METHOD FOR TREATING MUSCULAR DYSTROPHY BY TARGETING DMPK GENE
20220233721 · 2022-07-28
Assignee
Inventors
- Eiji YOSHIMI (Chuo-ku, JP)
- Tomoya OE (Chuo-ku, JP)
- Tetsuya Yamagata (Cambridge, MA, US)
- Keith M. Connolly (Cambridge, MA, US)
Cpc classification
C12N2310/20
CHEMISTRY; METALLURGY
A61K31/7088
HUMAN NECESSITIES
A61K48/0058
HUMAN NECESSITIES
A61K31/7105
HUMAN NECESSITIES
A61K38/465
HUMAN NECESSITIES
A61K48/0066
HUMAN NECESSITIES
International classification
A61K48/00
HUMAN NECESSITIES
A61K31/7088
HUMAN NECESSITIES
Abstract
Polynucleotides comprising the following base sequences: (a) a base sequence encoding a fusion protein of a nuclease-deficient CRISPR effector protein and a transcriptional repressor, and (b) a base sequence encoding a guide RNA targeting a continuous region of 18 to 24 nucleotides in length in a region set forth in SEQ ID NO: 127, SEQ ID NO: 46, SEQ ID NO: 128, SEQ ID NO: 129, SEQ ID NO: 130, SEQ ID NO: 131, SEQ ID NO: 132, SEQ ID NO: 88, SEQ ID NO: 91, SEQ ID NO: 133, SEQ ID NO: 137, SEQ ID NO: 117, or SEQ ID NO: 119 in an expression regulatory region of a human DMPK gene, are expected to be useful for treating muscular dystrophy.
Claims
1: A polynucleotide comprising the following base sequences: (a) a base sequence encoding a fusion protein of a nuclease-deficient CRISPR effector protein and a transcriptional repressor, and (b) a base sequence encoding a guide RNA targeting a continuous region of 18 to 24 nucleotides in length in a region set forth in SEQ ID NO: 127, SEQ ID NO: 46, SEQ ID NO: 128, SEQ ID NO: 129, SEQ ID NO: 130, SEQ ID NO: 131, SEQ ID NO: 132, SEQ ID NO: 88, SEQ ID NO: 91, SEQ ID NO: 133, SEQ ID NO: 137, SEQ ID NO: 117, or SEQ ID NO: 119 in the expression regulatory region of human DMPK gene.
2: The polynucleotide according to claim 1, comprising the following base sequences: (a) a base sequence encoding a fusion protein of a nuclease-deficient CRISPR effector protein and a transcriptional repressor, and (b) a base sequence encoding a guide RNA targeting a continuous region of 18 to 24 nucleotides in length in a region set forth in SEQ ID NO: 127, SEQ ID NO: 46, SEQ ID NO: 128, SEQ ID NO: 66, SEQ ID NO: 68, SEQ ID NO: 130, SEQ ID NO: 131, SEQ ID NO: 132, SEQ ID NO: 88, SEQ ID NO: 91, SEQ ID NO: 96, SEQ ID NO: 99, SEQ ID NO: 100, SEQ ID NO: 134, SEQ ID NO: 108, SEQ ID NO: 109, SEQ ID NO: 111, SEQ ID NO: 117, or SEQ ID NO: 119 in the expression regulatory region of human DMPK gene.
3: The polynucleotide according to claim 1, comprising the following base sequences: (a) a base sequence encoding a fusion protein of a nuclease-deficient CRISPR effector protein and a transcriptional repressor, and (b) a base sequence encoding a guide RNA targeting a continuous region of 18 to 24 nucleotides in length in a region set forth in SEQ ID NO: 63, SEQ ID NO: 136, SEQ ID NO: 83, SEQ ID NO: 99, SEQ ID NO: 135, SEQ ID NO: 109, or SEQ ID NO: 111 in the expression regulatory region of human DMPK gene.
4: The polynucleotide according to claim 1, wherein the base sequence encoding the guide RNA comprises the base sequence set forth in SEQ ID NO: 43, SEQ ID NO: 44, SEQ ID NO: 46, SEQ ID NO: 62, SEQ ID NO: 63, SEQ ID NO: 66, SEQ ID NO: 68, SEQ ID NO: 70, SEQ ID NO: 71, SEQ ID NO: 72, SEQ ID NO: 73, SEQ ID NO: 80, SEQ ID NO: 81, SEQ ID NO: 82, SEQ ID NO: 83, SEQ ID NO: 85, SEQ ID NO: 86, SEQ ID NO: 88, SEQ ID NO: 91, SEQ ID NO: 96, SEQ ID NO: 99, SEQ ID NO: 100, SEQ ID NO: 103, SEQ ID NO: 105, SEQ ID NO: 106, SEQ ID NO: 108, SEQ ID NO: 109, SEQ ID NO: 111, SEQ ID NO: 117, or SEQ ID NO: 119, or the base sequence set forth in SEQ ID NO: 43, SEQ ID NO: 44, SEQ ID NO: 46, SEQ ID NO: 62, SEQ ID NO: 63, SEQ ID NO: 66, SEQ ID NO: 68, SEQ ID NO: 70, SEQ ID NO: 71, SEQ ID NO: 72, SEQ ID NO: 73, SEQ ID NO: 80, SEQ ID NO: 81, SEQ ID NO: 82, SEQ ID NO: 83, SEQ ID NO: 85, SEQ ID NO: 86, SEQ ID NO: 88, SEQ ID NO: 91, SEQ ID NO: 96, SEQ ID NO: 99, SEQ ID NO: 100, SEQ ID NO: 103, SEQ ID NO: 105, SEQ ID NO: 106, SEQ ID NO: 108, SEQ ID NO: 109, SEQ ID NO: 111, SEQ ID NO: 117, or SEQ ID NO: 119 in which 1 to 3 bases are deleted, substituted, inserted, and/or added.
5: The polynucleotide according to claim 1 comprising at least two base sequences encoding the guide RNAs, wherein the at least two base sequences are different.
6: The polynucleotide according to claim 1, wherein the transcriptional repressor is selected from the group KRAB, MeCP2, SIN3A, HDT1, MBD2B, NIPP1, and HP1A.
7: The polynucleotide according to claim 6, wherein the transcriptional repressor is KRAB.
8: The polynucleotide according to claim 1, wherein the nuclease-deficient CRISPR effector protein is dCas9.
9: The polynucleotide according to claim 8, wherein the dCas9 is derived from Staphylococcus aureus.
10: The polynucleotide according to claim 1, further comprising a promoter sequence for the base sequence encoding the guide RNA and/or a promoter sequence for the base sequence encoding the fusion protein of the nuclease-deficient CRISPR effector protein and the transcriptional repressor.
11: The polynucleotide according to claim 10, wherein the promoter sequence for the base sequence encoding the guide RNA is selected from the group U6 promoter, SNR6 promoter, SNR52 promoter, SCR1 promoter, RPR1 promoter, U3 promoter, and H1 promoter.
12: The polynucleotide according to claim 11, wherein the promoter sequence for the base sequence encoding the guide RNA is U6 promoter.
13: The polynucleotide according to claim 10, wherein the promoter sequence for the base sequence encoding the fusion protein of the nuclease-deficient CRISPR effector protein and the transcriptional repressor is a ubiquitous promoter or a muscle specific promoter.
14: The polynucleotide according to claim 13, wherein the ubiquitous promoter is selected from the group EFS promoter, CMV promoter and CAG promoter.
15: The polynucleotide according to claim 13, wherein the muscle specific promoter is selected from the group CK8 promoter, myosin heavy chain kinase (MHCK) promoter, muscle creatine kinase (MCK) promoter, synthetic C5-12 (Syn) promoter, and Des promoter.
16: The polynucleotide according to claim 15, wherein the muscle specific promoter is CK8 promoter.
17: The polynucleotide according to claim 10, wherein the base sequence encoding the guide RNA comprises the base sequence set forth in SEQ ID NO: 70, SEQ ID NO: 81, SEQ ID NO: 83, or SEQ ID NO: 99, or the base sequence set forth in SEQ ID NO: 70, SEQ ID NO: 81, SEQ ID NO: 83, or SEQ ID NO: 99 in which 1 to 3 bases are deleted, substituted, inserted, and/or added, the transcriptional repressor is KRAB, the nuclease-deficient CRISPR effector protein is dCas9 derived from Staphylococcus aureus, the promoter sequence for the base sequence encoding the guide RNA is U6 promoter, and the promoter sequence for the base sequence encoding the fusion protein of the nuclease-deficient CRISPR effector protein and the transcriptional repressor is CK8 promoter.
18: The polynucleotide according to claim 17, wherein the base sequence encoding the guide RNA comprises the base sequence set forth in SEQ ID NO: 83, or the base sequence set forth in SEQ ID NO: 83 in which 1 to 3 bases are deleted, substituted, inserted, and/or added.
19: A vector comprising a polynucleotide according to claim 1.
20: The vector according to claim 19, wherein the vector is a plasmid vector or a viral vector.
21: The vector according to claim 20, wherein the viral vector is selected from the group adeno-associated virus (AAV) vector, adenovirus vector, and lentivirus vector.
22: The vector according to claim 21, wherein the AAV vector is selected from the group AAV1, AAV2, AAV6, AAV7, AAV8, AAV9, Anc80, AAV.sub.587MTP, AAV.sub.588MTP, AAV-B 1, AAVM41, and AAVrh74.
23-25. (canceled)
26: A method for treating or preventing myotonic dystrophy type 1, comprising administering a polynucleotide according to claim 1, to a subject in need thereof.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0157] A more complete appreciation of the invention and many of the attendant advantages thereof will be readily obtained as the same become better understood by reference to the following detailed description when considered in connection with the accompanying drawings, wherein:
[0158]
[0159]
[0160]
[0161]
[0162]
[0163]
[0164]
[0165]
[0166]
[0167]
[0168]
DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS
1. Polynucleotide
[0169] The present invention provides a polynucleotide comprising the following base sequences (hereinafter sometimes to be also referred to as “the polynucleotide of the present invention”):
[0170] (a) a base sequence encoding a fusion protein of a nuclease-deficient CRISPR effector protein and a transcriptional repressor, and
[0171] (b) a base sequence encoding a guide. RNA targeting a continuous region of 18 to 24 nucleotides (i.e., 18 to 24 contiguous nucleotides) in length in a region set forth in SEQ. ID NO: 127, SEQ ID NO: 46, SEQ ID NO: 128, SEQ ID NO: 129, SEQ ID NO: 130, SEQ ID NO: 131, SEQ ID NO: 132, SEQ ID NO: 88, SEQ ID NO: 91, SEQ ID NO: 133, SEQ ID NO: 137, SEQ ID NO: 117, or SEQ ID NO: 119 in the expression regulatory region of human DMPK gene.
[0172] The polynucleotide of the present invention is introduced into a desired cell and transcribed to produce a fusion protein of a nuclease-deficient CRISPR effector protein and a transcriptional repressor, and a guide RNA targeting a particular region of the expression regulatory region of the human DMPK gene. These fusion protein and guide RNA form a complex (hereinafter the complex is sometimes referred to as “ribonucleoprotein; RNP”) and cooperatively act on the aforementioned particular region, thus repressing transcription of the human DMPK gene. In one embodiment of the present invention, the expression of the human DMPK gene can be suppressed by, for example, not less than about 40%, not less than about 50%, not less than about 60%, not less than about 70%, not less than about 75%, not less than about 80%, not less than about 85%, not less than about 90%, not less than about 95%, or about 100%.
(1) Definition
[0173] In the present specification, “the expression regulatory region of human DMPK gene” means any region in which the expression of human DMPK gene can be repressed by binding RNP to that region. That is, the expression regulatory region of human DMPK gene may exist in any region such as the promoter region, enhancer region, intron, exon of the human DMPK gene, and neighboring genes of human DMPK gene (e.g., human DMWD (DM1 locus, WD repeat containing) gene), as long as the expression of the human DMPK gene is repressed by the binding of RNP. In the present specification, when the expression regulatory region is shown by the particular sequence, the expression regulatory region includes both the sense strand sequence and the antisense strand sequence conceptually.
[0174] In the present invention, a fusion protein of a nuclease-deficient CRISPR effector protein and a transcriptional repressor is recruited by a guide RNA into a particular region in the expression regulatory region of the human DMPK gene. In the present specification, the “guide RNA targeting . . . ” means a “guide RNA recruiting a fusion protein into . . . ”.
[0175] In the present specification, the “guide RNA (to be also referred to as ‘gRNA’)” is an RNA comprising a genome specific CRISPR-RNA (to be referred to as “crRNA”). crRNA is an RNA that binds to a complementary sequence of a targeting sequence (described later). When Cpf1 is used as the CRISPR effector protein, the “guide RNA” refers to an RNA comprising an RNA consisting of crRNA and a specific sequence attached to its 5′-terminal (for example, an RNA sequence set forth in SEQ ID NO: 138 in the case of FnCpf1). When Cas9 is used as the CRISPR effector protein, the “guide RNA” refers to a chimera RNA (to be referred to as “single guide RNA(sgRNA)”) comprising crRNA and trans-activating crRNA attached to its 3′-terminal (to be referred to as “tracrRNA”) (see, for example, Zhang F. et al., Hum Mol Genet. 2014 Sep. 15; 23(R1):R40-6 and Zetsche B. et al., Cell. 2015 Oct. 22; 163(3): 759-71, which are incorporated herein by reference in their entireties).
[0176] In the present specification, a sequence complementary to the sequence to which crRNA binds in the expression regulatory region of the human DMPK gene is referred to as a “targeting sequence”. That is, in the present specification, the “targeting sequence” is a DNA sequence present in the expression regulatory region of the human DMPK gene and adjacent to PAM (protospacer adjacent motif). PAM is adjacent to the 5′-side of the targeting sequence when Cpf1 is used as the CRISPR effector protein. PAM is adjacent to the 3′-side of the targeting sequence when Cas9 is used as the CRISPR effector protein. The targeting sequence may be present on either the sense strand sequence side or the antisense strand sequence side of the expression regulatory region of the human DMPK gene (see, for example, the aforementioned Zhang F. et al., Hum Mol Genet. 2014 Sep. 15; 23(R1):R40-6 and Zetsche B. et al., Cell. 2015 Oct. 22; 163(3): 759-71, which are incorporated herein by reference in their entireties).
(2) Nuclease-Deficient CRISPR Effector Protein
[0177] In the present invention, using a nuclease-deficient CRISPR effector protein, a transcriptional repressor fused thereto is recruited to the expression regulatory region of the human DMPK gene. The nuclease-deficient CRISPR effector protein (hereinafter sometimes to be simply referred to as “CRISPR effector protein”) to be used in the present invention is not particularly limited as long as it forms a complex with gRNA and is recruited to the expression regulatory region of the human DMPK gene. For example, nuclease-deficient Cas9 (hereinafter sometimes to be also referred to as “dCas9”) or nuclease-deficient Cpf1 (hereinafter sometimes to be also referred to as “dCpf1”) can be included.
[0178] Examples of the above-mentioned dCas9 include, but are not limited to, a nuclease-deficient variant of Streptococcus pyogenes-derived Cas9 (SpCas9; PAM sequence: NGG (N is A, G, T or C. hereinafter the same)), Streptococcus thermophilus-derived Cas9 (St1Cas9; PAM sequence: NNAGAAW (W is A or T. hereinafter the same), St3Cas9; PAM sequence: NGGNG), Neisseria meningitidis-derived Cas9 (NmCas9; PAM sequence: NNNNGATT), or Staphylococcus aureus-derived Cas9 (SaCas9; PAM sequence: NNGRRT (R is A or G. hereinafter the same)) and the like (see, for example, Nishimasu et al., Cell. 2014 Feb. 27; 156(5): 935-49, Esvelt K M et al., Nat Methods. 2013 November; 10(11):1116-21, Zhang Y. Mol Cell. 2015 Oct. 15; 60(2):242-55, and Friedland A E et al., Genome Biol. 2015 Nov. 24; 16:257, which are incorporated herein by reference in their entireties). For example, in the case of SpCas9, a double mutant in which the Asp residue at the 10th position is converted to Ala residue and the His residue at the 840th position is converted to Ala residue (sometimes referred to as “dSpCas9”) can be used (see, for example, the aforementioned Nishimasu et al., Cell. 2014, which is incorporated herein by reference in their entireties). Alternatively, in the case of SaCas9, a double mutant in which the Asp residue at the 10th position is converted to Ala residue and the Asn residue at the 580th position is converted to Ala residue (SEQ ID NO: 139), or a double mutant in which the Asp residue at the 10th position is converted to Ala residue and the His residue at the 557th position is converted to Ala residue (SEQ ID NO: 140) (hereinafter any of these double mutants is sometimes to be referred to as “dSaCas9”) can be used (see, for example, the aforementioned Friedland A E et al., Genome Biol. 2015, which are incorporated herein by reference in their entireties).
