comprising a recombinant fusion protein according to claim 16 for use in the prevention or treatment of adhesions at tissues or organs, in particular peritoneal adhesions following surgical interventions.

29. The pharmaceutical composition according to claim 28, characterized in that the recombinant fusion protein is present in an osmotically active medium, preferably Ico-dextrin solution.

30. Use of a recombinant fusion protein according to claim 16 for the manufacture of a medicament for the prevention or treatment of adhesions at tissues or organs, in particular peritoneal adhesions following surgical interventions.

Description

WAYS OF IMPLEMENTING THE INVENTION

[0044] The invention is illustrated in the following examples.

EXAMPLES

Example 1

[0045] Preparation of N-ancrod-Fc-fusion Protein

[0046] For the production of the composition of the invention a fusion protein was prepared, consisting of ancrod and the constant region of a human IgG1 antibody. Between the biologically active ancrod domain and the stabilizing domain formed by the IgG1-Fc antibody fragment, a glycine-alanine-linker is inserted. In order to improve secretion into the cell culture medium and to facilitate purification, the signal peptide of human serum albumin was added at the N-terminus. For the production, the sequence of ancrod protein (access number: ABN13428.1) was added at its C-terminus to the constant region of a human IgG1 (Uniprot acc.no. P01857-1, amino acids 104-330) via a flexible glycine-alanine linker. Subsequently, the HSA-signal peptide (amino acids 1 to 18), required for the purification was added. For the synthesis of cDNA coding for the fusion protein, the DNA codons were optimized for expression in human cells. At the 5′ end of cDNA, restriction sites for NotI and XbaI were added, and at the 3′ end, restriction sites for BstXI and HindiII, which allows the cloning of DNA into the appropriate vectors for a transient expression and/or for the production of stable cell lines. The resulting cDNA construct was produced synthetically.

[0047] This cDNA was cloned, amplified, and recloned into an expression vector for transient transfection. The correct insertion of cDNA was tested via a restriction digest. With the resulting plasmid, E. coli bacteria (DH5a) were then transformed and the strain was cultured in 0.8 litre of LB medium. From this, the plasmid DNA was isolated and the endotoxin solution was filtered sterile.

[0048] For transient expression of the protein, HEK-F cells were set up in serum-free suspension culture in a volume of 500 ml in shake flasks (approximately 2.5×10.sup.6 cells/ml). Transfection of cells was carried out via a branched PEG-amino ester copolymer with a transfection mixture of about 10 μg DNA/1×10.sup.7 cells—DNA/coPEG33-1/6 (w/w). After the addition of valproic acid, the cell culture was cultivated for a further 7 days. Thereafter, the cell culture supernatant was harvested by centrifugation. Chromatography was performed in 50 mM MES buffer, pH 5.5.

[0049] The purification of the fusion protein was carried out by ion exchange chromatography. HiTrap SP FF Affinity Resin (GE Healthcare Europe GmbH, Freiburg, Germany) was used as column material. The elution of fusion protein was carried out by a sodium chloride gradient. Analysis of the eluate fractions was carried out by gel electrophoresis (SDS—PAGE) and suitable protein fractions were pooled and dialyzed, aliquoted and stored until further use at −20° C. against buffered saline (PBS).

[0050] The cDNA sequence of the construct is shown in SEQ ID NO 1:

[0051] Underlined are the inserted restriction sites. - The sequence encoding the fusion protein is shown in bold.

