APTAMER SPECIFICALLY BINDING TO KRAS PROTEIN AND METHOD FOR USING SAME

Abstract

Provided are an aptamer specifically binding to KRAS protein, and a method of using the same. An aptamer of one aspect has excellent binding affinity to KRAS, which is a major factor regulating a cell growth signaling system in vivo, to inhibit binding between KRAS mutant in cancer cells and a Raf-1 kinase protein which is a downstream protein constituting the cell growth signaling system, thereby effectively suppressing cancer cell growth and cancer development. Further, the aptamer may specifically bind to KRAS in cancer cells, and thus may be widely applied to a pharmaceutical composition for treating or preventing cancer, a diagnostic agent, a reagent, etc.

Claims

1. An aptamer which specifically binds to KRAS protein and comprises a nucleotide sequence consisting of SEQ ID NO: 1 or SEQ ID NO: 2.

2. The aptamer of claim 1, further comprising consecutive polynucleotides of 5 to 50 nucleotides at any one or more of the 5′ end and the 3′ end of the aptamer.

3. The aptamer of claim 2, wherein the consecutive polynucleotides are primer sequences.

4. The aptamer of claim 2, wherein the aptamer comprises any one of nucleotide sequences consisting of SEQ ID NOS: 3 to 6.

5. The aptamer of claim 2, wherein the aptamer comprises two or more stem-loop structures.

6. The aptamer of claim 5, wherein the loop structure consists of 4 to 10 nucleotides.

7. The aptamer of claim 1, wherein the aptamer is labeled at any one or more of the 5′ end and the 3′ end with one or more fluorescent materials selected from the group consisting of a fluorescent dye, a semiconductor nanocrystal, a lanthanide chelate, and a green fluorescent protein.

8. The aptamer of claim 1, wherein the aptamer inhibits binding between the KRAS protein and Raf-1 protein.

9. A pharmaceutical composition for preventing or treating cancer, the pharmaceutical composition comprising the aptamer of claim 1 as an active ingredient.

10. The pharmaceutical composition of claim 9, wherein the cancer is one or more selected from the group consisting of lung cancer, laryngeal cancer, stomach cancer, colon/rectal cancer, liver cancer, gallbladder cancer, pancreatic cancer, breast cancer, ovarian cancer, uterine cancer, cervical cancer, prostate cancer, kidney cancer, osteosarcoma, myosarcoma, liposarcoma, melanoma, leukemia, lymphoma, blood cancer, and tumors arising from nerve tissue.

11. A composition for detecting cancer cells, the composition comprising the aptamer of claim 1.

12. A kit for detecting cancer cells, the kit comprising the aptamer of claim 1.

13. A method of providing information for diagnosing cancer, the method comprising bringing a biological sample into contact with the aptamer of claim 1 to form an aptamer-KRAS complex; measuring a level of the aptamer-KRAS complex; and comparing the measured level of the aptamer-KRAS complex with a level of a control group and diagnosing as cancer when the measured level is higher than that of the control group.

14. A method of preventing or treating cancer, the method comprising administering the aptamer of claim 1 to an individual in need thereof.

Description

BRIEF DESCRIPTION OF DRAWINGS

[0061] FIG. 1 is an illustration showing that a KRAS protein-specific aptamer is able to regulate a tumor growth signaling system induced by interaction between KRAS and Raf-1;

[0062] FIGS. 2A, 2B, and 2C show results of ELISA experiments to examine binding affinity between KRAS.sup.G12D protein and selected aptamers, respectively;

[0063] FIGS. 3A, 3B, 3C, and 3D show secondary structures predicted from nucleotide sequences of four finally selected aptamers, NBK1 (FIG. 3A), NBK1-1 (FIG. 3B), NBK2 (FIG. 3C), and NBK2-1 (FIG. 3D);

[0064] FIG. 4 shows results of ELISA experiments showing that binding between KRAS.sup.G12D and Raf-1 protein may be inhibited by the selected four kinds of aptamers; and

[0065] FIG. 5 shows images (FIG. 5, top) of fluorescence detection of actual binding affinity between KRAS protein and NBK1 and NBK2 aptamers transfected into a pancreatic cancer cell line BxPC-3, and results of measuring cell viability using a CellTiter-Glo (FIG. 5, bottom).

MODE OF DISCLOSURE

[0066] Hereinafter, an aspect will be described in more detail with reference to embodiments and experimental embodiments. However, these embodiments and experimental embodiments are only for illustrating an aspect, and the scope of an aspect is not limited to these embodiments and experimental embodiments. Embodiments and experimental embodiments of an aspect are provided to more fully explain an aspect to those skilled in the art.