[0179] In addition, in one embodiment of the present invention, as dCas9, a variant obtained by modifying a part of the amino acid sequence of the aforementioned dCas9, which forms a complex with gRNA and is recruited to the expression regulatory region of the human DMPK gene, may also be used. Examples of such variants include a truncated variant with a partly deleted amino acid sequence. In one embodiment of the present invention, the variant described in WO2019/235627 and WO2020/085441, which are incorporated herein by reference in their entireties, can be used as dCas9. Specifically, dSaCas9 obtained by deleting the 721st to 745th amino acids from dSaCas9 that is a double mutant in which the Asp residue at the 10th position is converted to Ala residue and the Asn residue at the 580th position is converted to Ala residue (SEQ ID NO: 141), or dSaCas9 in which the deleted part is substituted by a peptide linker (e.g., one in which the deleted part is substituted by GGSGGS linker (SEQ ID NO: 142) is set forth in SEQ ID NO: 143) (hereinafter any of these double mutants is sometimes to be referred to as “dSaCas9[-25]”), or dSaCas9 obtained by deleting the 482nd to 648th amino acids of dSaCas9 that is the aforementioned double mutant (SEQ ID NO: 144), or dSaCas9 in which the deleted part is substituted by a peptide linker (one in which the deleted part is substituted by GGSGGS linker is set forth in SEQ ID NO: 145) may also be used.
[0180] Examples of the above-mentioned dCpf1 include, but are not limited to, a nuclease-deficient variant of Francisella novicida-derived Cpf1 (FnCpf1; PAM sequence: TTN), Acidaminococcus sp.-derived Cpf1 (AsCpf1; PAM sequence: TTTN), or Lachnospiraceae bacterium-derived Cpf1 (LbCpf1; PAM sequence: TTTA, TCTA, TCCA, or CCCA) and the like (see, for example, Zetsche B. et al., Cell. 2015 Oct. 22; 163(3):759-71, Yamano T et al., Cell. 2016 May 5; 165(4):949-62, and Yamano T et al., Mol Cell. 2017 Aug. 17; 67(4):633-45, which are incorporated herein by reference in their entireties). For example, in the case of FnCpf1, a double mutant in which the Asp residue at the 917th position is converted to Ala residue and the Glu residue at the 1006th position is converted to Ala residue can be used (see, for example, the aforementioned Zetsche B et al., Cell. 2015, which is incorporated herein by reference in its entirety). In one embodiment of the present invention, as dCpf1, a variant obtained by modifying a part of the amino acid sequence of the aforementioned dCpf1, which forms a complex with gRNA and is recruited to the expression regulatory region of the human DMPK gene, may also be used.
[0181] In one embodiment of the present invention, dCas9 is used as the nuclease-deficient CRISPR effector protein. In one embodiment, the dCas9 is dSaCas9, and, in a particular embodiment, dSaCas9 is dSaCas9[-25].
[0182] A polynucleotide comprising a base sequence encoding a nuclease-deficient CRISPR effector protein can be cloned by, for example, synthesizing an oligoDNA primer covering a region encoding a desired part of the protein based on the cDNA sequence information thereof, and amplifying the polynucleotide by PCR method using total RNA or mRNA fraction prepared from the cells producing the protein as a template. In addition, a polynucleotide comprising a base sequence encoding a nuclease-deficient CRISPR effector protein can be obtained by introducing a mutation into a nucleotide sequence encoding a cloned CRISPR effector protein by a known site-directed mutagenesis method to convert the amino acid residues (e.g., Asp residue at the 10th position, His residue at the 557.sup.th position, and Asn residue at the 580th position in the case of SaCas9; Asp residue at the 917.sup.th position and Glu residue at the 1006.sup.th position in the case of FnCpf1, and the like can be included, but are not limited to these) at a site important for nuclease activity to other amino acids.
[0183] Alternatively, a polynucleotide comprising a base sequence encoding nuclease-deficient CRISPR effector protein can be obtained by chemical synthesis or a combination of chemical synthesis and PCR method or Gibson Assembly method, based on the cDNA sequence information thereof, and can also be further constructed as a base sequence that underwent codon optimization to be codons suitable for expression in human.
(3) Transcriptional Repressor
[0184] In the present invention, human DMPK gene expression is repressed by the action of the transcriptional repressor fused with the nuclease-deficient CRISPR effector protein. In the present specification, the “transcriptional repressor” means a protein having the ability to repress gene transcription of human DMPK gene or a peptide fragment retaining the function thereof. The transcriptional repressor to be used in the present invention is not particularly limited as long as it can repress expression of human DMPK gene. It includes, for example, Kruppel-associated box (KRAB), MBD2B, v-ErbA, SID (including chain state of SID (SID4X)), MBD2, MBD3, DNMT family (e.g., DNMT1, DNMT3A, DNMT3B), Rb, MeCP2, ROM2, LSD1, AtHD2A, SET1, HDAC11, SETD8, EZH2, SUV39H1, PHF19, SALI, NUE, SUVR4, KYP, DIM5, HDAC8, SIRT3, SIRT6, MESOL04, SET8, HST2, COBB, SET-TAF1B, NCOR, SIN3A, HDT1, NIPP1, HP1A, ERF repressor domain (ERD), and variants thereof having transcriptional repression ability, fusions thereof and the like. In one embodiment of the present invention, KRAB is used as the transcriptional repressor.
[0185] A polynucleotide comprising a base sequence encoding a transcriptional repressor can be constructed by chemical synthesis or a combination of chemical synthesis and PCR method or Gibson Assembly method. Furthermore, a polynucleotide comprising a base sequence encoding a transcriptional repressor can also be constructed as a codon-optimized DNA sequence to be codons suitable for expression in human.
[0186] A polynucleotide comprising a base sequence encoding a fusion protein of a transcriptional repressor and a nuclease-deficient CRISPR effector protein can be prepared by ligating a base sequence encoding the CRISPR effector protein to a base sequence encoding the transcriptional repressor directly or after adding a base sequence encoding a linker, NLS (nuclear localization signal)(for example, a base sequence set forth in SEQ ID NO: 189 or SEQ ID NO: 191), a tag and/or others. In the present invention, the transcriptional repressor may be fused with either N-terminal or C-terminal of the nuclease-deficient CRISPR effector protein. As the linker, a linker with an amino acid number of about 2 to 50 can be used, and specific examples thereof include, but are not limited to, a G-S-G-S linker in which glycine (G) and serine (S) are alternately linked and the like. In one embodiment of the present invention, as the polynucleotide comprising a base sequence encoding a fusion protein of a nuclease-deficient CRISPR effector protein and a transcriptional repressor, the base sequence set forth in SEQ ID NO: 151, which encodes SV40 NLS, dSaCas9, NLS and KRAB as a fused protein, can be used. (4) Guide RNA
[0187] In the present invention, a fusion protein of nuclease-deficient CRISPR effector protein and transcriptional repressor can be recruited to the expression regulatory region of the human DMPK gene by guide RNA. As described in the aforementioned “(1) Definition”, guide RNA comprises crRNA, and the crRNA binds to a complementary sequence of the targeting sequence. crRNA may not be completely complementary to the complementary sequence of the targeting sequence as long as the guide RNA can recruit the fusion protein to the target region, and may be a sequence in which at least 1 to 3 bases are deleted, substituted, inserted and/or added.
[0188] When dCas9 is used as the nuclease-deficient CRISPR effector protein, for example, the targeting sequence can be determined using a published gRNA design web site (CRISPR Design Tool, CRISPR direct etc.). To be specific, from the sequence of the target gene (i.e., human DMPK gene) and neighboring gene thereof, candidate targeting sequences of about 20 nucleotides in length for which PAM (e.g., NNGRRT in the case of SaCas9) is adjacent to the 3′-side thereof are listed, and one having a small number of off-target sites in human genome among these candidate targeting sequences can be used as the targeting sequence. The base length of the targeting sequence is 18 to 24 nucleotides in length, preferably 18 to 23 nucleotides in length, more preferably 18 to 22 nucleotides in length. As a primary screening for the prediction of the off-target site number, a number of bioinformatic tools are known and publicly available, and can be used to predict the targeting sequence with the lowest off-target effect. Examples thereof include bioinformatics tools such as Benchling (https://benchling.com), and COSMID (CRISPR Off-target Sites with Mismatches, Insertions and Deletions) (Available on https://crispr.bme.gatech.edu on the internet). Using these, the similarity to the base sequence targeted by gRNA can be summarized. When the gRNA design software to be used does not have a function to search for off-target site of the target genome, for example, the off-target site can be searched for by subjecting the target genome to Blast search with respect to 8 to 12 nucleotides on the 3′-side of the candidate targeting sequence (seed sequence with high discrimination ability of targeted nucleotide sequence).
[0189] In one embodiment of the present invention, in the region existing in the GRCh38.p12 position of human chromosome 19 (Chr19), region near the transcription start point of the DMPK gene: 45,777,342-45,784,715 can be the expression regulatory region of human DMPK gene. As shown in the Examples, the present inventors have found that the expression of human DMPK gene can be regulated by targeting the region 45,778,884-45,783,985 (Zone 2 in
[0190] Furthermore, the present inventors have found that the region set forth in SEQ ID NO: 127, SEQ ID NO: 46, SEQ ID NO: 128, SEQ ID NO: 129, SEQ ID NO: 130, SEQ ID NO: 131, SEQ ID NO: 132, SEQ ID NO: 88, SEQ ID NO: 91, SEQ ID NO: 133, SEQ ID NO: 137, SEQ ID NO: 117, or SEQ ID NO: 119 existing in the above-mentioned region 45,778,884-45,783,985 is preferable as a region for designing the targeting sequence for repressing the expression of DMPK gene. In one embodiment of the present invention, therefore, the targeting sequence may be a base sequence of continuous 18 to 24 nucleotides in length, preferably 18 to 23 nucleotides in length, more preferably 18 to 22 nucleotides in length, in these regions. The position of each sequence in the expression regulatory region of human DMPK gene is as described in Table 1 and
[0191] In one embodiment of the present invention, the targeting sequence may be a base sequence of continuous 18 to 24 nucleotides in length, preferably 18 to 23 nucleotides in length, more preferably 18 to 22 nucleotides in length, in the region set forth in SEQ ID NO: 127, SEQ ID NO: 46, SEQ ID NO: 128, SEQ ID NO: 66, SEQ ID NO: 68, SEQ ID NO: 130, SEQ ID NO: 131, SEQ ID NO: 132, SEQ ID NO: 88, SEQ ID NO: 91, SEQ ID NO: 96, SEQ ID NO: 99, SEQ ID NO: 100, SEQ ID NO: 134, SEQ ID NO: 108, SEQ ID NO: 109, SEQ ID NO: 111, SEQ ID NO: 117, or SEQ ID NO: 119, existing in the above-mentioned regions 45,778,884-45,783,985, which is considered to show not less than 50% reduction in human DMPK gene expression. The position of each sequence in the expression regulatory region of human DMPK gene is as described in Table 1 and
[0192] In another embodiment of the present invention, the targeting sequence may be a base sequence of continuous 18 to 24 nucleotides in length, preferably 18 to 23 nucleotides in length, more preferably 18 to 22 nucleotides in length, in the region set forth in SEQ ID NO: 63, SEQ ID NO: 136, SEQ ID NO: 83, SEQ ID NO: 99, SEQ ID NO: 135, SEQ ID NO: 109, or SEQ ID NO: 111, existing in the above-mentioned regions 45,778,884-45,783,985, which is considered to show not less than 75% reduction human DMPK gene expression. The position of each sequence in the expression regulatory region of human DMPK gene is as described in Table 1 and
[0193] In still another embodiment of the present invention, the targeting sequence may be a base sequence set forth in SEQ ID NO: 43, SEQ ID NO: 44, SEQ ID NO: 46, SEQ ID NO: 62, SEQ ID NO: 63, SEQ ID NO: 66, SEQ ID NO: 68, SEQ ID NO: 70, SEQ ID NO: 71, SEQ ID NO: 72, SEQ ID NO: 73, SEQ ID NO: 80, SEQ ID NO: 81, SEQ ID NO: 82, SEQ ID NO: 83, SEQ ID NO: 85, SEQ ID NO: 86, SEQ ID NO: 88, SEQ ID NO: 91, SEQ ID NO: 96, SEQ ID NO: 99, SEQ ID NO: 100, SEQ ID NO: 103, SEQ ID NO: 105, SEQ ID NO: 106, SEQ ID NO: 108, SEQ ID NO: 109, SEQ ID NO: 111, SEQ ID NO: 117, or SEQ ID NO: 119. The base sequences set forth in SEQ ID NOs: 43 and 44 are targeting sequences comprised in a region set forth in SEQ ID NO: 127. The base sequences set forth in SEQ ID NOs: 62 and 63 are targeting sequences comprised in a region set forth in SEQ ID NO: 128. The base sequences set forth in SEQ ID NOs: 66 to 68 are targeting sequences comprised in a region set forth in SEQ ID NO: 129. The base sequences set forth in SEQ ID NOs: 70 to 73 are targeting sequences comprised in a region set forth in SEQ ID NO: 130. The base sequences set forth in SEQ ID NOs: 80 to 83 are targeting sequences comprised in a region set forth in SEQ ID NO: 131. The base sequences set forth in SEQ ID NOs: 85 and 86 are targeting sequences comprised in a region set forth in SEQ ID NO: 132. The base sequences set forth in SEQ ID NOs: 95 to 100 are targeting sequences comprised in a region set forth in SEQ ID NO: 133. The base sequences set forth in SEQ ID NOs: 103, 105 and 106 are targeting sequences comprised in a region set forth in SEQ ID NO: 134. The base sequences set forth in SEQ ID NOs: 105 and 106 are targeting sequences comprised in a region set forth in SEQ ID NO: 135. The base sequences set forth in SEQ ID NOs: 70 and 71 are targeting sequences comprised in a region set forth in SEQ ID NO: 136. The base sequences set forth in SEQ ID NOs: 103 to 112 are targeting sequences comprised in a region set forth in SEQ ID NO: 137. The position of each sequence in the expression regulatory region of human DMPK gene is as described in Table 1 and
[0194] In one embodiment of the present invention, a base sequence encoding crRNA may be the same base sequence as the targeting sequence. For example, when the targeting sequence set forth in SEQ ID NO: 5 (CCCAGTCGAGGCCAAAGAAGA) is introduced into the cell as a base sequence encoding crRNA, crRNA transcribed from the sequence is CCCAGUCGAGGCCAAAGAAGA (SEQ ID NO: 146) and is bound to TCTTCTTTGGCCTCGACTGGG (SEQ ID NO: 147), which is a sequence complementary to the base sequence set forth in SEQ ID NO: 5 and is present in the expression regulatory region of the human DMPK gene. In another embodiment, a base sequence which is a targeting sequence in which at least 1 to 3 bases are deleted, substituted, inserted and/or added can be used as the base sequence encoding crRNA as long as guide RNA can recruit a fusion protein to the target region. Therefore, in one embodiment of the present invention, as a base sequence encoding crRNA, the base sequence set forth in SEQ ID NO: 43, SEQ ID NO: 44, SEQ ID NO: 46, SEQ ID NO: 62, SEQ ID. NO: 63, SEQ ID NO: 66, SEQ ID NO: 68, SEQ ID NO: 70, SEQ ID NO: 71, SEQ ID NO: 72, SEQ ID NO: 73, SEQ ID NO: 80, SEQ ID NO: 81, SEQ ID NO: 82, SEQ ID NO: 83, SEQ ID NO: 85, SEQ ID NO: 86, SEQ ID NO: 88, SEQ ID NO: 91, SEQ ID NO: 96, SEQ ID NO: 99, SEQ ID NO: 100, SEQ ID NO: 103, SEQ ID NO: 105, SEQ ID NO: 106, SEQ ID NO: 108, SEQ ID NO: 109, SEQ ID NO: 111, SEQ ID NO: 117 or SEQ ID NO: 119, or the base sequence set forth in SEQ ID NO: 43, SEQ ID NO: 44, SEQ ID NO: 46, SEQ ID NO: 62, SEQ ID NO: 63, SEQ ID NO: 66, SEQ ID NO: 68, SEQ ID NO: 70, SEQ ID NO: 71, SEQ ID NO: 72, SEQ ID NO: 73, SEQ ID NO: 80, SEQ ID NO: 81, SEQ ID NO: 82, SEQ ID NO: 83, SEQ ID NO: 85, SEQ ID NO: 86, SEQ ID NO: 88, SEQ ID NO: 91, SEQ ID NO: 96, SEQ ID NO: 99, SEQ ID NO: 100, SEQ ID NO: 103, SEQ ID NO: 105, SEQ ID NO: 106, SEQ ID NO: 108, SEQ ID NO: 109, SEQ ID NO: 111, SEQ ID NO: 117 or SEQ ID NO: 119 in which 1 to 3 bases are deleted, substituted, inserted and/or added can be used. In another embodiment of the present invention, as a base sequence encoding crRNA, the base sequence set forth in SEQ ID NO: 63, SEQ ID NO: 70, SEQ ID NO: 71, SEQ ID NO: 83, SEQ ID NO: 99, SEQ ID NO: 105, SEQ ID NO: 106, SEQ ID NO: 109, or SEQ ID NO: 111, or the base sequence set forth in SEQ ID NO: 63, SEQ ID NO: 70, SEQ ID NO: 71, SEQ ID NO: 83, SEQ ID NO: 99, SEQ ID NO: 105, SEQ ID NO: 106, SEQ ID NO: 109, or SEQ ID NO: 111 in which 1 to 3 bases are deleted, substituted, inserted and/or added can be used. In still another embodiment of the present invention, as a base sequence encoding crRNA, the base sequence set forth in SEQ ID NO: 70, SEQ ID NO: 81, SEQ ID NO: 83, or SEQ ID NO: 99, or the base sequence set forth in SEQ ID NO: 70, SEQ ID NO: 81, SEQ ID NO: 83, or SEQ ID NO: 99 in which 1 to 3 bases are deleted, substituted, inserted and/or added can be used. In one embodiment of the present invention, as a base sequence encoding crRNA, the base sequence set forth in SEQ ID NO: 83, or the base sequence set forth in SEQ ID NO: 83 in which 1 to 3 bases are deleted, substituted, inserted and/or added can be used.
