USE OF P44 AS MARKER FOR DIAGNOSING ANAPLASMOSIS
20220235399 · 2022-07-28
Assignee
Inventors
Cpc classification
C12Q1/6883
CHEMISTRY; METALLURGY
International classification
Abstract
A novel use of P.sub.44 as a marker for predicting or diagnosing anaplasmosis including a diagnostic composition and a diagnostic kit is disclosed. A diagnostic composition for anaplasmosis containing a P.sub.44 gene, a primer set or probe for detecting Anaplasma phagocytophilum, a kit for diagnosing anaplasmosis, and a method for providing information to diagnose infection with Anaplasma phagocytophilum are also disclosed. P.sub.44, which is a novel biomarker for diagnosing anaplasmosis, is a multi-copy gene and exists in a large number of copies in the Anaplasma phagocytophilum genome, thus having the effect of detecting Anaplasma phagocytophilum infection at high sensitivity using only a small amount of DNA compared to conventional diagnostic marker genes. In addition, the primer set or probe for detecting and amplifying P.sub.44 is capable of providing rapid and easy detection of anaplasmosis with high specificity and sensitivity, making it appropriate for early detection of anaplasmosis.
Claims
1. (canceled)
2. (canceled)
3. A diagnostic composition for anaplasmosis comprising a substance for measuring a level of a P.sub.44 gene or P.sub.44 protein.
4. The diagnostic composition according to claim 1, wherein the substance for measuring the level of the P.sub.44 gene is a primer or probe that specifically binds to the P.sub.44 gene or P.sub.44 mRNA.
5. The diagnostic composition according to claim 4, wherein the primer is selected from the group consisting of: a primer set consisting of primers having sequences of SEQ ID NOS: 3 and 4; a primer set consisting of primers having sequences of SEQ ID NOS: 5 and 6; a primer set consisting of primers having sequences of SEQ ID NOS: 7 and 8; a primer set consisting of primers having sequences of SEQ ID NOS: 9 and 10; a primer set consisting of primers having sequences of SEQ ID NOS: 9 and 11; a primer set consisting of primers having sequences of SEQ ID NOS: 12 and 13; and a primer set consisting of primers having sequences of SEQ ID NOS: 14 and 15, and the probe is selected from the group consisting of probes having sequences of SEQ ID NOS: 16 to 27.
6. The diagnostic composition according to claim 3, wherein the substance for measuring the level of the P.sub.44 protein is an antibody that specifically recognizes the P.sub.44 protein.
7. (canceled)
8. (canceled)
9. A diagnostic kit for anaplasmosis comprising the diagnostic composition according to claim 3.
10. The diagnostic kit according to claim 9, wherein the diagnostic kit comprises at least one selected from the group consisting of: a primer set consisting of primers having sequences of SEQ ID NOS: 3 and 4; a primer set consisting of primers having sequences of SEQ ID NOS: 5 and 6; a primer set consisting of primers having sequences of SEQ ID NOS: 7 and 8; a primer set consisting of primers having sequences of SEQ ID NOS: 9 and 10; a primer set consisting of primers having sequences of SEQ ID NOS: 9 and 11; a primer set consisting of primers having sequences of SEQ ID NOS: 12 and 13; a primer set consisting of primers having sequences of SEQ ID NOS: 14 and 15; and a probe consisting of probes having sequences of SEQ ID NOS: 16 to 27.
11. A method for detecting anaplasmosis infection using the diagnostic kit for anaplasmosis comprising the diagnostic composition according to claim 3.
12. The method according to claim 11, comprising performing polymerase chain reaction (PCR) using any one primer set selected from the group consisting of: a primer set consisting of primers having sequences of SEQ ID NOS: 3 and 4; a primer set consisting of primers having sequences of SEQ ID NOS: 5 and 6; a primer set consisting of primers having sequences of SEQ ID NOS: 7 and 8; a primer set consisting of primers having sequences of SEQ ID NOS: 9 and 10; a primer set consisting of primers having sequences of SEQ ID NOS: 9 and 11; a primer set consisting of primers having sequences of SEQ ID NOS: 12 and 13; and a primer set consisting of primers having sequences of SEQ ID NOS: 14 and 15, or any one probe selected from the group consisting of probes having sequences of SEQ ID NOS: 16 to 27.
