COMPOUNDS AND METHODS FOR MODULATION OF DYSTROPHIA MYOTONICA-PROTEIN KINASE (DMPK) EXPRESSION

20210403916 · 2021-12-30

Assignee

Inventors

Cpc classification

International classification

Abstract

Provided herein are methods, compounds, and compositions for reducing expression of a DMPK mRNA and protein in an animal. Also provided herein are methods, compounds, and compositions for preferentially reducing CUGexp DMPK RNA, reducing myotonia or reducing spliceopathy in an animal. Such methods, compounds, and compositions are useful to treat, prevent, delay, or ameliorate type 1 myotonic dystrophy, or a symptom thereof.

Claims

1. A compound comprising a single-stranded modified oligonucleotide consisting of 10-30 linked nucleosides and having a nucleobase sequence comprising a portion of at least 12 contiguous nucleobases 100% complementary to a target region of equal length of a DMPK nucleic acid, wherein the modified oligonucleotide comprises at least one modified internucleoside linkage and/or at least one modified nucleoside comprising a modified sugar.

2. The compound of claim 1, wherein the modified oligonucleotide has a nucleobase sequence comprising a portion of at least 12 contiguous nucleobases 100% complementary to an equal length portion of nucleobases 636-697, 1317-1366, 1446-1486, 1610-1638, 1635-1670, or 2696-2717 of SEQ ID NO: 1 or nucleobases 6445-6468, 6789-6806, 13628-13657, 13735-13760, or 13746-13905 of SEQ ID NO: 2, and wherein the nucleobase sequence of the modified oligonucleotide is at least 90% complementary to SEQ ID NO: 1 or SEQ ID NO: 2 as measured over the entirety of the modified oligonucleotide.

3. The compound of claim 2, wherein the modified oligonucleotide comprises at least one modified internucleoside linkage.

4. The compound of claim 3, wherein each internucleoside linkage of the modified oligonucleotide is a phosphorothioate internucleoside linkage.

5. The compound of claim 4, wherein the modified oligonucleotide comprises at least one modified nucleoside comprising a modified sugar.

6. The compound of claim 5, wherein the modified oligonucleotide comprises at least two modified nucleosides comprising a modified sugar.

7. The compound of claim 5, wherein the modified sugar is a bicyclic sugar.

8. The compound of claim 7, wherein the bicyclic sugar is selected from cEt, LNA, α-L-LNA, ENA, and 2′-thio LNA.

9. The compound of claim 5, wherein the modified oligonucleotide comprises at least one 2′-substituted nucleoside.

10. The compound of claim 9, wherein the 2′-substituted nucleoside is selected from 2′-OCH.sub.3, 2′-F, and 2′-O-methoxyethyl.

11. The compound of claim 10, wherein the modified oligonucleotide comprises: a gap segment consisting of 7-11 linked deoxynucleosides; a 5′ wing segment consisting of 2-6 linked nucleosides; a 3′ wing segment consisting of 2-6 linked nucleosides; wherein the gap segment is positioned between the 5′ wing segment and the 3′ wing segment and wherein each nucleoside of each wing segment comprises a modified sugar.

12. The compound of claim 11, wherein the modified oligonucleotide consists of 16, 17, 18, 19, or 20 linked nucleosides.

13. The compound of claim 1, wherein the modified oligonucleotide has a nucleobase sequence comprising a portion of at least 12 contiguous nucleobases of any of SEQ ID NOs: 33, 94-110, 530-539, 25, 117-128, 376-384, 176-197, 224-233, 246-262, 426-429, 487-489, 433, 681-685, 712-713, 269-277, 286-291, 23, 264, 294-311, or 426-430, and wherein the nucleobase sequence of the modified oligonucleotide is at least 90% complementary to SEQ ID NO: 1 or SEQ ID NO: 2 as measured over the entirety of the modified oligonucleotide.

14. The compound of claim 13, wherein the modified oligonucleotide comprises at least one modified internucleoside linkage.

15. The compound of claim 14, wherein each internucleoside linkage of the modified oligonucleotide is a phosphorothioate internucleoside linkage.

16. The compound of claim 15, wherein the modified oligonucleotide comprises at least one modified nucleoside comprising a modified sugar.

17. The compound of claim 16, wherein the modified oligonucleotide comprises at least two modified nucleosides comprising a modified sugar.

18. The compound of claim 16, wherein the modified sugar is a bicyclic sugar.

19. The compound of claim 18, wherein the bicyclic sugar is selected from cEt, LNA, α-L-LNA, ENA, and 2′-thio LNA.

20. The compound of claim 16, wherein the modified oligonucleotide comprises at least one 2′-substituted nucleoside.

21. The compound of claim 20, wherein the 2′-substituted nucleoside is selected from 2′-OCH.sub.3, 2′-F, and 2′-O-methoxyethyl.

22. The compound of claim 21, wherein the modified oligonucleotide comprises: a gap segment consisting of 7-10 linked deoxynucleosides; a 5′ wing segment consisting of 2-5 linked nucleosides; a 3′ wing segment consisting of 2-5 linked nucleosides; wherein the gap segment is positioned between the 5′ wing segment and the 3′ wing segment and wherein each nucleoside of each wing segment comprises a modified sugar.

23. The compound of claim 22, wherein the modified oligonucleotide consists of 16, 17, 18, 19, or 20 linked nucleosides.

24. A composition comprising the compound of claim 1 and a pharmaceutically acceptable carrier or diluent.

25. A composition comprising the compound of claim 13 and a pharmaceutically acceptable carrier or diluent.

26. A method of treating type 1 myotonic dystrophy (DM1) in an animal comprising administering to an animal in need thereof a composition according to claim 2.

27. A method of treating type 1 myotonic dystrophy (DM1) in an animal comprising administering to an animal in need thereof a composition according to claim 13.

Description

DETAILED DESCRIPTION

[0292] It is to be understood that both the foregoing general description and the following detailed description are exemplary and explanatory only and are not restrictive of the invention, as claimed. Herein, the use of the singular includes the plural unless specifically stated otherwise. Herein, the use of “or” means “and/or” unless stated otherwise. Furthermore, the use of the term “including” as well as other forms, such as “includes” and “included”, is not limiting. Also, terms such as “element” or “component” encompass both elements and components comprising one unit and elements and components that comprise more than one subunit, unless specifically stated otherwise.

[0293] The section headings used herein are for organizational purposes only and are not to be construed as limiting the subject matter described. All documents, or portions of documents, cited in this application, including, but not limited to, patents, patent applications, articles, books, and treatises, are hereby expressly incorporated-by-reference for the portions of the document discussed herein, as well as in their entirety.

Definitions

[0294] Unless specific definitions are provided, the nomenclature utilized in connection with, and the procedures and techniques of, analytical chemistry, synthetic organic chemistry, and medicinal and pharmaceutical chemistry described herein are those well known and commonly used in the art. Standard techniques can be used for chemical synthesis, and chemical analysis. Where permitted, all patents, applications, published applications and other publications, GENBANK Accession Numbers and associated sequence information obtainable through databases such as National Center for Biotechnology Information (NCBI) and other data referred to throughout in the disclosure herein are incorporated by reference for the portions of the document discussed herein, as well as in their entirety.

[0295] Unless otherwise indicated, the following terms have the following meanings:

[0296] “2′-O-methoxyethyl” (also 2′-MOE and 2′-O(CH.sub.2).sub.2—OCH.sub.3) refers to an O-methoxy-ethyl modification of the 2′ position of a furanosyl ring. A 2′-O-methoxyethyl modified sugar is a modified sugar.

[0297] “2′-O-methoxyethyl nucleotide” means a nucleotide comprising a 2′-O-methoxyethyl modified sugar moiety.

[0298] “5-methylcytosine” means a cytosine modified with a methyl group attached to position 5. A 5-methylcytosine is a modified nucleobase.

[0299] “About” means within ±7% of a value. For example, if it is stated, “the compound affected at least about 70% inhibition of DMPK”, it is implied that the DMPK levels are inhibited within a range of 63% and 77%.

[0300] “Active pharmaceutical agent” means the substance or substances in a pharmaceutical composition that provide a therapeutic benefit when administered to an animal. For example, in certain embodiments an antisense oligonucleotide targeted to DMPK is an active pharmaceutical agent.

[0301] “Active target region” or “target region” means a region to which one or more active antisense compounds is targeted. “Active antisense compounds” means antisense compounds that reduce target nucleic acid levels or protein levels.

[0302] “Administered concomitantly” refers to the co-administration of two agents in any manner in which the pharmacological effects of both are manifest in the patient at the same time. Concomitant administration does not require that both agents be administered in a single pharmaceutical composition, in the same dosage form, or by the same route of administration. The effects of both agents need not manifest themselves at the same time. The effects need only be overlapping for a period of time and need not be coextensive.

[0303] “Administering” means providing an agent to an animal, and includes, but is not limited to, administering by a medical professional and self-administering.

[0304] “Agent” means an active substance that can provide a therapeutic benefit when administered to an animal. “First Agent” means a therapeutic compound of the invention. For example, a first agent can be an antisense oligonucleotide targeting DMPK. “Second agent” means a second therapeutic compound of the invention (e.g. a second antisense oligonucleotide targeting DMPK) and/or a non-DMPK therapeutic compound.

[0305] “Amelioration” refers to a lessening of at least one indicator, sign, or symptom of an associated disease, disorder, or condition. The severity of indicators can be determined by subjective or objective measures, which are known to those skilled in the art.

[0306] “Animal” refers to a human or non-human animal, including, but not limited to, mice, rats, rabbits, dogs, cats, pigs, and non-human primates, including, but not limited to, monkeys and chimpanzees.

[0307] “Antisense activity” means any detectable or measurable activity attributable to the hybridization of an antisense compound to its target nucleic acid. In certain embodiments, antisense activity is a decrease in the amount or expression of a target nucleic acid or protein encoded by such target nucleic acid.

[0308] “Antisense compound” means an oligomeric compound that is capable of undergoing hybridization to a target nucleic acid through hydrogen bonding. Examples of antisense compounds include single-stranded and double-stranded compounds, such as, antisense oligonucleotides, siRNAs, shRNAs, snoRNAs, miRNAs, and satellite repeats.

[0309] “Antisense inhibition” means reduction of target nucleic acid levels or target protein levels in the presence of an antisense compound complementary to a target nucleic acid compared to target nucleic acid levels or target protein levels in the absence of the antisense compound.

[0310] “Antisense oligonucleotide” means a single-stranded oligonucleotide having a nucleobase sequence that permits hybridization to a corresponding region or segment of a target nucleic acid.

[0311] “Bicyclic sugar” means a furanosyl ring modified by the bridging of two non-geminal carbon ring atoms. A bicyclic sugar is a modified sugar.

[0312] “Bicyclic nucleic acid” or “BNA” refers to a nucleoside or nucleotide wherein the furanose portion of the nucleoside or nucleotide includes a bridge connecting two carbon atoms on the furanose ring, thereby forming a bicyclic ring system.

[0313] “Cap structure” or “terminal cap moiety” means chemical modifications, which have been incorporated at either terminus of an antisense compound.

[0314] “Chemically distinct region” refers to a region of an antisense compound that is in some way chemically different than another region of the same antisense compound. For example, a region having 2′-O-methoxyethyl nucleotides is chemically distinct from a region having nucleotides without 2′-O-methoxyethyl modifications.

[0315] “Chimeric antisense compound” means an antisense compound that has at least two chemically distinct regions.

[0316] “Co-administration” means administration of two or more agents to an individual. The two or more agents can be in a single pharmaceutical composition, or can be in separate pharmaceutical compositions. Each of the two or more agents can be administered through the same or different routes of administration. Co-administration encompasses parallel or sequential administration.

[0317] “Complementarity” means the capacity for pairing between nucleobases of a first nucleic acid and a second nucleic acid.

[0318] “Contiguous nucleobases” means nucleobases immediately adjacent to each other.

[0319] “CUGexp DMPK” means mutant DMPK RNA containing an expanded CUG repeat (CUGexp). The wild-type DMPK gene has 5-37 CTG repeats in the 3′ untranslated region. In a “CUGexp DMPK” (such as in a myotonic dystrophy type I patient) this number is significantly expanded and is, for example, in the range of 50 to greater than 3,500 (Harper, Myotonic Dystrophy (Saunders, London, ed. 3, 2001); Annu. Rev. Neurosci. 29: 259, 2006; EMBO J. 19: 4439, 2000; Curr Opin Neurol. 20: 572, 2007).

[0320] “Diluent” means an ingredient in a composition that lacks pharmacological activity, but is pharmaceutically necessary or desirable. For example, the diluent in an injected composition can be a liquid, e.g. saline solution.

[0321] “DMPK” means any nucleic acid or protein of distrophia myotonica protein kinase. DMPK can be a mutant DMPK including CUGexp DMPK nucleic acid.

[0322] “DMPK expression” means the level of mRNA transcribed from the gene encoding DMPK or the level of protein translated from the mRNA. DMPK expression can be determined by art known methods such as a Northern or Western blot.

[0323] “DMPK nucleic acid” means any nucleic acid encoding DMPK. For example, in certain embodiments, a DMPK nucleic acid includes a DNA sequence encoding DMPK, an RNA sequence transcribed from DNA encoding DMPK (including genomic DNA comprising introns and exons), and an mRNA or pre-mRNA sequence encoding DMPK. “DMPK mRNA” means an mRNA encoding a DMPK protein.

[0324] “Dose” means a specified quantity of a pharmaceutical agent provided in a single administration, or in a specified time period. In certain embodiments, a dose can be administered in one, two, or more boluses, tablets, or injections. For example, in certain embodiments where subcutaneous administration is desired, the desired dose requires a volume not easily accommodated by a single injection, therefore, two or more injections can be used to achieve the desired dose. In certain embodiments, the pharmaceutical agent is administered by infusion over an extended period of time or continuously. Doses can be stated as the amount of pharmaceutical agent per hour, day, week, or month.

[0325] “Effective amount” or “therapeutically effective amount” means the amount of active pharmaceutical agent sufficient to effectuate a desired physiological outcome in an individual in need of the agent. The effective amount can vary among individuals depending on the health and physical condition of the individual to be treated, the taxonomic group of the individuals to be treated, the formulation of the composition, assessment of the individual's medical condition, and other relevant factors.

[0326] “Fully complementary” or “100% complementary” means each nucleobase of a nucleobase sequence of a first nucleic acid has a complementary nucleobase in a second nucleobase sequence of a second nucleic acid. In certain embodiments, a first nucleic acid is an antisense compound and a target nucleic acid is a second nucleic acid.

[0327] “Gapmer” means a chimeric antisense compound in which an internal region having a plurality of nucleosides that support RNase H cleavage is positioned between external regions having one or more nucleosides, wherein the nucleosides comprising the internal region are chemically distinct from the nucleoside or nucleosides comprising the external regions. The internal region can be referred to as a “gap segment” and the external regions can be referred to as “wing segments.”

[0328] “Gap-widened” means a chimeric antisense compound having a gap segment of 12 or more contiguous 2′-deoxyribonucleosides positioned between and immediately adjacent to 5′ and 3′ wing segments having from one to six nucleosides.

[0329] “Hybridization” means the annealing of complementary nucleic acid molecules. In certain embodiments, complementary nucleic acid molecules include an antisense compound and a target nucleic acid.

[0330] “Identifying an animal with type 1 myotonic dystrophy” means identifying an animal having been diagnosed with a type 1 myotonic dystrophy, disorder or condition or identifying an animal predisposed to develop a type 1 myotonic dystrophy, disorder or condition. For example, individuals with a familial history can be predisposed to type 1 myotonic dystrophy, disorder or condition. Such identification can be accomplished by any method including evaluating an individual's medical history and standard clinical tests or assessments.

[0331] “Immediately adjacent” means there are no intervening elements between the immediately adjacent elements.

[0332] “Individual” means a human or non-human animal selected for treatment or therapy.

[0333] “Internucleoside linkage” refers to the chemical bond between nucleosides.

[0334] “Linked nucleosides” means adjacent nucleosides which are bonded or linked together by an internucleoside linkage.

[0335] “Mismatch” or “non-complementary nucleobase” refers to the case when a nucleobase of a first nucleic acid is not capable of pairing with the corresponding nucleobase of a second or target nucleic acid.

[0336] “Modified internucleoside linkage” refers to a substitution or any change from a naturally occurring internucleoside bond (i.e. a phosphodiester internucleoside bond).

[0337] “Modified nucleobase” refers to any nucleobase other than adenine, cytosine, guanine, thymidine, or uracil. An “unmodified nucleobase” means the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C), and uracil (U).

[0338] “Modified nucleotide” means a nucleotide having, independently, a modified sugar moiety, modified internucleoside linkage, or modified nucleobase. A “modified nucleoside” means a nucleoside having, independently, a modified sugar moiety or modified nucleobase.

[0339] “Modified oligonucleotide” means an oligonucleotide comprising at least one modified nucleoside and/or modified internucleoside linkage.

[0340] “Modified sugar” refers to a substitution or change from a natural sugar moiety. Modified sugars include substituted sugar moieities and surrogate sugar moieties.

[0341] “Motif” means the pattern of chemically distinct regions in an antisense compound.

[0342] “Myotonia” means an abnormally slow relaxation of a muscle after voluntary contraction or electrical stimulation.

[0343] “Nuclear ribonuclease” means a ribonuclease found in the nucleus. Nuclear ribonucleases include, but are not limited to, RNase H including RNase H1 and RNase H2, the double stranded RNase drosha and other double stranded RNases.

[0344] “Naturally occurring internucleoside linkage” means a 3′ to 5′ phosphodiester linkage.

[0345] “Natural sugar moiety” means a sugar found in DNA (2′-H) or RNA (2′-OH).

[0346] “Nucleic acid” refers to molecules composed of monomeric nucleotides. A nucleic acid includes ribonucleic acids (RNA), deoxyribonucleic acids (DNA), single-stranded nucleic acids, double-stranded nucleic acids, small interfering ribonucleic acids (siRNA), and microRNAs (miRNA). A nucleic acid can also comprise a combination of these elements in a single molecule.

[0347] “Nucleobase” means a heterocyclic moiety capable of pairing with a base of another nucleic acid.

[0348] “Nucleobase sequence” means the order of contiguous nucleobases independent of any sugar, linkage, or nucleobase modification.

[0349] “Nucleoside” means a nucleobase linked to a sugar. In certain embodiments, a nucleoside is linked to a phosphate group.

[0350] “Nucleoside mimetic” includes those structures used to replace the sugar or the sugar and the base and not necessarily the linkage at one or more positions of an oligomeric compound such as for example nucleoside mimetics having morpholino, cyclohexenyl, cyclohexyl, tetrahydropyranyl, bicyclo or tricyclo sugar mimetics e.g. non furanose sugar units.

[0351] “Nucleotide” means a nucleoside having a phosphate group covalently linked to the sugar portion of the nucleoside.

[0352] “Nucleotide mimetic” includes those structures used to replace the nucleoside and the linkage at one or more positions of an oligomeric compound such as for example peptide nucleic acids or morpholinos (morpholinos linked by —N(H)—C(═O)—O— or other non-phosphodiester linkage).

[0353] “Oligomeric compound” or “oligomer” means a polymer of linked monomeric subunits which is capable of hybridizing to at least a region of a nucleic acid molecule.

[0354] “Oligonucleotide” means a polymer of linked nucleosides, wherein each nucleoside and each internucleoside linkage may be modified or unmodified, independent one from another.

[0355] “Parenteral administration” means administration through injection or infusion. Parenteral administration includes subcutaneous administration, intravenous administration, intramuscular administration, intraarterial administration, intraperitoneal administration, or intracranial administration, e.g. intrathecal or intracerebroventricular administration. Administration can be continuous, or chronic, or short or intermittent.

[0356] “Peptide” means a molecule formed by linking at least two amino acids by amide bonds. Peptide refers to polypeptides and proteins.

[0357] “Pharmaceutical composition” means a mixture of substances suitable for administering to an individual. For example, a pharmaceutical composition can comprise one or more active agents and a sterile aqueous solution.

[0358] “Pharmaceutically acceptable salts” means physiologically and pharmaceutically acceptable salts of antisense compounds, i.e., salts that retain the desired biological activity of the parent oligonucleotide and do not impart undesired toxicological effects thereto.

[0359] “Phosphorothioate linkage” means a linkage between nucleosides where the phosphodiester bond is modified by replacing one of the non-bridging oxygen atoms with a sulfur atom. A phosphorothioate linkage is a modified internucleoside linkage.

[0360] “Portion” means a defined number of contiguous (i.e. linked) nucleobases of a nucleic acid. In certain embodiments, a portion is a defined number of contiguous nucleobases of a target nucleic acid. In certain embodiments, a portion is a defined number of contiguous nucleobases of an antisense compound.

[0361] “Preferentially reducing CUG exp DMPK RNA” refers to a preferential reduction of RNA transcripts from a CUGexp DMPK allele relative to RNA transcripts from a normal DMPK allele.

[0362] “Prevent” refers to delaying or forestalling the onset or development of a disease, disorder, or condition for a period of time from minutes to indefinitely. Prevent also means reducing risk of developing a disease, disorder, or condition.

[0363] “Prodrug” means a therapeutic agent that is prepared in an inactive form that is converted to an active form within the body or cells thereof by the action of endogenous enzymes or other chemicals or conditions.

[0364] “Side effects” means physiological responses attributable to a treatment other than the desired effects. In certain embodiments, side effects include injection site reactions, liver function test abnormalities, renal function abnormalities, liver toxicity, renal toxicity, central nervous system abnormalities, myopathies, and malaise. For example, increased aminotransferase levels in serum can indicate liver toxicity or liver function abnormality. For example, increased bilirubin can indicate liver toxicity or liver function abnormality.

[0365] “Single-stranded oligonucleotide” means an oligonucleotide which is not hybridized to a complementary strand.

[0366] “Specifically hybridizable” refers to an antisense compound having a sufficient degree of complementarity between an antisense oligonucleotide and a target nucleic acid to induce a desired effect, while exhibiting minimal or no effects on non-target nucleic acids under conditions in which specific binding is desired, i.e. under physiological conditions in the case of in vivo assays and therapeutic treatments.

[0367] “Spliceopathy” means a change in the alternative splicing of one or more RNAs that leads to the expression of altered splice products in a particular tissue.

[0368] “Subcutaneous administration” means administration just below the skin.

[0369] “Substituted sugar moiety” means a furanosyl other than a natural sugar of RNA or DNA.

[0370] “Sugar” or “Sugar moiety” means a natural sugar moiety or a modified sugar.

[0371] “Sugar surrogate” overlaps with the slightly broader term “nucleoside mimetic” but is intended to indicate replacement of the sugar unit (furanose ring) only A sugar surrogate is capable of replacing the naturally occurring sugar moiety of a nucleoside, such that the resulting nucleoside sub-units are capable of linking together and/or linking to other nucleosides to form an oligomeric compound which is capable of hybridizing to a complementary oligomeric compound. Such structures include rings comprising a different number of atoms than furanosyl (e.g., 4, 6, or 7-membered rings); replacement of the oxygen of a furanosyl with a non-oxygen atom (e.g., carbon, sulfur, or nitrogen); or both a change in the number of atoms and a replacement of the oxygen. Such structures may also comprise substitutions corresponding to those described for substituted sugar moieties (e.g., 6-membered carbocyclic bicyclic sugar surrogates optionally comprising additional substituents). Sugar surrogates also include more complex sugar replacements (e.g., the non-ring systems of peptide nucleic acid). Sugar surrogates include without limitation morpholinos, cyclohexenyls and cyclohexitols.

[0372] “Targeting” or “targeted” means the process of design and selection of an antisense compound that will specifically hybridize to a target nucleic acid and induce a desired effect.

[0373] “Target nucleic acid,” “target RNA,” and “target RNA transcript” all refer to a nucleic acid capable of being targeted by antisense compounds. In certain embodiments, a target nucleic acid comprises a region of a DMPK nucleic acid.

[0374] “Target segment” means the sequence of nucleotides of a target nucleic acid to which an antisense compound is targeted. “5′ target site” refers to the 5′-most nucleotide of a target segment.

[0375] “3′ target site” refers to the 3′-most nucleotide of a target segment.

[0376] “Therapeutically effective amount” means an amount of an agent that provides a therapeutic benefit to an individual.

[0377] “Treat” refers to administering a pharmaceutical composition to effect an alteration or improvement of a disease, disorder, or condition.

[0378] “Type 1 myotonic dystrophy” or “DM1” means an autosomal dominant disorder caused by expansion of a non-coding CTG repeat in DMPK. This mutation leads to RNA dominance, a process in which expression of RNA containing an expanded CUG repeat (CUGexp) induced cell dysfunction. The CUGexp tract interacts with RNA binding proteins and causes the mutant transcript to be retained in nuclear foci. The toxicity of this RNA stems from sequestration of RNA binding proteins and activation of signaling pathways.

[0379] “Unmodified nucleotide” means a nucleotide composed of naturally occurring nucleobases, sugar moieties, and internucleoside linkages. In certain embodiments, an unmodified nucleotide is an RNA nucleotide (i.e. β-D-ribonucleosides) or a DNA nucleotide (i.e. β-D-deoxyribonucleoside).

CERTAIN EMBODIMENTS

[0380] Certain embodiments provide methods, compounds, and compositions for inhibiting DMPK expression.

[0381] Certain embodiments provide a method of reducing DMPK expression in an animal comprising administering to the animal a compound comprising a modified oligonucleotide targeting DMPK.

[0382] Certain embodiments provide a method of preferentially reducing CUGexp DMPK RNA, reducing myotonia or reducing spliceopathy in an animal comprising administering to the animal a compound comprising a modified oligonucleotide targeted to DMPK, wherein the modified oligonucleotide preferentially reduces CUGexp DMPK RNA, reduces myotonia or reduces spliceopathy in the animal.

[0383] Certain embodiments provide a method of administering an antisense oligonucleotide to counteract RNA dominance by directing the cleavage of pathogenic transcripts.

[0384] Certain embodiments provide a method of reducing spliceopathy of Serca1. In certain embodiments, methods provided herein result in exon 22 inclusion. In certain embodiments, the corrective splicing occurs in the tibialis anterior, gastrocnemius, and quadriceps muscles.

[0385] Certain embodiments provide a method of reducing spliceopathy of m-Titin. In certain embodiments, methods provided herein result in exon 5 inclusion. In certain embodiments, the corrective splicing occurs in the tibialis anterior, gastrocnemius, and quadriceps muscles.

[0386] Certain embodiments provide a method of reducing spliceopathy of Clcn1. In certain embodiments, methods provided herein result in exon 7a inclusion. In certain embodiments, the corrective splicing occurs in the tibialis anterior, gastrocnemius, and quadriceps muscles.

[0387] Certain embodiments provide a method of reducing spliceopathy of Zasp. In certain embodiments, methods provided herein result in exon 11 inclusion. In certain embodiments, the corrective splicing occurs in the tibialis anterior, gastrocnemius, and quadriceps muscles.

[0388] Certain embodiments provide a method for treating an animal with type 1 myotonic dystrophy comprising: a) identifying said animal with type 1 myotonic dystrophy, and b) administering to said animal a therapeutically effective amount of a compound comprising a modified oligonucleotide targeted to DMPK. In certain embodiments, the therapeutically effective amount of the compound administered to the animal preferentially reduces CUGexp DMPK RNA, reduces myotonia or reduces spliceopathy in the animal.

[0389] Certain embodiments provide a method of achieving a preferential reduction of CUGexp DMPK RNA, including administering to the subject suspected of having type 1 myotonic dystrophy or having a CUGexp DMPK RNA a modified antisense oligonucleotide complementary to a non-repeat region of said CUGexp DMPK RNA. The modified antisense oligonucleotide, when bound to said CUGexp DMPK RNA, achieves a preferential reduction of the CUGexp DMPK RNA.

[0390] Certain embodiments provide a method of achieving a preferential reduction of CUGexp DMPK RNA, including selecting a subject having type 1 myotonic dystrophy or having a CUGexp DMPK RNA and administering to said subject a modified antisense oligonucleotide complementary to a non-repeat region of said CUGexp DMPK RNA. The modified antisense oligonucleotide, when bound to the CUGexp DMPK RNA, activates a ribonuclease or nuclear ribonuclease, thereby achieving a preferential reduction of the CUGexp DMPK RNA in the nucleus.

[0391] Certain embodiments provide a method of achieving a preferential reduction of CUGexp DMPK RNA, including selecting a subject having type 1 myotonic dystrophy or having a mutant or CUGexp DMPK RNA and systemically administering to said subject a modified antisense oligonucleotide complementary to a non-repeat region of said CUGexp DMPK RNA. The modified antisense oligonucleotide, when bound to the mutant or CUGexp DMPK RNA, achieves a preferential reduction of the mutant or CUGexp DMPK RNA.

[0392] Certain embodiments provide a method of reducing myotonia in a subject in need thereof. The method includes administering to the subject a modified antisense oligonucleotide complementary to a non-repeat region of a DMPK RNA, wherein the modified antisense oligonucleotide, when bound to the DMPK RNA, activates a ribonuclease or nuclear ribonuclease, thereby reducing myotonia. In certain embodiments, the subject has or is suspected of having type 1 myotonic dystrophy or having a mutant DMPK RNA or CUGexp DMPK RNA. In certain embodiments, the DMPK RNA is nuclear retained.

