ANTITUMOR IMMUNITY ENHANCING COMPOSITION CONTAINING ADENOVIRUS SIMULTANEOUSLY EXPRESSING IL-12 AND SHVEGF

Abstract

An oncolytic adenovirus co-expressing interleukin (IL-12) and shVEGF and a composition for enhancing an anticancer effect are disclosed. The inventors confirmed that, when VEGF suppression and IL-12 expression are co-expressed in immunocompetent murine melanoma or kidney cancer models, an immune function is restored and an anticancer effect is improved. Particularly, it has been revealed that such an improved anticancer effect is associated with an increase in anticancer immunity, an increase in Thl cytokines and prevention of tumor-induced thymic atrophy, and therefore the applicability of a gene delivery system co-expressing IL-12 and shVEGF to cancer gene therapy was identified for the first time.

Claims

1. A recombinant oncolytic adenovirus comprising: an interleukin-12 (IL-12) gene, a small hairpin RNA (shRNA) gene which is complementary to VEGF mRNA, and suppresses VEGF gene expression, and a promoter operably linked to the IL-12 gene and the shRNA gene wherein the recombinant oncolytic adenovirus comprises an E1A region gene and an E1B 55 gene.

2. The recombinant adenovirus of claim 1, wherein the IL-12 and shRNA genes are inserted into E1 and F3 regions of the adenovirus, respectively.

3. The recombinant adenovirus of claim 1, wherein the IL-12 gene includes an IL-12A (p35) gene sequence, an internal ribosome entry site (IRES) sequence and an IL-12B (p40) gene sequence.

4. A method for treating cancer in a subject in need thereof, comprising: administering an effective amount of a composition comprising (a) a recombinant oncolytic adenovirus; and (b) a pharmaceutically acceptable carrier, to the subject, wherein the recombinant oncolytic adenovirus comprises: an interleukin-12 (IL-12) gene, a small hairpin RNA (shRNA) gene which is complementary to VEGF mRNA, and suppresses VEGF gene expression, and a promoter operably linked to the IL-12 gene and the shRNA gene wherein the recombinant oncolytic adenovirus comprises an E1A region gene and an E1B 55 gene.

5. The method for treating cancer of claim 4, wherein the IL-12 and shRNA genes are inserted into E1 and E3 regions of the adenovirus, respectively.

6. The method for treating cancer of claim 4, wherein the IL-12 gene includes an IL-12A (p35) gene sequence, an internal ribosome entry site (IRES) sequence and an IL-12B (p40) gene sequence.

7. The method for treating cancer of claim 4, wherein the cancer is gastric cancer, lung cancer, breast cancer, ovarian cancer, liver cancer, bronchial cancer, nasopharyngeal cancer, laryngeal cancer, pancreatic cancer, bladder cancer, colorectal cancer, colon cancer, cervical cancer, brain cancer, prostate cancer, bone cancer, head and neck cancer, skin cancer, kidney cancer, polyploid carcinoma, thyroid cancer, parathyroid cancer or ureter cancer.

8. A method for treating tumor-induced thymic atrophy in a subject in need thereof, comprising: administering an effective amount of a composition comprising (a) a recombinant oncolytic adenovirus; and (b) a pharmaceutically acceptable carrier to the subject, wherein the recombinant oncolytic adenovirus comprises: an interleukin-12 (IL-12) gene, a small hairpin RNA (shRNA) gene which is complementary to VEGF mRNA, and suppresses VEGF gene expression, and a promoter operably linked to the 11-12 gene and the shRNA gene wherein the recombinant oncolytic adenovirus comprises an E1A region gene and an E1B 55 gene.

9. The method for treating tumor-induced thymic atrophy of claim 8, wherein the IL-12 and shRNA genes are inserted into E1 and E3 regions of the adenovirus respectively.

10. The method for treating tumor-induced thymic atrophy of claim 8, wherein the IL-12 gene includes an IL-12A (p35) gene sequence, an internal ribosome entry site (IRES) sequence and an IL12B (p40) gene sequence.

Description

DESCRIPTION OF DRAWINGS

[0043] FIGS. 1A to 1E show the characteristics of oncolytic adenoviruses co-expressing IL-12 and VEGF shRNA. FIG. 1A shows schematic diagrams of genomic structures of adenovirus RdB and RdB/IL12/shVEGF. RdB includes mutated E1A (open star—a mutant of Rb protein-binding site), E1B 19, 55 kDa (ΔE1B) and E3 (ΔE3) regions are deleted; murine IL-12 and murine shVEGF were inserted into the E1 and E3 regions of the adenovirus genome. B16-F10 cells were infected with RdB, RdB/IL12, RdB/shVEGF or RdB/IL12/shVEGF, and IL-12 (FIG. 1B) and VEGF (FIG. 1C) expression levels were detected. Forty eight hours after infection, a cell culture supernatant was collected, and IL-12 and VEGF levels were quantified using an ELISA kit. Referring to FIG. 1D, by the same method as described above, IL-12 levels according to MOIs (5, 10, 20, 50 MOI) were quantified. FIG. 1E represents the cytopathic effects of the oncolytic adenovirus expressing IL-12 and/or shVEGF in murine cancer cell lines (BNL, B16-F10, LLC and CMT-93) and a human cancer cell line (U87MG). Data of triplicate experiments is expressed as the mean f standard deviation (SD), and similar results were obtained from at least three independent experiments. MOI, multiplicity of infection. 1. PBS 2. RdB 3. RdB/IL12 4. RdB/shVEGF 5. RdB/IL12/shVEGF.