[0195] In one embodiment of the present invention, the base sequence set forth in SEQ ID NO: 43, SEQ ID NO: 44, SEQ ID NO: 46, SEQ ID NO: 62, SEQ ID NO: 63, SEQ ID NO: 66, SEQ ID NO: 68, SEQ ID NO: 70, SEQ ID NO: 71, SEQ ID NO: 72, SEQ ID NO: 73, SEQ ID NO: 80, SEQ ID NO: 81, SEQ ID NO: 82, SEQ ID NO: 83, SEQ ID NO: 85, SEQ ID NO: 86, SEQ ID NO: 88, SEQ ID NO: 91, SEQ ID NO: 96, SEQ ID NO: 99, SEQ ID NO: 100, SEQ ID NO: 103, SEQ ID NO: 105, SEQ ID NO: 106, SEQ ID NO: 108, SEQ ID NO: 109, SEQ ID NO: 111, SEQ ID NO: 117 or SEQ ID NO: 119, or the base sequence set forth in SEQ ID NO: 43, SEQ ID NO: 44, SEQ ID NO: 46, SEQ ID NO: 62, SEQ ID NO: 63, SEQ ID NO: 66, SEQ ID NO: 68, SEQ ID NO: 70, SEQ ID NO: 71, SEQ ID NO: 72, SEQ ID NO: 73, SEQ ID NO: 80, SEQ ID NO: 81, SEQ ID NO: 82, SEQ ID NO: 83, SEQ ID NO: 85, SEQ ID NO: 86, SEQ ID NO: 88, SEQ ID NO: 91, SEQ ID NO: 96, SEQ ID NO: 99, SEQ ID NO: 100, SEQ ID NO: 103, SEQ ID NO: 105, SEQ ID NO: 106, SEQ ID NO: 108, SEQ ID NO: 109, SEQ ID NO: 111, SEQ ID NO: 117 or SEQ ID NO: 119 in which 1 to 3 bases are deleted, substituted, inserted and/or added can be used as the base sequence encoding crRNA to produce gRNA comprising crRNA set forth in SEQ ID NO: 157, SEQ ID NO: 158, SEQ ID NO: 159, SEQ ID NO: 160, SEQ ID NO: 161, SEQ ID NO: 162, SEQ ID NO: 163, SEQ ID NO: 164, SEQ ID NO: 165, SEQ ID NO: 166, SEQ ID NO: 167, SEQ ID NO: 168, SEQ ID NO: 169, SEQ ID NO: 170, SEQ ID NO: 171, SEQ ID NO: 172, SEQ ID NO: 173, SEQ ID NO: 174, SEQ ID NO: 175, SEQ ID NO: 176, SEQ ID NO: 177, SEQ ID NO: 178, SEQ ID NO: 179, SEQ ID NO: 180, SEQ ID NO: 181, SEQ ID NO: 182, SEQ ID NO: 183, SEQ ID NO: 184, SEQ ID NO: 185, or SEQ ID NO: 186, or crRNA set forth in SEQ ID NO: 157, SEQ ID NO: 158, SEQ ID NO: 159, SEQ ID NO: 160, SEQ ID NO: 161, SEQ ID NO: 162, SEQ ID NO: 163, SEQ ID NO: 164, SEQ ID NO: 165, SEQ ID NO: 166, SEQ ID NO: 167, SEQ ID NO: 168, SEQ ID NO: 169, SEQ ID NO: 170, SEQ ID NO: 171, SEQ ID NO: 172, SEQ ID NO: 173, SEQ ID NO: 174, SEQ ID NO: 175, SEQ ID NO: 176, SEQ ID NO: 177, SEQ ID NO: 178, SEQ ID NO: 179, SEQ ID NO: 180, SEQ ID NO: 181, SEQ ID NO: 182, SEQ ID NO: 183, SEQ ID NO: 184, SEQ ID NO: 185, or SEQ ID NO: 186 in which 1 to 3 bases are deleted, substituted, inserted, and/or added, respectively. In another embodiment of the present invention, the gRNA can comprise the base sequence set forth in SEQ ID NO: 157, SEQ ID NO: 158, SEQ ID NO: 159, SEQ ID NO: 160, SEQ ID NO: 161, SEQ ID NO: 162, SEQ ID NO: 163, SEQ ID NO: 164, SEQ ID NO: 165, SEQ ID NO: 166, SEQ ID NO: 167, SEQ ID NO: 168, SEQ ID NO: 169, SEQ ID NO: 170, SEQ ID NO: 171, SEQ ID NO: 172, SEQ ID NO: 173, SEQ ID NO: 174, SEQ ID NO: 175, SEQ ID NO: 176, SEQ ID NO: 177, SEQ ID NO: 178, SEQ ID NO: 179, SEQ ID NO: 180, SEQ ID NO: 181, SEQ ID NO: 182, SEQ ID NO: 183, SEQ ID NO: 184, SEQ ID NO: 185, or SEQ ID NO: 186, or the base sequence set forth in SEQ ID NO: 157, SEQ ID NO: 158, SEQ ID NO: 159, SEQ ID NO: 160, SEQ ID NO: 161, SEQ ID NO: 162, SEQ ID NO: 163, SEQ ID NO: 164, SEQ ID NO: 165, SEQ ID NO: 166, SEQ ID NO: 167, SEQ ID NO: 168, SEQ ID NO: 169, SEQ ID NO: 170, SEQ ID NO: 171, SEQ ID NO: 172, SEQ ID NO: 173, SEQ ID NO: 174, SEQ ID NO: 175, SEQ ID NO: 176, SEQ ID NO: 177, SEQ ID NO: 178, SEQ ID NO: 179, SEQ ID NO: 180, SEQ ID NO: 181, SEQ ID NO: 182, SEQ ID NO: 183, SEQ ID NO: 184, SEQ ID NO: 185, or SEQ ID NO: 186 in which 1 to 3 bases are deleted, substituted, inserted, and/or added. In one embodiment of the present invention, the gRNA can comprise the base sequence set forth in SEQ ID NO: 161, SEQ ID NO: 164, SEQ ID NO: 165, SEQ ID NO: 171, SEQ ID NO: 177, SEQ ID NO: 180, SEQ ID NO: 181, SEQ ID NO: 183, or SEQ ID NO: 184, or the base sequence set forth in SEQ ID NO: 161, SEQ ID NO: 164, SEQ ID NO: 165, SEQ ID NO: 171, SEQ ID NO: 177, SEQ ID NO: 180, SEQ ID NO: 181, SEQ ID NO: 183, or SEQ ID NO: 184 in which 1 to 3 bases are deleted, substituted, inserted, and/or added. In another embodiment of the present invention, the gRNA can comprise the base sequence set forth in SEQ ID NO: 164, SEQ ID NO: 169, SEQ ID NO: 171, or SEQ ID NO: 177, or the base sequence set forth in SEQ ID NO: 164, SEQ ID NO: 169, SEQ ID NO: 171, or SEQ ID NO: 177 in which 1 to 3 bases are deleted, substituted, inserted, and/or added. In still another embodiment of the present invention, the gRNA can comprise the base sequence set forth in SEQ ID NO: 171, or the base sequence set forth in SEQ ID NO: 171 in which 1 to 3 bases are deleted, substituted, inserted, and/or added.
[0196] When dCpf1 is used as the nuclease-deficient CRISPR effector protein, a base sequence encoding gRNA can be designed as a DNA sequence encoding crRNA with particular RNA attached to the 5′-terminal. Such RNA attached to the 5′-terminal of crRNA and a DNA sequence encoding said RNA can be appropriately selected by those of ordinary skill in the art according to the dCpf1 to be used. For example, when dFnCpf1 is used, a base sequence in which SEQ ID NO: 148; AATTTCTACTGTTGTAGAT is attached to the 5′-side of the targeting sequence can be used as a base sequence encoding gRNA (when transcribed to RNA, the sequences of the underlined parts form base pairs to form a stem-loop structure). The sequence to be added to the 5′-terminal may be a sequence generally used for various Cpf1 proteins in which at least 1 to 6 bases are deleted, substituted, inserted and/or added, as long as gRNA can recruit a fusion protein to the expression regulatory region after transcription.
[0197] When dCas9 is used as the nuclease-deficient CRISPR effector protein, a base sequence encoding gRNA can be designed as a DNA sequence in which a DNA sequence encoding known tracrRNA is linked to the 3′-terminal of a DNA sequence encoding crRNA. Such tracrRNA and a DNA sequence encoding the tracrRNA can be appropriately selected by those of ordinary skill in the art according to the dCas9 to be used. For example, when dSaCas9 is used, the base sequence set forth in SEQ ID NO: 149 is used as the DNA sequence encoding tracrRNA. The DNA sequence encoding tracrRNA may be a base sequence encoding tracrRNA generally used for various Cas9 proteins in which at least 1 to 6 bases are deleted, substituted, inserted and/or added, as long as gRNA can recruit a fusion protein to the expression regulatory region after transcription.
[0198] A polynucleotide comprising a base sequence encoding gRNA designed in this way can be chemically synthesized using a known DNA synthesis method.
[0199] In another embodiment of the present invention, the polynucleotide of the present invention may comprise at least two different base sequences respectively encoding a gRNA targeting a continuous region of 18 to 24 nucleotides in length in a region set forth in SEQ ID NO: 127, SEQ ID NO: 46, SEQ ID NO: 128, SEQ ID NO: 129, SEQ ID NO: 130, SEQ ID NO: 131, SEQ ID NO: 132, SEQ ID NO: 88, SEQ ID NO: 91, SEQ ID NO: 133, SEQ ID NO: 137, SEQ ID NO: 117, or SEQ ID NO: 119 in the expression regulatory region of human DMPK gene. For example, the polynucleotide can comprise at least two different base sequences respectively encoding a guide RNA, wherein the at least two different base sequences are selected from a base sequence comprising a sequence set forth in SEQ ID NO: 43, SEQ ID NO: 44, SEQ ID NO: 46, SEQ ID NO: 62, SEQ ID NO: 63, SEQ ID NO: 66, SEQ ID NO: 68, SEQ ID NO: 70, SEQ ID NO: 71, SEQ ID NO: 72, SEQ ID NO: 73, SEQ ID NO: 80, SEQ ID NO: 81, SEQ ID NO: 82, SEQ ID NO: 83, SEQ ID NO: 85, SEQ ID NO: 86, SEQ ID NO: 88, SEQ ID NO: 91, SEQ ID NO: 96, SEQ. ID NO: 99, SEQ ID NO: 100, SEQ ID NO: 103, SEQ ID NO: 105, SEQ ID NO: 106, SEQ ID NO: 108, SEQ ID NO: 109, SEQ ID NO: 111, SEQ ID NO: 117 or SEQ ID NO: 119 or a base sequence set forth in SEQ ID NO: 43, SEQ ID NO: 44, SEQ ID NO: 46, SEQ ID NO: 62, SEQ ID NO: 63, SEQ ID NO: 66, SEQ ID NO: 68, SEQ ID NO: 70, SEQ ID NO: 71, SEQ ID NO: 72, SEQ ID NO: 73, SEQ ID NO: 80, SEQ ID NO: 81, SEQ ID NO: 82, SEQ ID NO: 83, SEQ ID NO: 85, SEQ ID NO: 86, SEQ ID NO: 88, SEQ ID NO: 91, SEQ ID NO: 96, SEQ ID NO: 99, SEQ ID NO: 100, SEQ ID NO: 103, SEQ ID NO: 105, SEQ ID NO: 106, SEQ ID NO: 108, SEQ ID NO: 109, SEQ ID NO: 111, SEQ ID NO: 117 or SEQ ID NO: 119 in which 1 to 3 bases are deleted, substituted, inserted, and/or added. In one embodiment of the present invention, the polynucleotide can comprise at least two different base sequences respectively encoding a guide RNA, wherein the at least two different base sequences are selected from a base sequence comprising the sequence set forth in SEQ ID NO: 63, SEQ ID NO: 70, SEQ ID NO: 71, SEQ ID NO: 83, SEQ ID NO: 99, SEQ ID NO: 105, SEQ ID NO: 106, SEQ ID NO: 109, or SEQ ID NO: 111 or a base sequence set forth in SEQ ID NO: 63, SEQ ID NO: 70, SEQ ID NO: 71, SEQ ID NO: 83, SEQ ID NO: 99, SEQ ID NO: 105, SEQ ID NO: 106, SEQ ID NO: 109, or SEQ ID NO: 111 in which 1 to 3 bases are deleted, substituted, inserted, and/or added. In one embodiment of the present invention, the polynucleotide can comprise at least two different base sequences respectively encoding a guide RNA, wherein the at least two different base sequences are selected from a base sequence comprising the sequence set forth in SEQ ID NO: 70, SEQ ID NO: 81, SEQ ID NO: 83 or SEQ ID NO: 99 or a base sequence set forth in SEQ ID NO: 70, SEQ ID NO: 81, SEQ ID NO: 83 or SEQ ID NO: 99 in which 1 to 3 bases are deleted, substituted, inserted, and/or added.