[0393] Certain embodiments provide a method of reducing spliceopathy in a subject in need thereof. The method includes administering to the subject a modified antisense oligonucleotide complementary to a non-repeat region of a DMPK RNA, wherein the modified antisense oligonucleotide, when bound to the DMPK RNA, activates a ribonuclease or nuclear ribonuclease, thereby reducing spliceopathy. In certain embodiments, the subject has or is suspected of having type 1 myotonic dystrophy or having a nuclear retained CUGexp DMPK RNA. In certain embodiments, the DMPK RNA is nuclear retained. In certain embodiments, the spliceopathy is MBNL dependent spliceopathy.

[0394] In certain embodiments, the modified antisense oligonucleotide of the methods is chimeric. In certain embodiments, the modified antisense oligonucleotide of the methods is a gapmer.

[0395] In certain embodiments of the methods provided herein, the administering is subcutaneous. In certain embodiments, the administering is intravenous.

[0396] In certain embodiments, the modified antisense oligonucleotide of the methods targets a non-coding sequence within the non-repeat region of a DMPK RNA. In certain embodiments, the oligonucleotide targets a coding region, an intron, a 5′UTR, or a 3′UTR of the mutant DMPK RNA.

[0397] In certain embodiments of the methods provided herein, the nuclear ribonuclease is RNase H1.

[0398] In certain embodiments of the methods, the DMPK RNA is reduced in muscle tissue. In certain embodiments, the mutant DMPK RNA CUGexp DMPK RNA is preferentially reduced.

[0399] In certain embodiments, the DMPK has the sequence as set forth in GenBank Accession No. NM_001081560.1 (incorporated herein as SEQ ID NO: 1). In certain embodiments, the DMPK has the sequence as set forth in GenBank Accession No. NT_011109.15 truncated from nucleotides 18540696 to U.S. Pat. No. 18,555,106 (incorporated herein as SEQ ID NO: 2). In certain embodiments, the DMPK has the sequence as set forth in GenBank Accession No. NT_039413.7 truncated from nucleotides 16666001 to U.S. Pat. No. 16,681,000 (incorporated herein as SEQ ID NO: 3). In certain embodiments, the DMPK has the sequence as set forth in GenBank Accession No. NM_032418.1 (incorporated herein as SEQ ID NO: 4). In certain embodiments, the DMPK has the sequence as set forth in GenBank Accession No. AI007148.1 (incorporated herein as SEQ ID NO: 5). In certain embodiments, the DMPK has the sequence as set forth in GenBank Accession No. AI304033.1 (incorporated herein as SEQ ID NO: 6). In certain embodiments, the DMPK has the sequence as set forth in GenBank Accession No. BC024150.1 (incorporated herein as SEQ ID NO: 7). In certain embodiments, the DMPK has the sequence as set forth in GenBank Accession No. BC056615.1 (incorporated herein as SEQ ID NO: 8). In certain embodiments, the DMPK has the sequence as set forth in GenBank Accession No. BC075715.1 (incorporated herein as SEQ ID NO: 9). In certain embodiments, the DMPK has the sequence as set forth in GenBank Accession No. BU519245.1 (incorporated herein as SEQ ID NO: 10). In certain embodiments, the DMPK has the sequence as set forth in GenBank Accession No. CB247909.1 (incorporated herein as SEQ ID NO: 11). In certain embodiments, the DMPK has the sequence as set forth in GenBank Accession No. CX208906.1 (incorporated herein as SEQ ID NO: 12). In certain embodiments, the DMPK has the sequence as set forth in GenBank Accession No. CX732022.1 (incorporated herein as SEQ ID NO: 13). In certain embodiments, the DMPK has the sequence as set forth in GenBank Accession No. S60315.1 (incorporated herein as SEQ ID NO: 14). In certain embodiments, the DMPK has the sequence as set forth in GenBank Accession No. S60316.1 (incorporated herein as SEQ ID NO: 15). In certain embodiments, the DMPK has the sequence as set forth in GenBank Accession No. NM_001081562.1 (incorporated herein as SEQ ID NO: 16). In certain embodiments, the DMPK has the sequence as set forth in GenBank Accession No. NM_001100.3 (incorporated herein as SEQ ID NO: 17).

[0400] In certain embodiments, the modified oligonucleotide has a nucleobase sequence comprising at least 8 contiguous nucleobases of a nucleobase sequence recited in any one of SEQ ID NOs: 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33-874. In certain embodiments, the modified oligonucleotide has a nucleobase sequence comprising at least 9, at least 10, or at least 11, contiguous nucleobases of a nucleobase sequence recited in any one of SEQ ID NOs: 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33-874.

[0401] In certain embodiments, the modified oligonucleotide has a nucleobase sequence comprising at least 12 contiguous nucleobases of a nucleobase sequence recited in any one of SEQ ID NOs: 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33-874. In certain embodiments, the modified oligonucleotide has a nucleobase sequence comprising at least 13, or at least 14, contiguous nucleobases of a nucleobase sequence recited in any one of SEQ ID NOs: 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33-874.

[0402] In certain embodiments, the modified oligonucleotide has a nucleobase sequence comprising at least 15 contiguous nucleobases of a nucleobase sequence recited in any one of SEQ ID NOs: 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33-874. In certain embodiments, the modified oligonucleotide has a nucleobase sequence comprising at least 16 contiguous nucleobases of a nucleobase sequence recited in any one of SEQ ID NOs: 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33-874.

[0403] In certain embodiments, the modified oligonucleotide has a nucleobase sequence comprising at least 17 contiguous nucleobases of a nucleobase sequence recited in any one of SEQ ID NOs: 24, 25, 27, or 28.

[0404] In certain embodiments, the modified oligonucleotide has a nucleobase sequence comprising at least 18 contiguous nucleobases of a nucleobase sequence recited in any one of SEQ ID NOs: 24 or 25. In certain embodiments, the modified oligonucleotide has a nucleobase sequence comprising at least 19 contiguous nucleobases of a nucleobase sequence recited in any one of SEQ ID NOs: 24 or 25.

[0405] In certain embodiments, the modified oligonucleotides provided herein are targeted to any one of the following regions of SEQ ID NO: 1: 1343-1368, 1317-1366, 2748-2791, 2155-2208, 2748-2791, 730-748, 528-547, 531-567, 636-697, 1311-1331, 1314-1339, 1446-1475, 1635-1670, 1610-1638, 1457-1486, 2773-1788, 931-948, 934-949, 937-952, 942-957, 937-957, 943-958, 937-953, 1346-1363, 1346-1361, 1347-1363, 2162-2179, 2492-2508, 2696-2717, and 2683-2703. In certain embodiments, the modified oligonucleotides provided herein are targeted to any one of the following regions of SEQ ID NO: 1: 2773-2788, 1343-1358, and 1344-1359.

[0406] In certain embodiments, the modified oligonucleotides provided herein have a nucleobase sequence comprising a complementary region comprising at least 8 contiguous nucleobases complementary to a target region. In certain embodiments, the modified oligonucleotides provided herein have a nucleobase sequence comprising a complementary region comprising at least 8 contiguous nucleobases complementary to a target region, wherein the target region is targeted to nucleobases 1343-1368, 1317-1366, 2748-2791, 2155-2208, 2748-2791, 730-748, 528-547, 531-567, 636-697, 1311-1331, 1314-1339, 1446-1475, 1635-1670, 1610-1638, 1457-1486, 2773-1788, 931-948, 934-949, 937-952, 942-957, 937-957, 943-958, 937-953, 1346-1363, 1346-1361, 1347-1363, 2162-2179, 2492-2508, 2696-2717, or 2683-2703 of SEQ ID NO: 1. In certain embodiments, the modified oligonucleotides provided herein have a nucleobase sequence comprising a complementary region comprising at least 8 contiguous nucleobases complementary to a target region, wherein the target region is targeted to nucleobases 2773-2788, 1343-1358, or 1344-1359 of SEQ ID NO: 1.

[0407] In certain embodiments, the modified oligonucleotides provided herein have a nucleobase sequence comprising a complementary region comprising at least 10 contiguous nucleobases complementary to a target region. In certain embodiments, the modified oligonucleotides provided herein have a nucleobase sequence comprising a complementary region comprising at least 10 contiguous nucleobases complementary to a target region, wherein the target region is targeted to nucleobases 1343-1368, 1317-1366, 2748-2791, 2155-2208, 2748-2791, 730-748, 528-547, 531-567, 636-697, 1311-1331, 1314-1339, 1446-1475, 1635-1670, 1610-1638, 1457-1486, 2773-1788, 931-948, 934-949, 937-952, 942-957, 937-957, 943-958, 937-953, 1346-1363, 1346-1361, 1347-1363, 2162-2179, 2492-2508, 2696-2717, or 2683-2703 of SEQ ID NO: 1. In certain embodiments, the modified oligonucleotides provided herein have a nucleobase sequence comprising a complementary region comprising at least 10 contiguous nucleobases complementary to a target region, wherein the target region is targeted to nucleobases 2773-2788, 1343-1358, or 1344-1359 of SEQ ID NO: 1.

[0408] In certain embodiments, the modified oligonucleotides provided herein have a nucleobase sequence comprising a complementary region comprising at least 12 contiguous nucleobases complementary to a target region. In certain embodiments, the modified oligonucleotides provided herein have a nucleobase sequence comprising a complementary region comprising at least 12 contiguous nucleobases complementary to a target region, wherein the target region is targeted to nucleobases 1343-1368, 1317-1366, 2748-2791, 2155-2208, 2748-2791, 730-748, 528-547, 531-567, 636-697, 1311-1331, 1314-1339, 1446-1475, 1635-1670, 1610-1638, 1457-1486, 2773-1788, 931-948, 934-949, 937-952, 942-957, 937-957, 943-958, 937-953, 1346-1363, 1346-1361, 1347-1363, 2162-2179, 2492-2508, 2696-2717, or 2683-2703 of SEQ ID NO: 1. In certain embodiments, the modified oligonucleotides provided herein have a nucleobase sequence comprising a complementary region comprising at least 12 contiguous nucleobases complementary to a target region, wherein the target region is targeted to nucleobases 2773-2788, 1343-1358, or 1344-1359 of SEQ ID NO: 1.

[0409] In certain embodiments, the modified oligonucleotides provided herein have a nucleobase sequence comprising a complementary region comprising at least 14 contiguous nucleobases complementary to a target region. In certain embodiments, the modified oligonucleotides provided herein have a nucleobase sequence comprising a complementary region comprising at least 14 contiguous nucleobases complementary to a target region, wherein the target region is targeted to nucleobases 1343-1368, 1317-1366, 2748-2791, 2155-2208, 2748-2791, 730-748, 528-547, 531-567, 636-697, 1311-1331, 1314-1339, 1446-1475, 1635-1670, 1610-1638, 1457-1486, 2773-1788, 931-948, 934-949, 937-952, 942-957, 937-957, 943-958, 937-953, 1346-1363, 1346-1361, 1347-1363, 2162-2179, 2492-2508, 2696-2717, or 2683-2703 of SEQ ID NO: 1. In certain embodiments, the modified oligonucleotides provided herein have a nucleobase sequence comprising a complementary region comprising at least 14 contiguous nucleobases complementary to a target region, wherein the target region is targeted to nucleobases 2773-2788, 1343-1358, or 1344-1359 of SEQ ID NO: 1.

[0410] In certain embodiments, the modified oligonucleotides provided herein have a nucleobase sequence comprising a complementary region comprising at least 16 contiguous nucleobases complementary to a target region. In certain embodiments, the modified oligonucleotides provided herein have a nucleobase sequence comprising a complementary region comprising at least 16 contiguous nucleobases complementary to a target region, wherein the target region is targeted to nucleobases 1343-1368, 1317-1366, 2748-2791, 2155-2208, 2748-2791, 730-748, 528-547, 531-567, 636-697, 1311-1331, 1314-1339, 1446-1475, 1635-1670, 1610-1638, 1457-1486, 2773-1788, 931-948, 934-949, 937-952, 942-957, 937-957, 943-958, 937-953, 1346-1363, 1346-1361, 1347-1363, 2162-2179, 2492-2508, 2696-2717, or 2683-2703 of SEQ ID NO: 1. In certain embodiments, the modified oligonucleotides provided herein have a nucleobase sequence comprising a complementary region comprising at least 16 contiguous nucleobases complementary to a target region, wherein the target region is targeted to nucleobases 2773-2788, 1343-1358, or 1344-1359 of SEQ ID NO: 1.

[0411] In certain embodiments, the modified oligonucleotides provided herein are targeted to any one of the following regions of SEQ ID NO: 2: 10195-10294, 13553-13572, 13748-13767, 13455-13475, 13628-13657, 13735-13760, 13746-13905, 13836-13851, 13553-13568, 13563-13578, 13624-13639, 13686-13701, 13760-13775, 13763-13779, 13765-13780, 2580-2595, 6446-6461, 11099-11115, 11082-11099, 1974-1993, 4435-4456, 6035-6052, 6360-6385, 6445-6468, 6807-6824, 6789-6806, and 6596-6615. In certain embodiments, the modified oligonucleotides provided herein are targeted to any one of the following regions of SEQ ID NO: 2: 13836-13831, 8603-8618, and 8604-8619.

[0412] In certain embodiments, the modified oligonucleotides provided herein have a nucleobase sequence comprising a complementary region comprising at least 8 contiguous nucleobases complementary to a target region. In certain embodiments, the modified oligonucleotides provided herein have a nucleobase sequence comprising a complementary region comprising at least 8 contiguous nucleobases complementary to a target region, wherein the target region is targeted to nucleobases 10195-10294, 13553-13572, 13748-13767, 13455-13475, 13628-13657, 13735-13760, 13746-13905, 13836-13851, 13553-13568, 13563-13578, 13624-13639, 13686-13701, 13760-13775, 13763-13779, 13765-13780, 2580-2595, 6446-6461, 11099-11115, 11082-11099, 1974-1993, 4435-4456, 6035-6052, 6360-6385, 6445-6468, 6807-6824, 6789-6806, or 6596-6615 of SEQ ID NO: 2. In certain embodiments, the modified oligonucleotides provided herein have a nucleobase sequence comprising a complementary region comprising at least 8 contiguous nucleobases complementary to a target region, wherein the target region is targeted to nucleobases 13836-13831, 8603-8618, or 8604-8619 of SEQ ID NO: 2.

[0413] In certain embodiments, the modified oligonucleotides provided herein have a nucleobase sequence comprising a complementary region comprising at least 10 contiguous nucleobases complementary to a target region. In certain embodiments, the modified oligonucleotides provided herein have a nucleobase sequence comprising a complementary region comprising at least 10 contiguous nucleobases complementary to a target region, wherein the target region is targeted to nucleobases 10195-10294, 13553-13572, 13748-13767, 13455-13475, 13628-13657, 13735-13760, 13746-13905, 13836-13851, 13553-13568, 13563-13578, 13624-13639, 13686-13701, 13760-13775, 13763-13779, 13765-13780, 2580-2595, 6446-6461, 11099-11115, 11082-11099, 1974-1993, 4435-4456, 6035-6052, 6360-6385, 6445-6468, 6807-6824, 6789-6806, or 6596-6615 of SEQ ID NO: 2. In certain embodiments, the modified oligonucleotides provided herein have a nucleobase sequence comprising a complementary region comprising at least 10 contiguous nucleobases complementary to a target region, wherein the target region is targeted to nucleobases 13836-13831, 8603-8618, or 8604-8619 of SEQ ID NO: 2.

[0414] In certain embodiments, the modified oligonucleotides provided herein have a nucleobase sequence comprising a complementary region comprising at least 12 contiguous nucleobases complementary to a target region. In certain embodiments, the modified oligonucleotides provided herein have a nucleobase sequence comprising a complementary region comprising at least 12 contiguous nucleobases complementary to a target region, wherein the target region is targeted to nucleobases 10195-10294, 13553-13572, 13748-13767, 13455-13475, 13628-13657, 13735-13760, 13746-13905, 13836-13851, 13553-13568, 13563-13578, 13624-13639, 13686-13701, 13760-13775, 13763-13779, 13765-13780, 2580-2595, 6446-6461, 11099-11115, 11082-11099, 1974-1993, 4435-4456, 6035-6052, 6360-6385, 6445-6468, 6807-6824, 6789-6806, or 6596-6615 of SEQ ID NO: 2. In certain embodiments, the modified oligonucleotides provided herein have a nucleobase sequence comprising a complementary region comprising at least 12 contiguous nucleobases complementary to a target region, wherein the target region is targeted to nucleobases 13836-13831, 8603-8618, or 8604-8619 of SEQ ID NO: 2.

[0415] In certain embodiments, the modified oligonucleotides provided herein have a nucleobase sequence comprising a complementary region comprising at least 14 contiguous nucleobases complementary to a target region. In certain embodiments, the modified oligonucleotides provided herein have a nucleobase sequence comprising a complementary region comprising at least 14 contiguous nucleobases complementary to a target region, wherein the target region is targeted to nucleobases 10195-10294, 13553-13572, 13748-13767, 13455-13475, 13628-13657, 13735-13760, 13746-13905, 13836-13851, 13553-13568, 13563-13578, 13624-13639, 13686-13701, 13760-13775, 13763-13779, 13765-13780, 2580-2595, 6446-6461, 11099-11115, 11082-11099, 1974-1993, 4435-4456, 6035-6052, 6360-6385, 6445-6468, 6807-6824, 6789-6806, or 6596-6615 of SEQ ID NO: 2. In certain embodiments, the modified oligonucleotides provided herein have a nucleobase sequence comprising a complementary region comprising at least 14 contiguous nucleobases complementary to a target region, wherein the target region is targeted to nucleobases 13836-13831, 8603-8618, or 8604-8619 of SEQ ID NO: 2.

[0416] In certain embodiments, the modified oligonucleotides provided herein have a nucleobase sequence comprising a complementary region comprising at least 16 contiguous nucleobases complementary to a target region. In certain embodiments, the modified oligonucleotides provided herein have a nucleobase sequence comprising a complementary region comprising at least 16 contiguous nucleobases complementary to a target region, wherein the target region is targeted to nucleobases 10195-10294, 13553-13572, 13748-13767, 13455-13475, 13628-13657, 13735-13760, 13746-13905, 13836-13851, 13553-13568, 13563-13578, 13624-13639, 13686-13701, 13760-13775, 13763-13779, 13765-13780, 2580-2595, 6446-6461, 11099-11115, 11082-11099, 1974-1993, 4435-4456, 6035-6052, 6360-6385, 6445-6468, 6807-6824, 6789-6806, or 6596-6615 of SEQ ID NO: 2. In certain embodiments, the modified oligonucleotides provided herein have a nucleobase sequence comprising a complementary region comprising at least 16 contiguous nucleobases complementary to a target region, wherein the target region is targeted to nucleobases 13836-13831, 8603-8618, or 8604-8619 of SEQ ID NO: 2.

[0417] In certain embodiments, the animal is a human.

[0418] In certain embodiments, the compounds or compositions of the invention are designated as a first agent and the methods of the invention further comprise administering a second agent. In certain embodiments, the first agent and the second agent are co-administered. In certain embodiments the first agent and the second agent are co-administered sequentially or concomitantly.

[0419] In certain embodiments, administration comprises parenteral administration.

[0420] In certain embodiments, the compound is a single-stranded modified oligonucleotide. In certain embodiments, the nucleobase sequence of the modified oligonucleotide is at least 95% complementary to any one of SEQ ID NOs: 1-19 as measured over the entirety of said modified oligonucleotide. In certain embodiments, the nucleobase sequence of the modified oligonucleotide is 100% complementary to any one of SEQ ID NOs: 1-19 as measured over the entirety of said modified oligonucleotide. In certain embodiments, the compound is a single-stranded modified oligonucleotide. In certain embodiments, the nucleobase sequence of the modified oligonucleotide is at least 95% complementary to any one of SEQ ID NO: 1 as measured over the entirety of said modified oligonucleotide. In certain embodiments, the nucleobase sequence of the modified oligonucleotide is 100% complementary to any one of SEQ ID NO: 1 as measured over the entirety of said modified oligonucleotide.

[0421] In certain embodiments, the nucleobase sequence of the modified oligonucleotide is at least 90% complementary to any one of SEQ ID NO: 1 as measured over the entirety of said modified oligonucleotide. In certain embodiments, the nucleobase sequence of the modified oligonucleotide is 85% complementary to any one of SEQ ID NOs: 1 as measured over the entirety of said modified oligonucleotide.

[0422] In certain embodiments, the nucleobase sequence of the modified oligonucleotide is at least 90% complementary to any one of SEQ ID NO: 2 as measured over the entirety of said modified oligonucleotide. In certain embodiments, the nucleobase sequence of the modified oligonucleotide is 85% complementary to any one of SEQ ID NO: 2 as measured over the entirety of said modified oligonucleotide.

[0423] In certain embodiments, at least one internucleoside linkage of said modified oligonucleotide is a modified internucleoside linkage. In certain embodiments, each internucleoside linkage is a phosphorothioate internucleoside linkage.

[0424] In certain embodiments, at least one nucleoside of said modified oligonucleotide comprises a modified sugar. In certain embodiments, at least one modified sugar is a bicyclic sugar. In certain embodiments, at least one modified sugar comprises a 2′-O-methoxyethyl or a 4′-(CH.sub.2).sub.n—O-2′ bridge, wherein n is 1 or 2.

[0425] In certain embodiments, at least one nucleoside of said modified oligonucleotide comprises a modified nucleobase. In certain embodiments, the modified nucleobase is a 5-methylcytosine.

[0426] In certain embodiments, the modified oligonucleotide comprises: a) a gap segment consisting of linked deoxynucleosides; b) a 5′ wing segment consisting of linked nucleosides; and c) a 3′ wing segment consisting of linked nucleosides. The gap segment is positioned between the 5′ wing segment and the 3′ wing segment and each nucleoside of each wing segment comprises a modified sugar.

[0427] In certain embodiments, the modified oligonucleotide comprises: a) a gap segment consisting of ten linked deoxynucleosides; b) a 5′ wing segment consisting of five linked nucleosides; and c) a 3′ wing segment consisting of five linked nucleosides. The gap segment is positioned between the 5′ wing segment and the 3′ wing segment, each nucleoside of each wing segment comprises a 2′-O-methoxyethyl sugar, each internucleoside linkage of said modified oligonucleotide is a phosphorothioate linkage, and each cytosine in said modified oligonucleotide is a 5′-methylcytosine.

[0428] In certain embodiments, the modified oligonucleotide consists of 20 linked nucleosides. In certain embodiments, the modified oligonucleotide consists of 19 linked nucleosides. In certain embodiments, the modified oligonucleotide consists of 18 linked nucleosides. In certain embodiments, the modified oligonucleotide consists of 17 linked nucleosides. In certain embodiments, the modified oligonucleotide consists of 16 linked nucleosides.

[0429] Certain embodiments provide a method of preferentially reducing CUGexp DMPK RNA, reducing myotonia or reducing spliceopathy in an animal comprising administering to the animal a compound comprising a modified oligonucleotide having a gap segment consisting of ten linked deoxynucleosides, a 5′ wing segment consisting of five linked nucleosides and a 3′ wing segment consisting of five linked nucleosides. The gap segment is positioned between the 5′ wing segment and the 3′ wing segment, each nucleoside of each wing segment comprises a 2′-O-methoxyethyl sugar, each internucleoside linkage of said modified oligonucleotide is a phosphorothioate linkage, each cytosine in said modified oligonucleotide is a 5′-methylcytosine.

[0430] In certain embodiments, the modified oligonucleotide comprises: a) a gap segment consisting of eight linked deoxynucleosides; b) a 5′ wing segment consisting of four linked nucleosides and having a E-E-K-K 5′-wing motif; c) a 3′ wing segment consisting of four linked nucleosides and having a K-K-E-E 3′-wing motif; and d) wherein the gap segment is positioned between the 5′ wing segment and the 3′ wing segment, and wherein each E represents 2′-O-methoxyethyl sugar and each K represents a cEt sugar.

[0431] In certain embodiments, the modified oligonucleotide comprises: a) a gap segment consisting of seven linked deoxynucleosides; b) a 5′ wing segment consisting of five linked nucleosides and having an E-E-E-K-K 5′-wing motif; c) a 3′ wing segment consisting of five linked nucleosides and having a K-K-E-E-E 3′-wing motif; and d) wherein the gap segment is positioned between the 5′ wing segment and the 3′ wing segment, and wherein each E represents 2′-O-methoxyethyl sugar and each K represents a cEt sugar.

[0432] In certain embodiments, the modified oligonucleotide comprises: a) a gap segment consisting of ten linked deoxynucleosides; b) a 5′ wing segment consisting of five linked nucleosides; c) a 3′ wing segment consisting of five linked nucleosides; and d) wherein the gap segment is positioned between the 5′ wing segment and the 3′ wing segment, and wherein each nucleoside of each wing segment comprises a 2′-O-methoxyethyl sugar.

[0433] In certain embodiments, the modified oligonucleotide comprises: a) a gap segment consisting of ten linked deoxynucleosides; b) a 5′ wing segment consisting of three linked nucleosides; c) a 3′ wing segment consisting of three linked nucleosides; and d) wherein the gap segment is positioned between the 5′ wing segment and the 3′ wing segment, and wherein each nucleoside of each wing segment comprises a cEt sugar.

[0434] Certain embodiments provide a method of preferentially reducing CUGexp DMPK RNA, reducing myotonia or reducing spliceopathy in an animal comprising administering to the animal a compound comprising a modified oligonucleotide having: a) a gap segment consisting of eight linked deoxynucleosides; b) a 5′ wing segment consisting of four linked nucleosides and having a E-E-K-K 5′-wing motif; c) a 3′ wing segment consisting of four linked nucleosides and having a K-K-E-E 3′-wing motif; and d) wherein the gap segment is positioned between the 5′ wing segment and the 3′ wing segment, and wherein each E represents 2′-O-methoxyethyl sugar and each K represents a cEt sugar.

[0435] Certain embodiments provide a method of preferentially reducing CUGexp DMPK RNA, reducing myotonia or reducing spliceopathy in an animal comprising administering to the animal a compound comprising a modified oligonucleotide having: a) a gap segment consisting of seven linked deoxynucleosides; b) a 5′ wing segment consisting of five linked nucleosides and having an E-E-E-K-K 5′-wing motif; c) a 3′ wing segment consisting of five linked nucleosides and having a K-K-E-E-E 3′-wing motif; and d) wherein the gap segment is positioned between the 5′ wing segment and the 3′ wing segment, and wherein each E represents 2′-O-methoxyethyl sugar and each K represents a cEt sugar.

[0436] Certain embodiments provide a method of preferentially reducing CUGexp DMPK RNA, reducing myotonia or reducing spliceopathy in an animal comprising administering to the animal a compound comprising a modified oligonucleotide having: a) a gap segment consisting of ten linked deoxynucleosides; b) a 5′ wing segment consisting of five linked nucleosides; c) a 3′ wing segment consisting of five linked nucleosides; and d) wherein the gap segment is positioned between the 5′ wing segment and the 3′ wing segment, and wherein each nucleoside of each wing segment comprises a 2′-O-methoxyethyl sugar.

[0437] Certain embodiments provide a method of preferentially reducing CUGexp DMPK RNA, reducing myotonia or reducing spliceopathy in an animal comprising administering to the animal a compound comprising a modified oligonucleotide having: a) a gap segment consisting of ten linked deoxynucleosides; b) a 5′ wing segment consisting of three linked nucleosides; c) a 3′ wing segment consisting of three linked nucleosides; and d) wherein the gap segment is positioned between the 5′ wing segment and the 3′ wing segment, and wherein each nucleoside of each wing segment comprises a cEt sugar.

[0438] Certain embodiments provide the use of any compound as described herein in the manufacture of a medicament for use in any of the therapeutic methods described herein. For example, certain embodiments provide the use of a compound as described herein in the manufacture of a medicament for treating, ameliorating, or preventing type 1 myotonic dystrophy. Certain embodiments provide the use of a compound as described herein in the manufacture of a medicament for inhibiting expression of DMPK and treating, preventing, delaying or ameliorating a DMPK related disease and or a symptom thereof. Certain embodiments provide the use of a compound as described herein in the manufacture of a medicament for reducing DMPK expression in an animal. Certain embodiments provide the use of a compound as described herein in the manufacture of a medicament for preferentially reducing CUGexp DMPK, reducing myotonia, or reducing spliceopathy in an animal. Certain embodiments provide the use of a compound as described herein in the manufacture of a medicament for treating an animal with type 1 myotonic dystrophy. Certain embodiments provide the use of a compound as described herein in the manufacture of a medicament for treating, preventing, delaying, or ameliorating symptoms and outcomes associated with development of DM1 including muscle stiffness, myotonia, disabling distal weakness, weakness in face and jaw muscles, difficulty in swallowing, drooping of the eyelids (ptosis), weakness of neck muscles, weakness in arm and leg muscles, persistent muscle pain, hypersomnia, muscle wasting, dysphagia, respiratory insufficiency, irregular heartbeat, heart muscle damage, apathy, insulin resistance, and cataracts. Certain embodiments provide the use of a compound as described herein in the manufacture of a medicament for counteracting RNA dominance by directing the cleavage of pathogenic transcripts.

[0439] Certain embodiments provide a kit for treating, preventing, or ameliorating type 1 myotonic dystrophy as described herein wherein the kit comprises: a) a compound as described herein; and optionally b) an additional agent or therapy as described herein. The kit can further include instructions or a label for using the kit to treat, prevent, or ameliorate type 1 myotonic dystrophy.