TABLE-US-00001 gcggccgccaccatgaaatgggtcacctttatctcccttctgttcctctt tagtagcgcctattctgtcatcggtggtgacgagtgcaatatcaacgagc atcgatttctggtggcagtgtatgaaggaaccaactggacctttatctgc ggcggggtccttattcacccagagtgggtcattaccgccgaacactgtgc tcggcgtcgaatgaatcttgtgttcgggatgcacaggaaatcagagaagt ttgatgacgaacaggaacggtatcccaagaagcggtacttcattcgatgc aacaaaacccggactagctgggatgaggacatcatgctgattcggctgaa caagcccgtgaataacagcgagcatattgctcctttgtcactgccttcca atccgcctattgtgggtagtgactgccgtgtgatgggctggggtagcatt aacagaaggatccacgtgcttagcgatgaacccagatgtgccaacatcaa tctccacaacttcaccatgtgtcatgggttgttccgcaagatgcctaaga agggacgcgtactctgtgctggcgatctgcgcggtagacgggactcttgc aattcagatagtggaggaccccttatctgcaacgaagagctgcatggcat tgtggccagaggccccaatccatgtgcacagcccaacaaaccagctctgt atactagcgtgtacgactacagggattgggtgaacaacgttatcgccggc aatgcaacctgtagtccaggcggcggcggagccggtggaggcggggcagg aggaggaggagctagagacaaaacacacacttgtccaccctgtcctgctc ccgaactgcttggtggacccagcgtgtttctgtttccgcctaagcccaaa gacaccctcatgatctcacggactcccgaagttacgtgtgtcgtagtaga cgtgtcacacgaagatcccgaggtcaagttcaactggtatgtggacggag ttgaggttcacaacgccaaaaccaaaccgagagaggagcagtacaactcc acatatagggtggtaagcgtgttgaccgtgctgcatcaggattggctgaa tggcaaagagtacaagtgcaaggtgtccaataaggctcttccagcaccca ttgagaaaacgatctccaaggcgaaaggccaacctcgtgaacctcaggtg tatactctccctccaagtcgcgatgagctcaccaagaaccaggtgtcttt gacatgcctcgtcaaagggttctacccatcagacatagccgtcgaatggg agtctaatggccaaccagagaataactacaagaccactcctccggttctg gatagtgatgggagcttctttctgtacagcaagctgacagtcgacaagtc ccgatggcagcagggtaatgtgttcagttgctctgtgatgcatgaagccc tgcataaccactatacccagaaaagcctgtctctgagcccaggaaagtaa tagaagctt

[0052] The resulting amino acid sequence is shown in SEQ ID NO 2:

TABLE-US-00002 MKWVTFISLL FLFSSAYSVI GGDECNINEH RFLVAVYEGT NWTFICGGVL  50 IHPEWVITAE HCARRRMNLV FGMHRKSEKF DDEQERYPKK RYFIRCNKTR 100 TSWDEDIMLI RLNKPVNNSE HIAPLSLPSN PPIVGSDCRV MGWGSINRRI 150 HVLSDEPRCA NINLHNFTMC HGLFRKMPKK GRVLCAGDLR GRRDSCNSDS 200 GGPLICNEEL HGIVARGPNP CAQPNKPALY TSVYDYRDWV NNVIAGNATC 250 SPGGGGAGGG GAGGGGARDK THTCPPCPAP ELLGGPSVFL FPPKPKDTLM 300 ISRTPEVTCV VVDVSHEDPE VKFNWYVDGV EVHNAKTKPR EEQYNSTYRV 350 VSVLTVLHQD WLNGKEYKCK VSNKALPAPI EKTISKAKGQ PREPQVYTLP 400 PSRDELTKNQ VSLTCLVKGF YPSDIAVEWE SNGQPENNYK TTPPVLDSDG 450 SFFLYSKLTV DKSRWQQGNV FSCSVMHEAL HNHYTQKSLS LSPGK 495

[0053] The amino acid sequence starts with the signal peptide of human serum albumin MKWVTFISLLFLFSSAYS shown (underlined), which is separated during secretion of the protein from the cell. The linker GGGGAGGGGAGGGGAR, arranged between the human serum albumin and the ancrod-domain, is connected to the C-terminus of ancrod (shown in bold).

, Example 2

[0054] Preparation of N-ancrod-HSA-C Fusion Protein with His-Tag.

[0055] In this example, a further variant of an ancrod-based fusion protein is shown, consisting of ancrod, human serum albumin (HSA), a signal peptide of human serum albumin and a subsequent His-Tag. Between the biologically active domain and the stabilization domain formed by the human serum albumin, a glycine-/serin-linker is inserted. For the production, the sequence of ancrod protein (accession number: ABN13428.1) is merged C-terminally with the N-terminus of human serum albumin (HSA) (accession number: P02768, amino acids 25-609). Subsequently, the HSA signal peptide (amino acids 1 to 18) was added. The cDNA was processed as described above and the protein was expressed.