Example 1. Mass Production and Isolation of KRAS Protein and Raf-1 (RAS Binding Domain) Protein

[0067] For KRAS expression, a pReceiver-B01 (Genecopoeia) gene having 6-histidine tags at the N-terminus and encoding a wild-type KRAS gene was purchased. To prepare a vector for KRAS.sup.G12D mutant protein expression, the gene was amplified by polymerase chain reaction (PCR) using a forward primer (F: GTAGTTGGAGCTGATGGCGTAGGCAAG) and a reverse primer (R: CTTGCCTACGCCATCAGCTCCAACTAC). As a result, 6-histidine-tagged human KRAS wild-type loaded with GDP and KRAS.sup.G11D mutant protein loaded with GMPPNP were obtained. For protein expression, transformation into E. coli Rosetta DE3 was performed, followed by incubation using luria-bertani (LB) at 37° C. until OD.sub.600 reached about 0.6. Thereafter, to induce protein expression, 0.1 mM β-D-1-thiogalactopyranoside (IPTG) was added. Incubation was performed at 37° C. for 2 hours and 30 minutes, and then a cell pellet was recovered. The recovered E. coli cells were disrupted with a sonicator using a lysis buffer containing 50 mM tris-HCl (pH 7.5), 500 mM NaCl, 0.1% triton X-100, 14.3 mM β-mercaptoethanol, 1 mM PMSF, and 10% glycerol, and a soluble fraction was obtained by centrifugation. Affinity chromatography was performed using a HisTrap HP column. Thereafter, dialysis was performed using a desalting column, and additional purification was performed using an ion-exchange chromatography column.

Example 2. Preparation of KRAS Wild-Type and KRAS.SUP.G12D .(GMPPNP Loaded Form) Protein

[0068] Using the protein purified in Example 1, KRAS wild-type protein was dialyzed against a GDP exchange buffer containing 50 mM Tris-HCl (pH 8), 1 mM DTT, and 2 mM MgCl.sub.2, followed by adding 45 times GDP and about 20 mM EDTA. Incubation was performed at 30° C. for 30 minutes, and 50 mM MgCl.sub.2 was further added, followed by incubation at 4° C. for 30 minutes. Then, the protein was dialyzed against a buffer solution containing 25 mM Tris-HCl (pH 7.5), 100 mM NaCl, 2 mM MgCl.sub.2, 1 mM DTT, and 10% glycerol. KRAS.sup.G12D protein was dialyzed against an exchange buffer containing 40 mM Tris-HCl (pH 7.5), 200 mM (NH.sub.4).sub.2SO.sub.4, 10 μM ZnCl.sub.2, and 5 mM DTT GMPPNP. 45 times GMPPNP and alkaline phosphate beads were added, followed by incubation at 25° C. for 90 minutes. Thereafter, the beads were removed and then dialyzed against the same buffer as used for the KRAS wild-type protein.

Example 3. Selection of Aptamer Specifically Binding to KRAS and Identification of Structure Thereof

[0069] An experiment was performed to effectively select an aptamer that specifically binds only to KRAS protein. A single-stranded DNA aptamer capable of specifically binding to a KRAS mutant protein (KRAS.sup.G12D) was selected from random libraries consisting of 8×10.sup.14 DNA molecules through Systemic Evolution of Ligands by Exponential Enrichment (SELEX) technique. At this time, single-stranded DNA libraries (Trilink Biotechnologies USA) consisting of 23 consecutive primer sequences at the 5′ and 3′ ends of 40 random sequences were purchased and used, and a necessary template DNA was amplified through PCR. Thereafter, an experiment was performed to select a KRAS-specific aptamer from the products amplified by the PCR by varying the KRAS concentration, and experimental conditions for each round are shown in Table 2 below.

TABLE-US-00002 TABLE 2 Number of round 1 2 3 4 5 6 7 8 9 10 KRAS 425.5 255.3 128.0 concentration (pmol) ssDNA 1276.6 1282.1 concentration (pmol) Buffer 50 mM tris-HCl (pH 7.5), 150 mM NaCl, composition 1 mM MgCl.sub.2, 0.4 mM PMSF, 5% glycerol, and 14.3 mM β-mercaptoethanol

[0070] The selection and PCR amplification processes were repeated 10 times using the above conditions, and a total of 4 types of aptamers, including 2 types showing the highest binding affinity to the KRAS mutant protein (KRAS.sup.G12D) in the libraries and 2 types obtained by trimming each aptamer, were subjected to an ELISA experiment to determine the binding affinity, and the results thereof are shown in FIG. 2.

[0071] As in FIG. 2, it was confirmed that all the four aptamer candidates finally selected exhibited a significant binding affinity to KRAS.sup.G12D protein when compared with the sequences of the random libraries, and the binding affinity increased in an aptamer concentration-dependent manner. In particular, the binding affinity between the KRAS mutant protein and NBK2-1, 2 was found to be remarkably high. As described above, the final four aptamer sequences capable of binding to KRAS with high affinity were identified, and shown in Table 3 below.