(5) Promoter Sequence
[0200] In one embodiment of the present invention, a promoter sequence may be operably linked to the upstream of each of a base sequence encoding fusion protein of nuclease-deficient CRISPR effector protein and transcriptional repressor and/or a base sequence encoding gRNA. The promoter to be possibly linked is not particularly limited as long as it shows a promoter activity in the target cell. Examples of the promoter sequence possibly linked to the upstream of the base sequence encoding gRNA include, but are not limited to, U6 promoter, SNR6 promoter, SNR52 promoter, SCR1 promoter, RPR1 promoter, U3 promoter, H1 promoter, and tRNA promoter, which are pol III promoters, and the like. In one embodiment of the present invention, U6 promoter can be used as the promoter sequence for the base sequence encoding the guide RNA. In one embodiment of the present invention, when a polynucleotide comprises two or more base sequences respectively encoding a guide RNA, a single promoter sequence may be operably linked to the upstream of the two or more base sequences. In another embodiment, when a polynucleotide comprises two or more base sequences respectively encoding a guide RNA, a promoter sequence may be operably linked to the upstream of each of the two or more base sequences, wherein the promoter sequence operably linked to each base sequence may be the same or different.
[0201] As the aforementioned promoter sequence possibly linked to the upstream of the base sequence encoding fusion protein, a ubiquitous promoter or muscle-specific promoter may be used. Examples of the ubiquitous promoter include, but are not limited to, EF-1α promoter, EFS promoter, CMV (cytomegalovirus) promoter, hTERT promoter, SRα promoter, SV40 promoter, LTR promoter, CAG promoter, RSV (Rous sarcoma virus) promoter, and the like. In one embodiment of the present invention, EFS promoter, CMV promoter or CAG promoter can be used as the ubiquitous promoter. Examples of the muscle specific promoter include, but are not limited to, CK8 promoter, CK6 promoter, CK1 promoter, CK7 promoter, CK9 promoter, cardiac muscle troponin C promoter, α-actin promoter, myosin heavy chain kinase (MHCK) promoter (e.g., MHCK7 promoter etc.), MHC promoter, myosin light chain 2A promoter, dystrophin promoter, muscle creatine kinase (MCK) promoter, dMCK promoter, tMCK promoter, enh348 MCK promoter, synthetic C5-12 (Syn) promoter, Myf5 promoter, MLC1/3f promoter, MLC-2 promoter, MYOD promoter, Myog promoter, Pax7 promoter, Des promoter, cTnC promoter and the like (for the detail of the muscle specific promoter, see, US2011/0212529A1, McCarthy J J et al., Skeletal Muscle. 2012 May; 2(1):8, Wang B. et al., Gene Ther. 2008 November; 15(22):1489-99, and the like, which are incorporated herein by reference in their entireties). In one embodiment of the present invention, CK8 promoter, myosin heavy chain kinase (MHCK) promoter, muscle creatine kinase (MCK) promoter, synthetic C5-12 (Syn) promoter, or Des promoter can be used as the muscle-specific promoter. In one embodiment of the present invention, CK8 promoter can be used as the muscle specific promoter. The aforementioned promoter may have any modification and/or alteration as long as it has promoter activity in the target cell.
[0202] In one embodiment of the present invention, U6 is used as a promoter for a base sequence encoding the guide RNA, and CK8 promoter can be used as the promoter sequence for the base sequence encoding the fusion protein. Specifically, as for the U6 promoter, the following base sequences can be used; (i) the base sequence set forth in SEQ ID NO: 155, (ii) a base sequence set forth in SEQ ID NO: 155 wherein 1 or several (e.g., 2, 3, 4, 5 or more) bases are deleted, substituted, inserted and/or added with a promoter activity in the target cell, or (iii) a base sequence not less than 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or above) identical with the base sequence set forth in SEQ ID NO: 155 showing a promoter activity in the target cell. As for the CK8 promoter, the following base sequences can be used; (i) the base sequence set forth in SEQ ID NO: 187, (ii) a base sequence set forth in SEQ ID NO: 187 wherein 1 or several (e.g., 2, 3, 4, 5 or more) bases are deleted, substituted, inserted and/or added with a promoter activity in the target cell, or (iii) a base sequence not less than 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or above) identical with the base sequence set forth in SEQ ID NO: 187 showing a promoter activity in the target cell.
(6) Other Base Sequence
[0203] Furthermore, the polynucleotide of the present invention may further comprise known sequences such as Polyadenylation (polyA) signal, Kozak consensus sequence and the like besides those mentioned above for the purpose of improving the translation efficiency of mRNA produced by transcription of a base sequence encoding a fusion protein of nuclease-deficient CRISPR effector protein and transcriptional repressor. In addition, the polynucleotide of the present invention may comprise a base sequence encoding a linker sequence, a base sequence encoding NLS and/or a base sequence encoding a tag.
(7) Exemplified Embodiments of the Present Invention
[0204] In one embodiment of the present invention, a polynucleotide is provided comprising:
[0205] a base sequence encoding a fusion protein of a nuclease-deficient CRISPR effector protein and a transcriptional repressor,
[0206] a promoter sequence for the base sequence encoding the fusion protein of the nuclease-deficient CRISPR effector protein and the transcriptional repressor,
[0207] one or two base sequences respectively encoding a guide RNA, wherein the one or two base sequences are selected from a base sequence comprising a sequence set forth in SEQ ID NO: 63, SEQ ID NO: 70, SEQ ID NO: 71, SEQ ID NO: 83, SEQ ID NO: 99, SEQ ID NO: 105, SEQ ID NO: 106, SEQ ID NO: 109, or SEQ ID NO: 111, or the base sequence comprising a sequence set forth in SEQ ID NO: 63, SEQ ID NO: 70, SEQ ID NO: 71, SEQ ID NO: 83, SEQ ID NO: 99, SEQ ID NO: 105, SEQ ID NO: 106, SEQ ID NO: 109, or SEQ ID NO: 111, in which 1 to 3 bases are deleted, substituted, inserted, and/or added, and
[0208] a promoter sequence for the base sequence encoding the gRNA,
[0209] wherein the nuclease-deficient CRISPR effector protein is dSaCas9 or dSaCas9[-25],
[0210] wherein the transcriptional repressor is selected from the group KRAB, MeCP2, SIN3A, HDT1, MBD2B, NIPP1, and HP1A,
[0211] wherein the promoter sequence for the base sequence encoding the fusion protein is selected from the group EFS promoter, CMV promoter, CAG promoter, CK8 promoter, myosin heavy chain kinase (MHCK) promoter, muscle creatine kinase (MCK) promoter, synthetic C5-12 (Syn) promoter, and Des promoter, and
[0212] wherein the promoter sequence for the base sequence encoding the gRNA is selected from the group U6 promoter, SNR6 promoter, SNR52 promoter, SCR1 promoter, RPR1 promoter, U3 promoter, and H1 promoter.
[0213] In one embodiment of the present invention, a polynucleotide is provided comprising:
[0214] a base sequence encoding a fusion protein of a nuclease-deficient CRISPR effector protein and a transcriptional repressor,
[0215] CK8 promoter for the base sequence encoding the fusion protein of the nuclease-deficient CRISPR effector protein and the transcriptional repressor,
[0216] one or two base sequences respectively encoding a guide RNA, wherein the one or two base sequences are selected from a base sequence comprising a sequence set forth in SEQ ID NO: 70, SEQ ID NO: 81, SEQ ID NO: 83, or SEQ ID NO: 99, or a base sequence comprising a sequence set forth in SEQ ID NO: 70, SEQ ID NO: 81, SEQ ID NO: 83, or SEQ ID NO: 99 in which 1 to 3 bases are deleted, substituted, inserted, and/or added, and
[0217] U6 promoter for the base sequence encoding the guide RNA,
[0218] wherein the nuclease-deficient CRISPR effector protein is dSaCas9, and
[0219] wherein the transcriptional repressor is KRAB.
[0220] In one embodiment of the present invention, a polynucleotide is provided comprising:
[0221] a base sequence encoding a fusion protein of a nuclease-deficient CRISPR effector protein and a transcriptional repressor,
[0222] CK8 promoter for the base sequence encoding the fusion protein of the nuclease-deficient CRISPR effector protein and the transcriptional repressor,
[0223] a base sequence encoding a guide RNA comprising the base sequence set forth in SEQ ID NO: 83, or the base sequence set forth in SEQ ID NO: 83 in which 1 to 3 bases are deleted, substituted, inserted, and/or added, and
[0224] U6 promoter for the base sequence encoding the guide RNA,
[0225] wherein the nuclease-deficient CRISPR effector protein is dSaCas9 and
[0226] wherein the transcriptional repressor is KRAB.
[0227] In an embodiment of the polynucleotide of the present invention, the polynucleotide comprises in order from the 5′ end (i) the base sequence encoding the fusion protein of the nuclease-deficient CRISPR effector protein and the transcriptional repressor and (ii) the base sequence encoding the gRNA. In another embodiment, the polynucleotide comprises in order from the 5′ end (ii) the base sequence encoding the gRNA and (i) the base sequence encoding the fusion protein of the nuclease-deficient CRISPR effector protein and the transcriptional repressor.
2. Vector
[0228] The present invention provides a vector comprising the polynucleotide of the present invention (hereinafter sometimes referred to as “the vector of the present invention”). The vector of the present invention may be a plasmid vector or a viral vector.
[0229] When the vector of the present invention is a plasmid vector, the plasmid vector to be used is not particularly limited and may be any plasmid vector such as cloning plasmid vector and expression plasmid vector. The plasmid vector is prepared by inserting the polynucleotide of the present invention into a plasmid vector by a known method.
[0230] When the vector of the present invention is a viral vector, examples of the viral vector to be used include, but are not limited to, adeno-associated virus (AAV) vector, adenovirus vector, lentivirus vector, retrovirus vector, Sendaivirus vector and the like. In the present specification, the “virus vector” or “viral vector” also includes derivatives thereof. Considering the use in gene therapy, AAV vector is preferably used for the reasons such that it can express transgene for a long time, and it is derived from a non-pathogenic virus and has high safety.
[0231] A viral vector comprising the polynucleotide of the present invention can be prepared by a known method. In brief, a plasmid vector for virus expression into which the polynucleotide of the present invention has been inserted is prepared, the vector is transfected into an appropriate host cell to allow for transient production of a viral vector comprising the polynucleotide of the present invention, and the viral vector is collected.
[0232] In one embodiment of the present invention, when AAV vector is used, the serotype of the AAV vector is not particularly limited as long as the expression of the human DMPK gene in the subject can be repressed, and any of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAVrh. 10 and the like may be used (for the various serotypes of AAV, see, for example, WO 2005/033321 and EP2341068 (A1), which are incorporated herein by reference in their entireties). In another embodiment of the present invention, AAV isolated from monkey (e.g., AAVrh74 (see Mol Ther. 2017 Apr. 5; 25(4): 855-869, etc., which is incorporated herein by reference in its entirety), AAV isolated from porcine (e.g., AAVpol (e.g., see Gene Ther. 2009 November; 16(11): 1320-8, which is incorporated herein by reference in its entirety)), Anc 80, which is a predicted ancestor of AAV1, AAV2, AAV8 and AAV9 (see Cell Rep. 2015 Aug. 11; 12(6):1056-68, which is incorporated herein by reference in its entirety) and the like can also be used as long as the expression of human DMPK gene can be repressed in the subject. Examples of the variants of AAV include, but are not limited to, new serotype with a modified capsid (e.g., WO 2012/057363, which is incorporated herein by reference in its entirety) and the like. For example, in one embodiment of the present invention, a new serotype with a modified capsid improving infectivity for muscle cells can be used, such as AAV.sub.587MTP, AAV.sub.588MTP, AAV-B1, AAVM41, and the like (see Yu et al., Gene Ther. 2009 August; 16(8):953-62, Choudhury et al., Mol Ther. 2016 Aug.; 24(7):1247-57, and Yang et al., Proc Natl Acad Sci USA. 2009 Mar. 10; 106(10):3946-51, which are incorporated herein by reference in their entireties).
[0233] When an AAV vector is prepared, a known method such as (1) a method using a plasmid, (2) a method using a baculovirus, (3) a method using a herpes simplex virus, (4) a method using an adenovirus, or (5) a method using yeast can be used (e.g., Appl Microbiol Biotechnol. 2018; 102(3): 1045-1054, etc., which is incorporated herein by reference in its entirety). For example, when an AAV vector is prepared by a method using a plasmid, first, a vector plasmid comprising inverted terminal repeat (ITR) at both ends of wild-type AAV genomic sequence and the polynucleotide of the present invention inserted in place of the DNA encoding Rep protein and capsid protein is prepared. On the other hand, the DNA encoding Rep protein and capsid protein which are necessary for forming virus particles are inserted into other plasmids. Furthermore, a plasmid comprising genes (E1A, E1B, E2A, VA and E4orf6) responsible for the helper action of adenovirus necessary for proliferation of AAV is prepared as an adenovirus helper plasmid. The co-transfection of these three kinds of plasmids into the host cell causes the production of recombinant AAV (i.e., AAV vector) in the cell. As the host cell, a cell capable of supplying a part of the gene products (proteins) of the genes responsible for the aforementioned helper action (e.g., 293 cell etc.) is preferably used. When such cell is used, it is not necessary to carry the gene encoding a protein that can be supplied from the host cell in the aforementioned adenoviral helper plasmid. The produced AAV vector is present in the culture medium and/or cell. Thus, a desired AAV vector is prepared by collection of the virus from the culture medium after destroying the host cell with freeze-thawing or the like and then subjecting the virus fraction to separation and purification by density gradient ultracentrifugation method using cesium chloride, column method or the like.
[0234] AAV vector has great advantages in terms of safety, gene transduction efficiency and the like, and is used for gene therapy. However, it is known that the size of polynucleotide that can be packaged is limited. For example, in one embodiment of the present invention, the full-length including the base length of the polynucleotide comprising a base sequence encoding a fusion protein of dSaCas9 and KRAB, a base sequence encoding gRNA targeting an expression regulatory region of human DMPK gene, and CK8 promoter sequence and U6 promoter sequence as the promoter sequences, and the ITR region is about 4.9 kb and the polynucleotide can be carried in a single AAV vector.
3. Pharmaceutical Composition for Treating or Preventing DM1
[0235] The present invention also provides a pharmaceutical composition comprising the polynucleotide of the present invention or the vector of the present invention (hereinafter sometimes referred to as “the pharmaceutical composition of the present invention”). The pharmaceutical composition of the present invention can be used for treating or preventing DM1.
[0236] The pharmaceutical composition of the present invention comprises the polynucleotide of the present invention or the vector of the present invention as an active ingredient, and may be prepared as a formulation comprising such active ingredient (i.e., the polynucleotide of the present invention or the vector of the present invention) and, generally, a pharmaceutically acceptable carrier.
[0237] In an embodiment, the pharmaceutical composition of the present invention is administered parenterally, and may be administered topically or systemically. The pharmaceutical composition of the present invention can be administered by, but are not limited to, for example, intravenous administration, intraarterial administration, subcutaneous administration, intraperitoneal administration, or intramuscular administration.
[0238] The dose of the pharmaceutical composition of the present invention to a subject is not particularly limited as long as it is an effective amount for the treatment and/or prevention. It may be appropriately optimized according to the active ingredient, dosage form, age and body weight of the subject, administration schedule, administration method and the like.
[0239] In one embodiment of the present invention, the pharmaceutical composition of the present invention can be not only administered to the subject affected with DM1 but also prophylactically administered to subjects who may develop DM1 in the future based on the genetic background analysis and the like. The term “treatment” in the present specification also includes remission of disease, in addition to the cure of diseases. In addition, the term “prevention” may also include delaying the onset of disease, in addition to prophylaxis of the onset of disease. The pharmaceutical composition of the present invention can also be referred to as “the agent of the present invention” or the like.
4. Method for Treatment or Prevention of DM1
[0240] The present invention also provides a method for treating or preventing DM1, comprising administering the polynucleotide of the present invention or the vector of the present invention to a subject in need thereof (hereinafter sometimes referred to as “the method of the present invention”). In addition, the present invention includes the polynucleotide of the present invention or the vector of the present invention for use in the treatment or prevention of DM1. Furthermore, the present invention includes use of the polynucleotide of the present invention or the vector of the present invention in the manufacture of a pharmaceutical composition for the treatment or prevention of DM1.
[0241] The method of the present invention can be practiced by administering the aforementioned pharmaceutical composition of the present invention to a subject affected with DM1, and the dose, administration route, subject and the like are the same as those mentioned above.