13. The method according to claim 11, wherein the diagnosis is performed using a PCR method selected from the group consisting of conventional polymerase chain reaction (C-PCR: conventional PCR), nested polymerase chain reaction (N-PCR: nested PCR), multiple polymerase chain reaction, real-time polymerase chain reaction, real-time quantitative polymerase chain reaction, and loop-mediated isothermal amplification (LAMP).
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0025] The aforementioned and other objects, features and other advantages of the present disclosure will provide a clearly understanding from the following detailed description taken in conjunction with the accompanying drawings, in which:
[0026]
DETAILED DESCRIPTION
[0027] The present disclosure is characterized by identifying the fact that P.sub.44 can be used as a novel biomarker that can accurately and quickly diagnose anaplasmosis at an early stage.
[0028] In particular, when searching a method to enhance the speed and accuracy of anaplasmosis diagnosis, the present inventors identified that P.sub.44, a multi-copy gene present in A. phagocytophilum, can be used as a novel biomarker for diagnosing anaplasmosis.
[0029] In particular, the novel biomarker targeted by the present disclosure is a multi-copy gene. The reason for this is that the multi-copy gene exists as a repeating sequence in a gene cluster, allowing multiple copies to exist in one cell, resulting in extremely high sensitivity. Therefore, a biomarker capable of detecting A. phagocytophilum was screened from multi-copy genes.
[0030] It was found that, among them, P.sub.44 is capable of specifically detecting A. phagocytophilum with higher sensitivity than other polyclonal genes when used as a marker.
[0031] Accordingly, the present disclosure provides a composition as a diagnostic marker for anaplasmosis containing a P.sub.44 gene.
[0032] Anaplasmosis (human granulocytic anaplasmosis, HGA) is also known as zoonosis, and infects humans, dogs, cattle, sheep, goats, horses and wild animals, and the causative pathogen thereof is a bacterium called “Anaplasma phagocytophilum” that is obligately parasitic within cells.
[0033] Therefore, “anaplasmosis” in the present disclosure refers to a disease caused by infection with Anaplasma phagocytophilum.
[0034] As used herein, the term “diagnosis” refers to determine a subject's susceptibility to a certain disease or disorder, determine whether or not a subject currently has a specific disease or disorder, or determine the prognosis of a subject with a specific disease or disorder, or therametrics (e.g., monitoring the condition of a subject to provide information about therapeutic efficacy).
[0035] As used herein, the term “marker” refers to a substance that can be used to determine whether or not a subject is infected with Anaplasma phagocytophilum, or a substance that can be used to distinguish a subject with anaplasmosis caused by infection with Anaplasma phagocytophilum from a normal subject, and includes organic biomolecules such as polypeptides or nucleic acids (e.g., mRNA), lipids, glycolipids, glycoproteins, sugars (monosaccharides, disaccharides, oligosaccharides, and the like). For the purposes of the present disclosure, the diagnostic marker for anaplasmosis may be a P44 gene or a protein expressed by the gene.
[0036] Preferably, the P.sub.44 gene of the present disclosure may include the nucleotide sequence of SEQ ID NO: 1, and the P.sub.44 protein expressed by the gene may include the amino acid sequence of SEQ ID NO: 2.
[0037] In addition, the present disclosure provides a diagnostic composition for anaplasmosis containing a substance for measuring the level of the P.sub.44 gene or P.sub.44 protein.
[0038] That is, the diagnostic composition can detect Anaplasma phagocytophilum, the causative pathogen of anaplasmosis, and the detection may be performed using polymerase chain reaction (PCR).