[0440] Certain embodiments provide any compound or composition as described herein, for use in any of the therapeutic methods described herein. For example, certain embodiments provide a compound or composition as described herein for inhibiting expression of DMPK and treating, preventing, delaying or ameliorating a DMPK related disease and or a symptom thereof. Certain embodiments provide a compound or composition as described herein for use in reducing DMPK expression in an animal. Certain embodiments provide a compound or composition as described herein for use in preferentially reducing CUGexp DMPK, reducing myotonia, or reducing spliceopathy in an animal. Certain embodiments provide a compound or composition as described herein for use in treating an animal with type 1 myotonic dystrophy. Certain embodiments provide a compound or composition as described herein for use in treating, preventing, delaying, or ameliorating symptoms and outcomes associated with development of DM1 including muscle stiffness, myotonia, disabling distal weakness, weakness in face and jaw muscles, difficulty in swallowing, drooping of the eyelids (ptosis), weakness of neck muscles, weakness in arm and leg muscles, persistent muscle pain, hypersomnia, muscle wasting, dysphagia, respiratory insufficiency, irregular heartbeat, heart muscle damage, apathy, insulin resistance, and cataracts. Certain embodiments provide a compound or composition as described herein for use in counteracting RNA dominance by directing the cleavage of pathogenic transcripts. Certain embodiments provide compounds comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides having a nucleobase sequence comprising at least 12 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33-874.

[0441] Other compounds which can be used in the methods described herein are also provided.

[0442] For example, certain embodiments provide compounds comprising a modified oligonucleotide consisting of 10 to 80, 12 to 50, 12 to 30, 15 to 30, 18 to 24, 19 to 22, or 20 linked nucleosides having a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, or at least 19, contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33-874.

[0443] Certain embodiments provide compounds comprising a modified oligonucleotide consisting of 10 to 80, 12 to 50, 12 to 30, 15 to 30, 18 to 24, 19 to 22, or 20, linked nucleosides having a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33-874.

[0444] Certain embodiments provide compounds comprising a modified oligonucleotide consisting of 10 to 80, 12 to 50, 12 to 30, 15 to 30, or 15 to 17, linked nucleosides having a nucleobase sequence comprising a portion of at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, or at least 19, or more, contiguous nucleobases complementary to an equal length portion of nucleobases 1343-1368, 1317-1366, 2748-2791, 2155-2208, 2748-2791, 730-748, 528-547, 531-567, 636-697, 1311-1331, 1314-1339, 1446-1475, 1635-1670, 1610-1638, 1457-1486, 2773-1788, 931-948, 934-949, 937-952, 942-957, 937-957, 943-958, 937-953, 1346-1363, 1346-1361, 1347-1363, 2162-2179, 2492-2508, 2696-2717, or 2683-2703 of SEQ ID NO: 1.

[0445] Certain embodiments provide compounds comprising a modified oligonucleotide consisting of 10 to 80, 12 to 50, 12 to 30, 15 to 30, 18 to 24, 19 to 22, or 20, linked nucleosides having a nucleobase sequence comprising a portion of at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, or at least 19, or more, contiguous nucleobases complementary to an equal length portion of nucleobases 10195-10294, 13553-13572, 13748-13767, 13455-13475, 13628-13657, 13735-13760, 13746-13905, 13836-13851, 13553-13568, 13563-13578, 13624-13639, 13686-13701, 13760-13775, 13763-13779, 13765-13780, 2580-2595, 6446-6461, 11099-11115, 11082-11099, 1974-1993, 4435-4456, 6035-6052, 6360-6385, 6445-6468, 6807-6824, 6789-6806, or 6596-6615 of SEQ ID NO: 2.

[0446] In certain embodiments, the modified oligonucleotide is a single-stranded oligonucleotide.

[0447] In certain embodiments, the nucleobase sequence of the modified oligonucleotide is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100%, complementary to any of SEQ ID NOs: 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33-874.

[0448] In certain embodiments, at least one internucleoside linkage is a modified internucleoside linkage.

[0449] In certain embodiments, each internucleoside linkage is a phosphorothioate internucleoside linkage.

[0450] In certain embodiments, at least one nucleoside comprises a modified sugar.

[0451] In certain embodiments, at least one modified sugar is a bicyclic sugar.

[0452] In certain embodiments, at least one modified sugar is a cEt.

[0453] In certain embodiments, at least one modified sugar comprises a 2′-O-methoxyethyl.

[0454] In certain embodiments, at least one nucleoside comprises a modified nucleobase.

[0455] In certain embodiments, the modified nucleobase is a 5-methylcytosine. In certain embodiments, each cytosine residue comprises a 5-methylcytosine.

[0456] In certain embodiments, the modified oligonucleotide consists of 16 linked nucleosides.

[0457] In certain embodiments, the modified oligonucleotide consists of 17 linked nucleosides.

[0458] In certain embodiments, the modified oligonucleotide consists of 20 linked nucleosides.

Antisense Compounds

[0459] Oligomeric compounds include, but are not limited to, oligonucleotides, oligonucleosides, oligonucleotide analogs, oligonucleotide mimetics, antisense compounds, antisense oligonucleotides, and siRNAs. An oligomeric compound can be “antisense” to a target nucleic acid, meaning that is capable of undergoing hybridization to a target nucleic acid through hydrogen bonding.

[0460] In certain embodiments, an antisense compound has a nucleobase sequence that, when written in the 5′ to 3′ direction, comprises the reverse complement of the target segment of a target nucleic acid to which it is targeted. In certain such embodiments, an antisense oligonucleotide has a nucleobase sequence that, when written in the 5′ to 3′ direction, comprises the reverse complement of the target segment of a target nucleic acid to which it is targeted.

[0461] In certain embodiments, an antisense compound targeted to DMPK as described herein is 10 to 30 nucleotides in length. In other words, the antisense compounds are in some embodiments from 10 to 30 linked nucleobases. In other embodiments, the antisense compound comprises a modified oligonucleotide consisting of 8 to 80, 10 to 80, 12 to 30, 12 to 50, 15 to 30, 15 to 18, 15 to 17, 16 to 16, 18 to 24, 19 to 22, or 20 linked nucleobases. In certain such embodiments, the antisense compound comprises a modified oligonucleotide consisting of 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, or 80 linked nucleobases in length, or a range defined by any two of the above values. In certain embodiments, antisense compounds of any of these lengths contain at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, or at least 19, contiguous nucleobases of the nucleobase sequence of any of the exemplary antisense compounds described herein (e.g., at least 8 contiguous nucleobases of a nucleobase sequence recited in any one of SEQ ID NOs: 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33-874.

[0462] In certain embodiments, the antisense compound comprises a shortened or truncated modified oligonucleotide. The shortened or truncated modified oligonucleotide can have a single nucleoside deleted from the 5′ end (5′ truncation), or alternatively from the 3′ end (3′ truncation). A shortened or truncated oligonucleotide can have two nucleosides deleted from the 5′ end, or alternatively can have two subunits deleted from the 3′ end. Alternatively, the deleted nucleosides can be dispersed throughout the modified oligonucleotide, for example, in an antisense compound having one nucleoside deleted from the 5′ end and one nucleoside deleted from the 3′ end.

[0463] When a single additional nucleoside is present in a lengthened oligonucleotide, the additional nucleoside can be located at the 5′ or 3′ end of the oligonucleotide. When two or more additional nucleosides are present, the added nucleosides can be adjacent to each other, for example, in an oligonucleotide having two nucleosides added to the 5′ end (5′ addition), or alternatively to the 3′ end (3′ addition), of the oligonucleotide. Alternatively, the added nucleoside can be dispersed throughout the antisense compound, for example, in an oligonucleotide having one nucleoside added to the 5′ end and one subunit added to the 3′ end.

[0464] It is possible to increase or decrease the length of an antisense compound, such as an antisense oligonucleotide, and/or introduce mismatch bases without eliminating activity. For example, in Woolf et al. (Proc. Natl. Acad. Sci. USA 89:7305-7309, 1992), a series of antisense oligonucleotides 13-25 nucleobases in length were tested for their ability to induce cleavage of a target RNA in an oocyte injection model. Antisense oligonucleotides 25 nucleobases in length with 8 or 11 mismatch bases near the ends of the antisense oligonucleotides were able to direct specific cleavage of the target mRNA, albeit to a lesser extent than the antisense oligonucleotides that contained no mismatches. Similarly, target specific cleavage was achieved using 13 nucleobase antisense oligonucleotides, including those with 1 or 3 mismatches.

[0465] Gautschi et al (J. Natl. Cancer Inst. 93:463-471, March 2001) demonstrated the ability of an oligonucleotide having 100% complementarity to the bcl-2 mRNA and having 3 mismatches to the bcl-xL mRNA to reduce the expression of both bcl-2 and bcl-xL in vitro and in vivo. Furthermore, this oligonucleotide demonstrated potent anti-tumor activity in vivo.

[0466] Maher and Dolnick (Nuc. Acid. Res. 16:3341-3358, 1988) tested a series of tandem 14 nucleobase antisense oligonucleotides, and a 28 and 42 nucleobase antisense oligonucleotides comprised of the sequence of two or three of the tandem antisense oligonucleotides, respectively, for their ability to arrest translation of human DHFR in a rabbit reticulocyte assay. Each of the three 14 nucleobase antisense oligonucleotides alone was able to inhibit translation, albeit at a more modest level than the 28 or 42 nucleobase antisense oligonucleotides.

Target Nucleic Acids, Target Regions and Nucleotide Sequences

[0467] Nucleotide sequences that encode DMPK include, without limitation, the following sequences as set forth in GenBank Accession No. NM_001081560.1 (incorporated herein as SEQ ID NO: 1), GenBank Accession No. NT_011109.15 truncated from nucleotides 18540696 to U.S. Pat. No. 18,555,106 (incorporated herein as SEQ ID NO: 2), GenBank Accession No. NT_039413.7 truncated from nucleotides 16666001 to U.S. Pat. No. 16,681,000 (incorporated herein as SEQ ID NO: 3), GenBank Accession No. NM_032418.1 (incorporated herein as SEQ ID NO: 4), GenBank Accession No. AI007148.1 (incorporated herein as SEQ ID NO: 5), GenBank Accession No. AI304033.1 (incorporated herein as SEQ ID NO: 6), GenBank Accession No. BC024150.1 (incorporated herein as SEQ ID NO: 7), GenBank Accession No. BC056615.1 (incorporated herein as SEQ ID NO: 8), GenBank Accession No. BC075715.1 (incorporated herein as SEQ ID NO: 9), GenBank Accession No. BU519245.1 (incorporated herein as SEQ ID NO: 10), GenBank Accession No. CB247909.1 (incorporated herein as SEQ ID NO: 11), GenBank Accession No. CX208906.1 (incorporated herein as SEQ ID NO: 12), GenBank Accession No. CX732022.1 (incorporated herein as SEQ ID NO: 13), GenBank Accession No. S60315.1 (incorporated herein as SEQ ID NO: 14), GenBank Accession No. S60316.1 (incorporated herein as SEQ ID NO: 15), GenBank Accession No. NM_001081562.1 (incorporated herein as SEQ ID NO: 16), and GenBank Accession No. NM_001100.3 (incorporated herein as SEQ ID NO: 17). It is understood that the sequence set forth in each SEQ ID NO in the Examples contained herein is independent of any modification to a sugar moiety, an internucleoside linkage, or a nucleobase. As such, antisense compounds defined by a SEQ ID NO can comprise, independently, one or more modifications to a sugar moiety, an internucleoside linkage, or a nucleobase. Antisense compounds described by Isis Number (Isis No) indicate a combination of nucleobase sequence and motif.

[0468] In certain embodiments, a target region is a structurally defined region of the target nucleic acid. For example, a target region can encompass a 3′ UTR, a 5′ UTR, an exon, an intron, an exon/intron junction, a coding region, a translation initiation region, translation termination region, or other defined nucleic acid region. The structurally defined regions for DMPK can be obtained by accession number from sequence databases such as NCBI and such information is incorporated herein by reference. In certain embodiments, a target region can encompass the sequence from a 5′ target site of one target segment within the target region to a 3′ target site of another target segment within the target region.

[0469] Targeting includes determination of at least one target segment to which an antisense compound hybridizes, such that a desired effect occurs. In certain embodiments, the desired effect is a reduction in mRNA target nucleic acid levels. In certain embodiments, the desired effect is reduction of levels of protein encoded by the target nucleic acid or a phenotypic change associated with the target nucleic acid.

[0470] A target region can contain one or more target segments. Multiple target segments within a target region can be overlapping. Alternatively, they can be non-overlapping. In certain embodiments, target segments within a target region are separated by no more than about 300 nucleotides. In certain embodiments, target segments within a target region are separated by a number of nucleotides that is, is about, is no more than, is no more than about, 250, 200, 150, 100, 90, 80, 70, 60, 50, 40, 30, 20, or 10 nucleotides on the target nucleic acid, or is a range defined by any two of the preceding values. In certain embodiments, target segments within a target region are separated by no more than, or no more than about, 5 nucleotides on the target nucleic acid. In certain embodiments, target segments are contiguous. Contemplated are target regions defined by a range having a starting nucleic acid that is any of the 5′ target sites or 3′ target sites listed herein.

[0471] Suitable target segments can be found within a 5′ UTR, a coding region, a 3′ UTR, an intron, an exon, or an exon/intron junction. Target segments containing a start codon or a stop codon are also suitable target segments. A suitable target segment can specifically exclude a certain structurally defined region such as the start codon or stop codon.

[0472] The determination of suitable target segments can include a comparison of the sequence of a target nucleic acid to other sequences throughout the genome. For example, the BLAST algorithm can be used to identify regions of similarity amongst different nucleic acids. This comparison can prevent the selection of antisense compound sequences that can hybridize in a non-specific manner to sequences other than a selected target nucleic acid (i.e., non-target or off-target sequences).

[0473] There can be variation in activity (e.g., as defined by percent reduction of target nucleic acid levels) of the antisense compounds within an active target region. In certain embodiments, reductions in DMPK mRNA levels are indicative of inhibition of DMPK protein expression. Reductions in levels of a DMPK protein are also indicative of inhibition of target mRNA expression. Further, phenotypic changes, such as a reducing myotonia or reducing spliceopathy, can be indicative of inhibition of DMPK mRNA and/or protein expression.

Hybridization

[0474] In some embodiments, hybridization occurs between an antisense compound disclosed herein and a DMPK nucleic acid. The most common mechanism of hybridization involves hydrogen bonding (e.g., Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding) between complementary nucleobases of the nucleic acid molecules.

[0475] Hybridization can occur under varying conditions. Stringent conditions are sequence-dependent and are determined by the nature and composition of the nucleic acid molecules to be hybridized.

[0476] Methods of determining whether a sequence is specifically hybridizable to a target nucleic acid are well known in the art (Sambrooke and Russell, Molecular Cloning: A Laboratory Manual, 3.sup.rd Ed., 2001). In certain embodiments, the antisense compounds provided herein are specifically hybridizable with a DMPK nucleic acid.

Complementarity

[0477] An antisense compound and a target nucleic acid are complementary to each other when a sufficient number of nucleobases of the antisense compound can hydrogen bond with the corresponding nucleobases of the target nucleic acid, such that a desired effect will occur (e.g., antisense inhibition of a target nucleic acid, such as a DMPK nucleic acid).

[0478] An antisense compound can hybridize over one or more segments of a DMPK nucleic acid such that intervening or adjacent segments are not involved in the hybridization event (e.g., a loop structure, mismatch or hairpin structure).

[0479] In certain embodiments, the antisense compounds provided herein, or a specified portion thereof, are, or are at least, 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% complementary to a DMPK nucleic acid, a target region, target segment, or specified portion thereof. In certain embodiments, the antisense compounds are at least 70%, at least 80%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% complementary to a DMPK nucleic acid, a target region, target segment, or specified portion thereof, and contain at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, or at least 19, contiguous nucleobases of the nucleobase sequence of any of the exemplary antisense compounds described herein (e.g., at least 8 contiguous nucleobases of a nucleobase sequence recited in any one of SEQ ID NOs: 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33-874). Percent complementarity of an antisense compound with a target nucleic acid can be determined using routine methods, and is measured over the entirety of the antisense compound.

[0480] For example, an antisense compound in which 18 of 20 nucleobases of the antisense compound are complementary to a target region, and would therefore specifically hybridize, would represent 90 percent complementarity. In this example, the remaining noncomplementary nucleobases can be clustered or interspersed with complementary nucleobases and need not be contiguous to each other or to complementary nucleobases. As such, an antisense compound which is 18 nucleobases in length having 4 (four) noncomplementary nucleobases which are flanked by two regions of complete complementarity with the target nucleic acid would have 77.8% overall complementarity with the target nucleic acid and would thus fall within the scope of the present invention. Percent complementarity of an antisense compound with a region of a target nucleic acid can be determined routinely using BLAST programs (basic local alignment search tools) and PowerBLAST programs known in the art (Altschul et al., J. Mol. Biol., 1990, 215, 403 410; Zhang and Madden, Genome Res., 1997, 7, 649 656). Percent homology, sequence identity or complementarity, can be determined by, for example, the Gap program (Wisconsin Sequence Analysis Package, Version 8 for Unix, Genetics Computer Group, University Research Park, Madison Wis.), using default settings, which uses the algorithm of Smith and Waterman (Adv. Appl. Math., 1981, 2, 482 489).

[0481] In certain embodiments, the antisense compounds provided herein, or specified portions thereof, are fully complementary (i.e. 100% complementary) to a target nucleic acid, or specified portion thereof. For example, antisense compound can be fully complementary to a DMPK nucleic acid, or a target region, or a target segment or target sequence thereof. As used herein, “fully complementary” means each nucleobase of an antisense compound is capable of precise base pairing with the corresponding nucleobases of a target nucleic acid. For example, a 20 nucleobase antisense compound is fully complementary to a target sequence that is 400 nucleobases long, so long as there is a corresponding 20 nucleobase portion of the target nucleic acid that is fully complementary to the antisense compound. Fully complementary can also be used in reference to a specified portion of the first and/or the second nucleic acid. For example, a 20 nucleobase portion of a 30 nucleobase antisense compound can be “fully complementary” to a target sequence that is 400 nucleobases long. The 20 nucleobase portion of the 30 nucleobase oligonucleotide is fully complementary to the target sequence if the target sequence has a corresponding 20 nucleobase portion wherein each nucleobase is complementary to the 20 nucleobase portion of the antisense compound. At the same time, the entire 30 nucleobase antisense compound can be fully complementary to the target sequence, depending on whether the remaining 10 nucleobases of the antisense compound are also complementary to the target sequence.

[0482] The location of a non-complementary nucleobase can be at the 5′ end or 3′ end of the antisense compound. Alternatively, the non-complementary nucleobase or nucleobases can be at an internal position of the antisense compound. When two or more non-complementary nucleobases are present, they can be either contiguous (i.e. linked) or non-contiguous. In one embodiment, a non-complementary nucleobase is located in the wing segment of a gapmer antisense oligonucleotide.

[0483] In certain embodiments, antisense compounds that are, or are up to 10, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleobases in length comprise no more than 4, no more than 3, no more than 2, or no more than 1 non-complementary nucleobase(s) relative to a target nucleic acid, such as a DMPK nucleic acid, or specified portion thereof.

[0484] In certain embodiments, antisense compounds that are, or are up to 10, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleobases in length comprise no more than 6, no more than 5, no more than 4, no more than 3, no more than 2, or no more than 1 non-complementary nucleobase(s) relative to a target nucleic acid, such as a DMPK nucleic acid, or specified portion thereof.

[0485] The antisense compounds provided herein also include those which are complementary to a portion of a target nucleic acid. As used herein, “portion” refers to a defined number of contiguous (i.e. linked) nucleobases within a region or segment of a target nucleic acid. A “portion” can also refer to a defined number of contiguous nucleobases of an antisense compound. In certain embodiments, the antisense compounds, are complementary to at least an 8 nucleobase portion of a target segment. In certain embodiments, the antisense compounds are complementary to at least a 10 nucleobase portion of a target segment. In certain embodiments, the antisense compounds are complementary to at least a 15 nucleobase portion of a target segment. Also contemplated are antisense compounds that are complementary to at least an 8, at least a 9, at least a 10, at least an 11, at least a 12, at least a 13, at least a 14, at least a 15, at least a 16, at least a 17, at least an 18, at least a 19, at least a 20, or more nucleobase portion of a target segment, or a range defined by any two of these values.

Identity

[0486] The antisense compounds provided herein can also have a defined percent identity to a particular nucleotide sequence, SEQ ID NO, or compound represented by a specific Isis number, or portion thereof. As used herein, an antisense compound is identical to the sequence disclosed herein if it has the same nucleobase pairing ability. For example, a RNA which contains uracil in place of thymidine in a disclosed DNA sequence would be considered identical to the DNA sequence since both uracil and thymidine pair with adenine. Shortened and lengthened versions of the antisense compounds described herein as well as compounds having non-identical bases relative to the antisense compounds provided herein also are contemplated. The non-identical bases can be adjacent to each other or dispersed throughout the antisense compound. Percent identity of an antisense compound is calculated according to the number of bases that have identical base pairing relative to the sequence to which it is being compared.

[0487] In certain embodiments, the antisense compounds, or portions thereof, are at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% identical to one or more of the exemplary antisense compounds or SEQ ID NOs, or a portion thereof, disclosed herein.

Modifications

[0488] A nucleoside is a base-sugar combination. The nucleobase (also known as base) portion of the nucleoside is normally a heterocyclic base moiety. Nucleotides are nucleosides that further include a phosphate group covalently linked to the sugar portion of the nucleoside. For those nucleosides that include a pentofuranosyl sugar, the phosphate group can be linked to the 2′, 3′ or 5′ hydroxyl moiety of the sugar. Oligonucleotides are formed through the covalent linkage of adjacent nucleosides to one another, to form a linear polymeric oligonucleotide. Within the oligonucleotide structure, the phosphate groups are commonly referred to as forming the internucleoside linkages of the oligonucleotide.

[0489] Modifications to antisense compounds encompass substitutions or changes to internucleoside linkages, sugar moieties, or nucleobases. Modified antisense compounds are often preferred over native forms because of desirable properties such as, for example, enhanced cellular uptake, enhanced affinity for nucleic acid target, increased stability in the presence of nucleases, or increased inhibitory activity.

[0490] Chemically modified nucleosides can also be employed to increase the binding affinity of a shortened or truncated antisense oligonucleotide for its target nucleic acid. Consequently, comparable results can often be obtained with shorter antisense compounds that have such chemically modified nucleosides.

Modified Internucleoside Linkages

[0491] The naturally occurring internucleoside linkage of RNA and DNA is a 3′ to 5′ phosphodiester linkage. Antisense compounds having one or more modified, i.e. non-naturally occurring, internucleoside linkages are often selected over antisense compounds having naturally occurring internucleoside linkages because of desirable properties such as, for example, enhanced cellular uptake, enhanced affinity for target nucleic acids, and increased stability in the presence of nucleases.

[0492] Oligonucleotides having modified internucleoside linkages include internucleoside linkages that retain a phosphorus atom as well as internucleoside linkages that do not have a phosphorus atom. Representative phosphorus containing internucleoside linkages include, but are not limited to, phosphodiesters, phosphotriesters, methylphosphonates, phosphoramidate, and phosphorothioates. Methods of preparation of phosphorous-containing and non-phosphorous-containing linkages are well known.

[0493] In certain embodiments, antisense compounds targeted to a DMPK nucleic acid comprise one or more modified internucleoside linkages. In certain embodiments, the modified internucleoside linkages are phosphorothioate linkages. In certain embodiments, each internucleoside linkage of an antisense compound is a phosphorothioate internucleoside linkage.

Modified Sugar Moieties

[0494] Antisense compounds of the invention can optionally contain one or more nucleosides wherein the sugar group has been modified. Such sugar modified nucleosides may impart enhanced nuclease stability, increased binding affinity, or some other beneficial biological property to the antisense compounds. In certain embodiments, nucleosides comprise chemically modified ribofuranose ring moieties. Examples of chemically modified ribofuranose rings include without limitation, addition of substitutent groups (including 5′ and 2′ substituent groups, bridging of non-geminal ring atoms to form bicyclic nucleic acids (BNA), replacement of the ribosyl ring oxygen atom with S, N(R), or C(R.sub.1)(R.sub.2) (R, R.sub.1 and R.sub.2 are each independently H, C.sub.1-C.sub.12 alkyl or a protecting group) and combinations thereof. Examples of chemically modified sugars include 2′-F-5′-methyl substituted nucleoside (see PCT International Application WO 2008/101157 Published on Aug. 21, 2008 for other disclosed 5′,2′-bis substituted nucleosides) or replacement of the ribosyl ring oxygen atom with S with further substitution at the 2′-position (see published U.S. Patent Application US2005-0130923, published on Jun. 16, 2005) or alternatively 5′-substitution of a BNA (see PCT International Application WO 2007/134181 Published on Nov. 22, 2007 wherein LNA is substituted with for example a 5′-methyl or a 5′-vinyl group).

[0495] Examples of nucleosides having modified sugar moieties include without limitation nucleosides comprising 5′-vinyl, 5′-methyl (R or S), 4′-S, 2′-F, 2′-OCH.sub.3, 2′-OCH.sub.2CH.sub.3, 2′-OCH.sub.2CH.sub.2F and 2′-O(CH.sub.2).sub.2OCH.sub.3 substituent groups. The substituent at the 2′ position can also be selected from allyl, amino, azido, thio, O-allyl, O—C.sub.1-C.sub.10 alkyl, OCF.sub.3, OCH.sub.2F, O(CH.sub.2).sub.2SCH.sub.3, O(CH.sub.2).sub.2—O—N(R.sub.m)(R.sub.n), O—CH.sub.2—C(═O)—N(R.sub.m)(R.sub.n), and O—CH.sub.2—C(═O)—N(R.sub.l)—(CH.sub.2).sub.2—N(R.sub.m)(R.sub.n), where each R.sub.l, R.sub.m and R.sub.n is, independently, H or substituted or unsubstituted C.sub.1-C.sub.10 alkyl.

[0496] Examples of bicyclic nucleic acids (BNAs) include without limitation nucleosides comprising a bridge between the 4′ and the 2′ ribosyl ring atoms. In certain embodiments, antisense compounds provided herein include one or more BNA nucleosides wherein the bridge comprises one of the formulas: 4′-(CH.sub.2)—O-2′ (LNA); 4′-(CH.sub.2)—S-2′; 4′-(CH.sub.2).sub.2—O-2′ (ENA); 4′-CH(CH.sub.3)—O-2′ and 4′-CH(CH.sub.2OCH.sub.3)—O-2′ (and analogs thereof see U.S. Pat. No. 7,399,845, issued on Jul. 15, 2008); 4′-C(CH.sub.3)(CH.sub.3)—O-2′ (and analogs thereof see PCT/US2008/068922 published as WO/2009/006478, published Jan. 8, 2009); 4′-CH.sub.2—N(OCH.sub.3)-2′ (and analogs thereof see PCT/US2008/064591 published as WO/2008/150729, published Dec. 11, 2008); 4′-CH.sub.2—O—N(CH.sub.3)-2′ (see published U.S. Patent Application US2004-0171570, published Sep. 2, 2004); 4′-CH.sub.2—N(R)—O-2′, wherein R is H, C.sub.1-C.sub.12 alkyl, or a protecting group (see U.S. Pat. No. 7,427,672, issued on Sep. 23, 2008); 4′-CH.sub.2—C(H)(CH.sub.3)-2′ (see Chattopadhyaya et al., J. Org. Chem., 2009, 74, 118-134); and 4′-CH.sub.2—C(═CH.sub.2)-2′ (and analogs thereof see PCT/US2008/066154 published as WO 2008/154401, published on Dec. 8, 2008).

[0497] Further bicyclic nucleosides have been reported in published literature (see for example: Srivastava et al., J. Am. Chem. Soc., 2007, 129(26) 8362-8379; Frieden et al., Nucleic Acids Research, 2003, 21, 6365-6372; Elayadi et al., Curr. Opinion Invens. Drugs, 2001, 2, 558-561; Braasch et al., Chem. Biol., 2001, 8, 1-7; Orum et al., Curr. Opinion Mol. Ther., 2001, 3, 239-243; Wahlestedt et al., Proc. Natl. Acad. Sci. U.S.A, 2000, 97, 5633-5638; Singh et al., Chem. Commun., 1998, 4, 455-456; Koshkin et al., Tetrahedron, 1998, 54, 3607-3630; Kumar et al., Bioorg. Med. Chem. Lett., 1998, 8, 2219-2222; Singh et al., J. Org. Chem., 1998, 63, 10035-10039; U.S. Pat. Nos. 7,399,845; 7,053,207; 7,034,133; 6,794,499; 6,770,748; 6,670,461; 6,525,191; 6,268,490; U.S. Patent Publication Nos.: US2008-0039618; US2007-0287831; US2004-0171570; U.S. patent application Ser. Nos. 12/129,154; 61/099,844; 61/097,787; 61/086,231; 61/056,564; 61/026,998; 61/026,995; 60/989,574; International applications WO 2007/134181; WO 2005/021570; WO 2004/106356; WO 94/14226; and PCT International Applications Nos.: PCT/US2008/068922; PCT/US2008/066154; and PCT/US2008/064591). Each of the foregoing bicyclic nucleosides can be prepared having one or more stereochemical sugar configurations including for example α-L-ribofuranose and β-D-ribofuranose (see PCT international application PCT/DK98/00393, published on Mar. 25, 1999 as WO 99/14226).