[0242] Measurement of the symptoms may be performed before the start of the treatment using the method of the present invention and at any timing after the treatment to determine the response of the subject to the treatment.
[0243] The method of the present invention can improve, but are not limited to, any symptom of DM1 such as the function of skeletal muscle and/or cardiac muscle. Muscles or tissue to be improved in the function thereof are not particularly limited, and any muscles and tissue, and muscle groups can be mentioned.
5. Ribonucleoprotein
[0244] The present invention provides a ribonucleoprotein comprising the following (hereinafter sometimes referred to as “RNP of the present invention”):
[0245] (c) a fusion protein of a nuclease-deficient CRISPR effector protein and a transcriptional repressor, and
[0246] (d) a guide RNA targeting a continuous region of 18 to 24 nucleotides in length in a region set forth in SEQ ID NO: 127, SEQ ID NO: 46, SEQ ID NO: 128, SEQ ID NO: 129, SEQ ID NO: 130, SEQ ID NO: 131, SEQ ID NO: 132, SEQ ID NO: 88, SEQ ID NO: 91, SEQ ID NO: 133, SEQ ID NO: 137, SEQ ID NO: 117, or SEQ ID NO: 119 in the expression regulatory region of human DMPK gene.
[0247] As the nuclease-deficient CRISPR effector protein, transcriptional repressor, and guide RNA comprised in the RNP of the present invention, the nuclease-deficient CRISPR effector protein, transcriptional repressor, and guide RNA explained in detail in the above-mentioned section of “1. Polynucleotide” can be used. The fusion protein of nuclease-deficient CRISPR effector protein and transcriptional repressor to be comprised in the RNP of the present invention can be produced by, for example, introducing a polynucleotide encoding the fusion protein into the cell, bacterium, or other organism to allow for the expression, or an in vitro translation system by using the polynucleotide. In addition, guide RNA comprised in the RNP of the present invention can be m produced by, for example, chemical synthesis or an in vitro transcription system by using a polynucleotide encoding the guide RNA. The thus-prepared fusion protein and guide RNA are mixed to prepare the RNP of the present invention. Where necessary, other substances such as gold particles may be mixed. To directly deliver the RNP of the present invention to the target cell, tissue and the like, the RNP may be encapsulated in a lipid nanoparticle (LNP) or loaded in an extracellular vesicle by a known method. The RNP of the present invention can be introduced into the target cell, tissue and the like by a known method. For example, Lee K., et al., Nat Biomed Eng. 2017; 1:889-901, WO 2016/153012 and the like can be referred to for encapsulation in LNP and introduction method, which are incorporated herein by reference in their entireties.
[0248] In one embodiment of the present invention, the guide RNA comprised in RNP of the present invention targets continuous 18 to 24 nucleotides in length, preferably 18 to 23 nucleotides in length, more preferably 18 to 22 nucleotides in length, in the following region: 45,778,884-45,783,985 existing in the GRCh38.p12 position of human chromosome 19 (Chr 19).
[0249] In one embodiment, the guide RNA targets a base sequence of continuous 18 to 24 nucleotides in length, preferably 18 to 23 nucleotides in length, more preferably 18 to 22 nucleotides in length, in a region set forth in SEQ ID NO: 127, SEQ ID NO: 46, SEQ ID NO: 128, SEQ ID NO: 129, SEQ ID NO: 130, SEQ ID NO: 131, SEQ ID NO: 132, SEQ ID NO: 88, SEQ ID NO: 91, SEQ ID NO: 133, SEQ ID NO: 137, SEQ ID NO: 117, or SEQ ID NO: 119. In another embodiment, the guide RNA targets a base sequence of continuous 18 to 24 nucleotides in length, preferably 18 to 23 nucleotides in length, more preferably 18 to 22 nucleotides in length, in a region set forth in SEQ ID NO: 127, SEQ ID NO: 46, SEQ ID NO: 128, SEQ ID NO: 66, SEQ ID NO: 68, SEQ ID NO: 130, SEQ ID NO: 131, SEQ ID NO: 132, SEQ ID NO: 88, SEQ ID NO: 91, SEQ ID NO: 96, SEQ ID NO: 99, SEQ ID NO: 100, SEQ ID NO: 134, SEQ ID NO: 108, SEQ ID NO: 109, SEQ ID NO: 111, SEQ ID NO: 117, or SEQ ID NO: 119. In a still another embodiment, the guide RNA targets a base sequence of continuous 18 to 24 nucleotides in length, preferably 18 to 23 nucleotides in length, more preferably 18 to 22 nucleotides in length, in a region set forth in SEQ ID NO: 63, SEQ ID NO: 136, SEQ ID NO: 83, SEQ ID NO: 99, SEQ ID NO: 135, SEQ ID NO: 109, or SEQ ID NO: 111. In a yet another embodiment, the guide RNA targets a region comprising the whole or a part of the sequence set forth in SEQ ID NO: 43, SEQ ID NO: 44, SEQ ID NO: 46, SEQ ID NO: 62, SEQ ID NO: 63, SEQ ID NO: 66, SEQ ID NO: 68, SEQ ID NO: 70, SEQ ID NO: 71, SEQ ID NO: 72, SEQ ID NO: 73, SEQ ID NO: 80, SEQ ID NO: 81, SEQ ID NO: 82, SEQ ID NO: 83, SEQ ID NO: 85, SEQ ID NO: 86, SEQ ID NO: 88, SEQ ID NO: 91, SEQ ID NO: 96, SEQ ID NO: 99, SEQ ID NO: 100, SEQ ID NO: 103, SEQ ID NO: 105, SEQ ID NO: 106, SEQ ID NO: 108, SEQ ID NO: 109, SEQ ID NO: 111, SEQ ID NO: 117, or SEQ ID NO: 119. In another embodiment of the present invention, the guide RNA targets a region comprising the whole or a part of the sequence set forth in SEQ ID NO: 63, SEQ ID NO: 70, SEQ ID NO: 71, SEQ ID NO: 83, SEQ ID NO: 99, SEQ ID NO: 105, SEQ ID NO: 106, SEQ ID NO: 109, or SEQ ID NO: 111. In still another embodiment of the present invention, the guide RNA targets a region comprising the whole or a part of the sequence set forth in SEQ ID NO: 70, SEQ ID NO: 81, SEQ ID NO: 83, or SEQ ID NO: 99. In one embodiment of the present invention, the guide RNA targets a region comprising the whole or a part of the sequence set forth in SEQ ID NO: 83.
[0250] In one embodiment of the present invention, the guide RNA comprising the base sequence set forth in SEQ ID NO: 157, SEQ ID NO: 158, SEQ ID NO: 159, SEQ ID NO: 160, SEQ ID NO: 161, SEQ ID NO: 162, SEQ ID NO: 163, SEQ ID NO: 164, SEQ ID NO: 165, SEQ ID NO: 166, SEQ ID NO: 167, SEQ ID NO: 168, SEQ ID NO: 169, SEQ ID NO: 170, SEQ ID NO: 171, SEQ ID NO: 172, SEQ ID NO: 173, SEQ ID NO: 174, SEQ ID NO: 175, SEQ ID NO: 176, SEQ ID NO: 177, SEQ ID. NO: 178, SEQ ID NO: 179, SEQ ID NO: 180, SEQ ID NO: 181, SEQ ID NO: 182, SEQ ID NO: 183, SEQ ID NO: 184, SEQ ID NO: 185, or SEQ ID NO: 186, or the base sequence set forth in SEQ ID NO: 157, SEQ ID NO: 158, SEQ ID NO: 159, SEQ ID NO: 160, SEQ ID NO: 161, SEQ ID NO: 162, SEQ ID NO: 163, SEQ ID NO: 164, SEQ ID NO: 165, SEQ ID NO: 166, SEQ ID NO: 167, SEQ ID NO: 168, SEQ ID NO: 169, SEQ ID NO: 170, SEQ ID NO: 171, SEQ ID NO: 172, SEQ ID NO: 173, SEQ ID NO: 174, SEQ ID NO: 175, SEQ ID NO: 176, SEQ ID NO: 177, SEQ ID NO: 178, SEQ ID NO: 179, SEQ ID NO: 180, SEQ ID NO: 181, SEQ ID NO: 182, SEQ ID NO: 183, SEQ ID NO: 184, SEQ ID NO: 185, or SEQ ID NO: 186 in which 1 to 3 bases are deleted, substituted, inserted, and/or added respectively can be used. In one embodiment of the present invention, the guide RNA comprising the base sequence set forth in SEQ ID NO: 161, SEQ ID NO: 164, SEQ ID NO: 165, SEQ ID NO: 171, SEQ ID NO: 177, SEQ ID NO: 180, SEQ ID NO: 181, SEQ ID NO: 183, or SEQ ID NO: 184, or the base sequence set forth in SEQ ID NO: 161, SEQ ID NO: 164, SEQ ID NO: 165, SEQ ID NO: 171, SEQ ID NO: 177, SEQ ID NO: 180, SEQ ID NO: 181, SEQ ID NO: 183, or SEQ ID NO: 184 in which 1 to 3 bases are deleted, substituted, inserted, and/or added respectively can be used. In another embodiment of the present invention, the guide RNA comprising the base sequence set forth in SEQ ID NO: 164, SEQ ID NO: 169, SEQ ID NO: 171, or SEQ ID NO: 177, or the base sequence set forth in SEQ ID NO: 164, SEQ ID NO: 169, SEQ ID NO: 171, or SEQ ID NO: 177 in which 1 to 3 bases are deleted, substituted, inserted, and/or added respectively can be used. In still another embodiment of the present invention, the guide RNA comprising the base sequence set forth in SEQ ID NO: 171, or the base sequence set forth in SEQ ID NO: 171 in which 1 to 3 bases are deleted, substituted, inserted, and/or added respectively can be used.
6. Others
[0251] The present invention also provides a composition or kit comprising the following for repression of the expression of the human DMPK gene:
[0252] (e) a fusion protein of a nuclease-deficient CRISPR effector protein and a transcriptional repressor, or a polynucleotide encoding the fusion protein, and
[0253] (f) a guide RNA targeting a continuous region of 18 to 24 nucleotides in length in a region set forth in SEQ ID NO: 127, SEQ ID NO: 46, SEQ ID NO: 128, SEQ ID NO: 129, SEQ ID NO: 130, SEQ ID NO: 131, SEQ ID NO: 132, SEQ ID NO: 88, SEQ ID NO: 91, SEQ ID NO: 133, SEQ ID NO: 137, SEQ ID NO: 117, or SEQ ID NO: 119 in the expression regulatory region of human DMPK gene, or a polynucleotide encoding the guide RNA.
[0254] The present invention also provides a method for treating or preventing myotonic dystrophy type 1, comprising a step of administering the following (e) and (f):
[0255] (e) a fusion protein of a nuclease-deficient CRISPR effector protein and a transcriptional repressor, or a polynucleotide encoding the fusion protein, and
[0256] (f) a guide RNA targeting a continuous region of 18 to 24 nucleotides in length in a region set forth in SEQ ID NO: 127, SEQ ID NO: 46, SEQ ID NO: 128, SEQ ID NO: 129, SEQ ID NO: 130, SEQ ID NO: 131, SEQ ID NO: 132, SEQ ID NO: 88, SEQ ID NO: 91, SEQ ID NO: 133, SEQ ID NO: 137, SEQ ID NO: 117, or SEQ ID NO: 119 in the expression regulatory region of human DMPK gene, or a polynucleotide encoding the guide RNA.
[0257] The present invention also provides use of the following (e) and (f):
[0258] (e) a fusion protein of a nuclease-deficient CRISPR effector protein and a transcriptional repressor, or a polynucleotide encoding the fusion protein, and
[0259] (f) a guide RNA targeting a continuous region of 18 to 24 nucleotides in length in a region set forth in SEQ ID NO: 127, SEQ ID NO: 46, SEQ ID NO: 128, SEQ ID NO: 129, SEQ ID NO: 130, SEQ ID NO: 131, SEQ ID NO: 132, SEQ ID NO: 88, SEQ ID NO: 91, SEQ ID NO: 133, SEQ ID NO: 137, SEQ ID NO: 117, or SEQ ID NO: 119 in the expression regulatory region of human DMPK gene, or a polynucleotide encoding the guide RNA,
[0260] in the manufacture of a pharmaceutical composition for the treatment or prevention of DM1.
[0261] As the nuclease-deficient CRISPR effector protein, transcriptional repressor, guide RNA, as well as polynucleotides encoding them and vectors in which they are carried in these inventions, those explained in detail in the above-mentioned sections of “1. Polynucleotide”, “2. Vector” and “5. Ribonucleoprotein” can be used. The dose, administration route, subject, formulation and the like of the above-mentioned (e) and (f) are the same as those explained in the section of “3. Pharmaceutical composition for treating or preventing DM1”.
[0262] Other features of the invention will become apparent in the course of the following descriptions of exemplary embodiments which are given for illustration of the invention and are not intended to be limiting thereof.
EXAMPLES
Example 1. Screening of gRNAs for Human DMPK Gene Using, iCM and iDM Cells
(1) Experimental Methods
Selection of DMPK Targeting Sequences
[0263] Roughly 7.4 kb of sequence around the promoter region of the human DMPK gene (Chr19: GRCh38.p12; 45,777,342-45,784,715) was scanned for sequences that can be targeted by a nuclease-deficient SaCas9 (D10A and N580A mutant; dSaCas9 (SEQ ID NO: 139)) complexed with gRNA, defined herein as a targeting sequence. Targeting sequences were initially specified by the 19-21-nucleotide segment adjacent to a protospacer adjacent motif (PAM) having the sequence NNGRRT (5′-19-21 nt targeting sequence-NNGRRT-3′), and were filtered to include only those with a perfect match (targeting sequence and PAM sequences) for the corresponding region of the cynomolgus monkey (Macaca fascicularis) genome (listed as “TRUE” in Table 1). Additional 21-nucleotide targeting sequences were also selected that direct RNP to regions that exhibit high DNase sensitivity in DNase-Seq experiments curated by The ENCODE Project (The ENCODE Project Consortium, Nature. 2012 Sep. 6; 489(7414): 57-74; https://www.encodeproject.org).
Construction of Lentiviral Transfer Plasmid (pED162)
[0264] pLentiCRISPR v2 was purchased from Genscript (https://www.genscript.com) and the following modifications were made: the SpCas9 gRNA scaffold sequence was replaced by SaCas9 gRNA scaffold sequence (SEQ ID NO: 150); SpCas9 was replaced with dSaCas9 fused to Kruppel-associated box transcriptional repression domains (KRAB) with two NLSes sandwiching dSaCas9 (SV40 NLS-dSaCas9-NLS-KRAB [SEQ ID NO: 151 (DNA) and 152 (Protein)]); and the puroR cassette was replaced by a blastR cassette [SEQ ID NO: 153 (DNA) and SEQ ID NO: 154 (Protein)]. dSaCas9 was attached with two nuclear localization signal (NLS) in its N-terminus (amino acid sequence shown by SEQ ID NO: 188, DNA sequence shown by SEQ ID NO: 189) and C-terminus (amino acid sequence shown by SEQ ID NO: 190, DNA sequence shown by SEQ ID NO: 191) to enable efficient localization of the effector molecules to the nucleus. KRAB can repress gene expression when localized to promoters by inhibiting transcription (Gilbert L A, et al., Cell, 2013 Jul. 18; 154(2):442-51). KRAB was tethered to the C-terminus of dSaCas9 (D10A and N580A mutant), which is referred to as dSaCas9-KRAB hereinafter, and targeted to human DMPK promoter regions as directed by targeting sequences (
gRNA Cloning
[0265] Three control non-targeting targeting sequences (Table 1, SEQ ID NOs: 1 through 3) and 123 targeting sequences (Table 1, SEQ ID NOs: 4 through 126) were cloned into pED162. Forward and reverse oligos were synthesized by Integrated DNA Technologies in the following format: Forward; 5′ CACC(G)-19-21 basepair targeting sequence-3′, and Reverse: 5′ AAAC—19-21 basepair reverse complement targeting sequence-(C)-3′, where bases in parenthesis were added if the target did not begin with a G. Oligos were resuspended in Tris-EDTA buffer (pH 8.0) at 100 μM. 1.5 μl of each complementary oligo were combined in a 50 μl reaction in NE Buffer 3.1 (New England Biolabs (NEB) #B7203S). The reaction was heated to 95° C. in 1 L H.sub.2O and allowed to cool to 25° C., thus annealing oligos with sticky end overhangs compatible with cloning to pED162. Annealed oligos were combined with lentiviral transfer plasmid pED162 which had been digested with BsmBI and gel purified, and ligated with T4 DNA ligase (NEB #M0202S) according to manufacturer's protocol. 2 μl of the ligation reaction was transformed to NEB® Stable Competent cells (NEB #C30401) according to the manufacturer's protocol. The resulting construct drives expression of sgRNAs comprising crRNA encoded by individual targeting sequences fused to their 3′ end with tracrRNA (GUUUUAGUACUCUGGAAACAGAAUCUACUAAAACAAGGCAAAAUGCCGUGUUUAUCACGUC AACUUGUUGGCGAGAUUUUUU) (SEQ ID NO: 156), which is encoded from the SaCas9 gRNA scaffold sequence added with a termination signal of U6 polymerase TTTTTT, by a U6 promoter (SEQ ID NO: 155).