[0039] The substance for measuring the level of the P.sub.44 gene may be a primer or probe that specifically binds to the P.sub.44 gene or P.sub.44 mRNA, and preferably, the primer is selected from the group consisting of: a primer set consisting of primers having sequences of SEQ ID NOS: 3 and 4, a primer set consisting of primers having sequences of SEQ ID NOS: 5 and 6, a primer set consisting of primers having sequences of SEQ ID NOS: 7 and 8, a primer set consisting of primers having sequences of SEQ ID NOS: 9 and 10, a primer set consisting of primers having sequences of SEQ ID NOS: 9 and 11, a primer set consisting of primers having sequences of SEQ ID NOS: 12 and 13, and a primer set consisting of primers having sequences of SEQ ID NOS: 14 and 15, and the probe may be selected from the group consisting of probes having sequences of SEQ ID NOS: 16 to 27.
[0040] In addition, the substance for measuring the level of the P.sub.44 protein may be an antibody that specifically recognizes the P.sub.44 protein.
[0041] The diagnostic composition of the present disclosure may contain at least one component, for example, a buffer solution for reaction, dNTP, Mg.sup.2+ ions, and DNA polymerase, that may be used for polymerase chain reaction (PCR), in addition to the respective primer sets or probe described above.
[0042] The buffer solution for reaction may be 1 to 10 mM Tris HCl or 10 to 40 mM KCl (pH 9.0), and the dNTP may comprise at least one of dATP, dTTP, dGTP, and dCTP.
[0043] The diagnostic composition may include a stabilizer and/or a non-reactive dye to improve experimental convenience, stability, and reactivity.
[0044] The non-reactive dye should be selected from substances that do not affect the polymerase chain reaction, and is intended to be used for analysis or identification using the polymerase chain reaction product. Substances that satisfy these requirements may be water-soluble dyes such as rhodamine, TAMRA, sodium hypochlorite (household lax), bromophenol blue, xylene cyanol, bromocresol red, and cresol red.
[0045] The diagnostic composition may be provided in a liquid form, and is preferably provided in a dried state to increase stability, convenience of storage, and long-term storage. The drying may be performed by a known drying method such as general room-temperature drying, heat drying, freeze drying, or vacuum drying, but any drying method may be used as long as it does not cause loss of components of the composition. The drying method described above may vary depending on the type and amount of the enzyme that is used.
[0046] The diagnostic composition is produced and utilized in a stable manner by mixing in a single reaction tube, followed by freezing or drying, thus requiring no separate mixing steps during the polymerase chain reaction. Therefore, errors due to mixing during the reaction can be prevented and stability, reactivity, and storability can be improved.
[0047] A commercially available product that contains ingredients other than the primer set or probe, namely, buffer solution for reaction, dNTP, Mg.sup.2+ ion, and DNA polymerase, may be utilized as the diagnostic composition.
[0048] The present disclosure further includes a primer set or probe that is capable of specifically detecting Anaplasma phagocytophilum.
[0049] The primer or probe according to the present disclosure may be a primer or probe that specifically binds to P.sub.44 identified in the present disclosure in order to rapidly and accurately detect Anaplasma phagocytophilum, and the primer is preferably selected from the group consisting of: a primer set consisting of primers having sequences of SEQ ID NOS: 3 and 4, a primer set consisting of primers having sequences of SEQ ID
[0050] NOS: 5 and 6, a primer set consisting of primers having sequences of SEQ ID NOS: 7 and 8, a primer set consisting of primers having sequences of SEQ ID NOS: 9 and 10, a primer set consisting of primers having sequences of SEQ ID NOS: 9 and 11, a primer set consisting of primers having sequences of SEQ ID NOS: 12 and 13, and a primer set consisting of primers having sequences of SEQ ID NOS: 14 and 15.
[0051] In addition, preferably, the probe may be selected from the group including SEQ ID NOS: 16 to 27.
[0052] In particular, the primer or probe designed in the present disclosure aims to enable rapid and accurate detection of Anaplasma phagocytophilum at an early stage, and can specifically bind to and/or amplify the multi-copy gene P.sub.44, and is useful for polymerase chain reaction (PCR).
[0053] Furthermore, the present disclosure provides a diagnostic kit for detecting Anaplasma phagocytophilum.
[0054] The diagnostic kit contains the diagnostic composition for anaplasmosis of the present disclosure as described above.