[0498] In certain embodiments, bicyclic nucleosides comprise a bridge between the 4′ and the 2′ carbon atoms of the pentofuranosyl sugar moiety including without limitation, bridges comprising 1 or from 1 to 4 linked groups independently selected from —[C(R.sub.a)(R.sub.b)].sub.n—, —C(R.sub.a)═C(R.sub.b)—, —C(R.sub.a)═N—, —C(═NR.sub.a)—, —C(═O)—, —C(═S)—, —O—, —Si(R.sub.a).sub.2—, —S(═O).sub.x—, and —N(R.sub.a)—; wherein: x is 0, 1, or 2; n is 1, 2, 3, or 4; each R.sub.a and R.sub.b is, independently, H, a protecting group, hydroxyl, C.sub.1-C.sub.12 alkyl, substituted C.sub.1-C.sub.12 alkyl, C.sub.2-C.sub.12 alkenyl, substituted C.sub.2-C.sub.12 alkenyl, C.sub.2-C.sub.12 alkynyl, substituted C.sub.2-C.sub.12 alkynyl, C.sub.5-C.sub.20 aryl, substituted C.sub.5-C.sub.20 aryl, heterocycle radical, substituted heterocycle radical, heteroaryl, substituted heteroaryl, C.sub.5-C.sub.7 alicyclic radical, substituted C.sub.5-C.sub.7 alicyclic radical, halogen, OJ.sub.1, NJ.sub.1J.sub.2, SJ.sub.1, N.sub.3, COOJ.sub.1, acyl (C(═O)—H), substituted acyl, CN, sulfonyl (S(═O).sub.2-J.sub.1), or sulfoxyl (S(═O)-J.sub.1); and

[0499] each J.sub.1 and J.sub.2 is, independently, H, C.sub.1-C.sub.12 alkyl, substituted C.sub.1-C.sub.12 alkyl, C.sub.2-C.sub.12 alkenyl, substituted C.sub.2-C.sub.12 alkenyl, C.sub.2-C.sub.12 alkynyl, substituted C.sub.2-C.sub.12 alkynyl, C.sub.5-C.sub.20 aryl, substituted C.sub.5-C.sub.20 aryl, acyl (C(═O)—H), substituted acyl, a heterocycle radical, a substituted heterocycle radical, C.sub.1-C.sub.12 aminoalkyl, substituted C.sub.1-C.sub.12 aminoalkyl or a protecting group.

[0500] In certain embodiments, the bridge of a bicyclic sugar moiety is, —[C(R.sub.a)(R.sub.b)].sub.n—, —[C(R.sub.a)(R.sub.b)].sub.n—O—, —C(R.sub.aR.sub.b)—N(R)—O— or —C(R.sub.aR.sub.b)—O—N(R)—. In certain embodiments, the bridge is 4′-CH.sub.2-2′, 4′-(CH.sub.2).sub.2-2′, 4′-(CH.sub.2).sub.3-2′, 4′-CH.sub.2—O-2′, 4′-(CH.sub.2).sub.2—O-2′, 4′-CH.sub.2—O—N(R)-2′ and 4′-CH.sub.2—N(R)—O-2′- wherein each R is, independently, H, a protecting group or C.sub.1-C.sub.12 alkyl.

[0501] In certain embodiments, bicyclic nucleosides are further defined by isomeric configuration. For example, a nucleoside comprising a 4′-(CH.sub.2)—O-2′ bridge, may be in the α-L configuration or in the β-D configuration. Previously, α-L-methyleneoxy (4′-CH.sub.2—O-2′) BNA's have been incorporated into antisense oligonucleotides that showed antisense activity (Frieden et al., Nucleic Acids Research, 2003, 21, 6365-6372).

[0502] In certain embodiments, bicyclic nucleosides include those having a 4′ to 2′ bridge wherein such bridges include without limitation, α-L-4′-(CH.sub.2)—O-2′, β-D-4′-CH.sub.2—O-2′, 4′-(CH.sub.2).sub.2—O-2′, 4′-CH.sub.2—O—N(R)-2′, 4′-CH.sub.2—N(R)—O-2′, 4′-CH(CH.sub.3)—O-2′, 4′-CH.sub.2—S-2′, 4′-CH.sub.2—N(R)-2′, 4′-CH.sub.2—CH(CH.sub.3)-2′, and 4′-(CH.sub.2).sub.3-2′, wherein R is H, a protecting group or C.sub.1-C.sub.12 alkyl.

[0503] In certain embodiments, bicyclic nucleosides have the formula:

##STR00001##

wherein:

[0504] Bx is a heterocyclic base moiety;

[0505] -Q.sub.a-Q.sub.b-Q.sub.c- is —CH.sub.2—N(R.sub.c)—CH.sub.2—, —C(═O)—N(R.sub.c)—CH.sub.2—, —CH.sub.2—O—N(R.sub.c)—, —CH.sub.2—N(R.sub.c)—O— or —N(R.sub.c)—O—CH.sub.2;

[0506] R.sub.c is C.sub.1-C.sub.12 alkyl or an amino protecting group; and

[0507] T.sub.a and T.sub.b are each, independently H, a hydroxyl protecting group, a conjugate group, a reactive phosphorus group, a phosphorus moiety or a covalent attachment to a support medium.

[0508] In certain embodiments, bicyclic nucleosides have the formula:

##STR00002##

wherein:

[0509] Bx is a heterocyclic base moiety;

[0510] T.sub.a and T.sub.b are each, independently H, a hydroxyl protecting group, a conjugate group, a reactive phosphorus group, a phosphorus moiety or a covalent attachment to a support medium;

[0511] Z.sub.a is C.sub.1-C.sub.6 alkyl, C.sub.2-C.sub.6 alkenyl, C.sub.2-C.sub.6 alkynyl, substituted C.sub.1-C.sub.6 alkyl, substituted C.sub.2-C.sub.6 alkenyl, substituted C.sub.2-C.sub.6 alkynyl, acyl, substituted acyl, substituted amide, thiol or substituted thiol.

[0512] In one embodiment, each of the substituted groups, is, independently, mono or poly substituted with substituent groups independently selected from halogen, oxo, hydroxyl, OJ.sub.c, NJ.sub.cJ.sub.d, SJ.sub.c, N.sub.3, OC(═X)J.sub.c, and NJ.sub.eC(═X)NJ.sub.cJ.sub.d, wherein each J.sub.c, J.sub.d and J.sub.e is, independently, H, C.sub.1-C.sub.6 alkyl, or substituted C.sub.1-C.sub.6 alkyl and X is O or NJ.sub.c.

[0513] In certain embodiments, bicyclic nucleosides have the formula:

##STR00003##

wherein:

[0514] Bx is a heterocyclic base moiety;

[0515] T.sub.a and T.sub.b are each, independently H, a hydroxyl protecting group, a conjugate group, a reactive phosphorus group, a phosphorus moiety or a covalent attachment to a support medium;

[0516] Z.sub.b is C.sub.1-C.sub.6 alkyl, C.sub.2-C.sub.6 alkenyl, C.sub.2-C.sub.6 alkynyl, substituted C.sub.1-C.sub.6 alkyl, substituted C.sub.2-C.sub.6 alkenyl, substituted C.sub.2-C.sub.6 alkynyl or substituted acyl (C(═O)—).

[0517] In certain embodiments, bicyclic nucleosides have the formula:

##STR00004##

wherein:

[0518] Bx is a heterocyclic base moiety;

[0519] T.sub.a and T.sub.b are each, independently H, a hydroxyl protecting group, a conjugate group, a reactive phosphorus group, a phosphorus moiety or a covalent attachment to a support medium;

[0520] R.sub.d is C.sub.1-C.sub.6 alkyl, substituted C.sub.1-C.sub.6 alkyl, C.sub.2-C.sub.6 alkenyl, substituted C.sub.2-C.sub.6 alkenyl, C.sub.2-C.sub.6 alkynyl or substituted C.sub.2-C.sub.6 alkynyl;

[0521] each q.sub.a, q.sub.b, q.sub.c and q.sub.d is, independently, H, halogen, C.sub.1-C.sub.6 alkyl, substituted C.sub.1-C.sub.6 alkyl, C.sub.2-C.sub.6 alkenyl, substituted C.sub.2-C.sub.6 alkenyl, C.sub.2-C.sub.6 alkynyl or substituted C.sub.2-C.sub.6 alkynyl, C.sub.1-C.sub.6 alkoxyl, substituted C.sub.1-C.sub.6 alkoxyl, acyl, substituted acyl, C.sub.1-C.sub.6 aminoalkyl or substituted C.sub.1-C.sub.6 aminoalkyl;

[0522] In certain embodiments, bicyclic nucleosides have the formula:

##STR00005##

wherein:

[0523] Bx is a heterocyclic base moiety;

[0524] T.sub.a and T.sub.b are each, independently H, a hydroxyl protecting group, a conjugate group, a reactive phosphorus group, a phosphorus moiety or a covalent attachment to a support medium;

[0525] q.sub.a, q.sub.b, q.sub.e and q.sub.f are each, independently, hydrogen, halogen, C.sub.1-C.sub.12 alkyl, substituted C.sub.1-C.sub.12 alkyl, C.sub.2-C.sub.12 alkenyl, substituted C.sub.2-C.sub.12 alkenyl, C.sub.2-C.sub.12 alkynyl, substituted C.sub.2-C.sub.12 alkynyl, C.sub.1-C.sub.12 alkoxy, substituted C.sub.1-C.sub.12 alkoxy, OJ.sub.j, SJ.sub.j, SOJ.sub.j, SO.sub.2J.sub.j, NJ.sub.jJ.sub.k, N.sub.3, CN, C(═O)OJ.sub.j, C(═O)NJ.sub.jJ.sub.k, C(═O)J.sub.j, O—C(═O)NJ.sub.jJ.sub.k, N(H)C(═NH)NJ.sub.jJ.sub.k, N(H)C(═O)NJ.sub.jJ.sub.k or N(H)C(═S)NJ.sub.jJ.sub.k;

[0526] or q.sub.e and q.sub.f together are ═C(q.sub.g)(q.sub.h);

[0527] q.sub.g and q.sub.h are each, independently, H, halogen, C.sub.1-C.sub.12 alkyl or substituted C.sub.1-C.sub.12 alkyl.

[0528] The synthesis and preparation of adenine, cytosine, guanine, 5-methyl-cytosine, thymine and uracil bicyclic nucleosides having a 4′-CH.sub.2—O-2′ bridge, along with their oligomerization, and nucleic acid recognition properties have been described (Koshkin et al., Tetrahedron, 1998, 54, 3607-3630). The synthesis of bicyclic nucleosides has also been described in WO 98/39352 and WO 99/14226.

[0529] Analogs of various bicyclic nucleosides that have 4′ to 2′ bridging groups such as 4′-CH.sub.2—O-2′ and 4′-CH.sub.2—S-2′, have also been prepared (Kumar et al., Bioorg. Med. Chem. Lett., 1998, 8, 2219-2222). Preparation of oligodeoxyribonucleotide duplexes comprising bicyclic nucleosides for use as substrates for nucleic acid polymerases has also been described (Wengel et al., WO 99/14226). Furthermore, synthesis of 2′-amino-BNA, a novel conformationally restricted high-affinity oligonucleotide analog has been described in the art (Singh et al., J. Org. Chem., 1998, 63, 10035-10039). In addition, 2′-amino- and 2′-methylamino-BNA's have been prepared and the thermal stability of their duplexes with complementary RNA and DNA strands has been previously reported.

[0530] In certain embodiments, bicyclic nucleosides have the formula:

##STR00006##

wherein:

[0531] Bx is a heterocyclic base moiety;

[0532] T.sub.a and T.sub.b are each, independently H, a hydroxyl protecting group, a conjugate group, a reactive phosphorus group, a phosphorus moiety or a covalent attachment to a support medium;

[0533] each q.sub.i, q.sub.j, q.sub.k and q.sub.l is, independently, H, halogen, C.sub.1-C.sub.12 alkyl, substituted C.sub.1-C.sub.12 alkyl, C.sub.2-C.sub.12 alkenyl, substituted C.sub.2-C.sub.12 alkenyl, C.sub.2-C.sub.12 alkynyl, substituted C.sub.2-C.sub.12 alkynyl, C.sub.1-C.sub.12 alkoxyl, substituted C.sub.1-C.sub.12 alkoxyl, OJ.sub.j, SJ.sub.j, SOJ.sub.j, SO.sub.2J.sub.j, NJ.sub.jJ.sub.k, N.sub.3, CN, C(═O)OJ.sub.j, C(═O)NJ.sub.jJ.sub.k, C(═O)J.sub.j, O—C(═O)NJ.sub.jJ.sub.k, N(H)C(═NH)NJ.sub.jJ.sub.k, N(H)C(═O)NJ.sub.jJ.sub.k or N(H)C(═S)NJ.sub.jJ.sub.k; and

[0534] q.sub.i and q.sub.j or q.sub.l and q.sub.k together are ═C(q.sub.g)(q.sub.h), wherein q.sub.g and q.sub.h are each, independently, H, halogen, C.sub.1-C.sub.12 alkyl or substituted C.sub.1-C.sub.12 alkyl.

[0535] One carbocyclic bicyclic nucleoside having a 4′-(CH.sub.2).sub.3-2′ bridge and the alkenyl analog bridge 4′-CH═CH—CH.sub.2-2′ have been described (Frier et al., Nucleic Acids Research, 1997, 25(22), 4429-4443 and Albaek et al., J. Org. Chem., 2006, 71, 7731-7740). The synthesis and preparation of carbocyclic bicyclic nucleosides along with their oligomerization and biochemical studies have also been described (Srivastava et al., J. Am. Chem. Soc. 2007, 129(26), 8362-8379).

[0536] In certain embodiments, bicyclic nucleosides include, but are not limited to, (A) α-L-methyleneoxy (4′-CH.sub.2—O-2′) BNA, (B) β-D-methyleneoxy (4′-CH.sub.2—O-2′) BNA, (C) ethyleneoxy (4′-(CH.sub.2).sub.2—O-2′) BNA, (D) aminooxy (4′-CH.sub.2—O—N(R)-2′) BNA, (E) oxyamino (4′-CH.sub.2—N(R)—O-2′) BNA, (F) methyl(methyleneoxy) (4′-CH(CH.sub.3)—O-2′) BNA (also referred to as constrained ethyl or cEt), (G) methylene-thio (4′-CH.sub.2—S-2′) BNA, (H) methylene-amino (4′-CH.sub.2—N(R)-2′) BNA, (I) methyl carbocyclic (4′-CH.sub.2—CH(CH.sub.3)-2′) BNA, (J) propylene carbocyclic (4′-(CH.sub.2).sub.3-2′) BNA, and (K) vinyl BNA as depicted below.

##STR00007##

wherein Bx is the base moiety and R is, independently, H, a protecting group, C.sub.1-C.sub.6 alkyl or C.sub.1-C.sub.6 alkoxy.

[0537] In certain embodiments, nucleosides are modified by replacement of the ribosyl ring with a sugar surrogate. Such modification includes without limitation, replacement of the ribosyl ring with a surrogate ring system (sometimes referred to as DNA analogs) such as a morpholino ring, a cyclohexenyl ring, a cyclohexyl ring or a tetrahydropyranyl ring such as one having one of the formula:

##STR00008##

[0538] In certain embodiments, sugar surrogates are selected having the formula:

##STR00009##

wherein:

[0539] Bx is a heterocyclic base moiety;

[0540] T.sub.3 and T.sub.4 are each, independently, an internucleoside linking group linking the tetrahydropyran nucleoside analog to the oligomeric compound or one of T.sub.3 and T.sub.4 is an internucleoside linking group linking the tetrahydropyran nucleoside analog to an oligomeric compound or oligonucleotide and the other of T.sub.3 and T.sub.4 is H, a hydroxyl protecting group, a linked conjugate group or a 5′ or 3-terminal group;

q.sub.1, q.sub.2, q.sub.3, q.sub.4, q.sub.5, q.sub.6 and q.sub.7 are each independently, H, C.sub.1-C.sub.6 alkyl, substituted C.sub.1-C.sub.6 alkyl, C.sub.2-C.sub.6 alkenyl, substituted C.sub.2-C.sub.6 alkenyl, C.sub.2-C.sub.6 alkynyl or substituted C.sub.2-C.sub.6 alkynyl; and

[0541] one of R.sub.1 and R.sub.2 is hydrogen and the other is selected from halogen, substituted or unsubstituted alkoxy, NJ.sub.1J.sub.2, SJ.sub.1, N.sub.3, OC(═X)J.sub.1, OC(═X)NJ.sub.1J.sub.2, NJ.sub.3C(═X)NJ.sub.1J.sub.2 and CN, wherein X is O, S or NJ.sub.1 and each J.sub.1, J.sub.2 and J.sub.3 is, independently, H or C.sub.1-C.sub.6 alkyl.

[0542] In certain embodiments, q.sub.1, q.sub.2, q.sub.3, q.sub.4, q.sub.5, q.sub.6 and q are each H. In certain embodiments, at least one of q.sub.1, q.sub.2, q.sub.3, q.sub.4, q.sub.5, q.sub.6 and q is other than H. In certain embodiments, at least one of q.sub.1, q.sub.2, q.sub.3, q.sub.4, q.sub.5, q.sub.6 and q is methyl. In certain embodiments, THP nucleosides are provided wherein one of R.sub.1 and R.sub.2 is F. In certain embodiments, R.sub.1 is fluoro and R.sub.2 is H; R.sub.1 is methoxy and R.sub.2 is H, and R.sub.1 is methoxyethoxy and R.sub.2 is H.

[0543] Such sugar surrogates include, but are not limited to, what is referred to in the art as hexitol nucleic acid (HNA), altritol nucleic acid (ANA), and mannitol nucleic acid (MNA) (see Leumann, C. J., Bioorg. & Med. Chem., 2002, 10, 841-854).

[0544] In certain embodiments, sugar surrogates comprise rings having more than 5 atoms and more than one heteroatom. For example nucleosides comprising morpholino sugar moieties and their use in oligomenc compounds has been reported (see for example: Braasch et al., Biochemistry, 2002, 41, 4503-4510; and U.S. Pat. Nos. 5,698,685; 5,166,315; 5,185,444; and 5,034,506).

[0545] As used here, the term “morpholino” means a sugar surrogate having the following structure:

##STR00010##

[0546] In certain embodiments, morpholinos may be modified, for example by adding or altering various substituent groups from the above morpholino structure. Such sugar surrogates are refered to herein as “modifed morpholinos.”

[0547] In certain embodiments, antisense compounds comprise one or more modified cyclohexenyl nucleosides, which is a nucleoside having a six-membered cyclohexenyl in place of the pentofuranosyl residue in naturally occurring nucleosides. Modified cyclohexenyl nucleosides include, but are not limited to those described in the art (see for example commonly owned, published PCT Application WO 2010/036696, published on Apr. 10, 2010, Robeyns et al., J. Am. Chem. Soc., 2008, 130(6), 1979-1984; Horvith et al., Tetrahedron Letters, 2007, 48, 3621-3623; Nauwelaerts et al., J. Am. Chem. Soc., 2007, 129(30), 9340-9348; Gu et al., Nucleosides, Nucleotides & Nucleic Acids, 2005, 24(5-7), 993-998; Nauwelaerts et al., Nucleic Acids Research, 2005, 33(8), 2452-2463; Robeyns et al., Acta Crystallographica, Section F: Structural Biology and Crystallization Communications, 2005, F61(6), 585-586; Gu et al., Tetrahedron, 2004, 60(9), 2111-2123; Gu et al., Oligonucleotides, 2003, 13(6), 479-489; Wang et al., J. Org. Chem., 2003, 68, 4499-4505; Verbeure et al., Nucleic Acids Research, 2001, 29(24), 4941-4947; Wang et al., J Org. Chem., 2001, 66, 8478-82; Wang et al., Nucleosides, Nucleotides & Nucleic Acids, 2001, 20(4-7), 785-788; Wang et al., J. Am. Chem., 2000, 122, 8595-8602; Published PCT application, WO 06/047842; and Published PCT Application WO 01/049687; the text of each is incorporated by reference herein, in their entirety). Certain modified cyclohexenyl nucleosides have the formula:

##STR00011##

wherein:

[0548] Bx is a heterocyclic base moiety;

[0549] T.sub.3 and T.sub.4 are each, independently, an internucleoside linking group linking the cyclohexenyl nucleoside analog to an antisense compound or one of T.sub.3 and T.sub.4 is an internucleoside linking group linking the tetrahydropyran nucleoside analog to an antisense compound and the other of T.sub.3 and T.sub.4 is H, a hydroxyl protecting group, a linked conjugate group, or a 5′- or 3′-terminal group; and q.sub.1, q.sub.2, q.sub.3, q.sub.4, q.sub.5, q.sub.6, q.sub.7, q.sub.8 and q.sub.9 are each, independently, H, C.sub.1-C.sub.6 alkyl, substituted C.sub.1-C.sub.6 alkyl, C.sub.2-C.sub.6 alkenyl, substituted C.sub.2-C.sub.6 alkenyl, C.sub.2-C.sub.6 alkynyl, substituted C.sub.2-C.sub.6 alkynyl or other sugar substituent group.

[0550] Many other bicyclic and tricyclic sugar surrogate ring systems are also known in the art that can be used to modify nucleosides for incorporation into antisense compounds (see for example review article: Leumann, Christian J., Bioorg. & Med. Chem., 2002, 10, 841-854). Such ring systems can undergo various additional substitutions to enhance activity.

[0551] Methods for the preparations of modified sugars are well known to those skilled in the art. Some representative U.S. patents that teach the preparation of such modified sugars include without limitation, U.S. Pat. Nos. 4,981,957; 5,118,800; 5,319,080; 5,359,044; 5,393,878; 5,446,137; 5,466,786; 5,514,785; 5,519,134; 5,567,811; 5,576,427; 5,591,722; 5,597,909; 5,610,300; 5,627,053; 5,639,873; 5,646,265; 5,670,633; 5,700,920; 5,792,847 and 6,600,032 and International Application PCT/US2005/019219, filed Jun. 2, 2005 and published as WO 2005/121371 on Dec. 22, 2005, and each of which is herein incorporated by reference in its entirety.

[0552] In nucleotides having modified sugar moieties, the nucleobase moieties (natural, modified or a combination thereof) are maintained for hybridization with an appropriate nucleic acid target.

[0553] In certain embodiments, antisense compounds targeted to a DMPK nucleic acid comprise one or more nucleotides having modified sugar moieties. In certain embodiments, the modified sugar moiety is 2′-MOE. In certain embodiments, the 2′-MOE modified nucleotides are arranged in a gapmer motif.

Modified Nucleobases

[0554] Nucleobase (or base) modifications or substitutions are structurally distinguishable from, yet functionally interchangeable with, naturally occurring or synthetic unmodified nucleobases. Both natural and modified nucleobases are capable of participating in hydrogen bonding. Such nucleobase modifications can impart nuclease stability, binding affinity or some other beneficial biological property to antisense compounds. Modified nucleobases include synthetic and natural nucleobases such as, for example, 5-methylcytosine (5-me-C). Certain nucleobase substitutions, including 5-methylcytosine substitutions, are particularly useful for increasing the binding affinity of an antisense compound for a target nucleic acid. For example, 5-methylcytosine substitutions have been shown to increase nucleic acid duplex stability by 0.6-1.2° C. (Sanghvi, Y. S., Crooke, S. T. and Lebleu, B., eds., Antisense Research and Applications, CRC Press, Boca Raton, 1993, pp. 276-278).

[0555] Additional unmodified nucleobases include 5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyl (—C≡C—CH.sub.3) uracil and cytosine and other alkynyl derivatives of pyrimidine bases, 6-azo uracil, cytosine and thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl and other 8-substituted adenines and guanines, 5-halo particularly 5-bromo, 5-trifluoromethyl and other 5-substituted uracils and cytosines, 7-methylguanine and 7-methyladenine, 2-F-adenine, 2-amino-adenine, 8-azaguanine and 8-azaadenine, 7-deazaguanine and 7-deazaadenine and 3-deazaguanine and 3-deazaadenine.

[0556] Heterocyclic base moieties can also include those in which the purine or pyrimidine base is replaced with other heterocycles, for example 7-deaza-adenine, 7-deazaguanosine, 2-aminopyridine and 2-pyridone. Nucleobases that are particularly useful for increasing the binding affinity of antisense compounds include 5-substituted pyrimidines, 6-azapyrimidines and N-2, N-6 and 0-6 substituted purines, including 2 aminopropyladenine, 5-propynyluracil and 5-propynylcytosine.

[0557] In certain embodiments, antisense compounds targeted to a DMPK nucleic acid comprise one or more modified nucleobases. In certain embodiments, gap-widened antisense oligonucleotides targeted to a DMPK nucleic acid comprise one or more modified nucleobases. In certain embodiments, the modified nucleobase is 5-methylcytosine. In certain embodiments, each cytosine is a 5-methylcytosine.

Certain Antisense Compound Motifs

[0558] In certain embodiments, antisense compounds targeted to a DMPK nucleic acid have chemically modified subunits arranged in patterns, or motifs, to confer to the antisense compounds properties such as enhanced the inhibitory activity, increased binding affinity for a target nucleic acid, or resistance to degradation by in vivo nucleases.

[0559] Chimeric antisense compounds typically contain at least one region modified so as to confer increased resistance to nuclease degradation, increased cellular uptake, increased binding affinity for the target nucleic acid, and/or increased inhibitory activity. A second region of a chimeric antisense compound can optionally serve as a substrate for the cellular endonuclease RNase H, which cleaves the RNA strand of an RNA:DNA duplex.

[0560] Antisense compounds having a gapmer motif are considered chimeric antisense compounds. In a gapmer an internal region having a plurality of nucleotides that supports RNaseH cleavage is positioned between external regions having a plurality of nucleotides that are chemically distinct from the nucleosides of the internal region. In the case of an antisense oligonucleotide having a gapmer motif, the gap segment generally serves as the substrate for endonuclease cleavage, while the wing segments comprise modified nucleosides. In certain embodiments, the regions of a gapmer are differentiated by the types of sugar moieties comprising each distinct region. The types of sugar moieties that are used to differentiate the regions of a gapmer can in some embodiments include β-D-ribonucleosides, β-D-deoxyribonucleosides, 2′-modified nucleosides (such 2′-modified nucleosides can include 2′-MOE, and 2′-O—CH.sub.3, among others), and bicyclic sugar modified nucleosides (such bicyclic sugar modified nucleosides can include those having a 4′-(CH.sub.2).sub.n—O-2′ bridge, where n=1 or n=2). The wing-gap-wing motif is frequently described as “X—Y—Z”, where “X” represents the length of the 5′ wing region, “Y” represents the length of the gap region, and “Z” represents the length of the 3′ wing region. As used herein, a gapmer described as “X—Y—Z” has a configuration such that the gap segment is positioned immediately adjacent each of the 5′ wing segment and the 3′ wing segment. Thus, no intervening nucleotides exist between the 5′ wing segment and gap segment, or the gap segment and the 3′ wing segment. Any of the antisense compounds described herein can have a gapmer motif. In some embodiments, X and Z are the same, in other embodiments they are different. In a preferred embodiment, Y is between 8 and 15 nucleotides. X, Y or Z can be any of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30 or more nucleotides. Thus, gapmers include, but are not limited to, for example 5-10-5, 4-8-4, 4-12-3, 4-12-4, 3-14-3, 2-13-5, 2-16-2, 1-18-1, 3-10-3, 2-10-2, 1-10-1, 2-8-2, 6-8-6, 5-8-5, 5-7-5, 1-8-1, or 2-6-2.

[0561] In certain embodiments, the antisense compound as a “wingmer” motif, having a wing-gap or gap-wing configuration, i.e. an X-Y or Y—Z configuration as described above for the gapmer configuration. Thus, wingmer configurations include, but are not limited to, for example 5-10, 8-4, 4-12, 12-4, 3-14, 16-2, 18-1, 10-3, 2-10, 1-10, 8-2, 2-13, or 5-13.

[0562] In certain embodiments, antisense compounds targeted to a DMPK nucleic acid possess a 5-10-5 gapmer motif. In certain embodiments, antisense compounds targeted to a DMPK nucleic acid possess a 5-7-5 gapmer motif. In certain embodiments, antisense compounds targeted to a DMPK nucleic acid possess a 3-10-3 gapmer motif. In certain embodiments, antisense compounds targeted to a DMPK nucleic acid possess a 4-8-4 gapmer motif.

[0563] In certain embodiments, an antisense compound targeted to a DMPK nucleic acid has a gap-widened motif.

[0564] In certain embodiments, antisense compounds of any of these gapmer or wingmer motifs contain at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, or at least 19, contiguous nucleobases of the nucleobase sequence of any of the exemplary antisense compounds described herein (e.g., at least 8 contiguous nucleobases of a nucleobase sequence recited in any one of SEQ ID NOs: 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33-874.

[0565] In certain embodiments, the present invention provides oligomeric compounds comprising oligonucleotides. In certain embodiments, such oligonucleotides comprise one or more chemical modification. In certain embodiments, chemically modified oligonucleotides comprise one or more modified sugars. In certain embodiments, chemically modified oligonucleotides comprise one or more modified nucleobases. In certain embodiments, chemically modified oligonucleotides comprise one or more modified internucleoside linkages. In certain embodiments, the chemically modifications (sugar modifications, nucleobase modifications, and/or linkage modifications) define a pattern or motif. In certain embodiments, the patterns of chemical modifications of sugar moieties, internucleoside linkages, and nucleobases are each independent of one another. Thus, an oligonucleotide may be described by its sugar modification motif, internucleoside linkage motif and/or nucleobase modification motif (as used herein, nucleobase modification motif describes the chemical modifications to the nucleobases independent of the sequence of nucleobases).

[0566] Certain Sugar Motifs

[0567] In certain embodiments, oligonucleotides comprise one or more type of modified sugar moieties and/or naturally occurring sugar moieties arranged along an oligonucleotide or region thereof in a defined pattern or sugar modification motif Such motifs may include any of the sugar modifications discussed herein and/or other known sugar modifications.