Lentivirus Generation
[0266] Lenti-Pac 293Ta Cell Line (Genecopoeia #LT008) was seeded at 0.8-1.0×10.sup.6 cells/well in 6 well cell culture dishes (VWR #10062-892) in 2 ml growth medium (DMEM media supplemented with 10% FBS and 2 mM fresh L-glutamine, 1 mM sodium pyruvate and MEM Non-Essential Amino Acids (Thermo Fisher #11140050)) and incubated at 37° C./5% CO.sub.2 for 24 hours. The next day TransIT-VirusGEN® transfection reactions (Mirus Bio #MIR6700) were set up according to manufacturer's protocol With 1.5 μg packaging plasmid mix [lug packaging plasmid (pCMV delta R8.2; addgene Plasmid #12263) and 0.5 μg envelope expression plasmid (pCMV-VSV-G; addgene Plasmid #8454)] and 1 μg of transfer plasmid pED162 containing sequence encoding dSaCas9-KRAB and indicated sgRNAs. Lentivirus was harvested 48 hours following transfection by passing media supernatant through a 0.45 μm PES filter (VWR #10218-488).
Transduction of iCM and iDM Cells
[0267] Immortalized non-DM control (Ctrl) myoblast (termed iCM) and immortalized DM1 myoblast (termed iDM) were obtained from Institut de Myologie which established these cell lines by the methods described in Dis Model Mech. 2017 Apr. 1; 10(4):487-497, which is incorporated herein by reference in its entirety. For transduction, cells were seeded at 0.05×10.sup.6 cells/well in 12 well cell culture dishes (VWR #10062-894) in 1 ml medium containing growth medium [PromoCell Skeletal Muscle Cell Growth Medium Kit; part number: C-23160 (note: media was supplemented with 20% FBS, rather than 5% as directed by kit, and 30 μg/ml Gentamicin S)] and incubated at 37° C./5% CO.sub.2 for 24 hours. The next day, the medium was replaced with 1 ml growth medium supplemented with 10 μg/ml Polybrene (Sigma #TR-1003-G) and 0.3 ml lentivirus supernatant (see above) corresponding to each sgRNA comprising crRNA encoded by individual targeting sequences (Table 1) fused with tracrRNA was added to each well. Cells were incubated with lentivirus for 48 hours before viral media was removed and replaced with selection media [growth media supplemented with 10 μg/ml Blasticidin (Thermo Fisher #A1113903)]. Following 48 hours of incubation in selection media one third of cells were passed into new wells (from 12 well plates) in growth media. After allowing cells to seed for 24 hours, growth media were replaced with selection media. Following 48 hours of culture in selection media, cells were harvested and RNA was extracted with RNeasy® 96 kit (Qiagen #74182) as directed by the manufacturer.
Gene Expression Analysis
[0268] For gene expression analysis, CDNA was generated from 0.2 μg of total RNA according to High-Capacity cDNA Reverse Transcription Kit (Thermo Fisher #4368813) protocol in a 20 μl volume. cDNA was diluted 10-fold and analyzed using Taqman™ Fast Advanced Master Mix (Thermo Fisher #4444557) according to the manufacturer's protocol. Taqman probes (DMPK: Assay Id Hs01094336 ml FAM; HPRT: Assay Id Hs99999909 ml VIC_PL) were obtained from Thermo Fisher. Taqman probe-based real-time PCR reactions were processed and analyzed by QuantStudio 5 Real-Time PCR system as directed by Taqman Fast Advanced Master Mix protocol.
Data Analysis
[0269] For each sample and three controls, deltaCt values were calculated by subtracting the average Ct values from 3 technical replicates of the HPRT probe from the DMPK probe (Average Ct DMPK—Average Ct HPRT). Expression values were determined for each sample using the formula 2.sup.−(deltaCt) Sample expression values (Table 1; SEQ ID NOs: 4-126) were then normalized to the average of 3 control expression values (Table 1; SEQ ID NOs: 1 to 3) for each experiment to determine the relative DMPK expression for each sample. Two biological replicates for each cell line were analyzed and the average from all the experiments was calculated (Table 1).
(2) Results
Repression of DMPK Gene Expression by the RNP
[0270] Lentivirus was produced that deliver expression cassettes for dSaCas9-KRAB and sgRNAs for each targeting sequence to iCM and iDM cells. Transduced cells were selected for resistance to blasticidin, and DMPK expression was quantitated using the Taqman Assay (Table 1). Expression values from each sample were normalized to an average of DMPK expression in cells transduced with control sgRNAs (Table 1; SEQ ID NOs: 1, 2 and 3). Average expression levels were measured across duplicates of iCM and iDM cell lines (Table 1; Average DMPK ALL and
Table 1 Targeting sequences used to screen expression regulatory region of DMPK gene
TABLE-US-00001 TABLE 1 plus Coordinate or iCM_RE_ iCM_RE_ iDM_RE_ iDM_RE_ Average SEQ (Chr19: nt minus Cyno- Rep1_ Rep2_ Rep1_ Rep2_ DMPK ID GRCh38.p12) length strand Sequence (5′.fwdarw.3′) Match DMPK DMPK DMPK DMPK ALL 1 NA 20 — acggaggctaagcgtcgcaa TRUE 87.02 87.02 91.11 91.11 89.06 2 HA 20 — cgcttccgcggcccgttcaa TRUE 113.39 113.39 115.89 115.89 114.64 3 NA 20 — gtaggcgcgccgctctctac TRUE 97.39 97.39 116.90 116.90 107.14 4 45777464 21 −1 cccttcttctttggcctcgac TRUE 138.8 73.27 97.97 144.53 113.64 5 45777440 21 1 cccagtcgaggccaaagaaga TRUE 120.25 39.62 103.63 129.09 98.15 6 45777515 21 −1 cccccggagacacggctgggc TRUE 99.27 55.29 113.56 81.75 87.47 7 45777507 21 1 ctccgggggacacagcaaccg TRUE 96.04 39.70 67.89 128.91 83.13 8 45777800 21 −1 ctgggacaggcagctacgggc TRUE 117.97 62.26 80.33 119.89 95.11 9 45777799 21 1 aggcccaccgcccacagcctg TRUE 195.53 68.11 105.18 131.07 124.97 10 45777823 21 1 gatctcgggggacaggtagtc TRUE 149.35 68.70 92.68 144.93 113.91 11 45777934 21 −1 gcccagagctggtgggcccag TRUE 128.08 62.02 73.11 139.73 100.74 12 45776175 21 1 gatgtggccacagcggtccag TRUE 127.90 70.42 — 154.76 117.69 13 45778185 21 1 cagcggtccagcaggatgttg TRUE 110.91 66.59 80.54 146.00 101.01 14 45778470 21 −1 gatagcaagcttgttccctgg TRUE 148.46 77.17 87.79 145.43 114.71 15 45778549 21 1 gtagaagcgcgccatctcggc TRUE 71.09 69.25 78.23 125.77 86.08 16 45778600 21 −1 actgctgagcaagtttgggga TRUE 62.07 116.61 130.87 131.02 110.14 17 45778652 21 −1 ccccttctcagtacctggtca TRUE 113.82 67.08 86.42 61.15 82.12 18 45778627 21 1 ctccatgaccaggtactgaga TRUE 92.43 73.49 79.85 70.43 79.05 19 45776638 21 1 ggtactgagaaggggttcgtc TRUE 122.63 98.65 108.90 111.73 110.48 20 45778758 21 −1 tggggctgcaggtctctgccc TRUE 89.95 128.02 122.31 100.95 110.31 21 45778902 21 −1 tcccagaacatctcaggggga TRUE 183.05 102.82 165.03 136.15 146.76 22 45778906 21 −1 tctttcccagaacatctcagg TRUE 58.11 64.67 49.83 39.37 52.99 23 45778946 21 −1 ctgggacctattctctgggtg TRUE 92.68 83.80 99.29 87.70 90.87 24 45778953 21 −1 ggagtgtctgggacctattct TRUE 109.17 124.48 129.33 95.68 114.671 25 45778975 21 −1 aacggggccactgcctaggga TRUE 94.69 95.11 89.77 73.35 88.23 26 45778955 20 1 tccctaggcagtggccccgt TRUE 88.30 92.69 79.72 98.60 89.83 27 45779018 20 −1 ggggggtctcttacctggaa TRUE 88.10 95.30 82.72 79.91 86.51 28 45779108 21 −1 ggggccttccctatctgagac FALSE 143.89 69.50 142.21 111.02 116.65 29 45779137 21 −1 tgcggtaagagggtgtgtcag FALSE 120.88 53.88 126.17 98.73 99.91 30 45779150 21 −1 gggaaagtctgtgtgcggtaa FALSE 107.77 73.33 124.12 121.33 106.64 31 45779196 21 −1 gggagaggaagctctaggatt TRUE 117.72 27.13 65.48 55.27 66.40 32 45779203 21 −1 ggaggtggggagaggaagctc TRUE 104.85 21.91 54.68 95.18 69.16 33 45779271 21 −1 actacctggtgagctccgggc TRUE 122.88 85.40 138.00 94.83 110.28 34 45779330 21 −1 gttggtgaatggggaccggcg TRUE — 12.04 24.88 137.55 58.16 35 45779347 21 −1 cgtgaggagagggacgtgttg TRUE 119.05 91.71 106.22 91.81 102.20 36 45779522 21 1 cctgaggtcgagatagtgaga FALSE 79.64 54.05 94.91 100.06 82.17 37 45779608 21 −1 tgggtgcagaagcgggtggag FALSE 86.59 72.53 99.66 98.20 89.24 38 45779613 21 −1 acggctgggtgcagaagcggg FALSE 87.68 78.74 58.35 94.72 79.87 39 45779720 21 −1 ggggcggggccttagaaattg FALSE 157.32 77.19 101.23 107.10 110.71 40 45779748 21 −1 gactcgtggtgggcggggcat FALSE 150.18 78.33 144.03 121.12 123.41 41 45779721 21 1 aacccctatgccccgcccacc FALSE 132.60 74.37 168.61 110.00 121.39 42 45779787 21 1 cgccccgcgtccgatcacctt TRUE 141.13 78.50 162.94 116.70 124.82 43 45779878 19 1 gtggtgggggaaaagaacc TRUE 45.08 48.99 45.68 45.89 46.41 44 45779966 21 −1 agagagaaggggagacagaca FALSE 42.68 24.74 47.03 39.60 38.51 45 45780114 21 1 tccaagggtgtgcaggatggt FALSE 138.00 49.69 77.81 82.81 87.08 46 45780119 21 1 gggtgtgcaggatggttaggg FALSE 42.45 24.16 42.40 66.67 43.92 47 45780127 21 1 aggatggttagggtggggtaa FALSE 110.52 59.01 88.97 88.04 86.64 48 45780194 21 −1 tttccttctccccttgttctt TRUE 125.85 65.70 144.19 124.99 115.18 49 45780225 21 −1 tcagggtggaaggtggaagaa FALSE 87.95 58.19 95.31 101.33 85.69 50 45780244 20 −1 cctgaactgtcacctggagt TRUE 104.19 90.84 79.54 117.75 98.08 51 45780244 20 −1 cctgaactgtcacctggagt TRUE 70.57 82.39 55.60 55.60 66.04 52 45780251 21 −1 ggctgcacctgaactgtcacc FALSE 63.71 49.98 55.08 88.96 64.43 53 45780286 21 −1 ggacattctacatgagaacgt FALSE 71.53 64.93 62.82 119.58 79.72 54 45780256 21 1 ccccacccccacgttctcatg FALSE 110.55 59.09 120.30 160.26 112.55 55 45780267 19 1 cgttctcatgtagaatgtc TRUE 94.64 96.41 89.90 75.60 89.14 56 45780284 21 1 tcctgggtaacggcccagacg FALSE 120.72 78.62 145.16 97.50 110.50 57 45780355 21 −1 tggttcaagaaccacctgcat FALSE 131.59 62.02 108.62 119.04 105.32 58 45780349 21 1 tgaaccacactttggaaaacc FALSE 139.28 108.34 145.53 80.53 118.42 59 45780519 21 −1 cctgattgtcatctgtaaata TRUE 109.23 110.74 120.19 97.35 109.38 60 45780526 21 1 agaagtcaaggtcctatgact TRUE 69.46 88.66 90.23 77.02 81.34 61 45780618 21 1 gacagggaggcctggactccc TRUE 123.54 114.65 127.61 94.15 114.98 62 45780650 21 1 aagtggaggcaggatggagag TRUE 50.95 39.97 40.95 40.91 43.20 63 45780654 21 1 ggaggcaggatggagagaggg TRUE 12.64 31.01 20.01 29.32 23.25 64 45780867 21 −1 gcctggggcgggggagggggc TRUE 62.65 103.41 70.14 79.23 78.86 65 45780888 21 1 agatgcagctcgggccacaaa TRUE 81.20 94.72 86.48 80.35 85.68 66 45780967 21 −1 gcagggtaaactgagaccggg TRUE 29.66 22.91 49.61 30.58 33.19 67 45781030 21 1 gggagaaggtttttccagagg TRUE 64.97 65.44 48.21 58.86 59.37 68 45781243 21 1 gacatatgagggccagagggg FALSE 32.32 24.32 33.78 35.39 31.46 69 45781252 21 1 gggccagaggggcagggtgct TRUE 84.09 66.39 119.69 62.95 83.28 70 45781282 21 1 agaaaccagtgaccagtgagc TRUE 23.14 20.64 23.21 21.86 22.22 71 45781387 21 −1 gcctggggccagggctggaag TRUE 20.97 10.79 40.92 25.22 24.48 72 45781498 21 −1 tcagccaccattcccgccacc FALSE 23.89 44.36 21.25 45.84 33.84 73 45781524 21 −1 gtctcggttcctatgagccgt FALSE 27.57 26.85 24.56 36.90 28.97 74 45781519 21 1 cgagactttggggctgggggt TRUE 73.14 34.44 75.45 88.95 67.99 75 45781523 21 1 actttggggctgggggtgggg TRUE 114.18 57.79 101.92 155.65 107.39 76 45781602 21 −1 gagggacaactttgggttctt TRUE 85.52 58.90 74.19 114.90 83.38 77 45781582 21 1 aagaacccaaagttgtccctc TRUE 120.44 42.36 70.41 105.09 84.58 78 45781648 21 1 tggttctcccacagggcccgc FALSE 104.83 47.04 54.25 71.38 69.38 79 45781819 21 1 catagagcccacttttggggg FALSE 89.86 74.17 85.96 56.05 76.51 80 45781967 21 −1 tgtgactcagagccatggctt FALSE 32.90 31.73 46.30 59.56 42.62 81 45781937 21 1 tgtgactcctaagccatggct TRUE 52.83 14.62 30.71 22.30 30.11 82 45781965 19 −1 tgactcagagccatggctt TRUE 43.14 45.50 25.17 38.77 38.14 83 45781997 21 −1 cagagtaaggtcagcagaggc TRUE 18.87 15.39 23.48 22.27 20.00 84 45781983 21 1 gctgaccttactctgcccctc TRUE 127.49 57.38 69.11 108.98 90.74 85 45782175 19 −1 gggctcctgcagatggggt TRUE 44.15 43.85 44.43 24.14 39.14 86 45782213 21 −1 tggccgacttcttgcagtggg TRUE 71.85 22.88 38.12 21.26 38.53 87 45782217 21 −1 tacgtggccgacttcttgcag TRUE 92.60 114.52 110.26 9.39 81.69 88 45782280 21 1 ggggctccagccccaggaagc TRUE 76.77 14.27 36.77 42.05 42.47 89 45782374 21 1 cccctccccgggccgggggct TRUE 130.26 77.49 110.57 131.13 112.36 90 45782563 21 −1 ggcgggaggggggctggacca TRUE 100.09 18.98 52.22 56.49 56.95 91 45782651 21 −1 attccccctactctagcactg FALSE 29.90 29.88 39.24 38.95 34.49 92 45782707 21 −1 ctctgtgctctacctttttat TRUE 121.48 65.22 146.53 256.57 147.45 93 45782805 21 −1 ggagcaagggggtggttgcta TRUE — 54.40 97.95 126.58 92.98 94 45782702 21 1 acagaggaagccacaggtgtg TRUE 138.42 60.02 96.44 — 98.29 95 45782893 19 1 