[0056] The cDNA sequence of the construct is shown in SEQ ID NO 3:

TABLE-US-00003 gcggccgctctagagccaccatgaaatgggttaccttcattagcctcctg ttcctgttttcctccgcctattctgttatcggtggtgacgagtgtaacat caacgagcataggttcctggtcgcagtgtatgagggcacaaactggacct tcatttgtggcggggtgctgattcacccagagtgggtaataacagcggag cattgtgcccgcagacgcatgaatctcgtgtttggaatgcatcgcaaaag cgagaaattcgatgatgaacaagaaaggtaccctaagaagcggtacttca ttcggtgcaacaagacaagaacttcatgggacgaggacatcatgctgatc cgtcttaacaagccggtaaataacagcgagcatatcgcaccactctcatt gcccagcaaccctcccatcgtgggaagcgattgcagagtgatggggtggg gctccatcaatagaaggattcacgtgctctctgatgaaccgcggtgtgcc aacattaatctgcataattttactatgtgccatggtctgtttcgcaaaat gcccaagaaaggaagagttctgtgtgcaggcgatctgagaggaaggagag actcttgcaactccgatagtggcgggccactgatatgcaacgaagagctt cacggaatcgtggccagaggtcctaatccatgtgctcagcctaacaagcc cgctctgtacaccagcgtttatgactaccgggattgggtcaacaatgtca ttgccggaaatgccacctgttcccctggcggcggcgggtcaggaggagga gggtctggtggcggcgggtctgacgcacataaaagcgaagtggctcaccg gtttaaagatctcggcgaagagaacttcaaagctcttgtattgattgcct tcgctcagtacttgcaacagtgccctttcgaggaccacgtgaaactggtg aatgaagtcacagaattcgctaagacgtgtgtggcggatgagagtgctga gaactgtgacaagagtctgcacaccctgtttggggataaactgtgcactg tcgctactctgcgagaaacttatggcgaaatggccgactgctgcgccaag caggaacccgagagaaatgaatgctttctgcagcacaaagacgacaaccc taatctgccacgattggttcggcccgaggtggacgtaatgtgcacggctt tccacgacaatgaggaaaccttcctgaagaagtatctctacgaaatagct cgacggcatccctacttttatgcacccgagctgctgttctttgcgaagcg ctataaggccgctttcacagaatgctgtcaagctgccgacaaggctgcct gtctcctcccaaaactggacgagctccgcgatgaggggaaggcaagcagt gccaaacagcgcctgaaatgcgcatcacttcagaaattcggagagcgcgc attcaaagcatgggcagtggctcgattgtcccagcgatttcctaaggctg aatttgccgaagtgtcaaagctggtgacagaccttaccaaagtccacaca gaatgctgccatggtgacttgctggagtgcgccgatgacagagccgatct ggccaagtacatctgtgaaaatcaggattccatctcctccaaactgaaag aatgctgcgagaaacccctgctggagaagagccattgtattgctgaggtg gaaaacgatgagatgccagcggacctcccatcactggcagccgacttcgt cgagagtaaggacgtgtgtaagaactacgccgaagcgaaggatgtgtttc tcgggatgtttctgtacgaatatgcgcgtcgtcatcccgattatagcgtg gttctgctgcttaggcttgccaagacttacgaaaccaccctcgagaagtg ttgtgccgccgctgacccgcatgagtgctacgccaaagtatttgacgagt ttaagcctctggtcgaggagcctcagaacctgatcaaacagaactgcgag cttttcgagcagttgggtgaatacaaatttcagaatgccctgctcgtcag gtatactaagaaggtgccccaagtgtctacacctaccttggttgaggtca gccggaatctcggcaaggtcggcagcaaatgctgtaagcacccagaggca aagcgtatgccatgtgcagaggattatctgagtgtcgtcctcaaccagct gtgcgtacttcacgaaaagacaccagtgtccgatagggtcactaaatgtt gcaccgaatctctggtgaatcggaggccctgtttctcagctctggaagtt gatgaaacctacgttccgaaggagttcaatgcagaaacgtttacctttca cgctgacatctgcacgctctctgagaaggagaggcagataaagaagcaaa cagccctggtagagctggttaaacacaagcccaaagcaacaaaggagcag ctgaaagcggtgatggatgacttcgccgcgtttgtggagaagtgctgtaa ggccgacgataaagaaacttgcttcgccgaagagggaaagaagcttgtgg cagctagccaagcagcccttgggttgcaccaccatcaccaccactaatag ccactgtgctggttcgaa