[0044] FIGS. 2A to 2C show the anticancer effects of adenoviruses in cancer-bearing mice. FIGS. 2A and 2B show the anticancer effects in melanoma mice treated with PBS (open diamonds), RdB (open circles), RdB/shVEGF (open triangles), RdB/IL12 (filled diamonds) or RdB/IL12/shVEGF (filled circles), and FIG. 2A to 2C show the anticancer effect in kidney cancer mice treated with PBS (open diamonds), RdB/IL12 (filled diamonds) or RdB/IL12/shVEGF (filled circles). Adenoviruses at a dose of 3×10.sup.9 VP (FIG. 2A; initial tumor volume: 80-100 mm.sup.3) or 6×10.sup.8 VP; and RdB/IL12 and RdB/IL12/shVEGF (FIG. 2B; initial tumor volume: 80-100 mm.sup.3, FIG. 2C; initial tumor volume: 100 mm.sup.3) adenoviruses were administered into tumors of C57BL/6 mice on day 1, day 3 and day 5. Tumor volume was monitored and recorded every day until the end of the study. Arrows represent injection time of adenoviruses. Values is expressed as the mean±SD (n=8). **, P<0.01.

[0045] FIGS. 3A to 3C show in vivo intratumoral expression levels of IL-12, VEGF and IFN-γ. Seven days after initial viral injection, tumor tissues were collected, and IL-12 (FIG. 3A), VEGF (FIG. 3B) and IFN-γ (FIG. 3C) levels were measured by ELISA. Experiments were repeated three times, and data is expressed as the mean±SD. *, P<0.05 or **, P<0.01; 1. PBS 2. RdB 3. RdB/shVEGF 4. RdB/IL12 5. RdB/IL12/shVEGF.

[0046] FIGS. 4A to 4C show that Th1/Th2 cytokine ratios were increased in splenocyte and B16-F10 co-cultured supernatants. On day 7 after the final viral injection, splenocytes were collected and cultured for 3 days with irradiated B16-F10 cancer cells in the presence of recombinant human IL-2. Th1/Th2/Th17 CBA was analyzed to measure the Th1/Th2 cytokine ratios of the supernatants. (FIG. 4A) IFN-γ value, (FIG. 4B) IL-6 value (FIG. 4C) IFN-γ/IL-6 ratios. After triplicate experiments, data is expressed as the mean±SD. ** P<0.01; 1. PBS 2. RdB 3. RdB/shVEGF 4. RdB/IL12 5. RdB/IL12/shVEGF.

[0047] FIG. 5 shows the result of measuring tumor-specific immunity. On day 7 after the final viral injection, splenocytes were collected from mice treated with PBS-, RdB- or cytokine-expressing adenoviruses, and cultured for 3 days with irradiated B16-F10 cells. Subsequently, the IFN-γ ELISPOT assay was carried out, and the number of spots was measured at a concentration of 1×10.sup.5 IFN-γ ELISPOT. After triplicate experiments, each value is expressed as the mean spot number±SD. **, P<0.01; 1. PBS 2. RdB 3. RdB/shVEGF 4. RdB/IL12 5. RdB/IL12/shVEGF.

[0048] FIGS. 6A to 6E show the results of histological and immunohistochemical analyses for murine tumor fragments treated with adenoviruses. Adenoviruses were treated on days 1, 3 and 5, and tumors were collected on day 12, followed by histological analysis. FIG. 6A shows cryosections of tumor tissue were subjected to H&E staining. Magnification: 40× and 400×. FIG. 6B shows that cryosections of tumor tissue were stained with an anti-CD4 or anti-CD8 monoclonal antibody. Magnification: 400×. FIG. 6C shows increases in CD4+ T and CD8+ T expression that were semi-quantitatively measured using METAMORPH® image analysis software (**p<0.01). FIG. 6D shows cryosections of tumor tissue that were stained with anti-CD11c, anti-CD86 monoclonal antibodies, and DAPI. Magnification: 400×. FIG. 6E shows cryosections of tumor tissue that were stained with an anti-NK1.1 monoclonal antibody and DAPI. Magnification: 400×. 1. PBS 2. RdB 3. RdB/shVEGF 4. RdB/IL12 5. RdB/IL12/shVEGF.

[0049] FIGS. 7A to 7G show the effect of preventing thymic atrophy of the RdB/IL12/shVEGF adenovirus. FIG. 7A shows images of the entire thymus of mice treated with PBS, RdB, RdB/IL12, RdB/shVEGF or RdB/IL12/shVEGF. FIG. 7B shows the weight of thymuses in mice treated with oncolytic adenoviruses. Data is expressed as the mean±SD (* P<0.05, ** P<0.01). FIG. 7C shows sections from paraffin blocks that were stained with H&E. FIG. 7D shows the apoptosis in thymus tissue that was detected by TUNEL assay. FIG. 7E. shows the degree of proliferation of thymocytes as evaluated by proliferating cell nuclear antigen staining. FIGS. 7F and 7G show the results of FIGS. 7D and 7E that were semi-quantitatively measured using METAMORPH® image analysis software (**p<0.01). 1. PBS 2. RdB 3. RdB/shVEGF 4. RdB/IL12 5. RdB/IL12/shVEGF.

FIGS. 8A and 8B show the results obtained by ELISA assay following isolation of murine sera to confirm contents of IL-12 and IFN-γ remaining in mice on day 7 after final treatment of the mice with recombinant adenoviruses. FIG. 7A shows IL-12 contents in murine serum treated with PBS, RdB, RdB/shVEGF, RdB/IL12 or RdB/IL12/shVEGF. FIG. 7B shows IFN-γ contents in murine serum treated with PBS, RdB, RdB/shVEGF, RdB/IL12, or RdB/IL12/shVEGF.

MODES OF THE INVENTION

[0050] Hereinafter, the present invention will be described in further detail with respect to examples. These examples are only provided to more fully describe the present invention, and it is obvious to those of ordinary skill in the art that the scope of the present invention is not limited to these examples according to the scope of the present invention.