gggaggccagggcagcttc TRUE 72.39 48.88 33.91 52.60 51.94 96 45782906 21 1 agcttcttgggtgactcagag TRUE 54.89 8.50 30.23 — 31.21 97 45782945 21 −1 tgtccgagtcggaatccatct TRUE 70.35 25.78 48.04 86.59 57.69 98 45782957 21 −1 gctaaatttaactgtccgagt TRUE 59.16 43.62 40.66 60.66 51.03 99 45782963 21 −1 ctgagggctaaatttaactgt TRUE 20.26 17.60 22.85 34.48 23.80 100 45783081 21 −1 ggtcacccctgttcaggctct TRUE 22.62 9.80 29.57 38.39 25.09 101 45783051 21 1 gggcaccctcagagcctgaac TRUE 97.13 33.39 52.77 66.97 62.57 102 45783167 21 −1 ccaggggccaaggagctattt TRUE 119.69 54.63 75.27 134.51 96.02 103 45783206 21 −1 gtttctaatcccagcctgggc TRUE 49.83 27.77 43.30 49.19 42.52 104 45783174 20 1 agccacattcctgcccaggc TRUE 80.51 64.79 81.96 86.44 78.42 105 45783198 21 1 attagaaacagaaacatttcg TRUE 24.86 14.08 21.43 22.78 20.79 106 45783205 21 1 acagaaacatttcggggggtg TRUE 30.70 9.33 18.48 32.23 22.68 107 45783273 21 −1 ctcttggctctcggagccgca FALSE 107.28 44.44 37.83 71.88 65.36 108 45783251 21 1 cctgcggctccgagagccaag FALSE 64.13 37.14 34.19 57.31 48.19 109 45783374 21 1 gaaactaggaggcaaggaccg FALSE 15.29 7.19 25.40 16.57 16.11 110 45783472 21 1 atgaggggccctggctgcggg FALSE 66.04 35.62 63.12 67.56 58.08 111 45783492 21 1 gcaggatgctcttctccccaa FALSE 25.51 13.73 34.08 12.31 21.41 112 45783516 21 1 ggtcctgctccagccgctggt FALSE 79.19 53.78 58.44 79.21 67.65 113 45783584 21 1 ccggcttttcctgctatgaaa TRUE 114.69 80.57 112.83 128.55 109.16 114 45783666 21 −1 gcagtccgctttccccagagg TRUE 60.18 58.59 47.44 45.52 52.93 115 45783655 21 1 aaagcggactgcctagaacca FALSE 83.49 29.31 29.64 74.09 54.13 116 45783834 21 −1 ttgctattgtctgtgcttttg TRUE 87.37 85.12 101.17 85.36 89.76 117 45783821 21 1 acagacaatagcaagggcagc TRUE 36.68 36.14 42.16 52.36 41.83 118 45783956 21 1 gaccagtcacatgctggggac TRUE 53.49 79.58 84.52 58.10 68.92 119 45783962 21 1 tcacatgctggggacagggat TRUE 16.32 32.12 31.38 23.36 25.80 120 45784192 21 1 atggctaggaggctgggggca TRUE 67.44 80.24 82.09 78.30 77.02 121 45784257 19 −1 ggcacagtggtgtgaagcc TRUE 100.96 107.71 94.81 92.64 99.03 122 45784350 21 1 gtcaaggggagggagccagcc TRUE 88.94 97.88 86.05 78.71 87.89 123 45784387 21 1 gctgccaccctggccttgccc TRUE 74.58 91.91 94.32 27.60 72.10 124 45784627 21 −1 tgagttctttccccagcacct TRUE 99.38 101.58 87.81 106.90 98.92 125 45784649 21 −1 gtggtagaggtaggactgtcc TRUE 86.07 — 51.37 — 68.72 126 45784636 21 1 cctacctctaccactgacttg TRUE 111.67 112.66 120.50 — 114.94
[0271] In Table 1, “Coordinate” indicates the coordinate of the 5′ end of each sequences set forth in SEQ ID NOs: 4-126.
[0272] 30 targeting sequences showed a reduction in DMPK expression of not less than 50% (SEQ ID NOs: 43, 44, 46, 62, 63, 66, 68, 70, 71, 72, 73, 80, 81, 82, 83, 85, 86, 88, 91, 96, 99, 100, 103, 105, 106, 108, 109, 111, 117 and 119), nine targeting sequences showed a reduction in DMPK expression of not less than 75% (SEQ ID NOs: 63, 70, 71, 83, 99, 105, 106, 109 and 111), and one targeting sequence showed a reduction in DMPK expression of not less than 80% (SEQ ID NO: 109).
[0273] Zones were identified and characterized based on the likelihood of the system described above of suppressing the expression of DMPK. In Zone 1 (
Example 2 Adeno-Associated Virus (AAV) Production
(1) Experimental Methods
[0274] Construction of plasmids for delivery and expression of dSaCas9-KRAB:gRNA and generation of AAV
[0275] pAAV-CMV was purchased from Takara (#6230) and EFS promoter sequence (SEQ ID NO: 204) and SV40 NLS-dSaCas9-NLS-KRAB (SEQ ID NO: 151) with an additional terminal stop codon [SEQ ID NO: 200 (DNA) and SEQ ID NO: 152 (protein)] were subcloned from pED162 (see Example 1). A bGlobin polyA sequence (SEQ ID NO: 201), U6 promoter sequence (SEQ ID No: 202), and SaCas9 gRNA scaffold sequence (SEQ ID NO: 150) were subcloned from pED0001 (SEQ ID NO: 203), thus replacing sequences encoding all functional components of pAAV-CMV (i.e. CMV promoter, beta-globin intron, MCS, and hGH polyA) between the ITRs. Finally, the EFS promoter was replaced with the CK8 promoter (SEQ ID NO: 187) by restriction cloning (XhoI and AgeI), resulting in plasmid pED148. The targeting sequence set forth in SEQ ID NO: 83, 70, 81, or 99 was cloned by digesting pED148 with BsaI, thus generating overhangs compatable with annealed synthetic oligos. Synthetic oligos were designed such that the forward primer had CACC(G) sequence at the 5′ end [5′CACC-(G)-targeting sequence-3′], and the reverse primer contained an additional AAAC sequence at the 5′ end [5′AAAC—reverse complement targeting sequence-(C)-3′]. An additional G was added to the beginning of the targeting sequence to enhance expression from the U6 promoter. The generated plasmids were named pED148-h695 (comprising the targeting sequence set forth in SEQ ID NO: 83), pED148-h245 (comprising the targeting sequence set forth in SEQ ID NO: 70), pED148-h257 (comprising the targeting sequence set forth in SEQ ID NO: 81), and pED148-h269 (comprising the targeting sequence set forth in SEQ ID NO: 99), respectively.
Adeno-Associated Virus (AAV) Production
[0276] Adeno-associated virus serotype 9 (AAV9) particles were generated using 293T cells (ATCC #CRL-3216) seeded at a density of 0.86×10.sup.7 cells per Hyperflask (Corning #10030) and cultured in DMEM media (Sigma #D5796) supplemented with 10% FBS. Four days after seeding, media was changed to DMEM media supplemented with 2% FBS and 63 mM HEPES (Gibco #15630-080). The pRC9 plasmid was constructed as follows: AAV9 capsid sequence (see JP5054975B) was subcloned into a pRC2-mi342 vector (Takara #6230) replacing with that of AAV2 capsid sequence. Cells were transfected with 135 μg of the pRC9 plasmid, 121 μg of pHelper vector included in AAVpro® Helper Free System (Takara #6230) and 133 μg of one of pED148-h695, with 388 μl PEipro® in vitro DNA Transfection Reagent (Polyplus #115-010) per Hyperflask. After 3 days, 0.2% TritonX-100 was added to Hyperflask and cells were harvested.
[0277] After harvesting, its supernatant and cell lysate were clarified with cartridge filters (GE Healthcare #KGF-A-0506GG, KMP-HC9206GG). After the clarification, it was ultra filtrated with tangential flow filtration using the hollow fiber using the Xampler™ Ultrafiltration Cartridge, 750 kD (GE Healthcare #UFP-750-C-6MA). After reducing the volume, the sample was subjected to affinity chromatography (POROS™ CaptureSelect™ AAVX Affinity Resin (ThermoFisher Scientific #A36739)) for purifying AAV. Following the affinity chromatography step, the eluted sample was subjected to density gradient centrifugation for separating AAV from intermediate AAV particles. AAV particles separated with CsCl density gradient centrifugation, were subjected to buffer exchange with dialysis of phosphate buffered saline. After the buffer exchange, the AAV sample was concentrated using the Amicon® Ultra-4 Centrifugal Filter Unit (Merck millipore #UFC801024) and sterilized using the Millex-GV Syringe Filter Unit, 0.22 μm (Merck millipore #SLGV033RS). The AAV genome was purified with DNeasy Blood and Tissue Kit (QIAGEN #69506). The titer of purified AAV genome was measured using AAVpro® Titration Kit (for Real Time PCR) (Takara #6233). Resulting AAV denotes AAV9-695.
[0278] AAVs using pED148-h245, pED148-h257, or pED148-h269, were manufactured as described above and named AAV9-245, AAV9-257, and AAV9-269, respectively. Each of AAV9-695, AAV9-245, and AAV9-257 was manufactured twice and used for in vitro and in vivo experiments.
(2) Results
[0279] Genome titer of the AAVs is shown in Table 2.
TABLE-US-00002 TABLE 2 Concentration Lot AAV name (vg/mL) No. AAV9-695 2.8 × 10.sup.12 Lot 1 AAV9-245 3.6 × 10.sup.12 Lot 1 AAV9-257 4.5 × 10.sup.12 Lot 1 AAV9-269 5.5 × 10.sup.12 Lot 1 AAV9-695 3.6 × 10.sup.13 Lot 2 AAV9-245 3.7 × 10.sup.13 Lot 2 AAV9-257 4.6 × 10.sup.13 Lot 2
Example 3. In-Vitro Pharmacological Evaluation of Recombinant AAV9 Carrying the Base Sequence Encoding dSaCas9, Transcriptional Repressor and sgRNA on DMPK Gene Repression
(1) Experimental Methods
Cell Culture and AAV Infection
[0280] iCM cells were suspended in skeletal muscle cell growth medium kit (Promocell #C23060) (note: media was supplemented with 20% FBS, rather than 5% as directed by the kit, and 50 μg/ml Gentamicin S) and seeded into a Collagen type I-Coated 24 well plate (IWAKI #4820-010) at a density of 20,000 cells in 900 μl of medium per well. For AAV infection, 100 μl PBS with 0.001% Pluronic™ F-68 (GE healthcare #SH30594.01) containing 2.8, 3.6, 4.5, or 5.5×10.sup.12 vg/ml of AAV9-695, AAV9-245, AAV9-257, or AAV9-269 were added to the medium and cultured and incubated at 37° C./5% CO.sub.2 for 2 days. For control wells, 100 μl PBS with 0.001% Pluronic F-68 was added to the medium. The experiment was performed in tripricate. The media was replaced with differentiation media (DMEM media (Thermo Fisher #61965-026) supplemented with 10 μg/ml insulin (Sigma #19278)) and the cells were cultured for 4 days at 37° C. with 5% CO.sub.2. After washing with 500 μl PBS, total RNA was extracted using RNeasy Plus Mini Kit (Qiagen #74134) according to the manufacturer's instruction. RNA from cells without AAV infection was set as control and shown as Ctrl in
Gene Expression Analysis
[0281] For Taqman qPCR, 80 ng of total RNA was converted to cDNA using SuperScript™ VILO™ cDNA Synthesis Kit (Thermo Fisher #11754250) in 20 μl reaction volume. The cDNA was diluted 160 fold with water and 2 μl was used for the qPCR. The qPCR was run in 5 μl final volume containing Taqman probes for DMPK (Thermo Fisher #Hs01094329 ml, FAM) or GAPDH (Thermo Fisher #Hs99999905_m1, FAM), and Taqman™ Gene Expression Master Mix (Thermo Fisher #4369016) with QuantStudio™ 12K Flex Real-Time PCR System (Thermo Fisher). The qPCR cycling condition was as follows: 95° C. for 10 minutes after 50° C. for 2 minutes followed by 45 cycles of 95° C. for 15 seconds and 60° C. for 1 minutes. The data were analyzed with QuantStudio™ 12K Flex software (Thermo Fisher). The expression values were analyzed with the standard curve for each gene and the expression level of DMPK gene was normalized to that of GAPDH gene.
(2) Results
[0282] By applying AAV9-695, AAV9-245, AAV9-257, or AAV9-269 into iCM cells, DMPK mRNA downregulation was found, which suggests AAV9 carrying transgenes of dSaCas9, KRAB, and sgRNA comprising crRNA encoded by the targeting sequence set forth in SEQ ID NO: 83, 70, 81 or 99, has a pharmacological effect on DMPK downregulation in human muscular cells (
Example 4. Suppression of DMPK Gene Expression in DMSXL Mice
(1) Experimental Methods
Animal Treatment
[0283] AAV9-695, AAV9-245, or AAV9-257 was injected to DMSXL homo mice (termed DMSXL mice), transgenic mice carrying the human DM1 locus and very large expansions >1,000 CTG (PLoS Genet. 2012; 8(11):e1003043), intravenously (male n=2 and female n=2, in total n=4, respectively). Doses were as follows; 1.5×10.sup.13 vg/kg, 5×10.sup.13 vg/kg, 1.5×10.sup.14 vg/kg, and 5×10.sup.14 vg/kg for AAV9-695, AAV9-245, and AAV9-257, respectively. As a control, PBS containing 0.001% Pluronic F-68 (GE healthcare #SH30594.01) was injected. After 4 weeks, DMSXL mice were sacrificed and samples collected (tibialis anterior (TA), heart, and liver) from these mice. Gene expression analysis were performed on these samples as follows. Samples were stored in −80° C. freezing chamber until RNA extraction.
RNA Extraction and Gene Expression Analysis
[0284] Tissue samples were homogenized using TissueLyser II (Qiagen) in 1 ml of ISOGEN (NIPPON GENE #319-90211). After centrifugal separation, 700 μl of supernatant was transferred to 1.5 ml tube containing 150 μl of chloroform (Wako #034-02603). After voltex and centrifuge, 187 μl of water layer was added to 150 μl of isopropanol (WAKO #166-04836) and mixed. The RNA extract was transferred to RNeasy spin columns of RNeasy® Plus Mini Kit (QIAGEN #74134) and further purified following manufacturer's protocol.