[0057] Underlined are the inserted restriction sites (5 ′: NotI, XbaI; 3′: BstXI, HindIII)—in bold, the sequence encoding the fusion protein sequence is shown in bold.

[0058] The resulting amino acid sequence is shown in SEQ ID No 4:

TABLE-US-00004 MKWVTFISLL FLFSSAYSVI GGDECNINEH RFLVAVYEGT NWTFICGGVL IHPEWVITAE  60 HCARRRMNLV FGMHRKSEKF DDEQERYPKK RYFIRCNKTR TSWDEDIMLI RLNKPVNNSE 120 HIAPLSLPSN PPIVGSDCRV MGWGSINRRI HVLSDEPRCA NINLHNFTMC HGLFRKMPKK 180 GRVLCAGDLR GRRDSCNSDS GGPLICNEEL HGIVARGPNP CAQPNKPALY TSVYDYRDWV 240 NNVIAGNATC SPGGGGSGGG GSGGGGSDAH KSEVAHRFKD LGEENFKALV LIAFAQYLQQ 300 CPFEDHVKLV NEVTEFAKTC VADESAENCD KSLHTLFGDK LCTVATLRET YGEMADCCAK 360 QEPERNECFL QHKDDNPNLP RLVRPEVDVM CTAFHDNEET FLKKYLYEIA RRHPYFYAPE 420 LLFFAKRYKA AFTECCQAAD KAACLLPKLD ELRDEGKASS AKQRLKCASL QKFGERAFKA 480 WAVARLSQRF PKAEFAEVSK LVTDLTKVHT ECCHGDLLEC ADDRADLAKY ICENQDSISS 540 KLKECCEKPL LEKSHCIAEV ENDEMPADLP SLAADFVESK DVCKNYAEAK DVFLGMFLYE 600 YARRHPDYSV VLLLRLAKTY ETTLEKCCAA ADPHECYAKV FDEFKPLVEE PQNLIKQNCE 660 LFEQLGEYKF QNALLVRYTK KVPQVSTPTL VEVSRNLGKV GSKCCKHPEA KRMPCAEDYL 720 SVVLNQLCVL HEKTPVSDRV TKCCTESLVN RRPCFSALEV DETYVPKEFN AETFTFHADI 780 CTLSEKERQI KKQTALVELV KHKPKATKEQ LKAVMDDFAA FVEKCCKADD KETCFAEEGK 840 KLVAASQAAL GLHHHHHH 858

[0059] The amino acid sequence starts with the signal peptide of human serum albumin MKWVTFISLLFLFSSAYS, which is separated during secretion of the protein from the cell. The linker GGGGSGGGGSGGGGS, arranged between the human serum albumin and the ancrod-domain, is connected to the N-terminus of serum albumin (shown in bold).

Example 3

[0060] Activity Test of the Produced Fusion Proteins for Their Fibrinogenolytic Enzyme Activity

[0061] The activity test of the fusion protein was performed using fibrinogen as substrate (1 mg/ml) dissolved in 10 mM Tris-HCl, 0.15 M NaCl, pH 7.4. Each 500 μl of fibrinogen solution were pipetted into a cuvette. After 2 minutes, 100 μl sample or a positive control (batroxobin) was added. Thereafter, the increase in turbidity at 340 nm was determined by photometry over a period of one hour and the maximum slope of the curve was ascertained. The maximum slope of the curve is proportional to the enzymatic activity, which is converted into units/ml using a calibration curve.