EXAMPLES

[0051] Experimental Materials and Experimental Methods

[0052] (1) Cell Lines and Cell Culture

[0053] Dulbecco's modified Eagle's medium (DMEM; Gibco BRL, Grand Island, N.Y.) or Roswell Park Memorial Institute medium (RPMI; Gibco BRL), supplemented with 10% fetal bovine serum (FBS; Gibco BRL), L-glutamine (2 mmol/L), penicillin (100 IU/mL), and streptomycin (50 mg/mL), was used as a cell culture medium. HEK293 (human embryonic kidney cell line expressing an adenovirus E1 region), U87MG (human glioma cell line), BNL (murine liver cancer cell line), B16-F10 (murine melanoma cell line), LLC (murine lung cancer cell line), CMT-93 (murine polyploid carcinoma cell line), and Renca (murine renal adenocarcinoma cell line) were purchased from the American Type Culture Collection (ATCC; Manassas, Va.). All cell lines were cultured at 37° C. in a 5% CO.sub.2 humid environment, and subjected to a mycoplasma negative test using Hoeschst dye, cell culture and polymerase chain reaction (PCR). Escherichia coli was cultured at 37° C. in Luria Bertani medium.

[0054] (2) Animal Tests

[0055] Six- to eight-week-old male C57BL/6 mice were purchased from Charles River Laboratories International, Inc. (Wilmington, Mass.), and maintained in a laminar air-flow cabinet under a pathogen-free condition. All tests were approved by the Association for Assessment and Accreditation of Laboratory Animal Care (AAALAC), and conducted according to the guidelines established by the Hanyang University Institutional Animal Care and Use Committee.

[0056] (3) Manufacture of Oncolytic Adenovirus Co-Expressing IL-12 and shVEGF

[0057] To manufacture adenoviruses co-expressing IL-12 and shVEGF in E1 and E3 regions, first, a shVEGF-expressing E3 shuttle vector was constructed. Full-length murine shVEGF complementary DNA was cloned by RT-PCR using total RNA obtained from bone marrow-derived active dendritic cells.

[0058] shVEGF complementary DNA (nucleotides 53-982 of National Center for Biotechnology Information L15435) was manufactured using the following primer set: sense primer (5′-gatcccggaaggagagcagaagtcccatgttcaagagacatgggacttctgctctcctt tttttttggaaa-3′ (SEQ ID NO: 4)), antisense primer (5′-tttccaaaaaaa aaggagagcagaagtcccatgtctcttgaacatgggacttctgctctccttccgggatc-3′ (SEQ ID NO: 5)). The PCR product was digested with BamHI/HindIII, and cloned in a BamHI/HindIII-treated pSP72 E3/CMV-poly A adenovirus E3 shuttle vector [29], thereby manufacturing a pSP72 E3/shVEGF E3 shuttle vector. For homologous recombination, the pSP72 E3/shVEGF was co-transfected with an adenovirus total vector pdE1 into Escherichia coli BJ5183, thereby manufacturing a pdE1/shVEGF adenovirus plasmid. The structure of the recombinant vector was confirmed by treatment of restriction enzymes and PCR analysis.

[0059] To construct an adenovirus E1 shuttle vector expressing IL-12, a murine IL-12 gene was cut out from pCA14/IL12 [30] and subcloned in a pXC1RdB E1 shuttle vector [23], thereby manufacturing a pXC1RdB/IL12 E1 shuttle vector. For homologous recombination, the pXC1RdB/IL12 E1 shuttle vector and pdE1/shVEGF were co-transfected into Escherichia coli BJ5183, thereby manufacturing a pRdB/IL12/shVEGF adenovirus vector (FIG. 1A).

[0060] All viruses were produced using HEK293 cells, and purification, titration and quality analysis of the adenoviruses were carried out as described in the prior art [31, 32].

[0061] (4) Enzyme-Linked Immunosorbent Assay for IL-12 and VEGF Expression

[0062] After 3×10.sup.5 B16-F10 melanoma cells were inoculated into a 6-well plate, and infected with 50 MOI of RdB, RdB/IL12, RdB/shVEGF, or RdB/IL12/shVEGF adenoviruses. Forty eight hours after the infection, a supernatant was collected, and subjected to measurement of IL-12 and shVEGF expression levels using an ELISA kit (IL-12 ELISA kit: Endogen, Woburn, Mass.; VEGF ELISA kit: R&D Systems, Minneapolis, Minn.).

[0063] (5) Cytopathic Effect Assay

[0064] Cytopathic effect values are associated with a degree of virus replication, and able to be used to measure whether IL-12 and shVEGF expression affects the replicability of adenoviruses. Cells were inoculated into a 24-well plate to reach 30 to 80% confluence, and infected with 1-500 MOI of RdB, RdB/IL12, RdB/shVEGF or RdB/IL12/shVEGF adenoviruses. An apoptotic effect of viruses was visually monitored using a microscope. When virus-infected cells were completely dissolved at low MOI, dead cells were removed, and stained with 0.5% crystal violet in 50% methanol.

[0065] (6) In Vivo Antitumor Effect

[0066] B16-F10 cells (5×10.sup.5) or RENCA cells were injected subcutaneously into the right abdomen of 6- to 7-week-old male C57BL/6 mice. When the tumor volume reached approximately 100 mm.sup.3, the mice were divided into groups with similar tumor sizes, different doses of a total volume of 50 μl PBS-diluted adenoviruses (RdB or RdB/shVEGF at 3×10.sup.9 VP; RdB/IL-12 or RdB/IL-12/shVEGF at 6×10.sup.8 VP) were administered intratumorally three times every other day. Tumor growth was monitored everyday by measuring a perpendicular tumor diameter using a caliper. Tumor volume was calculated using the following formula: volume=0.523L(W).sup.2, in which L is a length and W is a width.

