Method for Determining the Repair Activity of Non-Homologous End Joining

20170254799 · 2017-09-07

    Inventors

    Cpc classification

    International classification

    Abstract

    The invention discloses a method for determining the repair activity of NHEJ. In this method, HPRT gene is mutated by using a site-directed gene mutation technology, and plasmid transfection, and 6-TG treatment are performed. By means of the method of the invention, the NHEJ repair activity level of cells can be observed by measuring the cell viability. The method can be used for screening the effects of different drugs and different genes on the NHEJ repair activity.

    Claims

    1. A method for determining the repair activity of non-homologous end joining, comprising steps of: (1) constructing a plasmid for HPRT gene by using a TALEN technology or CRISPR/Cas9 technology; (2) treating a mammalian cell combined with the constructed plasmid of the step (1) by an NHEJ inhibitor; (3) culturing the mammalian cell of the step (2) in a culture medium containing 6-thioguanine; and (4) adding a MTT solution into the treated mammalian cell of the step (3), dissolving the formed blue formazan particles and then determining the light absorption value thereof at OD570 nm via a microplate reader.

    2. The method as claimed in claim 1, wherein in the step (1) when the plasmid for the HPRT gene is constructed using the TALEN technology, a left-arm recognition sequence of the target gene is shown in SEQ ID NO:1, and a right-arm recognition sequence of the target gene is shown in SEQ ID NO:2.

    3. The method as claimed in claim 1, wherein in the step (1) when the plasmid for the HPRT gene is constructed using the CRISPR/Cas9 technology, a forward primer sequence is shown in SEQ ID NO:3, and a reverse primer sequence is shown in SEQ ID NO:4.

    4. The method as claimed in claim 1, wherein the mammalian cell of the step (2) is a 293T cell, the NHEJ inhibitor is NU7441 or DNA-PKcs siRNA, and the gene sequence of the DNA-PKcs siRNA being as shown in SEQ ID NO:5.

    5. The method as claimed in claim 4, wherein the step (2) comprises transfecting the constructed plasmid of the step (1) into the 293T cell, and treating the transfected 293T cell with the NHEJ inhibitor NU7441.

    6. The method as claimed in claim 5, wherein the plasmid transfection in the step (2) comprises inoculating the 293T cell in a culture dish, and transfecting the constructed plasmid of the step (1) into the 293T cell by using Lipofectamine 3000 as a transfection reagent when the cell density reaches 70%.

    7. The method as claimed in claim 4, wherein the step (2) comprises co-transfecting the constructed plasmid of the step (1) and the DNA-PKcs siRNA into the 293T cell.

    8. The method as claimed in claim 7, wherein the co-transfection of the step (2) comprises inoculating the 293T cell in a culture dish, and co-transfecting the constructed plasmid of the step (1) and DNA-PKcs siRNA into the 293T cell by using Lipofectamine 3000 as a transfection reagent when the cell density reaches 70%.

    Description

    BRIEF DESCRIPTION OF THE DRAWINGS

    [0025] FIG. 1 is a schematic drawing illustrating the method for determining the NHEJ activity according to the invention;

    [0026] FIG. 2 shows the effects of different concentrations of NU7441 on the NHEJ repair activity according to the invention;

    [0027] FIG. 3 shows the effects of 2.0 μmol/L NU7441 on the NHEJ repair activity for different treatment time according to the invention; and

    [0028] FIG. 4 shows the effects of DNA-PKcs siRNA transfection on the NHEJ repair activity.

    DESCRIPTION OF THE PREFERRED EMBODIMENTS

    [0029] The invention will be further illustrated in more detail with reference to accompanying drawings. It is noted that, the following embodiments only are intended for purposes of illustration and are not intended to limit the scope of the invention. In the following specific embodiments, the TALEN construction kit is available from SidanSai Biotechnology Co., Ltd., the CRISPR/Cas9 construction kit is available from Viewsolid Biotech Co. Ltd., the NHEJ inhibitor NU7441 is available from Selleck Co., Ltd., the DNA-PKcs siRNA is synthesized by GenePharma Co., Ltd. The primer is synthesized by Shanghai Branch Office of Invitrogen and is prepared into 10 μmol/L with distilled water. The transfecting reagent Lipofectamine 3000 is available from the Shanghai Branch Office of Invitrogen. MTT is available from Shanghai Sangon Biological Engineering Co., Ltd.