[0568] In certain embodiments, the oligonucleotides comprise or consist of a region having a gapmer sugar modification motif, which comprises two external regions or “wings” and an internal region or “gap.” The three regions of a gapmer motif (the 5′-wing, the gap, and the 3′-wing) form a contiguous sequence of nucleosides wherein at least some of the sugar moieties of the nucleosides of each of the wings differ from at least some of the sugar moieties of the nucleosides of the gap. Specifically, at least the sugar moieties of the nucleosides of each wing that are closest to the gap (the 3′-most nucleoside of the 5′-wing and the 5′-most nucleoside of the 3′-wing) differ from the sugar moiety of the neighboring gap nucleosides, thus defining the boundary between the wings and the gap. In certain embodiments, the sugar moieties within the gap are the same as one another. In certain embodiments, the gap includes one or more nucleoside having a sugar moiety that differs from the sugar moiety of one or more other nucleosides of the gap. In certain embodiments, the sugar modification motifs of the two wings are the same as one another (symmetric gapmer). In certain embodiments, the sugar modification motifs of the 5′-wing differs from the sugar modification motif of the 3′-wing (asymmetric gapmer).

[0569] Certain 5′-Wings

[0570] In certain embodiments, the 5′-wing of a gapmer consists of 1 to 5 linked nucleosides. In certain embodiments, the 5′-wing of a gapmer consists of 2 to 5 linked nucleosides. In certain embodiments, the 5′-wing of a gapmer consists of 3 to 5 linked nucleosides. In certain embodiments, the 5′-wing of a gapmer consists of 4 or 5 linked nucleosides. In certain embodiments, the 5′-wing of a gapmer consists of 1 to 4 linked nucleosides. In certain embodiments, the 5′-wing of a gapmer consists of 1 to 3 linked nucleosides. In certain embodiments, the 5′-wing of a gapmer consists of 1 or 2 linked nucleosides. In certain embodiments, the 5′-wing of a gapmer consists of 2 to 4 linked nucleosides. In certain embodiments, the 5′-wing of a gapmer consists of 2 or 3 linked nucleosides. In certain embodiments, the 5′-wing of a gapmer consists of 3 or 4 linked nucleosides. In certain embodiments, the 5′-wing of a gapmer consists of 1 nucleoside. In certain embodiments, the 5′-wing of a gapmer consists of 2 linked nucleosides. In certain embodiments, the 5′-wing of a gapmer consists of 3 linked nucleosides. In certain embodiments, the 5′-wing of a gapmer consists of 4 linked nucleosides. In certain embodiments, the 5′-wing of a gapmer consists of 5 linked nucleosides.

[0571] In certain embodiments, the 5′-wing of a gapmer comprises at least one bicyclic nucleoside. In certain embodiments, the 5′-wing of a gapmer comprises at least two bicyclic nucleosides. In certain embodiments, the 5′-wing of a gapmer comprises at least three bicyclic nucleosides. In certain embodiments, the 5′-wing of a gapmer comprises at least four bicyclic nucleosides. In certain embodiments, the 5′-wing of a gapmer comprises at least one constrained ethyl nucleoside. In certain embodiments, the 5′-wing of a gapmer comprises at least one LNA nucleoside. In certain embodiments, each nucleoside of the 5′-wing of a gapmer is a bicyclic nucleoside. In certain embodiments, each nucleoside of the 5′-wing of a gapmer is a constrained ethyl nucleoside. In certain embodiments, each nucleoside of the 5′-wing of a gapmer is a LNA nucleoside.

[0572] In certain embodiments, the 5′-wing of a gapmer comprises at least one non-bicyclic modified nucleoside. In certain embodiments, the 5′-wing of a gapmer comprises at least one 2′-substituted nucleoside. In certain embodiments, the 5′-wing of a gapmer comprises at least one 2′-MOE nucleoside. In certain embodiments, the 5′-wing of a gapmer comprises at least one 2′-OMe nucleoside. In certain embodiments, each nucleoside of the 5′-wing of a gapmer is a non-bicyclic modified nucleoside. In certain embodiments, each nucleoside of the 5′-wing of a gapmer is a 2′-substituted nucleoside. In certain embodiments, each nucleoside of the 5′-wing of a gapmer is a 2′-MOE nucleoside. In certain embodiments, each nucleoside of the 5′-wing of a gapmer is a 2′-OMe nucleoside.

[0573] In certain embodiments, the 5′-wing of a gapmer comprises at least one bicyclic nucleoside and at least one non-bicyclic modified nucleoside. In certain embodiments, the 5′-wing of a gapmer comprises at least one bicyclic nucleoside and at least one 2′-substituted nucleoside. In certain embodiments, the 5′-wing of a gapmer comprises at least one bicyclic nucleoside and at least one 2′-MOE nucleoside. In certain embodiments, the 5′-wing of a gapmer comprises at least one bicyclic nucleoside and at least one 2′-OMe nucleoside. In certain embodiments, the 5′-wing of a gapmer comprises at least one bicyclic nucleoside and at least one 2′-deoxynucleoside.

[0574] In certain embodiments, the 5′-wing of a gapmer comprises at least one constrained ethyl nucleoside and at least one non-bicyclic modified nucleoside. In certain embodiments, the 5′-wing of a gapmer comprises at least one constrained ethyl nucleoside and at least one 2′-substituted nucleoside. In certain embodiments, the 5′-wing of a gapmer comprises at least one constrained ethyl nucleoside and at least one 2′-MOE nucleoside. In certain embodiments, the 5′-wing of a gapmer comprises at least one constrained ethyl nucleoside and at least one 2′-OMe nucleoside. In certain embodiments, the 5′-wing of a gapmer comprises at least one constrained ethyl nucleoside and at least one 2′-deoxynucleoside.

[0575] In certain embodiments, the 5′-wing of a gapmer comprises at least one LNA nucleoside and at least one non-bicyclic modified nucleoside. In certain embodiments, the 5′-wing of a gapmer comprises at least one LNA nucleoside and at least one 2′-substituted nucleoside. In certain embodiments, the 5′-wing of a gapmer comprises at least one LNA nucleoside and at least one 2′-MOE nucleoside. In certain embodiments, the 5′-wing of a gapmer comprises at least one LNA nucleoside and at least one 2′-OMe nucleoside. In certain embodiments, the 5′-wing of a gapmer comprises at least one LNA nucleoside and at least one 2′-deoxynucleoside.

[0576] In certain embodiments, the 5′-wing of a gapmer comprises three constrained ethyl nucleosides. In certain embodiments, the 5′-wing of a gapmer comprises two bicyclic nucleosides and two non bicyclic modified nucleosides. In certain embodiments, the 5′-wing of a gapmer comprises two constrained ethyl nucleosides and two 2′-MOE nucleosides. In certain embodiments, the 5′-wing of a gapmer comprises two bicyclic nucleosides and two non bicyclic modified nucleosides. In certain embodiments, the 5′-wing of a gapmer comprises two constrained ethyl nucleosides and two 2′-MOE nucleosides. In certain embodiments, the 5′-wing of a gapmer comprises two constrained ethyl nucleosides and three 2′-MOE nucleosides.

[0577] In certain embodiments, the 5′-wing of a gapmer comprises three LNA nucleosides. In certain embodiments, the 5′-wing of a gapmer comprises two LNA nucleosides and two non bicyclic modified nucleosides. In certain embodiments, the 5′-wing of a gapmer comprises two LNA nucleosides and two 2′-MOE nucleosides. In certain embodiments, the 5′-wing of a gapmer comprises two LNA and two non bicyclic modified nucleosides. In certain embodiments, the 5′-wing of a gapmer comprises two LNA nucleosides and two 2′-MOE nucleosides. In certain embodiments, the 5′-wing of a gapmer comprises two LNA nucleosides and three 2′-MOE nucleosides.

[0578] In certain embodiments, the 5′-wing of a gapmer comprises three constrained ethyl nucleosides. In certain embodiments, the 5′-wing of a gapmer comprises two bicyclic nucleosides and two non bicyclic modified nucleosides. In certain embodiments, the 5′-wing of a gapmer comprises two constrained ethyl nucleosides and two 2′-OMe nucleosides. In certain embodiments, the 5′-wing of a gapmer comprises two bicyclic nucleosides and two non bicyclic modified nucleosides. In certain embodiments, the 5′-wing of a gapmer comprises two constrained ethyl nucleosides and two 2′-OMe nucleosides. In certain embodiments, the 5′-wing of a gapmer comprises two constrained ethyl nucleosides and three 2′-OMe nucleosides.

[0579] In certain embodiments, the 5′-wing of a gapmer comprises three LNA nucleosides. In certain embodiments, the 5′-wing of a gapmer comprises two LNA nucleosides and two non bicyclic modified nucleosides. In certain embodiments, the 5′-wing of a gapmer comprises two LNA nucleosides and two 2′-OMe nucleosides. In certain embodiments, the 5′-wing of a gapmer comprises two LNA and two non bicyclic modified nucleosides. In certain embodiments, the 5′-wing of a gapmer comprises two LNA nucleosides and two 2′-OMe nucleosides. In certain embodiments, the 5′-wing of a gapmer comprises two LNA nucleosides and three 2′-OMe nucleosides.

[0580] In certain embodiments, the 5′-wing of a gapmer has an AABB motif, wherein each A is selected from among a 2′-MOE nucleoside and a 2′OMe nucleoside. In certain embodiments, the 5′-wing of a gapmer has an AABB motif, wherein each B is selected from among a cEt, LNA, α-L-LNA, ENA and 2′-thio LNA nucleoside. In certain embodiments, the 5′-wing of a gapmer has an AABB motif, wherein each A represents a 2′-MOE nucleoside and each B represents a constrained ethyl nucleoside.

[0581] In certain embodiments, the 5′-wing of a gapmer has an AAABB motif, wherein each A is selected from among a 2′-MOE nucleoside and a 2′OMe nucleoside. In certain embodiments, the 5′-wing of a gapmer has an AABB motif, wherein each B is selected from among a cEt, LNA, α-L-LNA, ENA and 2′-thio LNA nucleoside. In certain embodiments, the 5′-wing of a gapmer has an AABB motif, wherein each A represents a 2′-MOE nucleoside and each B represents a constrained ethyl nucleoside.

Certain 3′-Wings

[0582] In certain embodiments, the 3′-wing of a gapmer consists of 1 to 5 linked nucleosides. In certain embodiments, the 3′-wing of a gapmer consists of 2 to 5 linked nucleosides. In certain embodiments, the 3′-wing of a gapmer consists of 3 to 5 linked nucleosides. In certain embodiments, the 3′-wing of a gapmer consists of 4 or 5 linked nucleosides. In certain embodiments, the 3′-wing of a gapmer consists of 1 to 4 linked nucleosides. In certain embodiments, the 3′-wing of a gapmer consists of 1 to 3 linked nucleosides. In certain embodiments, the 3′-wing of a gapmer consists of 1 or 2 linked nucleosides. In certain embodiments, the 3′-wing of a gapmer consists of 2 to 4 linked nucleosides. In certain embodiments, the 3′-wing of a gapmer consists of 2 or 3 linked nucleosides. In certain embodiments, the 3′-wing of a gapmer consists of 3 or 4 linked nucleosides. In certain embodiments, the 3′-wing of a gapmer consists of 1 nucleoside. In certain embodiments, the 3′-wing of a gapmer consists of 2 linked nucleosides. In certain embodiments, the 3′-wing of a gapmer consists of 3 linked nucleosides. In certain embodiments, the 3′-wing of a gapmer consists of 4 linked nucleosides. In certain embodiments, the 3′-wing of a gapmer consists of 5 linked nucleosides.

[0583] In certain embodiments, the 3′-wing of a gapmer comprises at least one bicyclic nucleoside. In certain embodiments, the 3′-wing of a gapmer comprises at least one constrained ethyl nucleoside. In certain embodiments, the 3′-wing of a gapmer comprises at least one LNA nucleoside. In certain embodiments, each nucleoside of the 3′-wing of a gapmer is a bicyclic nucleoside. In certain embodiments, each nucleoside of the 3′-wing of a gapmer is a constrained ethyl nucleoside. In certain embodiments, each nucleoside of the 3′-wing of a gapmer is a LNA nucleoside.

[0584] In certain embodiments, the 3′-wing of a gapmer comprises at least one non-bicyclic modified nucleoside. In certain embodiments, the 3′-wing of a gapmer comprises at least two non-bicyclic modified nucleosides. In certain embodiments, the 3′-wing of a gapmer comprises at least three non-bicyclic modified nucleosides. In certain embodiments, the 3′-wing of a gapmer comprises at least four non-bicyclic modified nucleosides. In certain embodiments, the 3′-wing of a gapmer comprises at least one 2′-substituted nucleoside. In certain embodiments, the 3′-wing of a gapmer comprises at least one 2′-MOE nucleoside. In certain embodiments, the 3′-wing of a gapmer comprises at least one 2′-OMe nucleoside. In certain embodiments, each nucleoside of the 3′-wing of a gapmer is a non-bicyclic modified nucleoside. In certain embodiments, each nucleoside of the 3′-wing of a gapmer is a 2′-substituted nucleoside. In certain embodiments, each nucleoside of the 3′-wing of a gapmer is a 2′-MOE nucleoside. In certain embodiments, each nucleoside of the 3′-wing of a gapmer is a 2′-OMe nucleoside.

[0585] In certain embodiments, the 3′-wing of a gapmer comprises at least one bicyclic nucleoside and at least one non-bicyclic modified nucleoside. In certain embodiments, the 3′-wing of a gapmer comprises at least one bicyclic nucleoside and at least one 2′-substituted nucleoside. In certain embodiments, the 3′-wing of a gapmer comprises at least one bicyclic nucleoside and at least one 2′-MOE nucleoside. In certain embodiments, the 3′-wing of a gapmer comprises at least one bicyclic nucleoside and at least one 2′-OMe nucleoside. In certain embodiments, the 3′-wing of a gapmer comprises at least one bicyclic nucleoside and at least one 2′-deoxynucleoside.

[0586] In certain embodiments, the 3′-wing of a gapmer comprises at least one constrained ethyl nucleoside and at least one non-bicyclic modified nucleoside. In certain embodiments, the 3′-wing of a gapmer comprises at least one constrained ethyl nucleoside and at least one 2′-substituted nucleoside. In certain embodiments, the 3′-wing of a gapmer comprises at least one constrained ethyl nucleoside and at least one 2′-MOE nucleoside. In certain embodiments, the 3′-wing of a gapmer comprises at least one constrained ethyl nucleoside and at least one 2′-OMe nucleoside. In certain embodiments, the 3′-wing of a gapmer comprises at least one constrained ethyl nucleoside and at least one 2′-deoxynucleoside.

[0587] In certain embodiments, the 3′-wing of a gapmer comprises at least one LNA nucleoside and at least one non-bicyclic modified nucleoside. In certain embodiments, the 3′-wing of a gapmer comprises at least one LNA nucleoside and at least one 2′-substituted nucleoside. In certain embodiments, the 3′-wing of a gapmer comprises at least one LNA nucleoside and at least one 2′-MOE nucleoside. In certain embodiments, the 3′-wing of a gapmer comprises at least one LNA nucleoside and at least one 2′-OMe nucleoside. In certain embodiments, the 3′-wing of a gapmer comprises at least one LNA nucleoside and at least one 2′-deoxynucleoside.

[0588] In certain embodiments, the 3′-wing of a gapmer comprises three constrained ethyl nucleosides. In certain embodiments, the 3′-wing of a gapmer comprises two bicyclic nucleosides and two non bicyclic modified nucleosides. In certain embodiments, the 3′-wing of a gapmer comprises two constrained ethyl nucleosides and two 2′-MOE nucleosides. In certain embodiments, the 3′-wing of a gapmer comprises two bicyclic nucleosides and two non bicyclic modified nucleosides. In certain embodiments, the 3′-wing of a gapmer comprises two constrained ethyl nucleosides and two 2′-MOE nucleosides. In certain embodiments, the 5′-wing of a gapmer comprises two constrained ethyl nucleosides and three 2′-MOE nucleosides.

[0589] In certain embodiments, the 3′-wing of a gapmer comprises three LNA nucleosides. In certain embodiments, the 3′-wing of a gapmer comprises two LNA nucleosides and two non bicyclic modified nucleosides. In certain embodiments, the 3′-wing of a gapmer comprises two LNA nucleosides and two 2′-MOE nucleosides. In certain embodiments, the 3′-wing of a gapmer comprises two LNA and two non bicyclic modified nucleosides. In certain embodiments, the 3′-wing of a gapmer comprises two LNA nucleosides and two 2′-MOE nucleosides. In certain embodiments, the 3′-wing of a gapmer comprises two LNA nucleosides and three 2′-MOE nucleosides.

[0590] In certain embodiments, the 3′-wing of a gapmer comprises three constrained ethyl nucleosides. In certain embodiments, the 3′-wing of a gapmer comprises two bicyclic nucleosides and two non bicyclic modified nucleosides. In certain embodiments, the 3′-wing of a gapmer comprises two constrained ethyl nucleosides and two 2′-OMe nucleosides. In certain embodiments, the 3′-wing of a gapmer comprises two bicyclic nucleosides and two non bicyclic modified nucleosides. In certain embodiments, the 3′-wing of a gapmer comprises two constrained ethyl nucleosides and two 2′-OMe nucleosides. In certain embodiments, the 3′-wing of a gapmer comprises two constrained ethyl nucleosides and three 2′-OMe nucleosides.

[0591] In certain embodiments, the 3′-wing of a gapmer comprises three LNA nucleosides. In certain embodiments, the 3′-wing of a gapmer comprises two LNA nucleosides and two non bicyclic modified nucleosides. In certain embodiments, the 3′-wing of a gapmer comprises two LNA nucleosides and two 2′-OMe nucleosides. In certain embodiments, the 3′-wing of a gapmer comprises two LNA and two non bicyclic modified nucleosides. In certain embodiments, the 3′-wing of a gapmer comprises two LNA nucleosides and two 2′-OMe nucleosides. In certain embodiments, the 3′-wing of a gapmer comprises two LNA nucleosides and three 2′-OMe nucleosides.

[0592] In certain embodiments, the 3′-wing of a gapmer has a BBAA motif, wherein each A is selected from among a 2′-MOE nucleoside and a 2′OMe nucleoside. In certain embodiments, the 3′-wing of a gapmer has an BBAA motif, wherein each B is selected from among a cEt, LNA, α-L-LNA, ENA and 2′-thio LNA nucleoside. In certain embodiments, the 3′-wing of a gapmer has a BBAA motif, wherein each A represents a 2′-MOE nucleoside and each B represents a constrained ethyl nucleoside.

[0593] In certain embodiments, the 3′-wing of a gapmer has a BBAAA motif, wherein each A is selected from among a 2′-MOE nucleoside and a 2′OMe nucleoside. In certain embodiments, the 3′-wing of a gapmer has a BBAA motif, wherein each B is selected from among a cEt, LNA, α-L-LNA, ENA and 2′-thio LNA nucleoside. In certain embodiments, the 3′-wing of a gapmer has a BBAA motif, wherein each A represents a 2′-MOE nucleoside and each B represents a constrained ethyl nucleoside.

Compositions and Methods for Formulating Pharmaceutical Compositions

[0594] Antisense oligonucleotides can be admixed with pharmaceutically acceptable active or inert substance for the preparation of pharmaceutical compositions or formulations. Compositions and methods for the formulation of pharmaceutical compositions are dependent upon a number of criteria, including, but not limited to, route of administration, extent of disease, or dose to be administered.

[0595] Antisense compound targeted to a DMPK nucleic acid can be utilized in pharmaceutical compositions by combining the antisense compound with a suitable pharmaceutically acceptable diluent or carrier. A pharmaceutically acceptable diluent includes phosphate-buffered saline (PBS). PBS is a diluent suitable for use in compositions to be delivered parenterally. Accordingly, in one embodiment, employed in the methods described herein is a pharmaceutical composition comprising an antisense compound targeted to a DMPK nucleic acid and a pharmaceutically acceptable diluent. In certain embodiments, the pharmaceutically acceptable diluent is PBS. In certain embodiments, the antisense compound is an antisense oligonucleotide.

[0596] Pharmaceutical compositions comprising antisense compounds encompass any pharmaceutically acceptable salts, esters, or salts of such esters, or any other oligonucleotide which, upon administration to an animal, including a human, is capable of providing (directly or indirectly) the biologically active metabolite or residue thereof. Accordingly, for example, the disclosure is also drawn to pharmaceutically acceptable salts of antisense compounds, prodrugs, pharmaceutically acceptable salts of such prodrugs, and other bioequivalents. Suitable pharmaceutically acceptable salts include, but are not limited to, sodium and potassium salts.

[0597] A prodrug can include the incorporation of additional nucleosides at one or both ends of an antisense compound which are cleaved by endogenous nucleases within the body, to form the active antisense compound.

Conjugated Antisense Compounds

[0598] Antisense compounds can be covalently linked to one or more moieties or conjugates which enhance the activity, cellular distribution or cellular uptake of the resulting antisense oligonucleotides. Typical conjugate groups include cholesterol moieties and lipid moieties. Additional conjugate groups include carbohydrates, phospholipids, biotin, phenazine, folate, phenanthridine, anthraquinone, acridine, fluoresceins, rhodamines, coumarins, and dyes.

[0599] Antisense compounds can also be modified to have one or more stabilizing groups that are generally attached to one or both termini of antisense compounds to enhance properties such as, for example, nuclease stability. Included in stabilizing groups are cap structures. These terminal modifications protect the antisense compound having terminal nucleic acid from exonuclease degradation, and can help in delivery and/or localization within a cell. The cap can be present at the 5′-terminus (5′-cap), or at the 3′-terminus (3′-cap), or can be present on both termini. Cap structures are well known in the art and include, for example, inverted deoxy abasic caps. Further 3′ and 5′-stabilizing groups that can be used to cap one or both ends of an antisense compound to impart nuclease stability include those disclosed in WO 03/004602 published on Jan. 16, 2003.

Cell Culture and Antisense Compounds Treatment

[0600] The effects of antisense compounds on the level, activity or expression of DMPK nucleic acids can be tested in vitro in a variety of cell types. Cell types used for such analyses are available from commercial vendors (e.g. American Type Culture Collection, Manassas, Va.; Zen-Bio, Inc., Research Triangle Park, N.C.; Clonetics Corporation, Walkersville, Md.) and cells are cultured according to the vendor's instructions using commercially available reagents (e.g. Invitrogen Life Technologies, Carlsbad, Calif.). Illustrative cell types include, but are not limited to, HepG2 cells, Hep3B cells, primary hepatocytes, A549 cells, GM04281 fibroblasts and LLC-MK2 cells.

In Vitro Testing of Antisense Oligonucleotides

[0601] Described herein are methods for treatment of cells with antisense oligonucleotides, which can be modified appropriately for treatment with other antisense compounds.

[0602] In general, cells are treated with antisense oligonucleotides when the cells reach approximately 60-80% confluence in culture.

[0603] One reagent commonly used to introduce antisense oligonucleotides into cultured cells includes the cationic lipid transfection reagent LIPOFECTIN® (Invitrogen, Carlsbad, Calif.). Antisense oligonucleotides are mixed with LIPOFECTIN® in OPTI-MEM® 1 (Invitrogen, Carlsbad, Calif.) to achieve the desired final concentration of antisense oligonucleotide and a LIPOFECTIN® concentration that typically ranges 2 to 12 ug/mL per 100 nM antisense oligonucleotide.

[0604] Another reagent used to introduce antisense oligonucleotides into cultured cells includes LIPOFECTAMINE 2000® (Invitrogen, Carlsbad, Calif.). Antisense oligonucleotide is mixed with LIPOFECTAMINE 2000® in OPTI-MEM® 1 reduced serum medium (Invitrogen, Carlsbad, Calif.) to achieve the desired concentration of antisense oligonucleotide and a LIPOFECTAMINE® concentration that typically ranges 2 to 12 ug/mL per 100 nM antisense oligonucleotide.

[0605] Another reagent used to introduce antisense oligonucleotides into cultured cells includes Cytofectin® (Invitrogen, Carlsbad, Calif.). Antisense oligonucleotide is mixed with Cytofectin® in OPTI-MEM® 1 reduced serum medium (Invitrogen, Carlsbad, Calif.) to achieve the desired concentration of antisense oligonucleotide and a Cytofectin® concentration that typically ranges 2 to 12 ug/mL per 100 nM antisense oligonucleotide.

[0606] Another technique used to introduce antisense oligonucleotides into cultured cells includes electroporation.

[0607] Cells are treated with antisense oligonucleotides by routine methods. Cells are typically harvested 16-24 hours after antisense oligonucleotide treatment, at which time RNA or protein levels of target nucleic acids are measured by methods known in the art and described herein. In general, when treatments are performed in multiple replicates, the data are presented as the average of the replicate treatments.

[0608] The concentration of antisense oligonucleotide used varies from cell line to cell line. Methods to determine the optimal antisense oligonucleotide concentration for a particular cell line are well known in the art. Antisense oligonucleotides are typically used at concentrations ranging from 1 nM to 300 nM when transfected with LIPOFECTAMINE2000®, Lipofectin or Cytofectin. Antisense oligonucleotides are used at higher concentrations ranging from 625 to 20,000 nM when transfected using electroporation.

RNA Isolation

[0609] RNA analysis can be performed on total cellular RNA or poly(A)+ mRNA. Methods of RNA isolation are well known in the art. RNA is prepared using methods well known in the art, for example, using the TRIZOL® Reagent (Invitrogen, Carlsbad, Calif.) according to the manufacturer's recommended protocols.

Analysis of Inhibition of Target Levels or Expression

[0610] Inhibition of levels or expression of a DMPK nucleic acid can be assayed in a variety of ways known in the art. For example, target nucleic acid levels can be quantitated by, e.g., Northern blot analysis, competitive polymerase chain reaction (PCR), or quantitaive real-time PCR. RNA analysis can be performed on total cellular RNA or poly(A)+mRNA. Methods of RNA isolation are well known in the art. Northern blot analysis is also routine in the art. Quantitative real-time PCR can be conveniently accomplished using the commercially available ABI PRISM® 7600, 7700, or 7900 Sequence Detection System, available from PE-Applied Biosystems, Foster City, Calif. and used according to manufacturer's instructions.

Quantitative Real-Time PCR Analysis of Target RNA Levels

[0611] Quantitation of target RNA levels can be accomplished by quantitative real-time PCR using the ABI PRISM® 7600, 7700, or 7900 Sequence Detection System (PE-Applied Biosystems, Foster City, Calif.) according to manufacturer's instructions. Methods of quantitative real-time PCR are well known in the art.

[0612] Prior to real-time PCR, the isolated RNA is subjected to a reverse transcriptase (RT) reaction, which produces complementary DNA (cDNA) that is then used as the substrate for the real-time PCR amplification. The RT and real-time PCR reactions are performed sequentially in the same sample well. RT and real-time PCR reagents are obtained from Invitrogen (Carlsbad, Calif.). RT, real-time-PCR reactions are carried out by methods well known to those skilled in the art.

[0613] Gene (or RNA) target quantities obtained by real time PCR are normalized using either the expression level of a gene whose expression is constant, such as cyclophilin A, or by quantifying total RNA using RIBOGREEN® (Invitrogen, Inc. Carlsbad, Calif.). Cyclophilin A expression is quantified by real time PCR, by being run simultaneously with the target, multiplexing, or separately. Total RNA is quantified using RIBOGREEN® RNA quantification reagent (Invitrogen, Inc. Eugene, Oreg.). Methods of RNA quantification by RIBOGREEN® are taught in Jones, L. J., et al, (Analytical Biochemistry, 1998, 265, 368-374). A CYTOFLUOR® 4000 instrument (PE Applied Biosystems) is used to measure RIBOGREEN® fluorescence.

[0614] Probes and primers are designed to hybridize to a DMPK nucleic acid. Methods for designing real-time PCR probes and primers are well known in the art, and can include the use of software such as PRIMER EXPRESS® Software (Applied Biosystems, Foster City, Calif.).

Analysis of Protein Levels

[0615] Antisense inhibition of DMPK nucleic acids can be assessed by measuring DMPK protein levels. Protein levels of DMPK can be evaluated or quantitated in a variety of ways well known in the art, such as immunoprecipitation, Western blot analysis (immunoblotting), enzyme-linked immunosorbent assay (ELISA), quantitative protein assays, protein activity assays (for example, caspase activity assays), immunohistochemistry, immunocytochemistry or fluorescence-activated cell sorting (FACS). Antibodies directed to a target can be identified and obtained from a variety of sources, such as the MSRS catalog of antibodies (Aerie Corporation, Birmingham, Mich.), or can be prepared via conventional monoclonal or polyclonal antibody generation methods well known in the art.

In Vivo Testing of Antisense Compounds

[0616] Antisense compounds, for example, antisense oligonucleotides, are tested in animals to assess their ability to inhibit expression of DMPK and produce phenotypic changes. Testing can be performed in normal animals, or in experimental disease models, for example, the HSA.sup.LR mouse model of myotonic dystrophy (DM1).

[0617] The HSA.sup.LR mouse model is an established model for DM1 (Mankodi, A. et al. Science. 289: 1769, 2000). The mice carry a human skeletal actin (hACTA1) transgene with 220 CTG repeats inserted in the 3′ UTR of the gene. The hACTA1-CUG.sup.exp transcript accumulates in nuclear foci in skeletal muscles and results in myotonia similar to that in human DM1 (Mankodi, A. et al. Mol. Cell 10: 35, 2002; Lin, X. et al. Hum. Mol. Genet. 15: 2087, 2006). Hence, it is expected that amelioration of DM1 symptoms in the HSA.sup.LR mouse by antisense inhibition of the hACTA1 transgene would predict amelioration of similar symptoms in human patients by antisense inhibition of the DMPK transcript.