[0067] (7) Cytokine Quantification and Th1/Th2/Th17 Profiles in Tumor Tissue

[0068] Seven days after the final viral injection, tumor tissues were collected from an adenovirus-treated mouse group. The tumor tissues were homogenized in RIPA buffer (Elipis Biotech, Taejeon, South Korea) to which a proteinase inhibitor cocktail (Sigma, St. Louis, Mo.) was added. Following high speed centrifugation of the homogenate for 10 minutes, a total protein level was measured using a BSA ELISA kit (Pierce, Rockford, Ill.). Levels of IL-12, VEGF, and IFN-γ were measured by ELISA kits (IL-12 ELISA kit: Endogen; VEGF ELISA kit: R&D; IFN-γ ELISA kit: Endogen). Each experiment was conducted three times by group. Th1/Th2/Th17 type cytokine expression profiles in the tumor tissues were measured using a Th1/Th2/Th17 CBA kit (BD Biosciences Pharmingen, San Diego, Calif.). ELISA and CBA results were normalized with respect to a total protein concentration, and the results are shown as “pg/total protein (mg)” values.

[0069] (8) IFN-γ Enzyme-Linked Immune Spot (ELISPOT) Assay in Splenocytes

[0070] On day 7 after the final viral injection, spleens were collected aseptically from mice, and unicellular splenocytes were prepared [30]. The splenocytes were cultured with irradiated B16-F10 (5,000 rad) tumor cells for 3 days in the presence of recombinant human IL-2 (100 Uml-1; R&D Systems). Subsequently, IFN-γELISPOT assay was carried out [30]. Spots were measured using a computer-based immunospot system (AID Elispot Reader System, version 3.4; Autoimmun Diagnostika GmbH, Strassberg, Germany).

[0071] (9) Histological and Immunohistochemical Analyses

[0072] Tumor tissues or thymus were fixed in 10% neutral buffered formalin, and a paraffin block was manufactured and then cut into 4-mm sections. The sections were stained with H&E, and observed using an optical microscope. To detect lymphocytes and dendritic cells, tumor tissues were frozen in an OCT compound (Sakura Finetec, Torrance, Calif.), and cut into 10-mm sections. The cryosections were reacted with rat anti-mouse CD4 monoclonal antibody (BD Biosciences Pharmingen), rat anti-mouse CD8 monoclonal antibody (BD Biosciences Pharmingen), mouse anti-mouse NK-1.1 monoclonal antibody (Biolegend, San Diego, Calif.), or rat anti-mouse CD86 monoclonal antibody (BD Biosciences Pharmingen) as a primary antibody, and reacted with horseradish peroxidase-conjugated goat anti-rat IgG (BD Biosciences Pharmingen) or horseradish peroxidase-conjugated goat anti-mouse IgG (Southern Biotech, Birmingham, Ala.) as a secondary antibody. Diaminobenzidine/hydrogen peroxidase (DAKO, Copenhagen, Denmark) was used as a chromogenic substrate. All sides were counterstained with Meyer's hematoxylin. To detect proliferated cells, the slide was deparaffinated with xylene, and dehydrated by treatment of an alcohol. Intrinsic peroxidase activity was inhibited using 3% hydrogen peroxide. An anti-proliferating cell nuclear antigen monoclonal antibody PC10 (DAKO) was bound to the secondary antibody Real/Envision (DAKO). A mouse serum was added to the complex of the first and second antibodies to minimize the interaction between isolated second antibodies and murine immunoglobulins found in the tissue sections. Subsequently, the sections were reacted with a complex of the first antibody and the second antibody, followed by the reaction with streptavidin-peroxidase. Diaminobenzidine/hydrogen peroxidase was used as a chromogenic substrate. Expression levels of CD4, CD8, NK-1.1, CD86, and PCNA were semi-quantitatively analyzed using METAMORPH® image analysis software (Universal Image Corp., Buckinghamshire, UK). Results were expressed as the mean optical density of five different digital images.

[0073] (10) Extraction of Thymuses

[0074] B16-F10 murine melanoma cells were suspended in a 100 ml Hank's balanced salt solution, and then injected into the abdomen of 6- to 8-week-old male C57BL/6 mice. When the volume of the tumor reached 80 to 100 mm.sup.3 (8-10 days after cell implantation), the mice were treated with adenoviruses (RdB or RdB/shVEGF at 1×10.sup.10 VP/tumor cell-suspended PBS at 50 μl; RdB/IL-12 or RdB/IL-12/shVEGF at 5×10.sup.9 VP/tumor cell-suspended PBS at 50 μl) every other day for three times. On day 7 after the final viral injection, all thymus tissues were extracted and immediately added to RPMI 1640 medium, and each thymus was weighed using an electronic scale (Ohaus Corp., Florham Park, N.J.).

[0075] (11) Terminal Deoxynucleotidyl Transferase dUTP Nick End Labeling (TUNEL) Assay

[0076] An apoptotic thymocyte population was observed by TUNEL assay [33]. The apoptotic cells were visually identified in five randomly selected regions, and photographed at magnifications of 100× and 400×. The expression level of the apoptotic thymocytes was semi-quantitatively analyzed using METAMORPH® image analysis software. Results are expressed as the mean optical density of five different digital images.

[0077] (12) Statistical Analysis

[0078] All data is expressed as the mean±SD. Statistical comparisons were made using Stat View software (Abacus Concepts, Inc., Berkeley, Calif.) and the Mann-Whitney test (non-parametric rank sum test). P values less than 0.05 were considered statistically significant (*, P<0.05; **, P<0.01).