[0285] For Taqman qPCR, 700-1,000 ng of total RNA was converted to cDNA using SuperScript™ VILO™ cDNA Synthesis Kit (Thermo Fisher #11754250) in 20 μl reaction volume. The cDNA was diluted 20 fold with water and 3-4 μl was used for the qPCR. The qPCR was run in 10 μl final volume containing Taqman probes for DMPK (Thermo Fisher #Hs01094329 ml, FAM) or GAPDH (Thermo Fisher #Mm99999915_g1, FAM), and Taqman Gene Expression Master Mix (Thermo Fisher #4369016) with QuantStudio™ 12K Flex Real-Time PCR System (Thermo Fisher). The qPCR cycling condition was as follows: 95° C. for 10 minutes after 50° C. for 2 minutes followed by 40-45 cycles of 95° C. for seconds and 60° C. for 1 minutes. The data were analyzed with QuantStudio™ 12K Flex software (Thermo Fisher). The expression values were analyzed with the standard curve for each gene and the expression level of DMPK gene was normalized to that of GAPDH gene.
(2) Results
[0286] AAV9-695, AAV9-245, and AAV9-257 expressed each transgene in mice. DMPK mRNA downregulation was not found in liver but found in skeletal muscles and cardiac muscles, which suggests AAV9 carrying the transgene of dSaCas9, KRAB, and sgRNA comprising crRNA encoded by the targeting sequence set forth in SEQ ID NO: 83, 70 or 81 has a pharmacological effect on DMPK downregulation in DMSXL mice (
Example 5. Improvement of RNA Foci Formation by AAV9-695 Administration to DMSXL Mice
(1) Experimental Methods
Fluorescence In Situ Hybridization: FISH
[0287] Administrations of AAV9-695 (5×10.sup.14 vg/kg) or vehicle (PBS containing 0.001% Pluronic F-68) as a control to DMSXL mice were conducted as described in Example 4. 4 weeks after administration, tibialis anterior (TA) muscles of DMSXL mice were excised and collected. After immediately embedded in Tissue-Tek® O.C.T. Compound (Sakura Finetek Japan, #4583), tissues were frozen in cold isopentane which is pre-chilled in liquid nitrogen and stored at −80° C.
[0288] 10 μm of frozen sections of the tissue were prepared by a cryostat microtome and the thin sections were put on glass slides. The slides were air-dried and fixed with 4% paraformaldehyde at room temperature for 15 minutes and washed twice with PBS for 2 minutes and stored at 4° C.
[0289] After incubation in PBS containing 2% acetone for 5 minutes at room temperature, the slides were incubated in 2×saline sodium citrate buffer (SSC) (300 mM NaCl and 30 mM Sodium Citrate) containing 30% formamide for 10 minutes at room temperature. The slides were incubated in probe solution (0.02% bovine serum albumin (SIGMA #A7030-100G), 0.066 mg/ml yeast tRNA (Thermo Fisher #15401-011), 2 mM ribonucleoside vanadyl complex (SIGMA #R3380-5ML), and 1 ng/μl Cy3-(CAG)5-2′-OMe probe (y_C(M)A(M)G(M)C(M)A(M)G(M)C(M)A(M)G(M)C(M)A(M)G(M)C(M)A(M)G(M), y means Cy3 and N(M) means 2′-OMe RNA. This probe was synthesized by GeneDesign, Inc., Japan) in 2×SSC containing 30% formamide) for 2 hours at 37° C. After hybridization, the probe solution was removed and the slides were incubated in 2×SSC containing 30% formamide for 30 minutes at 50° C. The slides were washed once with 1×SSC and incubated in 1×SSC for 30 minutes at room temperature. The slides were washed three times with PBS for 10 minutes and ProLong™ Diamond Antifade Mountant with DAPI (Thermo Fisher #P36971) was added to the slide. The slides were covered with cover slips and stored at 4° C.
[0290] Formation of RNA foci were observed using confocal laser microscope LSM700 (ZEISS).
(2) Results
[0291] Typical images of TA muscle section of DMSXL mice administered with the vehicle or AAV9-695 are shown in
[0292] The numbers of RNA foci observed in TA muscles of AAV9-695-administered DMSXL mice were lower than in TA muscles of vehicle-administered DMSXL mice, suggesting that AAV9-695 administration improved RNA foci formations in DMSXL mice.
Example 6. Suppression of DMPK Gene Expression in hDMPK sgRNA-Expressing iDM Cells
(1) Experimental Methods
Lentivirus Generation
[0293] Lenti-X™ 293T Cells (Takara #632180) were seeded at 5×10.sup.6 cells/dish in collagen type I-coated dish 100 mm (IWAKI #4020-010) in 10 ml DMEM (Thermo Fisher #10569-010) supplemented with 10% FBS and MEM Non-Essential Amino Acids Solution (Thermo. Fisher #11140050)) and incubated at 37° C./5% CO.sub.2 overnight. The next day Lipofectaminen™ 3000 Transfection Reagent (Thermo Fisher #L3000008) was set up according to manufacturer's protocol with 7 μg of Lentiviral High Titer Packaging Mix (Takara #6194) and 5.5 μg of transfer plasmid pED162 containing sequence encoding dSaCas9-KRAB and indicated targeting sequence set forth in SEQ ID NO: 1 or 83 (Example 1). Plasmids are named as described in Table 3. 10 ml of media containing lentivirus was harvested 48 hours following transfection by passing media supernatant through a 0.45 μm filter. To concentrate virus solution, ¼ volume of PEG-It™ Virus Precipitation Solution (SBI #LV810A-1) was added and incubated overnight at 4° C. The supernatant was centrifuged at 1,500×g for 30 minutes. After discarding the supernatant, 200 μl of DMEM was added to the tube and virus solution was resuspended gently and stored at −80° C.
TABLE-US-00003 TABLE 3 plasmid SEQ ID NO pED162-C1 1 pED162-695 83
[0294] Lentivirus titers ranged from 5×10.sup.10 to 7×10.sup.10 particles/ml, measured by using NucleoSpin® RNA Virus (MACHEREY-NAGEL #740956.250) and Lenti-X™ qRT-PCR Titration Kit (Clontech #631235).
Transduction of iDM Cells
[0295] iDM cells were seeded at 50,000 cells/well in collagen type I-coated 12 well plate (IWAKI #4815-010) in 1 ml medium containing growth medium [PromoCell Skeletal Muscle Cell Growth Medium Kit; part number: C-23060 (note: media was supplemented with 20% FBS, rather than 5% as directed by kit, and 50 μg/ml Gentamicin S)] and incubated at 37° C./5% CO.sub.2 overnight. The next day, the medium was replaced with 1 ml growth medium supplemented with 5 μg/ml Polybrene (Sigma, #TR-1003-G) and 0.03 ml lentivirus supernatant (see above) corresponding to each sgRNA comprising crRNA encoded by individual targeting sequences (SEQ ID No: 1 or 83) fused with tracrRNA was added to each well. Cells were incubated with lentivirus for 48 hours before viral media was removed and replaced with selection media [growth media supplemented with 10 μg/ml Blasticidin (Nacalai #03759-71)]. Following 24 hours of incubation in selection media one third of cells were passed into new wells with growth media. After allowing cells to seed for 72 hours, growth media were replaced with selection media. Following 48 hours of culture in selection media, cells were harvested and stocked.
Transduction of iCM Cells
[0296] iCM cells were seeded at 50,000 cells/well in collagen type I-coated 6 well plate (IWAKI #4810-010) in 2 ml medium containing growth medium [PromoCell Skeletal Muscle Cell Growth Medium Kit; part number: C-23060 (note: media was supplemented with 20% FBS, rather than 5% as directed by kit, and 50 μg/ml Gentamicin S)] and incubated at 37° C./5% CO.sub.2 overnight. The next day, the medium was replaced with 2 ml is growth medium supplemented with 5 μg/ml Polybrene (Sigma #TR-1003-G) and 2×10.sup.9 vg lentivirus supernatant (see above) corresponding to Control sgRNA comprising crRNA encoded by individual targeting sequence (SEQ ID No: 1) fused with tracrRNA was added to each well. Cells were incubated with lentivirus for 48 hours before viral media was removed and replaced with selection media [growth media supplemented with 10 μg/ml Blasticidin (Nacalai #03759-71)]. Following 24 hours of incubation in selection media, two third of cells were passed into collagen type I-coated dish 100 mm (iwaki #4020-010) with growth media. After allowing cells to seed for 72 hours, growth media were replaced with selection media. Following 48 hours of culture in selection media, cells were harvested and stocked.
Cell Culture, RNA Extraction, and cDNA Preparation
[0297] iDM cells expressing dSaCas9 and hDMPK sgRNA comprising crRNA encoded by the targeting sequence set forth in SEQ ID: 83, iDM cells expressing dSaCas9 and control sgRNA comprising crRNA encoded by the targeting sequence set forth in SEQ ID NO: 1, and iCM cells expressing dSaCas9 and control sgRNA comprising crRNA encoded by the targeting sequence set forth in SEQ ID NO: 1, termed iDM-695 cells (iDM_695), iDM-Ctrl cells (iDM_Ctrl), and iCM-Ctrl cells (iDM_Ctrl) respectively, were seeded into a collagen type I-coated 24 well plate (IWAKI #4820-010) at a density of 25,000 cells in 500 μl or 50,000 cells per well in in 1 ml of skeletal muscle cell growth medium kit (Promocell #C23060) supplemented with 20% of non-heat inactivated FBS and incubated at 37° C./5% CO.sub.2 for 2 days (seeded at 50,000 cells/well) or 3 days (seeded at 25,000 cells/well).
[0298] After washing with 200 μL PBS, total RNA was extracted using RNeasy Mini Kit (Qiagen #74106) according to the manufacturer's instruction.
[0299] 500 ng of total RNA was converted to cDNA using SuperScript™ VILO™ cDNA Synthesis Kit (Thermo Fisher #11754-250) according to the manufacturer's instruction. The cDNA was stored at −20° C.
Gene Expression Analysis
[0300] The cDNA was diluted 100-fold with water and 2 μl was used for the qPCR. The qPCR was run in 10 μl final volume containing Taqman probes for DMPK (Thermo Fisher #Hs01094329 ml, FAM) or for GAPDH (Thermo Fisher #Hs99999905 ml, FAM), and Taqman Gene Expression Master Mix (Thermo Fisher #4369016) with ViiA7 Real Time PCR System (Thermo Fisher). The qPCR condition was as follows: pre-heated with 50° C. for 2 minutes and 95° C. for 10 minutes followed by 45 cycles of 95° C. for 15 seconds and 60° C. for 1 minutes. The expression values were analyzed with the standard curve for each gene and the expression level of DMPK gene was normalized to that of GAPDH gene.
(2) Results
[0301] Expressions of DMPK gene in iDM-695 cells and those in -iDM-Ctrl cells are shown in
[0302] DMPK gene expression was suppressed in hDMPK sgRNA-expressing iDM cells.
Example 7. Improvement of RNA Foci Formation in hDMPK sgRNA-Expressing iDM Cells
(1) Experimental Methods
Fluorescence In Situ Hybridization: FISH
[0303] iDM-695 cells, iDM-Ctrl cells, and iCM-Ctrl cells, which were constructed in Example 6, were seeded quadruplicate into a collagen-coated 96 well plate (Thermo Fisher Scientific #152038) at a density of 2,500 cells or 5,000 cells per well in skeletal muscle cell growth medium kit (Promocell #C23060) supplemented with 20% of non-heat inactivated FBS and incubated at 37° C./5% CO.sub.2 for 2 days (seeded at 5,000 cells/well) or 3 days (seeded at 2,500 cells/well).
[0304] The cells were washed twice with phosphate buffered saline (PBS), fixed with 4% paraformaldehyde at room temperature for 15 minutes, washed twice with PBS, and stored at 4° C.
[0305] After incubation in PBS containing 0.2% Triton X-100 for 10 minutes at room temperature, the cells were washed and incubated in 2×SSC containing 40% formamide for 10 minutes at room temperature. 50 μl of probe solution (0.02% bovine serum albumin (SIGMA #A7030-100G), 0.066 mg/ml yeast tRNA (Thermo Fisher Scientific #15401-011), 2 mM ribonucleoside vanadyl complex (SIGMA #R3380-5ML), and 0.1 ng/μl Cy3-(CAG)5-LNA probe (y_5(L)A(L)G(L)cagcagcag5(L)A(L)G(L), y means Cy3, 5(L) means LNA-mC, N(L) means LNA, and lower case means DNA. This probe was synthesized by GeneDesign, Inc.) in 2×SSC containing 40% formamide) was added to each well and the cells were incubated for 2 hours at 37° C. After hybridization, the probe solution was removed and the cells were incubated in 2×SSC containing 40% formamide for 30 minutes at 37° C. The cells were washed once with 1×SSC and incubated in 1×SSC for 30 minutes at room temperature. 50 μl of PBS containing 2 μg/ml DAPI (Dojindo #340-07971) was added to each well and the cells were incubated for 30 minutes at room temperature. The cells were washed twice with PBS for 5 minutes at room temperature and stored at 4° C.
[0306] Formation of RNA foci was detected and analyzed using IN Cell Analyzer 6000 (GE healthcare). The images of 9 points in each well were captured and the number of RNA foci positive nuclei and the total number of nuclei in each image were counted. The ratio of foci positive nuclei in each well was analyzed and averages were calculated.
(2) Results
[0307] Typical images of iDM-695 cells and iDM-Ctrl cells are shown in
[0308] The ratios of RNA foci positive nuclei in each cell are shown in
[0309] The ratios of RNA foci positive nuclei in iDM-695 cells were lower than those in iDM-Ctrl cells.
Example 8. Improvement of Splicing Defects in hDMPK sgRNA-Expressing iDM Cells
(1) Experimental Methods
Splicing Analysis
[0310] Preparations of cDNAs from iDM-695 cells, iDM-Ctrl cells, and iCM-695 cells were described in Example 6.
[0311] PCR was conducted using PrimeSTAR® GXL DNA Polymerase (TaKaRa #R050A) according to the manufacturer's instruction. The cDNA was diluted 10-fold with water and 1 μl was used. The PCR primers used were as follows:
TABLE-US-00004 TABLE 4 Target Forward 5′.fwdarw.3′ Reverse 5′.fwdarw.3′ DMD exon 78 TTAGAGGAGGTGATGGAGCA GATACTAAGGACTCCATCGC (SEQ ID NO: 192) (SEQ ID NO: 193) MBNL1 exon 7 GCTGCCCAATACCAGGTCAAC TGGTGGGAGAAATGCTGTATGC (SEQ ID NO: 194) (SEQ ID NO: 195) KIF13A exon 21 ACCTGTGCAGCATTCAGGGACAC CTCGTCGTTTAATGAGTGCATCTG (SEQ ID NO: 196) (SEQ ID NO: 197) TNNT2 exon 5 ATAGAAGAGGTGGTGGAAGAGTAC GTCTCAGCCTCTGCTTCAGCATCC (SEQ ID NO: 198) (SEQ ID NO: 199)
[0312] The PCR cycle condition was as follows: 35 cycles of 98° C. for 10 seconds, 60° C. for 15 seconds, and 68° C. for 30 seconds followed by 72° C. for 7 minutes.
[0313] The PCR products were loaded on Agilent DNA1000 Kit (Agilent #5067-1504), electrophoresed, and analyzed using Agilent 2100 BioAnalyzer system according to the manufacturer's instruction.
[0314] AUCs of the peaks of normally and abnormally spliced products were measured, and the ratios of the normally spliced products in each cell were calculated.
(2) Results
[0315] Gel images and exon patterns of each gene, i.e. DMD, MBNL1, KIF13A, and TNNT2, are shown in
[0316] The ratios of normally spliced products, which are more abundant in iCM cells and less in iDM cells, in each cell are shown in
[0317] Splicing defects of all the genes tested were improved in iDM-695 cells.
[0318] Where a numerical limit or range is stated herein, the endpoints are included. Also, all values and subranges within a numerical limit or range are specifically included as if explicitly written out.
[0319] As used herein the words “a” and “an” and the like carry the meaning of “one or more.”
[0320] Obviously, numerous modifications and variations of the present invention are possible in light of the above teachings. It is therefore to be understood that, within the scope of the appended claims, the invention may be practiced otherwise than as specifically described herein.
[0321] All patents and other references mentioned above are incorporated in full herein by this reference, the same as if set forth at length.
INDUSTRIAL APPLICABILITY
[0322] According to the present invention, expression of DMPK gene can be suppressed in the cells derived from DM1 patients and the DM1 model mice. Therefore, the present invention is expected to be extremely useful for the treatment and/or prevention of DM1.