[0618] Expression of CUG.sup.exp RNA in mice causes extensive remodeling of the muscle transcriptome, much of which is reproduced by ablation of MBNL1. Hence, it is expected that normalization of the transcriptome in HSA.sup.LR mice would predict normalization of the human transcriptome in DM1 patients by antisense inhibition of the DMPK transcript.

[0619] For administration to animals, antisense oligonucleotides are formulated in a pharmaceutically acceptable diluent, such as phosphate-buffered saline. Administration includes parenteral routes of administration. Following a period of treatment with antisense oligonucleotides, RNA is isolated from tissue and changes in DMPK nucleic acid expression are measured. Changes in DMPK protein levels are also measured.

Splicing

[0620] Myotonic dystrophy (DM1) is caused by CTG repeat expansions in the 3′ untranslated region of the DMPK gene (Brook, J. D. et al. Cell. 68: 799, 1992). This mutation leads to RNA dominance, a process in which expression of RNA containing an expanded CUG repeat (CUGexp) induces cell dysfunction (Osborne R J and Thornton C A., Human Molecular Genetics., 2006, 15(2): R162-R169). Such CUGexp are retained in the nuclear foci of skeletal muscles (Davis, B. M. et al. Proc. Natl. Acad. Sci. U.S.A. 94:7388, 1997). The accumulation of CUGexp in the nuclear foci leads to the sequestration of poly(CUG)-binding proteins, such as, Muscleblind-like 1 (MBLN1) (Miller, J. W. et al. EMBO J. 19: 4439, 2000). MBLN1 is a splicing factor and regulates the splicing of genes such as Serca1, CIC-1, Titin, and Zasp. Therefore, sequestration of MBLN1 by CUGexp triggers misregulated alternative splicing of the exons of genes that MBLN1 normally controls (Lin, X. et al. Hum. Mol. Genet. 15: 2087, 2006). Correction of alternative splicing in an animal displaying such disregulation, such as, for example, in a DM1 patient and the HSALR mouse model, is a useful indicator for the efficacy of a treatment, including treatment with an antisense oligonucleotide.

Certain Antisense Mechanisms

[0621] Myotonic dystrophy (DM1) is caused by CTG repeat expansions in the 3′ untranslated region of the DMPK gene. In certain embodiments, expansions in the 3′ untranslated region of the DMPK gene results in the transcription of RNA containing an expanded CUG repeat, and RNA containing an expanded CUG repeat (CUGexp) is retained in the nuclear foci of skeletal muscles. In certain instances, the cellular machinery responsible for exporting mRNA from the nucleus into the cytoplasm does not export RNA containing an expanded CUG repeat from the nucleus or does so less efficiently. In certain embodiments, cells do not export DMPK CUGexp mRNA from the nucleus or such export is reduced. Accordingly, in certain embodiments, DMPK CUGexp mRNA accumulates in the nucleus. In certain embodiments, more copies of DMPK CUGexp mRNA are present in the nucleus of a cell than are copies of wild-type DMPK mRNA, which is exported normally. In such embodiments, antisense compounds that reduce target in the nucleus will preferentially reduce mutant DMPK CUGexp mRNA relative to wild type DMPK mRNA, due to their relative abundences in the nucleus, even if the antisense compound does not otherwise distinguish between mutant and wild type. Since RNase H dependent antisense compounds are active in the nucleus, such compounds are particularly well suited for such use.

[0622] In certain instances, wild-type DMPK pre-mRNA and mutant CUGexp DMPK pre-mRNA are expected to be processed into mRNA at similar rate. Accordingly, approximately the same amount of wild-type DMPK pre-mRNA and mutant CUGexp DMPK pre-mRNA are expected to be present in the nucleus of a cell. However, after proceesing, wild type DMPK mRNA is exported from the nucleus relatively quickly, and mutant CUGexp DMPK mRNA is exported slowly or not at all. In certan such embodiments, mutant CUGexp DMPK mRNA accumulates in the nucleus in greater amounts than wild-type DMPK mRNA. In certain such embodiments, an antisense oligonucleotide targeted to the mRNA, will preferentially reduce the expression of the mutant CUGexp DMPK mRNA compared to the wild-type DMPK mRNA because more copies of the mutant CUGexp DMPK mRNA are present in the nucleus of the cell. In certain embodiments, antisense compounds targeted to pre-mRNA and not mRNA (e.g., targeting an intron) are not expected to preferentially reduce mutant DMPK relative to wild type, because the nuclear abundance of the two pre-mRNAs is likely to be similar. In certain embodiments, antisense compounds described herein are not targeted to introns of DMPK pre-mRNA. In certain embodiments, antisense compounds described herein are targeted to exons or exon-exon junctions present in DMPK mRNA. In certain embodiments, use of an antisense oligonucleotide to target the mRNA is therefore preferred because an antisense oligonucleotide having one or more features described herein (i) has activity in the nucleus of a cell and (2) will preferentially reduce mutant CUGexp DMPK mRNA compared to wild-type DMPK mRNA.

Certain Biomarkers

[0623] DM1 severity in mouse models is determined, at least in part, by the level of CUG.sup.exp transcript accumulation in the nucleus or nuclear foci. A useful physiological marker for DM1 severity is the development of high-frequency runs of involuntary action potentials (myotonia).

Certain Indications

[0624] In certain embodiments, provided herein are methods of treating an individual comprising administering one or more pharmaceutical compositions as described herein. In certain embodiments, the individual has type 1 myotonic dystrophy (DM1).

[0625] Accordingly, provided herein are methods for ameliorating a symptom associated with type 1 myotonic dystrophy in a subject in need thereof. In certain embodiments, provided is a method for reducing the rate of onset of a symptom associated with type 1 myotonic dystrophy. In certain embodiments, provided is a method for reducing the severity of a symptom associated with type 1 myotonic dystrophy. In certain embodiments, symptoms associated with DM1 include muscle stiffness, myotonia, disabling distal weakness, weakness in face and jaw muscles, difficulty in swallowing, drooping of the eyelids (ptosis), weakness of neck muscles, weakness in arm and leg muscles, persistent muscle pain, hypersomnia, muscle wasting, dysphagia, respiratory insufficiency, irregular heartbeat, heart muscle damage, apathy, insulin resistance, and cataracts. In children, the symptoms may also be developmental delays, learning problems, language and speech issues, and personality development issues.

[0626] In certain embodiments, the methods comprise administering to an individual in need thereof a therapeutically effective amount of a compound targeted to a DMPK nucleic acid.

[0627] In certain embodiments, administration of an antisense compound targeted to a DMPK nucleic acid results in reduction of DMPK expression by at least about 15%, by at least about 20%, by at least about 25%, by at least about 30%, by at least about 35%, by at least about 40%, by at least about 45%, by at least about 50%, by at least about 55%, by at least about 60%, by least about 65%, by least about 70%, by least about 75%, by least about 80%, by at least about 85%, by at least about 90%, by at least about 95% or by at least about 99%, or a range defined by any two of these values.

[0628] In certain embodiments, pharmaceutical compositions comprising an antisense compound targeted to DMPK are used for the preparation of a medicament for treating a patient suffering or susceptible to type 1 myotonic dystrophy.

[0629] In certain embodiments, the methods described herein include administering a compound comprising a modified oligonucleotide having a contiguous nucleobases portion as described herein of a sequence recited in SEQ ID NOs: 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33-874.

Administration

[0630] In certain embodiments, the compounds and compositions as described herein are administered parenterally.

[0631] In certain embodiments, parenteral administration is by infusion. Infusion can be chronic or continuous or short or intermittent. In certain embodiments, infused pharmaceutical agents are delivered with a pump. In certain embodiments, parenteral administration is by injection (e.g., bolus injection). The injection can be delivered with a syringe.

[0632] Parenteral administration includes subcutaneous administration, intravenous administration, intramuscular administration, intraarterial administration, intraperitoneal administration, or intracranial administration, e.g., intrathecal or intracerebroventricular administration. Administration can be continuous, or chronic, or short, or intermittent.

[0633] In certain embodiments, the administering is subcutaneous, intravenous, intracerebral, intracerebroventricular, intrathecal or another administration that results in a systemic effect of the oligonucleotide (systemic administration is characterized by a systemic effect, i.e., an effect in more than one tissue) or delivery to the CNS or to the CSF.

[0634] The duration of action as measured by inhibition of alpha 1 actin and reduction of myotonia in the HSA.sup.LR mouse model of DM1 is prolonged in muscle tissue including quadriceps, gastrocnemius, and the tibialis anterior (see Examples, below). Subcutaneous injections of antisense oligonucleotide for 4 weeks results in inhibition of alpha 1 actin by at least 70% in quadriceps, gastrocnemius, and the tibialis anterior in HSA.sup.LR mice for at least 11 weeks (77 days) after termination of dosing. Subcutaneous injections of antisense oligonucleotide for 4 weeks results in elimination of myotonia in quadriceps, gastrocnemius, and the tibialis anterior in HSA.sup.LR mice for at least 11 weeks (77 days) after termination of dosing.

[0635] In certain embodiments, delivery of a compound of composition, as described herein, results in at least 70% down-regulation of a target mRNA and/or target protein for at least 77 days. In certain embodiments, delivery of a compound or composition, as described herein, results in 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% down-regulation of a target mRNA and/or target protein for at least 30 days, at least 35 days, at least 40 days, at least 45 days, at least 50 days, at least 55 days, at least 60 days, at least 65 days, at least 70 days, at least 75 days, at least 76 days, at least 77 days, at least 78 days, at least 79 days, at least 80 days, at least 85 days, at least 90 days, at least 95 days, at least 100 days, at least 105 days, at least 110 days, at least 115 days, at least 120 days, at least 1 year.

[0636] In certain embodiments, an antisense oligonucleotide is delivered by injection or infusion once every 77 days. In certain embodiments, an antisense oligonucleotide is delivered by injection or infusion once every month, every two months, every three months, every 6 months, twice a year or once a year.

Certain Combination Therapies

[0637] In certain embodiments, a first agent comprising the modified oligonucleotide of the invention is co-administered with one or more secondary agents. In certain embodiments, such second agents are designed to treat the same type 1 myotonic dystrophy as the first agent described herein. In certain embodiments, such second agents are designed to treat a different disease, disorder, or condition as the first agent described herein. In certain embodiments, such second agents are designed to treat an undesired side effect of one or more pharmaceutical compositions as described herein. In certain embodiments, second agents are co-administered with the first agent to treat an undesired effect of the first agent. In certain embodiments, second agents are co-administered with the first agent to produce a combinational effect. In certain embodiments, second agents are co-administered with the first agent to produce a synergistic effect.

[0638] In certain embodiments, a first agent and one or more second agents are administered at the same time. In certain embodiments, the first agent and one or more second agents are administered at different times. In certain embodiments, the first agent and one or more second agents are prepared together in a single pharmaceutical formulation. In certain embodiments, the first agent and one or more second agents are prepared separately.

Certain Comparator Compounds

[0639] In certain embodiments, the compounds disclosed herein benefit from one or more improved in vitro and/or in vivo properties relative to an appropriate comparator compound.

[0640] In certain embodiments, ISIS 445569, a 5-10-5 MOE gapmer, having a sequence of (from 5′ to 3′) CGGAGCGGTTGTGAACTGGC (incorporated herein as SEQ ID NO: 24), wherein each internucleoside linkage is a phosphorothioate linkage, each cytosine is a 5-methylcytosine, and each of nucleosides 1-5 and 16-20 comprise a 2′-O-methoxyethyl moiety, which was previously described in WO 2012/012443, incorporated herein by reference, is a comparator compound.

[0641] ISIS 445569 is an appropriate representative comparator compound because ISIS 445569 demonstrates statistically significant reduction of human DMPK in vitro as measured using a plurality of primer probe sets (see e.g. Example 1 and Example 2 of WO 2012/012443). Additionally, ISIS 445569 demonstrates statistically significant dose-dependent inhibition of human DMPK in vitro in both human skeletal muscle cells and DM1 fibroblasts (see e.g. Example 4 and Example 5 of WO 2012/012443 and Example 28 of WO 2012/012467). ISIS 445569 also reduces human DMPK transcript expression in transgenic mice (Examples 23 and 24 of WO 2012/012443 and Examples 29 and 30 of WO 2012/012467). ISIS 445569 was a preferred human DMPK antisense compound in WO 2012/012443 and WO 2012/012467.

Certain Compounds

[0642] In certain embodiments, the compounds disclosed herein benefit from improved activity and/or improved tolerability relative to appropriate comparator compounds, such as ISIS 445569. For example, in certain embodiments, ISIS 598769, ISIS 598768, and/or ISIS 486178 have more activity and/or tolerability than appropriate comparator compounds, such as ISIS 445569.

[0643] In certain embodiments, the compounds disclosed herein are more potent than appropriate comparator compounds, such as ISIS 445569. For example, as provided in Example 10 (described herein), ISIS 598769 achieved an IC.sub.50 of 1.9 μM, ISIS 598768 achieved an IC.sub.50 of 1.2 μM, and ISIS 486178 achieved an IC.sub.50 of 0.7 μM in a 6 point dose response curve (61.7 nM, 185.2 nM, 555.6 nM, 1666.7 nM, 5000.0 nM, and 15000.0 nM) in cultured in HepG2 cells when transfected using electroporation, whereas ISIS 445569 achieved an IC.sub.50 of 2.3 μM. Thus, ISIS 598769, ISIS 598768, and ISIS 486178 are more potent than the comparator compound, ISIS 445569.

[0644] In certain embodiments, the compounds disclosed herein have greater activity than appropriate comparator compounds, such as ISIS 445569, at achieving dose-dependent inhibition of DMPK across multiple different muscle tissues. In another example, as provided in Example 16 (described herein), ISIS 598768 and ISIS 598769 achieved greater dose-dependent inhibition than the comparator compound ISIS 445569 across several different muscle tissues when administered subcutaneously to DMSXL transgenic mice twice a week for 4 weeks with 25 mg/kg/week, 50 mg/kg/wk, or 100 mg/kg/wk. In some muscle tissues, for example, in the tibialis anterior, both ISIS 598768 and ISIS 598769 achieved greater inhibition of DMPK at 25, 50 and 100 mg/kg/wk than ISIS 445569 achieved at 200 mg/kg/wk. In the quadriceps and gastrocnemius, both ISIS 598768 and ISIS 598769 achieved equal or greater inhibition of DMPK at 50 mg/kg/wk than ISIS 445569 achieved at 100 or 200 mg/kg/wk. Thus, ISIS 598768 and ISIS 598769 have greater activity than ISIS 445569 at achieving dose-dependent inhibition of DMPK across multiple different muscle tissues.

[0645] In certain embodiments, the compounds disclosed herein are more tolerable than appropriate comparator compounds, such as ISIS 445569, when administered to CD-1 mice. In another example, as provided in Example 17 (described herein), ISIS 598769, ISIS 598768, and ISIS 486178 exhibited more favorable tolerability markers than ISIS 445569 when administered to CD-1 mice. ISIS 598769, ISIS 598768, and ISIS 486178 were administered subcutaneously twice a week for 6 weeks at 50 mg/kg/wk. ISIS 445569 was administered subcutaneously twice a week for 6 weeks at 100 mg/kg/wk. After treatment, ALT, AST, and BUN levels were lower in ISIS 486178 and ISIS 598768 treated mice than in ISIS 445569 treated mice. After treatment, ALT and AST levels were lower in ISIS 598769 treated mice than in ISIS 445569 treated mice. Therefore, ISIS 598769, ISIS 598768, and ISIS 486178 are more tolerable than the comparator compound, ISIS 445569 in CD-1 mice.

[0646] In certain embodiments, the compounds disclosed herein are more tolerable than appropriate comparator compounds, such as ISIS 445569, when administered to Sprague-Dawley rats. In another example, as provided in Example 18 (described herein), ISIS 598769, ISIS 598768, and ISIS 486178 exhibited more favorable tolerability markers than ISIS 445569 when administered to Sprague-Dawley rats. ISIS 598769, ISIS 598768, and ISIS 486178 were administered subcutaneously twice a week for 6 weeks at 50 mg/kg/wk. ISIS 445569 was administered subcutaneously twice a week for 6 weeks at 100 mg/kg/wk. After treatment, ALT and AST levels were lower in ISIS 486178, ISIS 598769, and ISIS 598768 treated mice than in ISIS 445569 treated mice. Therefore ISIS 598769, ISIS 598768, and ISIS 486178 are more tolerable than the comparator compound, ISIS 445569 in Sprague-Dawley rats.

[0647] In certain embodiments, the compounds disclosed herein exhibit more favorable tolerability markers in cynomolgous monkeys than appropriate comparator compounds, such as ISIS 445569. In another example, as provided in Example 19 (described herein), ISIS 598769, ISIS 598768, and ISIS 486178 exhibited more favorable tolerability markers in cynomolgous monkeys including Alanine aminotransferase (ALT), aspartate aminotransferase (AST), lactate dehydrogenase (LDH), and creatine kinase (CK) assessment. In certain embodiments, ALT and AST levels are used as indicators of hepatotoxicity. For example, in certain embodiments, elevated ALT and AST levels indicate trauma to liver cells. In certain embodiments, elevated CK levels are associated with damage to cells in muscle tissue. In certain embodiments, elevated LDH levels are associated with cellular tissue damage.

[0648] In certain embodiments, the compounds disclosed herein are more tolerable than appropriate comparator compounds, such as ISIS 445569, when administered to cynomolgous monkeys. As provided in Example 19, groups of cynomolgous monkeys were treated with 40 mg/kg/wk of ISIS 598769, ISIS 598768, ISIS 486178, and ISIS 445569. Treatment with ISIS 445569 resulted in elevated ALT and AST levels at 93 days into treatment. Treatment with ISIS 598768, and ISIS 486178 resulted in lower ALT and AST levels at 58 and 93 days into treatment compared to ISIS 445569. Treatment with ISIS 598769, resulted in lower AST levels at 58 and 93 days into treatment and lower ALT levels at 93 days of treatment compared to ISIS 445569. Furthermore, the ALT and AST levels of monkeys receiving doses of ISIS 598769, ISIS 598768, and ISIS 486178 were consistent with the ALT and AST levels of monkeys given saline. Treatment with ISIS 445569 resulted in elevated LDH levels compared to the LDH levels measured in animals given ISIS 598769, ISIS 598768, and ISIS 486178 at 93 days into treatment. Additionally, treatment with ISIS 445569 resulted in elevated CK levels compared to the CK levels measured in animals given ISIS 598769, ISIS 598768, and ISIS 486178 at 93 days into treatment. Therefore, ISIS 598769, ISIS 598768, and ISIS 486178 are more tolerable than the comparator compound, ISIS 445569.

[0649] As the data discussed above demonstrate, ISIS 598769, ISIS 598768, and ISIS 486178 possess a wider range of well-tolerated doses at which ISIS 598769, ISIS 598768, and ISIS 486178 are active compared to the comparator compound, ISIS 445569. Additionally, the totality of the data presented in the examples herein and discussed above demonstrate that each of ISIS 598769, ISIS 598768, and ISIS 486178 possess a number of safety and activity advantages over the comparator compound, ISIS 445569. In other words, each of ISIS 598769, ISIS 598768, and ISIS 486178 are likely to be safer and more active drugs in humans than ISIS 445569.

[0650] In certain embodiments, ISIS 445569 is likely to be a safer and more active drug in humans for reducing CUGexp DMPK mRNA and\or treating conditions or symptoms associated with having myotonic dystrophy type 1 than the other compounds disclosed in WO 2012/012443 and/or WO 2012/012467.

[0651] In certain embodiments, ISIS 512497 has a better safety profile in primates and CD-1 mice than ISIS 445569. In certain embodiments, ISIS 512497 achieves greater knockdown of human DMPK nucleic acid in multiple muscle tissues when administered at the same dose and at lower doses than ISIS 445569.

[0652] In certain embodiments, ISIS 486178 has a better safety profile in mice, rats, and primates than ISIS 445569. In certain embodiments, ISIS 486178 achieves greater knockdown of human DMPK nucleic acid in one or more muscle tissues when administered at the same dose and at lower doses than ISIS 445569.

[0653] In certain embodiments, ISIS 570808 achieves much greater knockdown of human DMPK nucleic acid at least five different muscle tissues when administered at the same dose and at lower dose than ISIS 445569.

[0654] In certain embodiments, ISIS 594292 achieves greater knockdown of human DMPK nucleic acid in one or more muscle tissues when administered at the same dose as ISIS 445569. In certain embodiments, ISIS 486178 has a better safety profile in primates than ISIS 445569.

[0655] In certain embodiments, ISIS 569473 achieves greater knockdown of human DMPK nucleic acid in one or more muscle tissues when administered at the same dose as ISIS 445569. In certain embodiments, ISIS 569473 has a better safety profile in primates than ISIS 445569.

[0656] In certain embodiments, ISIS 594300 achieves greater knockdown of human DMPK nucleic acid in one or more muscle tissues when administered at the same dose as ISIS 445569. In certain embodiments, ISIS 594300 has a better safety profile in primates than ISIS 445569.

[0657] In certain embodiments, ISIS 598777 achieves greater knockdown of human DMPK nucleic acid in one or more muscle tissues when administered at the same dose as ISIS 445569. In certain embodiments, ISIS 598777 has a better safety profile in primates than ISIS 445569.

[0658] In certain embodiments, ISIS 598768 achieves greater knockdown of human DMPK nucleic acid in one or more muscle tissues when administered at the same dose as ISIS 445569. In certain embodiments, ISIS 598768 has a better safety profile in primates than ISIS 445569.

[0659] In certain embodiments, ISIS 598769 achieves greater knockdown of human DMPK nucleic acid in one or more muscle tissues when administered at the same dose as ISIS 445569. In certain embodiments, ISIS 598769 has a better safety profile in primates than ISIS 445569.

NONLIMITING DISCLOSURE AND INCORPORATION BY REFERENCE

[0660] While certain compounds, compositions and methods described herein have been described with specificity in accordance with certain embodiments, the following examples serve only to illustrate the compounds described herein and are not intended to limit the same. Each of the references, GenBank accession numbers, and the like recited in the present application is incorporated herein by reference in its entirety.

[0661] Although the sequence listing accompanying this filing identifies each sequence as either “RNA” or “DNA” as required, in reality, those sequences may be modified with any combination of chemical modifications. One of skill in the art will readily appreciate that such designation as “RNA” or “DNA” to describe modified oligonucleotides is, in certain instances, arbitrary. For example, an oligonucleotide comprising a nucleoside comprising a 2′-OH sugar moiety and a thymine base could be described as a DNA having a modified sugar (2′-OH for the natural 2′-H of DNA) or as an RNA having a modified base (thymine (methylated uracil) for natural uracil of RNA).

[0662] Accordingly, nucleic acid sequences provided herein, including, but not limited to those in the sequence listing, are intended to encompass nucleic acids containing any combination of natural or modified RNA and/or DNA, including, but not limited to such nucleic acids having modified nucleobases. By way of further example and without limitation, an oligomeric compound having the nucleobase sequence “ATCGATCG” encompasses any oligomeric compounds having such nucleobase sequence, whether modified or unmodified, including, but not limited to, such compounds comprising RNA bases, such as those having sequence “AUCGAUCG” and those having some DNA bases and some RNA bases such as “AUCGATCG” and oligomeric compounds having other modified or naturally occurring bases, such as “AT.sup.meCGAUCG,” wherein .sup.meC indicates a cytosine base comprising a methyl group at the 5-position.

EXAMPLES

Non-Limiting Disclosure and Incorporation by Reference

[0663] While certain compounds, compositions and methods described herein have been described with specificity in accordance with certain embodiments, the following examples serve only to illustrate the compounds described herein and are not intended to limit the same. Each of the references recited in the present application is incorporated herein by reference in its entirety.

Example 1: Design of Antisense Oligonucleotides Targeting Human Dystrophia Myotonica Protein Kinase (hDMPK)

[0664] A series of antisense oligonucleotides (ASOs) were designed to target hDMPK. The newly designed ASOs were prepared using standard oligonucleotide synthesis well known in the art and are described in Tables 1 and 2, below. Subscripts “s” indicate phosphorothioate internucleoside linkages; subscripts “k” indicate 6′-(S)—CH.sub.3 bicyclic nucleosides (cEt); subscripts “e” indicate 2′-O-methoxyethyl (MOE) modified nucleosides; and subscripts “d” indicate β-D-2′-deoxyribonucleosides. “.sup.mC” indicates 5-methylcytosine nucleosides.

[0665] The antisense oligonucleotides are targeted to either SEQ ID NO: 1 (GENBANK Accession No. NM_001081560.1) and/or SEQ ID NO: 2 (the complement of GENBANK Accession No. NT_011109.15 truncated from nucleotides 18540696 to 18555106). “Start site” indicates the 5′-most nucleoside to which the gapmer is targeted in the human gene sequence. “Stop site” indicates the 3′-most nucleoside to which the gapmer is targeted human gene sequence.

TABLE-US-00001 TABLE 1 Design of antisense oligonucleotides targeting hDMPK and targeted to SEQ ID NO 2 ISIS Start Stop SEQ ID No. Composition (5′ to 3′) Motif Length Site Site No. 486178 A.sub.ks.sup.mC.sub.ksA.sub.ksA.sub.dsT.sub.dsA.sub.dsA.sub.dsA.sub.ds kkk-10-kkk 16 13836 13851 23 T.sub.dsA.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsG.sub.dsA.sub.ksG.sub.ksG.sub.k 445569 .sup.mC.sub.esG.sub.esG.sub.esA.sub.esG.sub.es.sup.mC.sub.dsG.sub.dsG.sub.dsT.sub.dsT.sub.dsG.sub.ds e5-d10-e5 20 13226 13245 24 T.sub.dsG.sub.dsA.sub.dsA.sub.ds.sup.mC.sub.esT.sub.esG.sub.esG.sub.es.sup.mC.sub.e 512497 G.sub.es.sup.mC.sub.esG.sub.es.sup.mC.sub.esA.sub.es.sup.mC.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.ds.sup.mC.sub.ds e5-d10-e5 20  8608  8627 25 .sup.mC.sub.ds.sup.mC.sub.dsG.sub.dsA.sub.dsA.sub.dsT.sub.esG.sub.esT.sub.es.sup.mC.sub.es.sup.mC.sub.e 598768 .sup.mC.sub.es.sup.mC.sub.es.sup.mC.sub.ksG.sub.ksA.sub.dsA.sub.dsT.sub.dsG.sub.ds eekk-d8-kkee 16  8603  8618 26 T.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsG.sub.dsA.sub.ks.sup.mC.sub.ksA.sub.esG.sub.e 594300 .sup.mC.sub.esG.sub.esG.sub.esA.sub.ksG.sub.ks.sup.mC.sub.dsG.sub.dsG.sub.ds eeekk-d7-kkeee 17 13229 13245 27 T.sub.dsT.sub.dsG.sub.dsT.sub.dsG.sub.ksA.sub.ksA.sub.es.sup.mC.sub.esT.sub.e 594292 A.sub.es.sup.mC.sub.esA.sub.esA.sub.ksT.sub.ksA.sub.dsA.sub.dsA.sub.dsT.sub.ds eeekk-d7-kkeee 17 13835 13851 28 A.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsG.sub.ksA.sub.ksG.sub.esG.sub.esA.sub.e 569473 G.sub.ksA.sub.ks.sup.mC.sub.ksA.sub.dsA.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.ds kkk-d10-kkk 16  5082  5097 29 .sup.mC.sub.ds.sup.mC.sub.dsC.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.ksG.sub.ksG.sub.k 598769 T.sub.es.sup.mC.sub.es.sup.mC.sub.ks.sup.mC.sub.ksG.sub.dsA.sub.dsA.sub.dsT.sub.ds eekk-d8-kkee 16  8604  8619 30 G.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsG.sub.ksA.sub.ks.sup.mC.sub.esA.sub.e 570808 T.sub.ksG.sub.ksT.sub.ksA.sub.dsA.sub.dsT.sub.dsG.sub.dsT.sub.ds kkk-d10-kkk 16 10201 10216 31 T.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.ksG.sub.ksT.sub.k 598777 G.sub.esT.sub.esG.sub.ksT.sub.ksA.sub.dsA.sub.dsT.sub.dsG.sub.ds eekk-d8-kkee 16 10202 10217 32 T.sub.dsT.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.ks.sup.mC.sub.ksA.sub.esG.sub.e

TABLE-US-00002 TABLE 2 Design of antisense oligonucleotides targeting hDMPK and targeted to SEQ ID NO 1 ISIS Start Stop No. Composition (5′ to 3′) Motif Length Site Site 486178 A.sub.ks.sup.mC.sub.ksA.sub.ksA.sub.dsT.sub.dsA.sub.dsA.sub.dsA.sub.ds kkk-10-kkk 16 2773 2788 T.sub.dsA.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsG.sub.dsA.sub.ksG.sub.ksG.sub.k 445569 .sup.mC.sub.esG.sub.esG.sub.esA.sub.esG.sub.es.sup.mC.sub.dsG.sub.dsG.sub.dsT.sub.dsT.sub.dsG.sub.ds e5-d10-e5 20 2163 2182 T.sub.dsG.sub.dsA.sub.dsA.sub.ds.sup.mC.sub.esT.sub.esG.sub.esG.sub.es.sup.mC.sub.e 512497 G.sub.es.sup.mC.sub.esG.sub.es.sup.mC.sub.esA.sub.es.sup.mC.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.ds.sup.mC.sub.ds e5-d10-e5 20 1348 1367 .sup.mC.sub.ds.sup.mC.sub.dsG.sub.dsA.sub.dsA.sub.dsT.sub.esG.sub.esT.sub.es.sup.mC.sub.es.sup.mC.sub.e 598768 .sup.mC.sub.es.sup.mC.sub.es.sup.mC.sub.ksG.sub.ksA.sub.dsA.sub.dsT.sub.dsG.sub.ds eekk-d8-kkee 16 1343 1358 T.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsG.sub.dsA.sub.ks.sup.mC.sub.ksA.sub.esG.sub.e 594300 .sup.mC.sub.esG.sub.esG.sub.esA.sub.ksG.sub.ks.sup.mC.sub.dsG.sub.dsG.sub.ds eeekk-d7-kkeee 17 2166 2182 T.sub.dsT.sub.dsG.sub.dsT.sub.dsG.sub.ksA.sub.ksA.sub.es.sup.mC.sub.esT.sub.e 594292 A.sub.es.sup.mC.sub.esA.sub.esA.sub.ksT.sub.ksA.sub.dsA.sub.dsA.sub.dsT.sub.ds eeekk-d7-kkeee 17 2772 2788 A.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsG.sub.ksA.sub.ksG.sub.esG.sub.esA.sub.e 569473 G.sub.ksA.sub.ks.sup.mC.sub.ksA.sub.dsA.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.ds kkk-d10-kkk 16  730  745 .sup.mC.sub.ds.sup.mC.sub.dsG.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.ksG.sub.ksG.sub.k 598769 T.sub.es.sup.mC.sub.es.sup.mC.sub.ks.sup.mC.sub.ksG.sub.dsA.sub.dsA.sub.dsT.sub.ds eekk-d8-kkee 16 1344 1359 G.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsG.sub.ksA.sub.ks.sup.mC.sub.esA.sub.e

Example 2: Antisense Inhibition of Human DMPK in Human Skeletal Muscle Cells (hSKMc)

[0666] Antisense oligonucleotides targeted to a human DMPK nucleic acid were tested for their effect on DMPK RNA transcript in vitro. Cultured hSKMc cells at a density of 20,000 cells per well were transfected using electroporation with 10,000 nM antisense oligonucleotide. After approximately 24 hours, RNA was isolated from the cells and DMPK transcript levels were measured by quantitative real-time PCR. DMPK RNA transcript levels were adjusted according to total RNA content, as measured by RIBOGREEN®. Results are presented as percent expression of DMPK, relative to untreated control cells.