[0079] Experimental Results

[0080] (1) Oncolytic Adenovirus-Mediated IL-12 and shVEGF Expression

[0081] To generate oncolytic adenoviruses effectively inhibiting the expression of long-term VEGF, an oncolytic adenovirus co-expressing IL-12 and shVEGF was manufactured by inserting murine IL-12 (p35, IRES, and p40) and shVEGF genes into the E1 and E3 regions of the adenovirus (RdB) [23] (FIG. 1A). In RdB/IL12/shVEGF, the level of IL-12 expression was measured, and to examine whether VEGF-specific shRNA inhibits VEGF expression, B16-F10 melanoma cells were infected with the adenoviruses at a multiplicity of infection (MOI) of 50 using RdB, RdB/IL12, RdB/shVEGF, or RdB/IL12/shVEGF. 48 hours after infection, the IL-12 or VEGF level in a supernatant was measured by ELISA. As shown in FIGS. 1B and 1C, the level of IL-12 secreted from cells infected with 50 MOI of RdB/IL12/shVEGF was 181.4±10.0 pg/mL, but was hardly detected in RdB- or RdB/shVEGF-infected cells, and only detected at 35.6±4.0 pg/mL in RdB/IL12-infected cells. In addition, the level of VEGF expression in RdB/IL12/shVEGF (MOI of 50)-infected cells was 338.0±6.1 pg/mL, and 552.1±10.3 pg/mL, 431.1±11.2 pg/mL, and 384.6±19.4 pg/mL in RdB-, RdB/IL12-, and RdB/shVEGF-infected cells, respectively. Such results, compared with RdB/IL12 or RdB/shVEGF, show that RdB/IL12/shVEGF was increased IL-12 secretion 5-fold, and decreased VEGF secretion 1.2-fold. In addition, as a result of measuring changes in IL-12 secretion according to MOIs (5, 10, 20, 50 MOIs), like the above result, a considerable increase in IL-12 secretion in RdB/IL12/shVEGF was dependent on the concentration of the viruses, but IL-12 secretion was hardly detected in RdB- or RdB/shVEGF-infected cells. In the case of RdB/IL12, IL-2 was detected, but there was a considerable difference when RdB/IL12/shVEGF was introduced (FIG. 1D).

[0082] To examine whether IL-12, shVEGF, or IL-12/shVEGF expression affects virus replication and oncolytic ability, in mouse cell lines (BNL, B16-F10, LLC, and CMT-93) with different histological types and a human cell line (U87MG), the ability to induce cytopathic effects of RdB/IL12, RdB/shVEGF, and RdB/IL12/shVEGF was measured. The human U87MG cell line exhibited higher sensitivity to adenovirus infection, than the mouse cells, and the human cell line was used for in vitro experiments. Cells were infected with RdB (oncolytic adenovirus species), RdB/IL12, RdB/shVEGF, or RdB/IL12/shVEGF, and then stained with crystal violet to observe cell lysis. As shown in FIG. 1E, the cytopathic effects of RdB/IL12, RdB/shVEGF, or RdB/IL12/shVEGF were equal or higher than RdB, and the high expression of IL-12 and shVEGF did not reduce the replicability and oncolytic ability of adenoviruses.

[0083] (2) Confirmation of Anticancer Effect in Cancer-Bearing Mouse Models

[0084] When compared with a single-use effect of RdB/IL-12 or RdB/shVEGF, to examine the therapeutic efficacy of RdB/IL12/shVEGF in vivo, first, B16-F10 melanoma in C57BL/6 mice were injected with RdB, RdB/IL12, RdB/shVEGF, or RdB/IL12/shVEGF. When the tumor volume averaged 80 to 100 mm.sup.3, virus treatment was started, and was performed total three times every other day. A PBS solution containing 3×10.sup.9 virus particles (VPs) was treated. Tumors in PBS control mice were rapidly grown to become huge tumors, and the average tumor volume until 5 days after the final treatment was 3,000 mm.sup.3 or more (FIG. 2A). Meanwhile, the RdB-, RdB/IL12-, RdB/shVEGF-, or RdB/IL12/shVEGF-treated group was considerably reduced in tumor volume, and the average tumor volume was 1747.4±127.2 mm.sup.3, 207.7±35.2 mm.sup.3, 1381.2±194.7 mm.sup.3, or 157.3±49.0 mm.sup.3, respectively. The tumor growth inhibition rates, compared with the PBS control, were 40% (RdB), 93% (RdB/IL12), 53% (RdB/shVEGF), and 95% (RdB/IL12/shVEGF). Five of 8 mice in RdB/IL12- and RdB/IL12/shVEGF-treated groups showed complete remission, whereas none of mice in other mouse groups (PBS, RdB, and RdB/shVEGF) showed complete remission. However, all IL-12-expressing adenoviruses (RdB/IL12 and RdB/IL12/shVEGF) showed considerable antitumor effects, whereas there was no considerable difference in the tumor inhibitory effect between RdB/IL12- and RdB/IL12/shVEGF-treated mouse groups. Therefore, the inventors measured the antitumor effects of RdB/IL12 and RdB/IL12/shVEGF at a 5-fold lower dose than the previous experiment using 6×10.sup.8 VP (FIG. 2B). On day 15 after the first administration of 6×10.sup.8 VP, tumors had regrown to a volume of 502.5±128.9 mm.sup.3 in the RdB/IL12-treated group, whereas tumor growth was still inhibited and thus the tumor volume was 106.1±52.9 mm.sup.3 in RdB/IL12/shVEGF treated groups, indicating that, compared with the RdB/IL12 group, there was an excellent tumor inhibitory effect (**, P<0.01). In addition, 6×10.sup.8 VP of RdB, RdB/IL12, RdB/IL12/shVEGF were introduced into RENCA kidney cancer cells of C57BL/6 mice, and their anticancer effects were examined. As described above, it can be seen that the PBS control mice showed the generation of huge tumors due to rapid growth of tumors on about day 7 or 8, and the RdB/IL12/shVEGF-related mouse group also showed a considerably excellent tumor growth inhibitory effect (FIG. 2C), which had a significant difference, when compared to RdB/IL12-treated group (**, P<0.01).