TABLE-US-00003 TABLE 3 Aptamer Sequence ID Nucleotides sequence length NBK1 5′-NNN NNN NNN NNN GGN CAT NNG ATC ATG NNC CGG 86 mer GTT CGG NTG GGG GGN NNN NNC ATG ATC TAC TTG ACT            AGT ANA TGN CCN NNN NN-3′ NBK1-1 5′-NNN NNN NNG ATC ATG NNC CGG GTT CGG NTG GGG 63 mer    GGN NNN NNC ATG ATC TAC TTG ACT AGT NNN-3′ NBK2 5′-NNN NNN NNN NNN NNN CAT ANN NNN CGG TAC GTC 86 mer CGN NTA TGN GTG GGN GGT AAG GGA GAC CNC NTG ACT            AGT ACA NNN CCA CNN NN-3′ NBK2-1 5′-NCA TAN NNN NCG GTA CGT CCG NNT ATG NGT GGG 69 mer  NGG TAA GGG AGA CCN CNT GAC TAG TAC ANN NCC                     ACN-3′

[0072] (In the above general formula, each N is independently selected from A, T, G, and C, and those other than the underlined indicate the primer sequence.)

[0073] Secondary structures of the selected DNA aptamers represented by the above sequences were predicted through RNA structures, and the structures thereof are shown in FIGS. 3A, 3B, 3C, and 3D, respectively.

[0074] As shown in FIGS. 3A, 3B, 3C, and 3D, it was confirmed that the KRAS-specific aptamers finally selected had four different types of secondary structures.

Example 4. Examination of Effect of Biological Anticancer Activity Inhibition of KRAS-Specific Binding Aptamer

[0075] To examine whether the four kinds of aptamers selected in Example 3 interact with KRAS to competitively act with an oncogenic signal Raf-1, thereby inhibiting excessive proliferation signals of cancer cells and exhibiting anticancer activity, ELISA was performed. The four kinds of aptamers finally selected were treated at concentrations 1, 5 times the concentration of KRAS protein and allowed to react in PBS buffer at 37° C., followed by ELISA assay. In order to effectively identify the actual inhibitory reaction, GST tagged Raf-1 protein was treated with KRAS.sup.G12D protein and DNA aptamer at the same time, a group treated with an inactivated wild-type KRAS protein was used as a negative control group, and a group treated with only an activated KRAS.sup.G12D protein was used as a positive control group, which were determined as a percentage of 100%. The other groups were determined as a relative value thereto. Experiments were performed and results thereof are shown in FIG. 4.

[0076] As in FIG. 4, it was confirmed that, when the four kinds of aptamers finally selected were treated, they effectively bound to KRAS in a concentration-dependent manner, thereby effectively suppressing the oncogenic signal of Raf-1, as compared with the positive control group. In particular, it was confirmed that, when the four kinds of aptamers were treated at concentrations 5 times the KRAS protein concentration, the KRAS activity could be significantly inhibited to about ½ on average, as compared with the positive control group.

Example 5. Examination of Cancer Cell-Killing Effect of KRAS-Specific Binding Aptamer In Vitro

[0077] As in Example 4, it was confirmed that the aptamers finally selected inhibited the interaction between the purified KRAS proteins, and thus the KRAS activity-inhibiting ability of the aptamers was confirmed. An experiment was performed to investigate the efficacy of the aptamers against actual cancer cells. In detail, a BxPC-3 pancreatic cancer cell line, which is a KRAS-expressing cell, was treated with the aptamers to examine whether the aptamers actually exhibit the cancer cell-killing effects.

[0078] 60 nM of Cy3-labeled NBK1 or NBK2 aptamer and AS1411 which is an aptamer having a cancer cell-targeting function were determined as control groups. To react each aptamer with BxPC-3 cells, cells were first seeded. After 24 hours, each aptamer was transfected into the cells using Lipofectamine 3000 reagent. After 24 hours, the cells were detached and then seeded again in a 96-well plate. On day 3 after transfection, the cells were examined through a fluorescence microscope. The results of examining the cells through the fluorescence microscope are shown in the top of FIG. 5, and the results of measuring viability of cancer cells by measuring cell viability using a CellTiter-Glo are shown in the bottom of FIG. 5.

[0079] As in the top and bottom of FIG. 5, it was confirmed that when the NBK1 and NBK2 aptamers finally selected were brought into contact with the BxPC-3 pancreatic cancer cell line, the viability of cancer cells was reduced by ½ or more. Even compared with the aptamer AS1411, the viability was confirmed to be reduced by about 50% or more. Taken together, it was confirmed that when the NBK1 and NBK2 aptamers finally selected are used, they specifically bind to KRAS in cancer cells to effectively inhibit tumorigenic signals, thereby significantly killing cancer cells.