[0055] Using the diagnostic kit, the present disclosure also provides a method of providing information for diagnosing whether or not a subject is infected with Anaplasma phagocytophilum
[0056] Specifically, the present disclosure provides a method of providing information to diagnose infection with anaplasmosis, the method including mixing a DNA-containing sample isolated from a biological sample obtained from a subject suspected of having contracted anaplasmosis with the diagnostic composition of the present disclosure as described above, performing a reaction to amplify the reaction mixture, and analyzing the resultant amplification product.
[0057] The diagnostic composition includes the above-described primer set or probe prepared in the present disclosure, and the reaction to amplify the reaction mixture may be performed by a polymerase chain reaction (PCR) method.
[0058] In addition, the analysis method for diagnosis is selected from the group that includes but not limited to conventional polymerase chain reaction (C-PCR: conventional PCR), nested polymerase chain reaction (N-PCR: nested PCR), multiple polymerase chain reaction, real-time polymerase chain reaction, real-time quantitative polymerase chain reaction, and loop-mediated isothermal amplification (LAMP), but is not limited thereto.
[0059] The subject suspected of having anaplasmosis is one who have been infected or suspected of having being infected with Anaplasma phagocytophilum, and may be selected from domestic animals such as ticks, rats, wild animals, cattle, pigs, sheep, goats, deer, horses, companion animals such as dogs and cats, and humans.
[0060] The biological sample may be a body fluid or secretion of the subject and examples thereof include, but are not limited to, blood, serum, plasma, lymph, cerebrospinal fluid, tissue fluid, or the like, or urine, tears, saliva, milk, vomit, feces, and the like, which are secretions from the body, and the biological sample may preferably be blood.
[0061] Hereinafter, the present disclosure will be described in more detail with reference to examples. The examples are provided only for illustration of the present disclosure, and should not be construed as limiting the scope of the present disclosure.
EXAMPLE 1
Production of Primers and Probes for Detecting and Diagnosing Anaplasmosis
[0062] While performing research to discover a novel biomarker enabling detection of anaplasmosis quickly, accurately, and with high sensitivity, the present inventors visited the Chosun University Hospital. They chose P.sub.44 as a target gene that can be used as a biomarker for anaplasmosis diagnosis from among multiple-copy genes that exhibit differences in expression from normal subjects in blood obtained from patients diagnosed with anaplasmosis and infected with the A. phagocytophilum strain, and produced primers and probes capable of specifically amplifying P.sub.44 as shown in Table 1, and in particular, designed the primers and probes of the present disclosure shown in Table 1 so as to diagnose anaplasmosis with high sensitivity through only simple PCR.