[0667] The antisense oligonucleotides in Tables 3, 4, 5, and 6 are 5-10-5 gapmers, where the gap segment comprises ten 2′-deoxynucleosides and each wing segment comprises five 2′-MOE nucleosides. The internucleoside linkages throughout each gapmer are phosphorothioate (P═S) linkages. All cytsoine residues throughout each gapmer are 5-methylcytosines. ‘Target start site’ indicates the 5′-most nucleoside to which the antisense oligonucleotide is targeted in the human genomic gene sequence. ‘Target stop site’ indicates the 3′-most nucleoside to which the antisense oligonucleotide is targeted in the human genomic sequence. All the antisense oligonucleotides listed in Table 3, 4, or 5 target SEQ ID NO: 1 (GENBANK Accession No. NM_001081560.1). All the antisense oligonucleotides listed in Table 6 target SEQ ID NO: 2 (the complement of GENBANK Accession No. NT_011109.15 truncated from nucleotides 18540696 to 18555106).

[0668] Several of the antisense oligonucleotides in Tables 2, 3, 4, and 5 demonstrated significant inhibition of DMPK mRNA levels under the conditions specified above.

TABLE-US-00003 TABLE 3 Inhibition of human DMPK RNA transcript in hSKMc by 5-10-5 gapmers targeting SEQ ID NO: 1 Start Site Stop Site ISIS % Target on Seq ID: on Seq ID: SEQ No. Sequence Expression 1 1 ID NO. UTC N/A 100.0 N/A N/A  33 444401 TTGCACTTTGCGAACCAACG   7.3 2490 2509  34 512326 CGACACCTCGCCCCTCTTCA  13.4  528  547  35 512327 ACGACACCTCGCCCCTCTTC  40.8  529  548  36 512328 CACGACACCTCGCCCCTCTT  27.8  530  549  37 512329 GCACGACACCTCGCCCCTCT  16.5  531  550  38 512330 AGCACGACACCTCGCCCCTC  17.9  532  551  39 512331 AAGCACGACACCTCGCCCCT  18.8  533  552  40 512332 GAAGCACGACACCTCGCCCC  23.3  534  553  41 512333 GGAAGCACGACACCTCGCCC  28.1  535  554  42 512334 CGGAAGCACGACACCTCGCC  16.3  536  555  43 512335 ACGGAAGCACGACACCTCGC  28.7  537  556  44 512336 CACGGAAGCACGACACCTCG  15.9  538  557  45 512337 TCACGGAAGCACGACACCTC  18.8  539  558  46 512338 CTCACGGAAGCACGACACCT  16.4  540  559  47 512339 CCTCACGGAAGCACGACACC  20.2  541  560  48 512340 TCCTCACGGAAGCACGACAC  19.3  542  561  49 512341 CTCCTCACGGAAGCACGACA  15.2  543  562  50 512342 TCTCCTCACGGAAGCACGAC  16.2  544  563  51 512343 CTCTCCTCACGGAAGCACGA  16.4  545  564  52 512344 CCTCTCCTCACGGAAGCACG  15.7  546  565  53 512345 CCCTCTCCTCACGGAAGCAC  14.7  547  566  54 512346 TCCCTCTCCTCACGGAAGCA  20.6  548  567  55 512347 GTCCCTCTCCTCACGGAAGC  32.6  549  568  56 512348 CGTCCCTCTCCTCACGGAAG  31.5  550  569  57 512349 GGTCCCCATTCACCAACACG  41.6  568  587  58 512350 CGGTCCCCATTCACCAACAC  31.6  569  588  59 512351 CCGGTCCCCATTCACCAACA  38.1  570  589  60 512352 GCCGGTCCCCATTCACCAAC  55.5  571  590  61 512353 CGCCGGTCCCCATTCACCAA  42.9  572  591  62 512354 CCGCCGGTCCCCATTCACCA  35.7  573  592  63 512355 ACCGCCGGTCCCCATTCACC  51.4  574  593  64 512356 CACCGCCGGTCCCCATTCAC  34.4  575  594  65 512357 CCACCGCCGGTCCCCATTCA  40.4  576  595  66 512358 TCCACCGCCGGTCCCCATTC  35.5  577  596  67 512359 ATCCACCGCCGGTCCCCATT  41.7  578  597  68 512360 GATCCACCGCCGGTCCCCAT  51.0  579  598  69 512361 TGATCCACCGCCGGTCCCCA  35.9  580  599  70 512362 GTGATCCACCGCCGGTCCCC  53.2  581  600  71 512363 CGTGATCCACCGCCGGTCCC  28.2  582  601  72 512364 TTCTCATCCTGGAAGGCGAA  34.6  611  630  73 512365 GTTCTCATCCTGGAAGGCGA  57.1  612  631  74 512366 AGTTCTCATCCTGGAAGGCG  72.1  613  632  75 512367 GTAGTTCTCATCCTGGAAGG  47.1  615  634  76 512368 GGTAGTTCTCATCCTGGAAG  56.0  616  635  77 512369 AGGTAGTTCTCATCCTGGAA  48.3  617  636  78 512370 CAGGTAGTTCTCATCCTGGA  20.2  618  637  79 512371 TACAGGTAGTTCTCATCCTG  44.0  620  639  80 512372 GTACAGGTAGTTCTCATCCT  64.1  621  640  81 512373 GGTACAGGTAGTTCTCATCC  54.2  622  641  82 512374 AGGTACAGGTAGTTCTCATC  65.6  623  642  83 512375 CCAGGTACAGGTAGTTCTCA  45.7  625  644  84 512376 ACCAGGTACAGGTAGTTCTC  60.4  626  645  85 512377 GACCAGGTACAGGTAGTTCT  62.2  627  646  86 512378 TGACCAGGTACAGGTAGTTC  64.9  628  647  87 512379 CATGACCAGGTACAGGTAGT  39.2  630  649  88 512380 CCATGACCAGGTACAGGTAG  27.7  631  650  89 512381 TCCATGACCAGGTACAGGTA  21.6  632  651  90 512382 CTCCATGACCAGGTACAGGT  25.7  633  652  91 512383 ACTCCATGACCAGGTACAGG  28.6  634  653  92 512384 TACTCCATGACCAGGTACAG  23.7  635  654  93 512385 ATACTCCATGACCAGGTACA  20.8  636  655  94 512386 AATACTCCATGACCAGGTAC  22.0  637  656  95 512387 TAATACTCCATGACCAGGTA  14.7  638  657  96 512388 CGTAATACTCCATGACCAGG  10.4  640  659  97 512389 AGCAGTGTCAGCAGGTCCCC  15.0  665  684  98 512390 CAGCAGTGTCAGCAGGTCCC  13.0  666  685  99 512391 TCAGCAGTGTCAGCAGGTCC  22.3  667  686 100 512392 CTCAGCAGTGTCAGCAGGTC  16.4  668  687 101 512393 GCTCAGCAGTGTCAGCAGGT  22.2  669  688 102 512394 TGCTCAGCAGTGTCAGCAGG  26.2  670  689 103 512395 TTGCTCAGCAGTGTCAGCAG  27.4  671  690 104 512396 CTTGCTCAGCAGTGTCAGCA  15.7  672  691 105 512397 ACTTGCTCAGCAGTGTCAGC  43.5  673  692 106 512398 AACTTGCTCAGCAGTGTCAG  26.9  674  693 107 512399 AAACTTGCTCAGCAGTGTCA  20.0  675  694 108 512400 CAAACTTGCTCAGCAGTGTC  23.1  676  695 109 512401 CCAAACTTGCTCAGCAGTGT  20.5  677  696 110 512402 CCCAAACTTGCTCAGCAGTG  13.5  678  697 33

TABLE-US-00004 TABLE 4 Inhibition of human DMPK RNA transcript in hSKMc by 5-10-5 gapmers targeting SEQ ID NO: 1 Start Site Stop Site ISIS % Target on Seq ID: on Seq ID: SEQ No. Sequence Expression 1 1 ID NO. UTC N/A 100 N/A N/A 444401 TTGCACTTTGCGAACCAACG  13.4 2490 2509  33 512480 GTGAGCCCGTCCTCCACCAA  29.8 1310 1329 111 512481 AGTGAGCCCGTCCTCCACCA  15.6 1311 1330 112 512482 CAGTGAGCCCGTCCTCCACC  10.7 1312 1331 113 512483 GCAGTGAGCCCGTCCTCCAC  33.3 1313 1332 114 512484 GGCAGTGAGCCCGTCCTCCA   9.6 1314 1333 115 512485 TGGCAGTGAGCCCGTCCTCC   8.8 1315 1334 116 512486 CATGGCAGTGAGCCCGTCCT  10.5 1317 1336 117 512487 CCATGGCAGTGAGCCCGTCC  10.1 1318 1337 118 512488 TCCATGGCAGTGAGCCCGTC  13.7 1319 1338 119 512489 CTCCATGGCAGTGAGCCCGT  16.9 1320 1339 120 512490 TCTCCATGGCAGTGAGCCCG  29.1 1321 1340 121 512491 GTCTCCATGGCAGTGAGCCC  41.3 1322 1341 122 512492 CCTTCCCGAATGTCCGACAG   8.8 1343 1362 123 512493 ACCTTCCCGAATGTCCGACA  12.1 1344 1363 124 512494 CACCTTCCCGAATGTCCGAC   6 1345 1364 125 512495 GCACCTTCCCGAATGTCCGA   8.5 1346 1365 126 512496 CGCACCTTCCCGAATGTCCG   5.6 1347 1366 127 512497 GCGCACCTTCCCGAATGTCC   7.7 1348 1367  25 512498 GGCGCACCTTCCCGAATGTC  15 1349 1368 128 512499 ACAAAAGGCAGGTGGACCCC  22.8 1373 1392 129 512500 CACAAAAGGCAGGTGGACCC  22 1374 1393 130 512501 CCACAAAAGGCAGGTGGACC  16.4 1375 1394 131 512502 CCCACAAAAGGCAGGTGGAC  15.8 1376 1395 132 512503 GCCCACAAAAGGCAGGTGGA  25.1 1377 1396 133 512504 AGCCCACAAAAGGCAGGTGG  24.7 1378 1397 134 512505 TAGCCCACAAAAGGCAGGTG  20.7 1379 1398 135 512506 GTAGCCCACAAAAGGCAGGT  20.7 1380 1399 136 512507 AGTAGCCCACAAAAGGCAGG  27.8 1381 1400 137 512508 GAGTAGCCCACAAAAGGCAG  43.9 1382 1401 138 512509 GGAGTAGCCCACAAAAGGCA  29.9 1383 1402 139 512510 AGGAGTAGCCCACAAAAGGC  31.9 1384 1403 140 512511 TAGGAGTAGCCCACAAAAGG  59.9 1385 1404 141 512512 GTAGGAGTAGCCCACAAAAG  40.1 1386 1405 142 512513 AGTAGGAGTAGCCCACAAAA  48.1 1387 1406 143 512514 GAGTAGGAGTAGCCCACAAA  53.3 1388 1407 144 512515 GGAGTAGGAGTAGCCCACAA  24.7 1389 1408 145 512516 AGGAGTAGGAGTAGCCCACA  22.1 1390 1409 146 512517 CAGGAGTAGGAGTAGCCCAC  15.4 1391 1410 147 512518 GCAGGAGTAGGAGTAGCCCA  32.8 1392 1411 148 512519 TGCAGGAGTAGGAGTAGCCC  37.6 1393 1412 149 512520 ATGCAGGAGTAGGAGTAGCC  47.4 1394 1413 150 512521 CATGCAGGAGTAGGAGTAGC  67.2 1395 1414 151 512522 CCATGCAGGAGTAGGAGTAG  58.8 1396 1415 152 512523 GCCATGCAGGAGTAGGAGTA  42.4 1397 1416 153 512524 GGCCATGCAGGAGTAGGAGT  34.1 1398 1417 154 512525 GGGCCATGCAGGAGTAGGAG  44.5 1399 1418 155 512526 AGGGCCATGCAGGAGTAGGA  42 1400 1419 156 512527 GAGGGCCATGCAGGAGTAGG  46.3 1401 1420 157 512528 CTGAGGGCCATGCAGGAGTA  25.3 1403 1422 158 512529 CCTGAGGGCCATGCAGGAGT  28.1 1404 1423 159 512530 CCCTGAGGGCCATGCAGGAG  22.8 1405 1424 160 512531 TCCCTGAGGGCCATGCAGGA  25.7 1406 1425 161 512532 GTCCCTGAGGGCCATGCAGG  17 1407 1426 162 512533 TGTCCCTGAGGGCCATGCAG  18.9 1408 1427 163 512534 CTGTCCCTGAGGGCCATGCA  27.3 1409 1428 164 512535 ACTGTCCCTGAGGGCCATGC  16.5 1410 1429 165 512536 CACTGTCCCTGAGGGCCATG  26 1411 1430 166 512537 TCACTGTCCCTGAGGGCCAT  22.7 1412 1431 167 512538 CTCACTGTCCCTGAGGGCCA  20.2 1413 1432 168 512539 CCTCACTGTCCCTGAGGGCC  19.3 1414 1433 169 512540 ACCTCACTGTCCCTGAGGGC  31 1415 1434 170 512541 GACCTCACTGTCCCTGAGGG  51.4 1416 1435 171 512542 GGACCTCACTGTCCCTGAGG  28 1417 1436 172 512543 GGGACCTCACTGTCCCTGAG  42.6 1418 1437 173 512544 CCTCCAGTTCCATGGGTGTG  16.7 1444 1463 174 512545 GCCTCCAGTTCCATGGGTGT  21.9 1445 1464 175 512546 GGCCTCCAGTTCCATGGGTG  19 1446 1465 176 512547 CGGCCTCCAGTTCCATGGGT  14.9 1447 1466 177 512548 TCGGCCTCCAGTTCCATGGG  23 1448 1467 178 512549 CTCGGCCTCCAGTTCCATGG  15.7 1449 1468 179 512550 GCTCGGCCTCCAGTTCCATG  16.2 1450 1469 180 512551 TGCTCGGCCTCCAGTTCCAT  17.7 1451 1470 181 512552 CTGCTCGGCCTCCAGTTCCA  18.4 1452 1471 182 512553 GCTGCTCGGCCTCCAGTTCC  22 1453 1472 183 512554 AGCTGCTCGGCCTCCAGTTC  32.4 1454 1473 184 512555 CAGCTGCTCGGCCTCCAGTT  15.7 1455 1474 185 512556 GCAGCTGCTCGGCCTCCAGT  16.3 1456 1475 186

TABLE-US-00005 TABLE 5 Inhibition of human DMPK RNA transcript in hSKMc by 5-10-5 gapmers targeting SEQ ID NO: 1 Start Site Stop Site ISIS % Target on Seq ID: on Seq ID: SEQ No. Sequence Expression 1 1 ID NO. UTC N/A 100.0 N/A N/A 444401 TTGCACTTTGCGAACCAACG   7.0 2490 2509  33 512557 AGCAGCTGCTCGGCCTCCAG  25.2 1457 1476 187 512558 AAGCAGCTGCTCGGCCTCCA  16.1 1458 1477 188 512559 CAAGCAGCTGCTCGGCCTCC  21.9 1459 1478 189 512560 TCAAGCAGCTGCTCGGCCTC  24.8 1460 1479 190 512561 CTCAAGCAGCTGCTCGGCCT  19.8 1461 1480 191 512562 GCTCAAGCAGCTGCTCGGCC  11.6 1462 1481 192 512563 GGCTCAAGCAGCTGCTCGGC  19.8 1463 1482 193 512564 TGGCTCAAGCAGCTGCTCGG  31.9 1464 1483 194 512565 GTGGCTCAAGCAGCTGCTCG  27.5 1465 1484 195 512566 TGTGGCTCAAGCAGCTGCTC  35.4 1466 1485 196 512567 GTGTGGCTCAAGCAGCTGCT  24.8 1467 1486 197 512568 CCACTTCAGCTGTTTCATCC  43.1 1525 1544 198 512569 TGCCACTTCAGCTGTTTCAT  35.0 1527 1546 199 512570 CTGCCACTTCAGCTGTTTCA  27.8 1528 1547 200 512571 ACTGCCACTTCAGCTGTTTC  78.9 1529 1548 201 512572 AACTGCCACTTCAGCTGTTT  36.4 1530 1549 202 512573 GAACTGCCACTTCAGCTGTT  30.3 1531 1550 203 512574 GGAACTGCCACTTCAGCTGT  66.7 1532 1551 204 512575 TGGAACTGCCACTTCAGCTG  22.6 1533 1552 205 512576 CTGGAACTGCCACTTCAGCT  22.9 1534 1553 206 512577 GCTGGAACTGCCACTTCAGC  59.5 1535 1554 207 512578 CGCTGGAACTGCCACTTCAG  24.9 1536 1555 208 512579 CCGCTGGAACTGCCACTTCA  42.5 1537 1556 209 512580 GCCGCTGGAACTGCCACTTC  20.0 1538 1557 210 512581 AGCCGCTGGAACTGCCACTT  19.4 1539 1558 211 512582 CTCAGCCTCTGCCGCAGGGA  22.1 1560 1579 212 512583 CCTCAGCCTCTGCCGCAGGG  33.7 1561 1580 213 512584 GGCCTCAGCCTCTGCCGCAG  24.6 1563 1582 214 512585 CGGCCTCAGCCTCTGCCGCA  55.1 1564 1583 215 512586 TCGGCCTCAGCCTCTGCCGC  60.8 1565 1584 216 512587 CTCGGCCTCAGCCTCTGCCG  31.8 1566 1585 217 512588 CCTCGGCCTCAGCCTCTGCC  16.4 1567 1586 218 512589 ACCTCGGCCTCAGCCTCTGC  31.1 1568 1587 219 512590 CACCTCGGCCTCAGCCTCTG  39.7 1569 1588 220 512591 TCACCTCGGCCTCAGCCTCT  24.8 1570 1589 221 512592 GTCACCTCGGCCTCAGCCTC  28.7 1571 1590 222 512593 CGTCACCTCGGCCTCAGCCT  20.3 1572 1591 223 512594 AGCACCTCCTCCTCCAGGGC  18.4 1610 1629 224 512595 GAGCACCTCCTCCTCCAGGG  19.9 1611 1630 225 512596 TGAGCACCTCCTCCTCCAGG  15.6 1612 1631 226 512597 GTGAGCACCTCCTCCTCCAG  22.3 1613 1632 227 512598 GGTGAGCACCTCCTCCTCCA  19.4 1614 1633 228 512599 GGGTGAGCACCTCCTCCTCC  17.3 1615 1634 229 512600 CGGGTGAGCACCTCCTCCTC  12.2 1616 1635 230 512601 CCGGGTGAGCACCTCCTCCT  15.9 1617 1636 231 512602 GCCGGGTGAGCACCTCCTCC  15.7 1618 1637 232 512603 TGCCGGGTGAGCACCTCCTC  15.1 1619 1638 233 512604 CTGCCGGGTGAGCACCTCCT  24.5 1620 1639 234 512605 TCTGCCGGGTGAGCACCTCC  33.8 1621 1640 235 512606 GCTCTGCCGGGTGAGCACCT  26.1 1623 1642 236 512607 GGCTCTGCCGGGTGAGCACC  50.4 1624 1643 237 512608 AGGCTCTGCCGGGTGAGCAC  42.9 1625 1644 238 512609 CAGGCTCTGCCGGGTGAGCA  39.2 1626 1645 239 512610 TCAGGCTCTGCCGGGTGAGC  20.2 1627 1646 240 512611 GCTCAGGCTCTGCCGGGTGA  22.5 1629 1648 241 512612 CGGCTCAGGCTCTGCCGGGT  27.0 1631 1650 242 512613 CCGGCTCAGGCTCTGCCGGG  68.8 1632 1651 243 512614 CCCGGCTCAGGCTCTGCCGG  58.8 1633 1652 244 512615 TCCCGGCTCAGGCTCTGCCG  24.8 1634 1653 245 512616 CTCCCGGCTCAGGCTCTGCC  10.4 1635 1654 246 512617 TCTCCCGGCTCAGGCTCTGC  12.8 1636 1655 247 512618 ATCTCCCGGCTCAGGCTCTG  13.3 1637 1656 248 512619 CATCTCCCGGCTCAGGCTCT   7.7 1638 1657 249 512620 CCATCTCCCGGCTCAGGCTC   2.8 1639 1658 250 512621 TCCATCTCCCGGCTCAGGCT   2.6 1640 1659 251 512622 CTCCATCTCCCGGCTCAGGC   1.5 1641 1660 252 512623 CCTCCATCTCCCGGCTCAGG   1.4 1642 1661 253 512624 GCCTCCATCTCCCGGCTCAG   2.0 1643 1662 254 512625 GGCCTCCATCTCCCGGCTCA   8.3 1644 1663 255 512626 TGGCCTCCATCTCCCGGCTC   9.4 1645 1664 256 512627 ATGGCCTCCATCTCCCGGCT   6.3 1646 1665 257 512628 GATGGCCTCCATCTCCCGGC   2.7 1647 1666 258 512629 GGATGGCCTCCATCTCCCGG   1.3 1648 1667 259 512630 CGGATGGCCTCCATCTCCCG   1.5 1649 1668 260 512631 GCGGATGGCCTCCATCTCCC   2.4 1650 1669 261 512632 TGCGGATGGCCTCCATCTCC   2.2 1651 1670 262 512633 GTTCCGAGCCTCTGCCTCGC  29.2 1701 1720 263

TABLE-US-00006 TABLE 6 Inhibition of human DMPK RNA transcript in hSKMc by 5-10-5 gapmers targeting SEQ ID NO: 2 Start Site Stop Site ISIS % Target on Seq ID: on Seq ID: SEQ No. Sequence Expression 2 2 ID NO. UTC N/A 100.0 N/A N/A 444401 TTGCACTTTGCGAACCAACG   7.0 13553 13572  33 444436 GTCGGAGGACGAGGTCAATA   9.7 13748 13767 264 512634 AGGGCCTCAGCCTGGCCGAA  31.7 13452 13471 265 512635 CAGGGCCTCAGCCTGGCCGA  39.5 13453 13472 266 512636 GTCAGGGCCTCAGCCTGGCC  20.5 13455 13474 267 512637 CGTCAGGGCCTCAGCCTGGC  23.3 13456 13475 268 512638 AGCAAATTTCCCGAGTAAGC  14.7 13628 13647 269 512639 AAGCAAATTTCCCGAGTAAG  21.2 13629 13648 270 512640 AAAAGCAAATTTCCCGAGTA  23.0 13631 13650 271 512641 CAAAAGCAAATTTCCCGAGT  19.7 13632 13651 272 512642 GCAAAAGCAAATTTCCCGAG  26.6 13633 13652 273 512643 GGCAAAAGCAAATTTCCCGA  12.8 13634 13653 274 512644 TGGCAAAAGCAAATTTCCCG  12.2 13635 13654 275 512645 TTTGGCAAAAGCAAATTTCC  24.2 13637 13656 276 512646 GTTTGGCAAAAGCAAATTTC  25.5 13638 13657 277 512647 GGGTTTGGCAAAAGCAAATT  43.0 13640 13659 278 512648 CGGGTTTGGCAAAAGCAAAT  27.2 13641 13660 279 512649 AAGCGGGTTTGGCAAAAGCA  27.0 13644 13663 280 512650 AATATCCAAACCGCCGAAGC  45.7 13728 13747 281 512651 AAATATCCAAACCGCCGAAG  56.6 13729 13748 282 512652 ATAAATATCCAAACCGCCGA  39.0 13731 13750 283 512653 AATAAATATCCAAACCGCCG  34.7 13732 13751 284 512654 TCAATAAATATCCAAACCGC  34.7 13734 13753 285 512655 GTCAATAAATATCCAAACCG  19.1 13735 13754 286 512656 GGTCAATAAATATCCAAACC  24.3 13736 13755 287 512657 AGGTCAATAAATATCCAAAC  23.5 13737 13756 288 512658 GAGGTCAATAAATATCCAAA  24.2 13738 13757 289 512659 ACGAGGTCAATAAATATCCA  28.3 13740 13759 290 512660 GACGAGGTCAATAAATATCC  17.8 13741 13760 291 512661 AGGACGAGGTCAATAAATAT  45.7 13743 13762 292 512662 GAGGACGAGGTCAATAAATA  27.6 13744 13763 293 512663 CGGAGGACGAGGTCAATAAA  15.8 13746 13765 294 512664 TCGGAGGACGAGGTCAATAA  10.8 13747 13766 295 512665 AGTCGGAGGACGAGGTCAAT  15.4 13749 13768 296 512666 GAGTCGGAGGACGAGGTCAA  18.8 13750 13769 297 512667 GCGAGTCGGAGGACGAGGTC  26.0 13752 13771 298 512668 AGCGAGTCGGAGGACGAGGT  21.7 13753 13772 299 512669 CAGCGAGTCGGAGGACGAGG  13.7 13754 13773 300 512670 TCAGCGAGTCGGAGGACGAG  16.5 13755 13774 301 512671 GTCAGCGAGTCGGAGGACGA  17.4 13756 13775 302 512672 CTGTCAGCGAGTCGGAGGAC  25.2 13758 13777 303 512673 CCTGTCAGCGAGTCGGAGGA  18.4 13759 13778 304 512674 AGCCTGTCAGCGAGTCGGAG  16.8 13761 13780 305 512675 GTCTCAGTGCATCCAAAACG  11.8 13807 13826 306 512676 GGTCTCAGTGCATCCAAAAC  17.7 13808 13827 307 512677 GGGTCTCAGTGCATCCAAAA  11.2 13809 13828 308 512678 GGAGGGCCTTTTATTCGCGA  17.8 13884 13903 309 512679 TGGAGGGCCTTTTATTCGCG  13.2 13885 13904 310 512680 ATGGAGGGCCTTTTATTCGC  19.3 13886 13905 311 512681 GATGGAGGGCCTTTTATTCG  30.5 13887 13906 312 512682 AGATGGAGGGCCTTTTATTC  50.8 13888 13907 313 512683 CAGATGGAGGGCCTTTTATT  46.1 13889 13908 314 512684 GCAGATGGAGGGCCTTTTAT  50.4 13890 13909 315 512685 CCCTCAGGCTCTCTGCTTTA  34.7   655   674 316 512686 GCCCTCAGGCTCTCTGCTTT  47.9   656   675 317 512687 AGCCCTCAGGCTCTCTGCTT  47.4   657   676 318 512688 TAGCCCTCAGGCTCTCTGCT  54.1   658   677 319 512689 TTAGCCCTCAGGCTCTCTGC  48.0   659   678 320 512690 TTTAGCCCTCAGGCTCTCTG  50.7   660   679 321 512691 ATTTAGCCCTCAGGCTCTCT  47.3   661   680 322 512692 AATTTAGCCCTCAGGCTCTC  44.8   662   681 323 512693 AAATTTAGCCCTCAGGCTCT  39.2   663   682 324 512694 TAAATTTAGCCCTCAGGCTC  48.0   664   683 325 512695 TTAAATTTAGCCCTCAGGCT  54.9   665   684 326 512696 GTTAAATTTAGCCCTCAGGC  48.1   666   685 327 512697 AGTTAAATTTAGCCCTCAGG  39.3   667   686 328 512698 CAGTTAAATTTAGCCCTCAG  47.5   668   687 329 512699 ACAGTTAAATTTAGCCCTCA  68.2   669   688 330 512700 GACAGTTAAATTTAGCCCTC  59.2   670   689 331 512701 GGACAGTTAAATTTAGCCCT  63.7   671   690 332 512702 CGGACAGTTAAATTTAGCCC  50.7   672   691 333 512703 TCGGACAGTTAAATTTAGCC  39.6   673   692 334 512704 CTCGGACAGTTAAATTTAGC  36.5   674   693 335 512705 ACTCGGACAGTTAAATTTAG  59.1   675   694 336 512706 GACTCGGACAGTTAAATTTA  50.0   676   695 337 512707 CGACTCGGACAGTTAAATTT  63.0   677   696 338 512708 CCGACTCGGACAGTTAAATT  34.3   678   697 339 512709 TCCGACTCGGACAGTTAAAT  39.5   679   698 340

Example 3: Design of Antisense Oligonucleotides Targeting Human Dystrophia Myotonica Protein Kinase (hDMPK)

[0669] A series of antisense oligonucleotides (ASOs) were designed to target hDMPK. The newly designed ASOs were prepared using standard oligonucleotide synthesis well known in the art and are described in Table 7, below. Subscripts “s” indicate phosphorothioate internucleoside linkages; subscripts “k” indicate 6′-(S)—CH.sub.3 bicyclic nucleosides (cEt); subscripts “e” indicate 2′-O-methoxyethyl (MOE) modified nucleosides; and subscripts “d” indicate β-D-2′-deoxyribonucleosides. “.sup.mC” indicates 5-methylcytosine nucleosides.