Example 4

[0062] Treatment of Peritoneal Adhesions in Mammals

[0063] For preventive or therapeutic application in a mammal (e.g., a human or a laboratory animal), the recombinant fusion protein of the invention isolated and purified following expression, or a matching placebo was applied directly into the abdominal area of the test animal post surgery that triggered adhesions. To achieve an optimum effect, an enzymatic activity of between 0.01 and 10 U/ml is desired. The pharmaceutical solution comprises the fusion protein having an activity between 0.1 and 5 U/ml.

[0064] After administering the fusion protein, a fibrinolytic enzyme activity of the fusion protein that continues over several days can be detected while simultaneously maintaining the wound healing. Compared to placebo-treated animals, the amount and severity of adhesions occurring as part of the wound healing process will be drastically reduced.

Example 5

[0065] Pharmacological and Pharmacokinetic Properties of N-ancrod-HSA-C Fusion Proteins

[0066] For the production of the fusion protein, the sequence of ancrod protein (accession number: ABN13428.1) was merged C-terminally with the N-terminus of human serum albumin (HSA) (accession number: P02768, amino acids 25-609). The enzymatic activity of the fusion protein is 24 U/ml.

[0067] Since native ancrod is unsuitable in a therapeutic application for the treatment of peritoneal adhesions, the resulting fusion protein was tested on its activity and disposition (residence time) in the abdominal area. FIG. 1 shows the enzyme activity in the fluid in the abdominal area after a single intra-peritoneal administration of native ancrod and ancrod fusion protein of the invention (AK03). It can be clearly seen that the native ancrod is unsuitable for therapeutic use because the intraperitoneally administered ancrod quickly leaves the abdominal area and thus only low concentrations are obtained, which additionally also fall within 6 hours to values close to the detection limit. In contrast, after administering a comparable dose of ancrod-fusion protein (AK03), significantly higher activity is achieved in the abdominal area, which still lies well within the therapeutically effective range, even after 6 hours.

[0068] In FIG. 2, the effect of ancrod and the ancrod-fusion protein of the invention (AK03) on fibrinogen concentration in blood plasma is shown. The rapid passage of ancrod in the vascular system results here in a drop in the fibrinogen level in blood by more than 50%. AK03 migrates only very slowly into the bloodstream due to the changed molecular structure, and therefore results in a slight drop in fibrinogen level of 14%. Such small changes in fibrinogen concentrations fall within the physiological range and have no effect on blood clotting.

[0069] The ancrod fusion protein AK03 equipped with the stabilization domain thus shows a much more favourable pharmacokinetic behaviour than the native ancrod molecule.

[0070] These results show that the ancrod fusion protein exhibits similar enzymatic features as ancrod, but it is pharmacokinetically distinctly different. In particular, this leads to a longer residence time of the fusion protein in the peritoneal cavity and a lower passage of the substance into the bloodstream. Due to these properties, the fusion protein of the invention is particularly suitable for intraperitoneal application for the treatment / prevention of peritoneal adhesions.

[0071] Materials and Methods

[0072] Pharmacokinetics in Dogs

[0073] Three Beagle dogs were provided with venous and intraperitoneal indwelling catheters. A week after catheter implantation, animals received one single intraperitoneal injection of the test substance. 0.5 ml of samples of peritoneal fluid were taken at intervals of 0, 0.5; 1, 2, 4, 6, and 8 hours after administration of the substance; venous blood samples were taken for extracting citrated plasma at the time-points of 0, 0.5; 1, 2, 4, 6, 8, 16 and 24 hours. The fibrinogen concentration in the plasma samples was determined photometrically by the method according to Clauss. The enzyme activity in peritoneal fluid was determined by centrifugation of the samples using a kinetic turbidimetric method following addition of human fibrinogen.

[0074] Pharmacokinetics in Rats:

[0075] Sprague-Dawley rats received intraperitoneal injections of the test substance in a short inhalation anaesthesia. Simultaneously, a venous blood sample was taken. Thereafter, the animals were returned to the cage where they awoke after a short time. Six hours after administrating the substance, the animals were anesthetized again and the peritoneal fluid and a further blood sample were withdrawn for extracting citrate plasma. Both samples were immediately centrifuged after collection and snap frozen at −80° C. and analyzed at a later time with the methods described above.