    Embodiment 1

    [0030] The inhibiting effects of different concentrations of NU7441 on NHEJ are determined by using the TALEN technology, and the specific steps are as follows:

    [0031] (1) a TALEN plasmid for HPRT gene was constructed. The specific steps comprise: a left-arm recognition sequence ATGACCTTGATTTA (SEQ ID NO:1) and a right-arm recognition sequence CCAAATCCTCAGCA (SEQ ID NO:2) of the target HPRT gene were designed according to the TALEN design principle, and the two recognition sequences were inserted into a corresponding backbone carrier according to the method indicated on the TALEN construction kit. Competent E. coli cells were transformed with the carrier, uniformly spread on a kanamycin-resistant (20 μg/ml) plate and cultured in an incubator at 37° C. for 12-16 h, then 3-5 clones were selected and inoculated in 5 ml LB culture solution (containing 20 μg/ml kanamycin), and cultured in a shaker at 250 rpm under 37° C. for 16 h, plasmids were extracted and sequenced, and the obtained sequences were compared with the designed recognition sequences, ensuring the left-arm and right-arm TALEN plasmids with correct sequences were obtained.

    [0032] (2) the left-arm and right-arm TALEN plasmids were transfected into 293T cells. The specific steps comprise: 293T cells were inoculated into a culture dish of 6 cm, and 4 μg left-arm plasmids and 4 μg right-arm plasmids were transfected into the 293T cells by using Lipofectamine 3000 when cell density reached 70%.

    [0033] (3) the 293T cells were treated with different concentrations of the inhibitor NU7441. The specific steps comprise: the cells were inoculated into a 96-well plate after the TALEN plasmids were transfected into the cells for 24 h, and then the cells were treated with 0, 0.1, 0.5, 1.0 and 2.0 μmol/L NU7441 for 4 h respectively after cell attachment.

    [0034] (4) the cells were treated with 6-TG. The specific steps comprise: the 293T cells were cultured in a DMEM culture medium containing 30 μmol/L 6-TG for 72 h after the NU7441 treatment.

    [0035] (5) cell viability was determined by a MTT method. The specific steps comprise: a MTT solution was added after the treatment was completed, 2 h later, the formed blue formazan particles were dissolved with DMSO, and then the light absorption value of each well was determined at OD570 nm via a microplate reader. The cell viability reflects the repair activity of NHEJ, and for the blank control group the NHEJ activity was set as 100%.

    [0036] The experimental result is shown in FIG. 2. For the 293T cells, when the cells were treated with 0.5, 1.0 μmol/L NU7441 for 4 h, the inhibiting effect on the NHEJ repair activity was optimal, and the inhibition rate was about 50%. When the concentration of NU7441 was increased to 2.0 μmol/L, the inhibiting effect was reduced.

    Embodiment 2

    [0037] The time dependence of the inhibiting effect of 2.0 μmol/L NU7441 on NHEJ was determined by using the CRISPR/Cas9 technology, specific steps were as follows:

    [0038] (1) a Cas9/gRNA plasmid was constructed for HPRT gene. The specific steps comprise: a target site primer of HPRT was designed according to a gRNA design principle, wherein the forward primer is AAACACCGAAAGGGTGTTTATTCCTCA (SEQ ID NO:3), and the reverse primer is CTCTAAAACTGAGGAATAAACACCCTTT (SEQ ID NO:4). The primers were annealed to form a dimer, and the gRNA-sequence primer dimer was inserted into a Cas9/gRNA plasmid according to the method indicated on the CRISPR/Cas9 construction kit. Competent E. coli cells were transformed with the plasmid, spread on an ampicillin-resistant plate. 3-5 clones were selected and cultured in a shaker, plasmids were extracted and sequenced, and the obtained sequences were compared with the designed recognition sequences, ensuring the Cas9/gRNA plasmids with correct sequences were obtained.