[0085] Such results infer that, in B16-F10 murine melanoma or RENCA kidney cancer models, RdB/IL12/shVEGF has a superior antitumor activity compared to the RdB/IL12 or RdB/shVEGF group.

[0086] (3) Increased Local Expression of IL-12, VEGF, and IFN-γ in Tumor Tissues

[0087] To measure the levels of IL-12 and VEGF produced in RdB/IL12, RdB/shVEGF, or RdB/IL12/shVEGF-treated mice, tumor tissues were harvested 7 days after final viral injection. As shown in FIG. 3A, IL-12 expression was not observed in tumors of PBS-, RdB-, and RdB/shVEGF-treated groups. However, high concentrations of IL-12 were shown in tumors in RdB/IL12 or RdB/IL12/shVEGF-treated groups (36.0±1.0 pg/mL and 43.0±6.0 pg/mL, respectively; *, P<0.05). In addition, PBS, compared with the PBS-, RdB-, or RdB/IL12-treated group (823.2±26.2, 796.3±6.7, and 320.6±8.0 pg/mL, respectively; **, P<0.01), tumors in the RdB/shVEGF- or RdB/IL12/shVEGF-treated group exhibited significantly lower VEGF levels (242.5±22.5 pg/mL and 212.0±15.7 pg/mL, respectively) (FIG. 3B). Such results showed that, compared with when using only an RdB/IL12 or RdB/shVEGF composition, in treatment using a mixed composition, IL-12 expression was further increased and VEGF expression was further decreased.

[0088] IL-12-induced IFN-γ attenuated VEGF levels in vivo [24]. Therefore, the levels of IFN-γ expression in tumor tissues were measured. As shown in FIG. 3C, the RdB/IL12- or RdB/IL12/shVEGF-treated group showed high IFN-γ levels, and particularly, the RdB/IL12/shVEGF-cotreated group showed considerably higher expression levels than the RdB/IL12 only-administered group (21.0±3.0 pg/mL: RdB/IL12, 73.0±1.0 pg/mL: RdB/IL12/shVEGF, **, P<0.01), whereas IFN-γ expression was not detected in the PBS-, RdB-, and RdB/shVEGF-treated groups. That is, tumors in the RdB/IL12/shVEGF-treated group showed considerably higher IL-12 and IFN-γ levels, and a lower VEGF level than other groups.

[0089] (4) Increase in Th1/Th2 Cytokine Ratio

[0090] The shift from 7l to M2 cytokine expression has been reported to be shown in the growth of malignant tumors in various mice and a human, and a correlation between the cytokine level and cancer therapeutic efficacy has also been reported [25, 26]. Therefore, the inventors investigated whether RdB/IL12/shVEGF, which allows Th1 cytokine (e.g., IFN-γ) expression to be considerably increased, could shift a Th2 immune response to a Th1 immune response in splenocytes. Splenocytes of mice were harvested 7 days after final viral injection, and cultured with tumor cells in irradiated B16-F10 mice for 3 days in the presence of recombinant human IL-2. Afterward, the cultured supernatant was analyzed using a Th1/Th2/Th17 cytometric bead assay (CBA) kit. The Th1/Th2 cytokine ratio was calculated from the IFN-γ/IL-6 ratio. As shown in FIGS. 4A to 4C, RdB/IL12/shVEGF-treated splenocytes of B16-F10 mice exhibited the highest IFN-γ/IL-6 ratio among the PBS-, RdB-, RdB/IL12- and RdB/shVEGF-treated groups (**, P<0.01). IL-2, IL-4, IL-10, and IL-17 were not detected. Such results showed that RdB/IL12/shVEGF suppressed Th2 cytokines and increased Th1 cytokines, resulting in deviation of T cell responses in Type 1 pattern.

[0091] (5) Occurrence of Tumor-Specific Immune Responses

[0092] Compared with oncolytic adenoviruses expressing one of IL-12 and shVEGF, RdB/IL12/shVEGF creates a tumor environment advantageous for inducing tumor-specific immune responses. Therefore, the inventors measured the number of immune cells expressing IFN-γ, which is the cytokine secreted from activated T cells, and an in vivo experiment to determine whether RdB/IL12/shVEGF increases antitumor immune responses was carried out. Splenocytes of mice were obtained 7 days after final viral injection, and cultured with tumor cells of irradiated B16-F10 mice for 24 hours in the presence of recombinant human IL-2. Afterward, IFN-γ-secreted immune cells were measured in splenocytes using an IFN-γ ELISPOT kit. As shown in FIG. 5, the frequency of IFN-γ-secreted immune cells in the RdB/IL12/shVEGF-injected mice was considerably higher than cells in the RdB/IL12- or RdB/shVEGF-treated mice. Particularly, the number of IFN-γ-secreted immune cells (27.3±1.1) isolated from 1×10.sup.5 cells of the RdB/IL12/shVEGF-treated group was much higher than those of the PBS-, RdB-, RdB/IL12-, and RdB/IL12/shVEGF-treated groups (0.3±0.5, 1.6±0.5, 9.0±2.0, and 3.3±0.5, **, P<0.01). These results indicate that the RdB/IL12/shVEGF-treated group exhibited higher tumor-specific immune responses than the RdB/IL12 or RdB/shVEGF-treated group.