BIBLIOGRAPHY

[0076] Arung, W.; Meurisse, M.; Detry, O. (2011): Pathophysiology and prevention of postoperative peritoneal adhesions. In: World J Gastroenterol 17 (41), pp 4545-4553.

[0077] Ashby, E. C; James, D. C; Ellis, H. (1970): The effect of intraperitoneal Malayan pit viper venom-on adhesion formation and peritoneal healing. In: Br J Surg 57 (1 1), S. 863 ad.

[0078] Binda, M M; Hellebrekers, B W; Declerck, P J; Koninckx, P R (2009): Effect of Reteplase and PAI-1 antibodies on postoperative adhesion formation in a laparoscopic mouse model. In: Surgical Endoscopy 23 (5), pp 1018-1025.

[0079] Binnebosel, M.; Klink, C; Serno, J.; Jansen, P.; Trotha, K. of; Neumann, U.; Young, K. (2011): Chronological evaluation of inflammatory mediators during peritoneal adhesion formation using a rat model. In: Langenbeck's Archives of Surgery 396 (3), pp 371-378.

[0080] Broek, R. P. G. ten; Issa, Y.; van Santbrink, E J P; Bouvy, N. D.; Kruitwagen, R. F. P. M.; Jeekel, J. et al. (2013A): Burden of adhesions in abdominal and pelvic surgery: systematic review and met-analysis. In: BMJ 347, p f5588.

[0081] Broek, R P G ten; Kok-Krant, N.; Bakkum, E A; Bleichrodt, R P; van Goor, H. (2013B): Different surgical techniques to reduce post-operative adhesion formation: a systematic review and meta-analysis. In: Hum Reprod Update 19 (1), pp 12-25.

[0082] Brokelman, W J A; Lensvelt, M.; Borel Rinkes, I. H. M.; Klinkenbijl, J H G; Reijnen, M. M. P. J. (2011): Peritoneal changes due to laparoscopic surgery. In: Surg Endosc 25 (1), pp 1 -9.

[0083] Brummer, T. H. I.; Jalkanen, J.; Fraser, J.; Heikkinen, A-M.; Kauko, M.; Makinen, J. et al. (2011): FINHYST, a prospective study of 5279 hysterectomies: complications and their risk factors. In: Hum Reprod 26 (7) pp 1741-1751. Buckman, R F Jr; Bordos, D.; Bell, W. R.;

[0084] Cameron, J. L. (1975): Prevention of experimental postoperative adhesions by ancrod defibrinogenation. In: J Surg Res 18 (4), pp 377-384.

[0085] Chowdhury, S. M.; Hubbell, J. A. (1996): Adhesion prevention with ancrod released via a tissue-adherent hydrogel. In: J Surg Res 61 (1), pp 58-64.

[0086] Cohen, Z.; Senagore, A. J.; Dayton, M. T.; Koruda, M. J.; de Beck; Wolff, B. G. et al. (2005): Prevention of postoperative abdominal adhesions by a novel, glycerol/sodium hyaluronate/carboxymethylcellulose-based bioresorbable membrane: a prospective, randomized, evaluator-blinded multicenter study. In: Diseases of the colon and rectum 48 (6), pp 1130-1139.

[0087] Diamond, M. P.; Kruger, M.; Saed, G. M. (2004): Effect of Tisseel on expression of plasminogen activator and plasminogen activator tissue inhibitor-1. In: Fertility and sterility 81 (6), pp 1657-1664.

[0088] Ellis, H.; Moran, B. J.; Thompson, J. N.; Parker, M. C; Wilson, M. S.; Menzies, D. et al. (1999): Adhesion-related hospital readmissions after abdominal and pelvic surgery: a retrospective cohort study. In: Lancet 353 (9163), pp 1476-1480.

[0089] Fossum, G. T.; Silverberg, K. M.; Miller, C. E.; Diamond, M. P.; Holmdahl, L. (2011): Gynecologic use of Sepraspray Adhesion Barrier for reduction of adhesion development after laparoscopic myomectomy: a pilot study. In: Fertil Steril 96 (2), pp 487-491.