TABLE-US-00001 TABLE 1 Assay Name Primer, Probes Base Sequence Position Length Tm SEQ ID No. Product Ana P44 Sense Primer GGATGGAAAGAGTGTAAAG 90 19 59.1 3 154 Ana P44 Anti-sense Primer CTCGTAACCAATCTCAAG 243 18 58.5 4 Ana P44 Anti-sense Probe CACCACCAATACCATAACCAACACTG 214 26 69 16 Ana P44 Sense Primer GGATGGAAAGAGTGTAAAG 90 19 59.1 3 154 Ana P44 Anti-sense Primer CTCGTAACCAATCTCAAG 243 18 58.5 4 Ana P44 Anti-sense Probe TACCATAACCAACACTGCCTTCCATA 205 26 69 17 Ana P44 Sense Primer GGATGGAAAGAGTGTAAAG 90 19 59.1 3 154 Ana P44 Anti-sense Primer CTCGTAACCAATCTCAAG 243 18 58.5 4 Ana P44 Anti-sense Probe CAATACCATAACCAACACTGCCTTCC 208 26 69.1 18 Ana P44 Sense Primer GGATGGAAAGAGTGTAAAG 90 19 59.1 3 154 Ana P44 Anti-sense Primer CTCGTAACCAATCTCAAG 243 18 58.5 4 Ana P44 Anti-sense Probe CCAATACCATAACCAACACTGCCTTC 209 26 69.1 19 Ana P44 Sense Primer GGATGGAAAGAGTGTAAAG 90 19 59.1 3 154 Ana P44 Anti-sense Primer CTCGTAACCAATCTCAAG 243 18 58.5 4 Ana P44 Anti-sense Probe ATACCATAACCAACACTGCCTTCCATA 206 27 69.1 20 Ana P44 Sense Primer GGATGGAAAGAGTGTAAAG 90 19 59.1 3 154 Ana P44 Anti-sense Primer CTCGTAACCAATCTCAAG 243 18 58.5 4 Ana P44 Anti-sense Probe TACCATAACCAACACTGCCTTCCA 205 24 69.2 21 Ana P44 Sense Primer GCTATGGAAGGCAGTGTTGG 178 20 55.98 5 73 Ana P44 Anti-sense Primer TGAAGCGCTCGTAACCAATC 231 20 55.77 6 Ana P44 Anti-sense Probe AGCTCAACCCTGGCACCACCA 207 21 63.17 22 Ana P44 Sense Primer ACAGTCCAGCGTTTAGCAAG 8 20 55.59 7 190 Ana P44 Anti-sense Primer CCAACACTGCCTTCCATAGC 178 20 55.98 8 Ana P44 sense Probe TGACTGGAACACTCCTGATCCTCGGA 126 26 62.7 23 Ana P44 Sense Primer CCTGATCCTCGGATTGGGTT 139 20 56.16 9 81 Ana P44 Anti-sense Primer CCTGGCACCACCAATACCAT 200 20 57.02 10 Ana P44 Anti-sense Probe CCAACACTGCCTTCCATAGCTACAAGC 171 27 62.02 24 Ana P44 Sense Primer CCTGATCCTCGGATTGGGTT 139 20 56.16 9 117 Ana P44 Anti-sense Primer GGTCTTGAAGCGCTCGTAAC 236 20 56.45 11 Ana P44 Anti-sense Probe AGCTCAACCCTGGCACCACCA 207 21 63.17 25 Ana P44 Sense Primer TATTGGTGGTGCCAGGGTT 204 19 55.97 12 156 Ana P44 Anti-sense Primer AGGTTATCAGTCTGCCCAGT 340 20 55.02 13 Ana P44 Anti-sense Probe ACCCTTGGTCTTGAAGCGCTCGT 239 23 63.22 26 Ana P44 Sense Primer ACAAGTTTGACTGGAACACTCC 119 22 55.47 14 101 Ana P44 Anti-sense Primer CCTGGCACCACCAATACCAT 200 20 57.02 15 Ana P44 Anti-sense Probe CCAACACTGCCTTCCATAGCTACAAGC 171 27 62.02 27
EXAMPLE 2
Detection Sensitivity Analysis of the Present Disclosure Using Primers and Probe for Detecting Anaplasmosis
[0063] A test was performed to determine whether or not the primer and probe for detecting anaplasmosis of the present disclosure devised in Example 1 can quickly detect anaplasmosis with high sensitivity.
[0064] For this purpose, first, among patients who visited Chosun University Hospital from 2016 to 2017, blood from 15 patients diagnosed with anaplasmosis and blood from 15 patients diagnosed with a disease other than anaplasmosis were selected for testing.
[0065] Anaplasmosis was defined as a case in which the amount of an antibody against A. phagocytophilum increased more than fourfold in immunofluorescence antibody assay (IFA), and the positive control used herein was blood collected from 15 confirmed patients. In addition, the negative control used herein was blood obtained from 15 patients in whom an antibody was not detected by immunofluorescence antibody assay (IFA) and who were diagnosed with diseases other than anaplasmosis. Each of the blood samples obtained above was centrifuged, a buffy coat was collected therefrom, genomic genes were extracted therefrom, and PCR was performed using the primers or probes of the present disclosure shown in Table 1 to analyze the diagnostic potential and sensitivity of anaplasmosis. In addition, regarding comparative groups, PCR analysis was performed on 16S rRNA (GenBank: CP000235), ankA (GenBank: AF020521) and groEL-STG (GenBank: CP000235) genes. These genes are known to be conventional anaplasmosis diagnostic markers as template DNA. Using specific primers to compare the detection sensitivity of P.sub.44, a novel biomarker identified in the present disclosure, as well as the primers and probes for detecting the same.