[0093] (6) Increased Infiltration of CD4+ T Cells, CD8+ T Cells and Dendritic Cells into RdB/IL12/shVEGF-Treated Tumors

[0094] To examine the histological characteristics of tumor tissues shown after RdB/IL12/shVEGF treatment, tumor tissues were stained with hematoxylin and eosin (H&E) for analysis. Histological analysis showed increased tumor necrosis in tumor tissues of the RdB/IL12/shVEGF-administered mice, compared with the RdB/IL12 and RdB/shVEGF-treated groups. However, almost all tumor cells died in the RdB/IL12/shVEGF-treated group. Immune cells infiltrated into the tumor tissues were identified by immunohistochemical analysis using CD4-, CD8-, CD11c, and CD86-specific antibodies. When compared with the RdB/IL12- or RdB/shVEGF-treated group, in the RdB/IL12/shVEGF-treated group, high frequencies of CD4+ T, CD8+ T, CD86, and CD11c were observed in tumors in the central and boundary regions (FIGS. 6A, 6B, 6D, and 6E). The increased CD4+ T and CD8+ T expression was semi-quantitatively measured using MetaMorph® image analysis software (FIG. 6C).

[0095] These results indicated that the co-expression of IL-12 and shVEGF in tumor tissues could induce strong activation and recruitment of T cells as well as dendritic cells. However, IL-12- and shVEGF-single expression are not effective for recruitment of T cells and dendritic cells to tumor tissues. As a result, the strongest anticancer immune responses are shown in tumor tissues due to intratumoral injection of adenoviruses co-expressing IL-12 and shVEGF.

[0096] (7) Prevention of Tumor-Induced Thymic Atrophy by RdB/IL12/shVEGF Treatment

[0097] Thymic atrophy is generally observed in tumor-bearing mice, and induces the suppression of host immunity against a tumor [27, 28]. In addition, even long-term exposure to recombinant VEGF induced thymic atrophy in vivo [21]. As a result, the prevention of thymic atrophy is important in overcoming tumor-induced immunosuppression. Therefore, the inventors measured changes in thymus volume and weight of adenovirus-treated mice. As seen from FIG. 7A, thymic atrophy was not observed in RdB/IL12/shVEGF-treated mice, whereas thymic atrophy was observed in PBS and RdB-treated mice, and on day 7 after final viral injection, the weight of thymuses of tumor-bearing mice was considerably reduced. However, in RdB/IL12- or RdB/shVEGF-treated mouse group, thymic atrophy became a little alleviated, and its effect was insignificant. However, the RdB/IL12/shVEGF-treated mouse group had much heavier thymus weights (FIG. 7B), which were inversely proportional to tumor volumes. Such results indicated that thymic atrophy was induced by tumor growth, and could be prevented by co-expressing IL-12 and shVEGF in tumors.

[0098] Subsequently, to examine a change in thymuses of oncolytic adenovirus-treated mice, histological and immunohistochemical staining was performed on thymic tissues. Normal morphology was observed in the thymic tissues, and this result showed that, on day 7 after final injection of RdB/IL12-, RdB/shVEGF-, and RdB/IL12/shVEGF adenoviruses, the cortex and medulla regions in mice were clearly separated (FIG. 7C). However, it could be seen that the thymic structure in mice was abnormally disrupted on day 7 after final injection of PBS or RdB. TUNEL analysis results showed that, compared with the RdB/IL12-, RdB/shVEGF-, or RdB/IL12/shVEGF-treated mice, abundant apoptosis was observed in thymic tissues in PBS- or RdB-treated mice (FIG. 7D). In addition, it was proven that the RdB/IL12/shVEGF-treated mice showed positive in proliferating cell nuclear antigen (PCNA) staining, indicating active proliferation of thymic cells in thymuses (FIG. 7E). The data were semi-quantitatively measured using METAMORPH® image analysis software (**p<0.01) (FIGS. 7F and 7G). These results indicated that RdB/IL12/shVEGF induces cell proliferation in thymuses and inhibits apoptosis, thereby preventing thymic atrophy in tumor-bearing mice.

[0099] (8) Examination of Systemic Toxicity Using Animal Models

[0100] To examine systemic toxicity caused by treatment of recombinant adenoviruses (PBS, RdB, RdB/shVEGF, RdB/IL12, or RdB/IL12/shVEGF), specifically, 7 days after final treatment of the recombinant adenoviruses, the contents of IL-12 and IFN-γ remaining in mouse serum were quantified using an ELISA kit. As a result, in all sera of the RdB/shVEGF-, RdB/IL12-, or RdB/IL12/shVEGF-treated mice, as well as PBS- or RdB-treated mice, neither IL-12 nor IFN-γ was detected at all, indicating that the recombinant adenoviruses according to the present invention did not cause systemic toxicity.