[0090] Hellebrekers, B. W. J.; Emeis, J. J.; Kooistra, T.; Trimbos, J. B.; Moore, N. R.; Zwinderman, K. H.; Trimbos-Kemper, T C (2005): A role for the fibrinolytic system in postsurgical adhesion formation. In: Fertil Steril 83 (1), pp 122-129.

[0091] Hellebrekers, B. W/; Trimbos-Kemper, T. C; Boesten, L; Jansen, F. W.; Kolkman, W.; Trimbos, J. B. et al. (2009): Preoperative predictors of postsurgical adhesion formation and the Prevention of Adhesions with Plasminogen Activator (PA-study): results of a clinical pilot study. In: Fertil Steril 91 (4), pp 1204-1214.

[0092] Hellebrekers, W. J.; Kooistra, T. (2011): Pathogenesis of postoperative adhesion formation. In: Br J Surg 98 (1 1), pp 1503-1516.

[0093] Hill-West, J. L.; Dunn, R. C.; Hubbell, J. A. (1995): Local release of fibrinolytic agents for adhesion prevention. In: J Surgical Research 59 (6), pp 759-763.

[0094] Klingler, P. J.; Floch, N. Ft.; Seelig, M. H.; Branton, S. A.; Wolfe, J. T.; Metzger, P. P. (1999): Seprafilm-induced peritoneal inflammation: a previously unknown complication. Report of a case. In: Diseases of the colon and rectum 42 (12), pp 1639-1643.

[0095] Kossi, J.; Salminen, P.; Rantala, A.; Laato, M. (2003): Population-based study of the surgical workload and economic impact of bowel obstruction caused by postoperative adhesions. In: Br J Surg 90 (11), pp 1441 -1444.

[0096] Parker, M. C; Wilson, M. S.; Menzies, D.; Sunderland, G.; Clark, D. N.; Knight, A. D.; Crowe, A. M. (2005): The SCAR-3 study: 5-year adhesion-related readmission risk Following lower abdominal surgical procedures. In: Colorectal Dis 7 (6), pp 551-558.

[0097] Parker, M. C; Ellis, H.; Moran, B. J.; Thompson, J. N.; Wilson, M. S.; Menzies, D. et al. (2001): Postoperative adhesions: ten-year follow-up of 12,584 patients undergoing lower abdominal surgery. In: Dis Colon Rectum 44 (6), pp 822-830.

[0098] Ray, N. F.; Denton, W. G.; Thamer, M.; Henderson, S. C; Perry, S. (1998): Abdominal adhesiolysis: inpatient care and expenditures in the United States in 1994. J Am Surg Coli 186 (1), pp 1 -9.

[0099] Saed, G. M.; Diamond, M. P. (2004): Molecular characterization of postoperative adhesions: the adhesion phenotype. In: The Journal of the American Association of Gynecologic Laparoscopists 11 (3), pp 307-314.

[0100] SCAR Group (2013): Pathogenesis, consequences, and control of peritoneal adhesions in gynaecologic surgery: a committee opinion. Fertil Steril 99 (6), pp 1550-1555.

[0101] Schnüriger, B.; Barmparas, G.; Branco, B. C; Lustenberger, T.; Inaba, K.; Demetriades, D. (2011): Prevention of postoperative peritoneal adhesions: a review of the literature. The American Journal of Surgery 201 (1), pp 111-121.

[0102] Schlapschy M, Binder U, Börger C, et al. (2013) PASylation: a biological alternative to PEGylation for extending the plasma half-life of pharmaceutically active proteins. Protein Eng Des Sel. 26 (8): 489-501.

[0103] Sikirica, V.; Bapat, B.; Candrilli, S. D.; Davis, K. L; Wilson, M.; Johns, A. (2011): The inpatient burden of abdominal and gynaecological adhesiolysis in the US. BMC Surg 11, p. 13.

[0104] Wallwiener, M.; Koninckx, P. R.; Hackethal, A.; Brömann, H.; Lundorff, P.; Mara, M. et al. (2014): A European survey on awareness of post-surgical adhesions among gynaecological surgeons. In: Surg Gynecol 11 (2), pp 105-112.