TABLE-US-00002 TABLE 2 PCR method Groel C-PCR AnkA PCR 16S PCR MSP2 C-PCR P44 C-PCR 16S N-PCR P44 Q-PCR Case Control Case Control Case Control Case Control Case Control Case Control Case Control Test positive 6 0 6 0 6 0 6 0 11 0 11 0 15 0 Test negative 9 15 9 15 8 15 9 15 4 15 4 15 0 15 Total 15 15 15 15 14 15 15 15 15 15 15 15 15 15 Sensitivity, % (95% Cl) 40(17-67) 40(17-67) 43( 9-70) 43( 9-70) 73(45-91) 73(45-91) 100(75-100) Specificity, % (95% Cl) 100(75-100) 100(74-100) 100(74-100) 100(75-100) 100(75-100) 100(75-100) 100(75-100) PPV, % (95% Cl) 100(52-100) 100(52-100) 100(52-100) 100(52-100) 100(68-100) 100(68-100) 100(75-100) NPV, % (95% Cl) 63(41-80) 63(41-80) 65(43-83) 65(43-83) 79(54-93) 79(54-93) 100(75-100) Time 3-4h 3-4h 3-4h 3-4h 3-4h 6-7h 1-2h
[0066] In addition, the respective primer sequences used for the test are shown in Table 3 below, and PCR was respectively performed under the conditions described in Tables 4 and 5 below.
TABLE-US-00003 TABLE 3 Product SEQ ID size PCR Primer Primer Name Primer Sequence NO. (bp) groEL N-PCR 1st GRO607F GAAGATGCWGTWGGWTGTACKGC 28 688 1.sup.st PCR Forward 1st Reverse GRO1294R AGMGCTTCWCCTTCWACRTCYTC 29 groEL N-PCR 2nd GRO677F ATTACTCAGAGTGCTTCTCARTG 30 445 2.sup.nd PCR/C-PCR Forward 2nd GRO1121R TGCATACCRTCAGTYTTTTCAAC 31 Reverse ankA N-PCR 1st ANK-F1 GAAGAAATTACAACTCCTGAAG 32 705 1.sup.st PCR Forward 1st Reverse ANK-R1 CAGCCAGATGCAGTAACGTG 33 ankA N-PCR 2nd ANK-F2 TTGACCGCTGAAGCACTAAC 34 664 2.sup.nd PCR/C-PCR Forward 2nd ANK-R2 ACCATTTGCTTCTTGAGGAG 35 Reverse 16s N-PCR 1st AE1-F AAGCTTAACACATGCAAGTCGAA 36 1406 1.sup.st PCR Forward 1st Reverse AE1-R AGTCACTGA CCCAACCTTAAATG 37 16s N-PCR 2nd EE-3 GTCGAACGGATTATTCTTTATAGCTTGC 38 926 2.sup.nd PCR/C-PCR Forward 2nd EE-4 CCCTTCCGTTAAGAAGGATCTAATCTCC 39 Reverse msp2(P44) C- Forward msp2F ATGTCCATGGCTATAGTCATGGCTG 40 430 PCR Reverse msp2R ACCTCGAGTTAAGCTAACTCCTTAGCT 41 msp2 N-PCR 1st Anapmsp21F TTATGATTAGGCCTTTGGGCATG 42 1079 1.sup.st PCR Forward 1st Reverse Anapmsp21R TCAGAAAGATACACGTGCGCCC 43 msp2 N-PCR 2nd Anapmsp22F GGTTACATAAGGGCCGCAAAGGTG 44 467 2.sup.nd PCR Forward 2nd Anapmsp22R CCGGCGCATGTGTAAGGTGAAA 45 Reverse P44 Q-PCR Forward anaP44 90F GGATGGAAAGAGTGTAAAG 46 153 Reverse anaP44 243R CTCGTAACCAATCTCAAG 47 Probe anaP44 anti- [TET]CACCACCAATACCATAACCAACACT 48 214P [BHQ1]
TABLE-US-00004 TABLE 4 groEL N-PCR groEL N-PCR ankA N-PCR ankA N-PCR lstPCR 2ndPCR/C-PCR lstPCR 2ndPCR/C-PCR Step Temperature Time Temperature Time Temperature Time Temperature Time 1 95 5 m 95 5 m 95 5 m 95 5 m 2 95 30 s 95 3 s 95 3 s 95 30 s 3 54 30 s 50 3 s 53 30 s 52 30 s 4 72 90 s 72 60 s 72 60 s 72 60 s 5 Step 2 35 cycle Step 2 5 cycle Step 2 35 cycle Step2 5 cycle 6 72 5 m 95 30 s 72 5 m 95 5m 7 53 30 s 54 30 s 8 72 60 s 72 30 s 9 Step 6 5 cycle Step 6 60 s 10 95 30 s 72 5 m 11 57 30 s 12 72 60 s 13 Step 10 25 cycle 14 72 5 m