    [0039] (2) the Cas9/gRNA plasmids were transfected into 293T cells. The specific steps comprise: 293T cells were inoculated into a 6 cm culture dish, and 5 μg Cas9/gRNA plasmid was transfected into the 293T cells by using Lipofectamine 3000 when cell density reached 70%.

    [0040] (3) the 293T cells were treated with 2.0 μmol/L NU7441. The specific steps comprise: the cells were inoculated into a 96-well plate after the Cas9/gRNA plasmid was transfected into the cells for 24 h, and then the cells were treated with 2.0 μmol/L NU7441 for 0, 0.5, 1, 2 and 4 h respectively after cell attachment.

    [0041] (4) the cells were treated with 6-TG. The specific steps comprise: the 293T cells were cultured in a DMEM culture medium containing 30 μmol/L 6-TG for 72 h after the NU7441 treatment.

    [0042] (5) cell viability was determined by a MTT method. The specific steps comprise: a MTT solution was added after the treatment was completed, 2 h later, the formed blue formazan particles were dissolved with DMSO, and then the light absorption value of each well was determined at OD570 nm via a microplate reader. The cell viability reflects the repair activity of NHEJ, and for the blank control group the NHEJ activity was set as 100%.

    [0043] The experimental result is shown in FIG. 3. For the 293T cells, when the cells were treated with 2.0 μmol/L NU7441 for 1 h, the inhibiting effect on the NHEJ repair activity is optimal, and the inhibition rate was about 50%, and then the inhibiting effect on the NHEJ activity is reduced over time.

    Embodiment 3

    [0044] The inhibiting effect of DNA-PKcs siRNA on NHEJ was determined by using a CRISPR/Cas9 technology, and the specific steps comprise:

    [0045] (1) a Cas9/gRNA plasmid was constructed for HPRT gene, and the specific steps are as described in the embodiment 2.

    [0046] (2) the Cas9/gRNA plasmid and DNA-PKcs siRNA were co-transfected into 293T cells. The specific steps comprise: 293T cells were inoculated into a culture dish of 6 cm, and 3 μg Cas9/gRNA plasmid and 3 μg DNA-PKcs siRNA were co-transfected into the 293T cells by using Lipofectamine 3000 when cell density reached 70%, and a negative control siRNA was transfected for the negative control group. The gene sequence of DNA-PKcs siRNA was UUCUCCGAACGUGUCACGUTT (SEQ ID NO:5).

    [0047] (3) the cells were treated with 6-TG. The specific steps comprise: the cells were inoculated into a 96-well plate after the transfection is performed for 24 h, then the culture medium was replaced with a DMEM culture medium containing 30 μmol/L 6-TG after cell attachment, and the cells were continually cultured for 72 h.

    [0048] (4) cell viability was determined by a MTT method. The specific steps comprise: a MTT solution was added after the treatment was completed, 2 h later, the formed blue formazan particles were dissolved with DMSO, and then the light absorption value of each well was determined at OD570 nm via a microplate reader. The cell viability reflects the repair activity of NHEJ, and for the control group the NHEJ activity was set as 100%.

    [0049] The experimental result is shown in FIG. 4. It is indicated that after the expression of the DNA-PKcs was reduced by siRNA transfection, the repair activity of NHEJ was inhibited significantly in the 293T cells.

    [0050] In conclusion, by means of the method of the invention, the repair activity level of NHEJ of cells can be observed by measuring the cell viability. In such a method, HPRT gene is mutated by using a site-directed gene mutation technology, and plasmid transfection, and 6-TG treatment are performed. The method of the invention can be used for screening chemical NHEJ inhibitors and genes involved in mediating NHEJ activity.

    [0051] The above preferred embodiments are described for illustration only, and are not intended to limit the scope of the invention. It should be understood, for a person skilled in the art, that various improvements or variations can be made therein without departing from the spirit and scope of the invention, and these improvements or variations should be covered within the protecting scope of the invention.