REFERENCES

[0101] 1. Kavanaugh, D. Y. and D. P. Carbone, Immunologic dysfunction in cancer. Hematol Oncol Clin North Am, 1996. 10(4): p. 927-51. [0102] 2. Reuther, T., et al., Osteoradionecrosis of the jaws as a side effect of radiotherapy of head and neck tumor patients—a report of a thirty-year retrospective review. Int J Oral Maxillofac Surg, 2003. 32(3): p. 289-95. [0103] 3. Lindley, C., et al., Perception of chemotherapy side effects cancer versus noncancer patients. Cancer Pract, 1999. 7(2): p. 59-65. [0104] 4. KruC., T. Greten, and F. Korangy, Immune based therapies in cancer. 2007. [0105] 5. Gabrilovich, D. I., et al., Production of vascular endothelial growth factor by human tumors inhibits the functional maturation of dendritic cells. Nat Med, 1996. 2(10): p. 1096-103. [0106] 6. Dunn, G. P., L. J. Old, and R. D. Schreiber, The immunobiology of cancer immunosurveillance and immunoediting. Immunity, 2004. 21(2): p. 137-48. [0107] 7. Huang, B., et al., Toll-like receptors on tumor cells facilitate evasion of immune surveillance. Cancer Res, 2005. 65(12): p. 5009-14. [0108] 8. Chen, Q., et al., Production of IL-10 by melanoma cells: examination of its role in immunosuppression mediated by melanoma. Int J Cancer, 1994. 56(5): p. 755-60. [0109] 9. Ormandy, L. A., et al., Increased populations of regulatory T cells in peripheral blood of patients with hepatocellular carcinoma. Cancer Res, 2005. 65(6): p. 2457-64. [0110] 10. Zou, W., Regulatory T cells, tumor immunity and immunotherapy. Nat Rev Immunol, 2006. 6(4): p. 295-307. [0111] 11. Kusmartsev, S. and D. I. Gabrilovich, Role of immature myeloid cells in mechanisms of immune evasion in cancer. Cancer Immunol Immunother, 2006. 55(3): p. 237-45. [0112] 12. Aste-Amezaga, M., et al., Cooperation of natural killer cell stimulatory factor/interleukin-12 with other stimuli in the induction of cytokines and cytotoxic cell-associated molecules in human T and NK cells. Cell Immunol, 1994. 156(2): p. 480-92. [0113] 13. Trinchieri, G., Interleukin-12 and the regulation of innate resistance and adaptive immunity. Nat Rev Immunol, 2003. 3(2): p. 133-46. [0114] 14. Robertson, M. J., et al., Interleukin 12 immunotherapy after autologous stem cell transplantation for hematological malignancies. Clin Cancer Res, 2002. 8(11): p. 3383-93. [0115] 15. Younes, A., et al., Phase II clinical trial of interleukin-12 in patients with relapsed and refractory non-Hodgkin's lymphoma and Hodgkin's disease. Clin Cancer Res, 2004. 10(16): p. 5432-8. [0116] 16. Atkins, M. B., et al., Phase I evaluation of intravenous recombinant human interleukin 12 in patients with advanced malignancies. Clin Cancer Res, 1997. 3(3): p. 409-17. [0117] 17. Robertson, M. J., et al., Immunological effects of interleukin 12 administered by bolus intravenous injection to patients with cancer. Clin Cancer Res, 1999. 5(1): p. 9-16. [0118] 18. Haicheur, N., et al., Cytokines and soluble cytokine receptor induction after IL-12 administration in cancer patients. Clin Exp Immunol, 2000. 119(1): p. 28-37. [0119] 19. Portielje, J. E., et al., Repeated administrations of interleukin (IL)-12 are associated with persistently elevated plasma levels of IL-10 and declining IFN-gamma, tumor necrosis factor-alpha, IL-6, and IL-8 responses. Clin Cancer Res, 2003. 9(1): p. 76-83. [0120] 20. Neufeld, G., et al., Vascular endothelial growth factor (VEGF) and its receptors. Faseb j, 1999. 13(1): p. 9-22. [0121] 21. Ohm, J. E., et al., VEGF inhibits T-cell development and may contribute to tumor-induced immune suppression. Blood, 2003. 101(12): p. 4878-86. [0122] 22. Su, J. L., et al., The VEGF-C/Flt-4 axis promotes invasion and metastasis of cancer cells. Cancer Cell, 2006. 9(3): p. 209-23. [0123] 23. Kim, J., et al., E1A- and E1B-Double mutant replicating adenovirus elicits enhanced oncolytic and antitumor effects. Hum Gene Ther, 2007. 18(9): p. 773-86. [0124] 24. Dias, S., R. Boyd, and F. Balkwill, IL-12 regulates VEGF and MMPs in a murine breast cancer model. Int J Cancer, 1998. 78(3): p. 361-5. [0125] 25. Smyth, M. J., et al., Cytokines in cancer immunity and immunotherapy. Immunol Rev, 2004. 202: p. 275-93. [0126] 26. Gadducci, A., et al., Serum tumor markers in the management of ovarian, endometrial and cervical cancer. Biomed Pharmacother, 2004. 58(1): p. 24-38. [0127] 27. Carrio, R. and D. M. Lopez, Impaired thymopoiesis occurring during the thymic involution of tumor-bearing mice is associated with a down-regulation of the antiapoptotic proteins Bcl-XL and A1. Int J Mol Med, 2009. 23(1): p. 89-98. [0128] 28. Fu, Y., et al., Thymic involution and thymocyte phenotypic alterations induced by murine mammary adenocarcinomas. J Immunol, 1989. 143(12): p. 4300-7. [0129] 29. Yun, C. O., et al., ADP-overexpressing adenovirus elicits enhanced cytopathic effect by induction of apoptosis. Cancer Gene Ther, 2005. 12(1): p. 61-71. [0130] 30. Lee, Y. S., et al., Enhanced antitumor effect of oncolytic adenovirus expressing interleukin-12 and B7-1 in an immunocompetent murine model. Clin Cancer Res, 2006. 12(19): p. 5859-68. [0131] 31. Zhang, S. N., et al., Optimizing DC vaccination by combination with oncolytic adenovirus co-expressing IL-12 and GM-CSF. Mol Ther, 2011. 19(8): p. 1558-68. [0132] 32. Choi, K. J., et al., Strengthening of antitumor immune memory and prevention of thymic atrophy mediated by adenovirus expressing IL-12 and GM-CSF. Gene Ther, 2012. 19(7): p. 711-23. [0133] 33. Yoo, J. Y., et al., Short hairpin RNA-expressing oncolytic adenovirus-mediated inhibition of IL-8: effects on antiangiogenesis and tumor growth inhibition. Gene Ther, 2008. 15(9): p. 635-51.