TABLE-US-00005 TABLE 5 16s N-PCR 16s N-PCR 2.sup.nd PCR msp2(P44) 1.sup.st PCR /C-PCR C-PCR Step Temperature Time Temperature Time Temperature Time 1 95 5m 95 5m 95 5 m 2 95 30 s 95 30 s 95 30 s 3 59 3O s i56 30 s 56 30 s 4 72 90 s 72 60 s 72 60 s 5 Step 2 35 cycle Step 2 30 cycle Step 2 35 cycle 6 72 5 m 72 5m 72 5 m msp2 N-PCR msp2 N-PCR P44 1st PCR 2nd PCR Q-PCR Step Temperature Time Temperature Time Temperature Time 1 95 5 m 95 5m ps 5 m 2 95 30 s 95 30 s 95 5 s 3 54 30 s 57 i3O s 51 5 s 4 72 60 s 72 60 s Scan TET 5 Step 2 35 cycle Step 2 35 cycle Step 2 45 cycle 6 72 5 m 72 5 m 25 1 m
[0067] As shown in Table 2 and
[0068] In addition, the diagnostic sensitivity of anaplasmosis, obtained through detection of P.sub.44, was 100% when the primer devised in the present disclosure was used, indicating that sensitivity and accuracy are very high. In contrast, it was found that the diagnostic sensitivity of conventionally used target genes (16S rRNA, ankA, groEL-STG) was low.
[0069] In addition, it was found that when C-PCR was performed using the P.sub.44 gene of the present disclosure, the analysis time was considerably shorter than when N-PCR was performed using other target genes. When real-time PCR (Q-PCR) was performed on P.sub.44 gene, 100% sensitivity was obtained, which has much higher sensitivity and specificity than markers and detection primers that have been developed and used to date, indicating that the P.sub.44 gene may accurately detect and diagnose anaplasmosis.
[0070] As previously stated, P.sub.44, which is a novel biomarker for diagnosing anaplasmosis according to the present disclosure, is a multicopy gene that exists in a large number of copies in the Anaplasma phagocytophilum genome, allowing detection of Anaplasma phagocytophilum infection with high sensitivity using only a small amount of DNA compared to conventional diagnostic marker genes. In addition, the primer set or probe for detecting and amplifying P.sub.44 according to the present disclosure is capable of quickly and simply detecting anaplasmosis with high specificity and sensitivity, and is thus useful for early diagnosis of anaplasmosis.
[0071] Although the preferred embodiments of the present disclosure have been disclosed, those skilled in the art will appreciate that various modifications, additions and substitutions are possible, without departing from the scope and spirit of the disclosure as disclosed in the accompanying claims. Therefore, the disclosed embodiments should be considered from an illustrative point of view rather than a limiting point of view. The scope of the present disclosure is defined by the claims rather than the aforementioned description, and all differences falling within the scope of equivalents thereto should be construed as falling within the scope of the present disclosure.