[0670] The antisense oligonucleotides targeted to a human DMPK nucleic acid were tested for their effect on DMPK RNA transcript in vitro. Cultured HepG2 cells at a density of 20,000 cells per well were transfected using electroporation with 4,500 nM antisense oligonucleotide. After approximately 24 hours, RNA was isolated from the cells and DMPK transcript levels were measured by quantitative real-time PCR. DMPK RNA transcript levels were adjusted according to total RNA content, as measured by RIBOGREEN®. Results are presented as percent expression of DMPK, relative to untreated control cells.

[0671] ‘Target start site’ indicates the 5′-most nucleoside to which the antisense oligonucleotide is targeted in the human genomic gene sequence. ‘Target stop site’ indicates the 3′-most nucleoside to which the antisense oligonucleotide is targeted in the human genomic sequence. All the antisense oligonucleotides listed in Table 7 target SEQ ID NO: 1 (GENBANK Accession No. NM_001081560.1).

[0672] Several of the antisense oligonucleotides demonstrated significant inhibition of DMPK mRNA levels under the conditions specified above.

TABLE-US-00007 TABLE 7 Inhibition of human DMPK RNA transcript in HepG2 cells targeting SEQ ID NO: 1 Start Site Stop Site SEQ ISIS % Target on Seq ID: on Seq ID: ID No. Sequence Expression 1 1 NO. UTC N/A 100 N/A N/A 533424 T.sub.es.sup.mC.sub.esT.sub.es.sup.mC.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.ds.sup.mC.sub.dsG.sub.dsG.sub.dsA.sub.dsA.sub.dsG.sub.ks.sup.mC.sub.ksA.sub.k  34.4  548  563 341 533425 .sup.mC.sub.esT.sub.es.sup.mC.sub.esT.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.ds.sup.mC.sub.dsG.sub.dsG.sub.dsA.sub.dsA.sub.ksG.sub.ks.sup.mC.sub.k  32.1  549  564 342 533426 .sup.mC.sub.es.sup.mC.sub.esT.sub.es.sup.mC.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.ds.sup.mC.sub.dsG.sub.dsG.sub.dsA.sub.ksA.sub.ksG.sub.k  52.1  550  565 343 533427 A.sub.esA.sub.esA.sub.es.sup.mC.sub.dsT.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.ds.sup.mC.sub.dsA.sub.ksG.sub.ksT.sub.k  36.8  679  694 344 533428 .sup.mC.sub.esA.sub.esA.sub.esA.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.ds.sup.mC.sub.ksA.sub.ksG.sub.k  59.9  680  695 345 533429 .sup.mC.sub.es.sup.mC.sub.esA.sub.esA.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.ks.sup.mC.sub.ksA.sub.k  39.3  681  696 346 533430 .sup.mC.sub.es.sup.mC.sub.es.sup.mC.sub.esA.sub.dsA.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.ksG.sub.ks.sup.mC.sub.k  37.6  682  697 347 533431 .sup.mC.sub.es.sup.mC.sub.es.sup.mC.sub.es.sup.mC.sub.dsA.sub.dsA.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.ksA.sub.ksG.sub.k  39.6  683  698 348 533432 T.sub.es.sup.mC.sub.es.sup.mC.sub.es.sup.mC.sub.ds.sup.mC.sub.dsA.sub.dsA.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.ksA.sub.ksG.sub.k  52.1  684  699 349 533433 G.sub.esT.sub.esT.sub.esT.sub.dsG.sub.dsA.sub.dsT.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.ksT.sub.ksG.sub.k  53.9  782  797 350 533434 G.sub.esG.sub.esT.sub.esT.sub.dsT.sub.dsG.sub.dsA.sub.dsT.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.ksG.sub.ksT.sub.k  38.1  783  798 351 533435 G.sub.esG.sub.esG.sub.esT.sub.dsT.sub.dsT.sub.dsG.sub.dsA.sub.dsT.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.ksT.sub.ksG.sub.k  43.7  784  799 352 533436 A.sub.es.sup.mC.sub.esA.sub.esG.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.dsG.sub.dsA.sub.dsT.sub.ks.sup.mC.sub.ksT.sub.k  29.5  927  942 353 533437 .sup.mC.sub.esA.sub.es.sup.mC.sub.esA.sub.dsG.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.dsG.sub.dsA.sub.ksT.sub.ks.sup.mC.sub.k  48.6  928  943 354 533438 .sup.mC.sub.es.sup.mC.sub.esA.sub.es.sup.mC.sub.dsA.sub.dsG.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.dsG.sub.ksA.sub.ksT.sub.k  46.9  929  944 355 533439 .sup.mC.sub.es.sup.mC.sub.es.sup.mC.sub.esA.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.ksG.sub.ksA.sub.k  43.6  930  945 356 533440 G.sub.es.sup.mC.sub.es.sup.mC.sub.es.sup.mC.sub.dsA.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.dsA.sub.ksG.sub.ksG.sub.k  26.9  931  946 357 533441 .sup.mC.sub.esG.sub.es.sup.mC.sub.es.sup.mC.sub.ds.sup.mC.sub.dsA.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.ksA.sub.ksG.sub.k  31.3  932  947 358 533442 .sup.mC.sub.es.sup.mC.sub.esG.sub.es.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.ks.sup.mC.sub.ksA.sub.k  20.5  933  948 359 533443 A.sub.es.sup.mC.sub.es.sup.mC.sub.esG.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.ds.sup.mCd.sup.mC.sub.dsT.sub.ksG.sub.ks.sup.mC.sub.k  13.7  934  949 360 533444 .sup.mC.sub.esA.sub.es.sup.mC.sub.es.sup.mC.sub.dsG.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.ds.sup.mC.sub.ds.sup.mC.sub.ksT.sub.ksG.sub.k  29.4  935  950 361 533445 .sup.mC.sub.es.sup.mC.sub.esA.sub.es.sup.mC.sub.ds.sup.mC.sub.dsG.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.ds.sup.mC.sub.ks.sup.mC.sub.ksT.sub.k  32  936  951 362 533446 .sup.mC.sub.es.sup.mC.sub.es.sup.mC.sub.esA.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsG.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.ks.sup.mC.sub.ks.sup.mC.sub.k   8.3  937  952 363 533447 G.sub.es.sup.mC.sub.es.sup.mC.sub.es.sup.mC.sub.dsA.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsG.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.ds.sup.mC.sub.dsA.sub.ks.sup.mG.sub.ks.sup.mC.sub.k  18.3  938  953 364 533448 .sup.mC.sub.es.sup.mC.sub.esA.sub.esG.sub.dsG.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsG.sub.ds.sup.mC.sub.ds.sup.mC.sub.ks.sup.mC.sub.ksA.sub.k  19.4  942  957 365 533449 .sup.mC.sub.es.sup.mC.sub.es.sup.mC.sub.esA.sub.dsG.sub.dsG.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsG.sub.ds.sup.mC.sub.ks.sup.mC.sub.ks.sup.mC.sub.k  24.2  943  958 366 533450 T.sub.es.sup.mC.sub.es.sup.mC.sub.es.sup.mC.sub.dsA.sub.dsG.sub.dsG.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsG.sub.ks.sup.mC.sub.ks.sup.mC.sub.k  39.2  944  959 367 533451 T.sub.esG.sub.es.sup.mC.sub.es.sup.mC.sub.dsT.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.dsG.sub.ds.sup.mC.sub.ks.sup.mC.sub.ks.sup.mC.sub.k  44.2  950  965 368 533452 .sup.mC.sub.esT.sub.esG.sub.es.sup.mC.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.dsG.sub.ks.sup.mC.sub.ks.sup.mC.sub.k  55.6  951  966 369 533453 G.sub.es.sup.mC.sub.esT.sub.esG.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.ksG.sub.ks.sup.mC.sub.k  71.2  952  967 370 533454 G.sub.esG.sub.esT.sub.esG.sub.dsG.sub.ds.sup.mC.sub.dsA.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.ds.sup.mC.sub.dsG.sub.dsA.sub.ksA.sub.ksA.sub.k  39.6 1276 1291 371 533455 .sup.mC.sub.esG.sub.esG.sub.esT.sub.dsG.sub.dsG.sub.ds.sup.mC.sub.dsA.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.ds.sup.mC.sub.dsG.sub.ksA.sub.ksA.sub.k  52.9 1277 1292 372 533456 T.sub.es.sup.mC.sub.esG.sub.esG.sub.dsT.sub.dsG.sub.dsG.sub.ds.sup.mC.sub.dsA.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.ds.sup.mC.sub.ksG.sub.ksA.sub.k  27 1278 1293 373 533457 A.sub.esG.sub.esT.sub.esG.sub.dsA.sub.dsG.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.ks.sup.mC.sub.ks.sup.mC.sub.k  51.5 1315 1330 374 533458 .sup.mC.sub.esA.sub.esG.sub.esT.sub.dsG.sub.dsA.sub.dsG.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.ksT.sub.ks.sup.mC.sub.k  55.1 1316 1331 375 533459 G.sub.es.sup.mC.sub.esA.sub.esG.sub.dsT.sub.dsG.sub.dsA.sub.dsG.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.ks.sup.mC.sub.ksT.sub.k  33.7 1317 1332 376 533460 T.sub.es.sup.mC.sub.es.sup.mC.sub.es.sup.mC.sub.dsG.sub.dsA.sub.dsA.sub.dsT.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsG.sub.dsA.sub.ks.sup.mC.sub.ksA.sub.k  28.7 1344 1359 377 533461 T.sub.esT.sub.es.sup.mC.sub.es.sup.mC.sub.ds.sup.mC.sub.dsG.sub.dsA.sub.dsA.sub.dsT.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsG.sub.ksA.sub.ks.sup.mC.sub.k  36.2 1345 1360 378 533462 .sup.mC.sub.esT.sub.esT.sub.es.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsG.sub.dsA.sub.dsA.sub.dsT.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.ksG.sub.ksA.sub.k  23 1346 1361 379 533463 .sup.mC.sub.es.sup.mC.sub.esT.sub.esT.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsG.sub.dsA.sub.dsA.sub.dsT.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.ks.sup.mC.sub.ksG.sub.k  11.5 1347 1362 380 533464 A.sub.es.sup.mC.sub.es.sup.mC.sub.esT.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsG.sub.dsA.sub.dsA.sub.dsT.sub.dsG.sub.dsT.sub.ks.sup.mC.sub.ks.sup.mC.sub.k  19.9 1348 1363 381 533465 .sup.mC.sub.esA.sub.es.sup.mC.sub.es.sup.mC.sub.dsT.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsG.sub.dsA.sub.dsA.sub.dsT.sub.dsG.sub.ksT.sub.ks.sup.mC.sub.k  30.2 1349 1364 382 533466 G.sub.es.sup.mC.sub.esA.sub.es.sup.mC.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsG.sub.dsA.sub.dsA.sub.dsT.sub.ksG.sub.ksT.sub.k  30.2 1350 1365 383 533467 .sup.mC.sub.esG.sub.es.sup.mC.sub.esA.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsG.sub.dsA.sub.dsA.sub.ksT.sub.ksG.sub.k  35.5 1351 1366 384 533468 A.sub.esT.sub.es.sup.mC.sub.es.sup.mC.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.dsA.sub.dsA.sub.ks.sup.mC.sub.ksT.sub.k  47.4 1746 1761 385 533469 .sup.mC.sub.esA.sub.esT.sub.es.sup.mC.sub.ds.sup.mC.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.dsA.sub.ksA.sub.ks.sup.mC.sub.k  51.2 1747 1762 386 533470 .sup.mC.sub.es.sup.mC.sub.esA.sub.esT.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.ksA.sub.ksA.sub.k  35.5 1748 1763 387 533471 G.sub.es.sup.mC.sub.esT.sub.es.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.ks.sup.mC.sub.ksA.sub.k  65.6 1770 1785 388 533472 A.sub.esG.sub.esG.sub.esT.sub.dsG.sub.dsG.sub.dsA.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsG.sub.dsT.sub.dsG.sub.dsG.sub.ks.sup.mC.sub.ks.sup.mC.sub.k  51.8 1816 1831 389 533473 G.sub.esG.sub.esG.sub.esA.sub.dsA.sub.dsG.sub.dsG.sub.dsT.sub.dsG.sub.dsG.sub.dsA.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.ksG.sub.ksT.sub.k  44.9 1820 1835 390 533474 A.sub.es.sup.mC.sub.esA.sub.esG.sub.dsG.sub.dsA.sub.dsG.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.dsG.sub.dsG.sub.dsA.sub.dsA.sub.ksA.sub.ksG.sub.k  80.8 1955 1970 391 533475 .sup.mC.sub.esA.sub.esG.sub.esA.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.dsG.sub.dsG.sub.dsT.sub.dsG.sub.dsA.sub.dsG.sub.ksT.sub.ksT.sub.k  95.5 2034 2049 392 533476 G.sub.esG.sub.es.sup.mC.sub.esT.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.dsG.sub.dsG.sub.ds.sup.mC.sub.dsG.sub.dsG.sub.ds.sup.mC.sub.ksG.sub.ks.sup.mC.sub.k  55.7 2050 2065 393 533477 G.sub.esG.sub.es.sup.mC.sub.esG.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.dsG.sub.dsG.sub.ds.sup.mC.sub.ksG.sub.ksG.sub.k  45.8 2053 2068 394 533478 .sup.mC.sub.esG.sub.es.sup.mC.sub.esG.sub.dsG.sub.dsG.sub.ds.sup.mC.sub.dsG.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.ksG.sub.ksG.sub.k  83.7 2057 2072 395 533479 G.sub.esA.sub.esG.sub.es.sup.mC.sub.dsG.sub.ds.sup.mC.sub.dsG.sub.dsG.sub.dsG.sub.ds.sup.mC.sub.dsG.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.ks.sup.mC.sub.ks.sup.mC.sub.k  79.8 2060 2075 396 533480 G.sub.esG.sub.esT.sub.esT.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.dsG.sub.dsG.sub.dsA.sub.dsG.sub.ds.sup.mC.sub.dsG.sub.ds.sup.mC.sub.ksG.sub.ksG.sub.k  49.4 2068 2083 397 533481 A.sub.esG.sub.esT.sub.esT.sub.ds.sup.mC.sub.dsT.sub.dsA.sub.dsG.sub.dsG.sub.dsG.sub.dsT.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.ksG.sub.ksG.sub.k  37 2076 2091 398 533482 .sup.mC.sub.esA.sub.esG.sub.esT.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.dsA.sub.dsG.sub.dsG.sub.dsG.sub.dsT.sub.dsT.sub.ds.sup.mC.sub.ksA.sub.ksG.sub.k  28.5 2077 2092 399 533483 A.sub.es.sup.mC.sub.esA.sub.esG.sub.dsT.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.dsA.sub.dsG.sub.dsG.sub.dsG.sub.dsT.sub.dsT.sub.ks.sup.mC.sub.ksA.sub.k  42 2078 2093 400 533484 G.sub.esA.sub.es.sup.mC.sub.esA.sub.dsG.sub.dsT.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.dsA.sub.dsG.sub.dsG.sub.dsG.sub.dsT.sub.ksT.sub.ks.sup.mC.sub.k  37.4 2079 2094 401 533485 A.sub.esG.sub.esA.sub.es.sup.mC.sub.dsA.sub.dsG.sub.dsT.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.dsA.sub.dsG.sub.dsG.sub.dsG.sub.ksT.sub.ksT.sub.k  66.5 2080 2095 402 533486 A.sub.esA.sub.esG.sub.esA.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.dsT.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.dsA.sub.dsG.sub.dsG.sub.ksG.sub.ksT.sub.k  62.4 2081 2096 403 533487 G.sub.esA.sub.esA.sub.esG.sub.dsA.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.dsT.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.dsA.sub.dsG.sub.ksG.sub.ksG.sub.k  56.9 2082 2097 404 533488 .sup.mC.sub.esG.sub.esA.sub.esA.sub.dsG.sub.dsA.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.dsT.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.dsA.sub.ksG.sub.ksG.sub.k  36.8 2083 2098 405 533489 T.sub.es.sup.mC.sub.esG.sub.esA.sub.dsA.sub.dsG.sub.dsA.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.dsT.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.ksA.sub.ksG.sub.k  49.6 2084 2099 406 533490 G.sub.esT.sub.es.sup.mC.sub.esG.sub.dsA.sub.dsA.sub.dsG.sub.dsA.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.dsT.sub.dsT.sub.ds.sup.mC.sub.ksT.sub.ksA.sub.k  40.4 2085 2100 407 533491 A.sub.esG.sub.esT.sub.es.sup.mC.sub.dsG.sub.dsA.sub.dsA.sub.dsG.sub.dsA.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.dsT.sub.dsT.sub.ks.sup.mC.sub.ksT.sub.k  37.4 2086 2101 408 533492 G.sub.esA.sub.esG.sub.esT.sub.ds.sup.mC.sub.dsG.sub.dsA.sub.dsA.sub.dsG.sub.dsA.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.dsT.sub.ksT.sub.ks.sup.mC.sub.k  36.6 2087 2102 409 533493 G.sub.esG.sub.esA.sub.esG.sub.dsT.sub.ds.sup.mC.sub.dsG.sub.dsA.sub.dsA.sub.dsG.sub.dsA.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.ksT.sub.ksT.sub.k  33.2 2088 2103 410 533494 .sup.mC.sub.esG.sub.esG.sub.esA.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.dsG.sub.dsA.sub.dsA.sub.dsG.sub.dsA.sub.ds.sup.mC.sub.dsA.sub.ksG.sub.ksT.sub.k  45.3 2089 2104 411 533495 .sup.mC.sub.es.sup.mC.sub.esG.sub.esG.sub.dsA.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.dsG.sub.dsA.sub.dsA.sub.dsG.sub.dsA.sub.ds.sup.mC.sub.ksA.sub.ksG.sub.k  45.9 2090 2105 412 533496 .sup.mC.sub.es.sup.mC.sub.es.sup.mC.sub.esG.sub.dsG.sub.dsA.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.dsG.sub.dsA.sub.dsA.sub.dsG.sub.dsA.sub.ks.sup.mC.sub.ksA.sub.k  51.3 2091 2106 413 533497 .sup.mC.sub.es.sup.mC.sub.es.sup.mC.sub.es.sup.mC.sub.dsG.sub.dsG.sub.dsA.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.dsG.sub.dsA.sub.dsA.sub.dsG.sub.ksA.sub.ks.sup.mC.sub.k  49.2 2092 2107 414 533498 G.sub.es.sup.mC.sub.es.sup.mC.sub.es.sup.mC.sub.ds.sup.mC.sub.dsG.sub.dsG.sub.dsA.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.dsG.sub.dsA.sub.dsA.sub.ksG.sub.ksA.sub.k  52.3 2093 2108 415 533499 G.sub.esG.sub.es.sup.mC.sub.es.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsG.sub.dsG.sub.dsA.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.dsG.sub.dsA.sub.ksA.sub.ksG.sub.k  54.9 2094 2109 416 533500 G.sub.esG.sub.esG.sub.es.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsG.sub.dsG.sub.dsA.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.dsG.sub.ksA.sub.ksA.sub.k  46.7 2095 2110 417 533809 A.sub.es.sup.mC.sub.esA.sub.esA.sub.dsT.sub.dsA.sub.dsA.sub.dsA.sub.dsT.sub.dsA.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsG.sub.dsA.sub.ksG.sub.ksG.sub.k  51.4 2773 2788 418

Example 4: Design of Antisense Oligonucleotides Targeting Human Dystrophia Myotonica Protein Kinase (hDMPK)

Dose Response HepG2

[0673] A series of antisense oligonucleotides (ASOs) were designed to target hDMPK. The newly designed ASOs were prepared using standard oligonucleotide synthesis well known in the art and are described in Table 8, below. Subscripts “s” indicate phosphorothioate internucleoside linkages; subscripts “k” indicate 6′-(S)—CH.sub.3 bicyclic nucleosides (cEt); subscripts “e” indicate 2′-O-methoxyethyl (MOE) modified nucleosides; and subscripts “d” indicate β-D-2′-deoxyribonucleosides. “.sup.mC” ˜ indicates 5-methylcytosine nucleosides.

[0674] The antisense oligonucleotides are targeted to SEQ TD NO: 1 (GENBANK Accession No. NM_001081560.1). “Start site” indicates the 5′-most nucleoside to which the gapmer is targeted in the human gene sequence. “Stop site” indicates the 3′-most nucleoside to which the gapmer is targeted human gene sequence.

TABLE-US-00008 TABLE 8 Design of antisense oligonucleotides targeting hDMPK ISIS Start Stop SEQ No. Composition (5′ to 3′) Site Site ID NO 533440 G.sub.es.sup.mC.sub.es.sup.mC.sub.es.sup.mC.sub.dsA.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.ds  931  946 357 .sup.mC.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.dsA.sub.ksG.sub.ksG.sub.k 533442 .sup.mC.sub.es.sup.mC.sub.esG.sub.es.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.ds  933  948 359 .sup.mC.sub.dsA.sub.dsG.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.ks .sup.mC.sub.ksA.sub.k 533443 A.sub.es.sup.mC.sub.es.sup.mC.sub.esG.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds  934  949 360 A.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.ks G.sub.ks.sup.mC.sub.k 533446 .sup.mC.sub.es.sup.mC.sub.es.sup.mC.sub.esA.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsG.sub.ds  937  952 363 .sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.ks .sup.mC.sub.ks.sup.mC.sub.k 533447 G.sub.es.sup.mC.sub.es.sup.mC.sub.es.sup.mC.sub.dsA.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds  938  953 364 G.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.ds.sup.mC.sub.dsA.sub.ks G.sub.ks.sup.mC.sub.k 533448 .sup.mC.sub.es.sup.mC.sub.esA.sub.esG.sub.dsG.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds  942  957 365 .sup.mC.sub.dsA.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsG.sub.ds.sup.mC.sub.ds.sup.mC.sub.ks .sup.mC.sub.ksA.sub.k 533449 .sup.mC.sub.es.sup.mC.sub.es.sup.mC.sub.esA.sub.dsG.sub.dsG.sub.ds.sup.mC.sub.ds  943  958 366 .sup.mC.sub.ds.sup.mC.sub.dsA.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsG.sub.ds.sup.mC.sub.ks .sup.mC.sub.ks.sup.mC.sub.k 533462 .sup.mC.sub.esT.sub.esT.sub.es.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsG.sub.ds 1346 1361 379 A.sub.dsA.sub.dsT.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.ksG.sub.ks A.sub.k 533463 .sup.mC.sub.es.sup.mC.sub.esT.sub.esT.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds 1347 1362 380 G.sub.dsA.sub.dsA.sub.dsT.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.ks.sup.mC.sub.ks G.sub.k 533464 A.sub.es.sup.mC.sub.es.sup.mC.sub.esT.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds 1348 1363 381 .sup.mC.sub.dsG.sub.dsA.sub.dsA.sub.dsT.sub.dsG.sub.dsT.sub.ks .sup.mC.sub.ks.sup.mC.sub.k 533529 .sup.mC.sub.esG.sub.esG.sub.esT.sub.dsT.sub.dsG.sub.dsT.sub.dsG.sub.ds 2162 2177  23 A.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.dsG.sub.ks.sup.mC.sub.ksA.sub.k 533530 A.sub.esG.sub.es.sup.mC.sub.esG.sub.dsG.sub.dsT.sub.dsT.sub.dsG.sub.ds 2164 2179 419 T.sub.dsG.sub.dsA.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.ksG.sub.ksG.sub.k 533599 G.sub.es.sup.mC.sub.esA.sub.es.sup.mC.sub.dsT.sub.dsT.sub.dsT.sub.dsG.sub.ds 2492 2507 420 .sup.mC.sub.dsG.sub.dsA.sub.dsA.sub.ds.sup.mC.sub.ds.sup.mC.sub.ksA.sub.ksA.sub.k 533600 T.sub.esG.sub.es.sup.mC.sub.esA.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.dsT.sub.ds 2493 2508 421 G.sub.ds.sup.mC.sub.dsG.sub.dsA.sub.dsA.sub.ds.sup.mC.sub.ks.sup.mC.sub.ksA.sub.k

Example 5: Dose Response HepG2

[0675] Antisense oligonucleotides targeted to a human DMPK nucleic acid were tested for their effect on human DMPK RNA transcript in vitro. Cultured HepG2 cells at a density of 20,000 cells 4 per well were transfected using electroporation with 625 nM, 1250 nM, 2500 nM, 5000 nM, and 10000.0 nM concentrations of each antisense oligonucleotide. After approximately 24 hours, RNA was isolated from the cells and DMPK RNA transcript levels were measured by quantitative real-time PCR using primer probe set RTS3164 (forward sequence AGCCTGAGCCGGGAGATG, designated herein as SEQ ID NO: 20; reverse sequence GCGTAGTTGACTGGCGAAGTT, designated herein as SEQ ID NO: 21; probe sequence AGGCCATCCGCACGGACAACCX, designated herein as SEQ ID NO: 22). Human DMPK RNA transcript levels were adjusted according to total RNA content, as measured by RIBOGREEN®. Results are presented in the table below as percent expression of human DMPK, relative to untreated control (UTC) cells. The tested antisense oligonucleotide sequences demonstrated dose-dependent inhibition of human DMPK mRNA levels under the conditions specified above.

TABLE-US-00009 TABLE 9 Inhibition of human DMPK RNA transcript in HepG2 cells targeting SEQ ID NO: 1 ISIS Dose % Target Start Site on Stop Site on No. (nM) Expression Seq ID: 1 Seq ID: 1 UTC N/A 100 N/A N/A 486178 625.0 39.4 2773 2788 486178 1250.0 31.2 2773 2788 486178 2500.0 20.6 2773 2788 486178 5000.0 13 2773 2788 486178 10000.0 11.5 2773 2788 533440 625.0 55.4 931 946 533440 1250.0 40.4 931 946 533440 2500.0 25.4 931 946 533440 5000.0 22.6 931 946 533440 10000.0 10.3 931 946 533442 625.0 55.2 933 948 533442 1250.0 33.1 933 948 533442 2500.0 29 933 948 533442 5000.0 16.9 933 948 533442 10000.0 7.2 933 948 533443 625.0 44.8 934 949 533443 1250.0 29.4 934 949 533443 2500.0 19.9 934 949 533443 5000.0 10.8 934 949 533443 10000.0 7 934 949 533446 625.0 50.9 937 952 533446 1250.0 35.5 937 952 533446 2500.0 30.4 937 952 533446 5000.0 14.6 937 952 533446 10000.0 14 937 952 533447 625.0 53.3 938 953 533447 1250.0 31.7 938 953 533447 2500.0 16.8 938 953 533447 5000.0 11.7 938 953 533447 10000.0 4.4 938 953 533448 625.0 58.8 942 957 533448 1250.0 36.9 942 957 533448 2500.0 24.8 942 957 533448 5000.0 11.5 942 957 533448 10000.0 10.1 942 957 533449 625.0 61.1 943 958 533449 1250.0 42.8 943 958 533449 2500.0 30.4 943 958 533449 5000.0 20.2 943 958 533449 10000.0 10.1 943 958 533462 625.0 50.7 1346 1361 533462 1250.0 32.3 1346 1361 533462 2500.0 29.2 1346 1361 533462 5000.0 12.5 1346 1361 533462 10000.0 5.8 1346 1361 533463 625.0 39.1 1347 1362 533463 1250.0 23.7 1347 1362 533463 2500.0 12.6 1347 1362 533463 5000.0 9.3 1347 1362 533463 10000.0 3.2 1347 1362 533464 625.0 48.8 1348 1363 533464 1250.0 36.4 1348 1363 533464 2500.0 24.5 1348 1363 533464 5000.0 11.7 1348 1363 533464 10000.0 5 1348 1363 533529 625.0 35.8 2162 2177 533529 1250.0 26.4 2162 2177 533529 2500.0 18.3 2162 2177 533529 5000.0 14.8 2162 2177 533529 10000.0 14.7 2162 2177 533530 625.0 47.4 2164 2179 533530 1250.0 22.1 2164 2179 533530 2500.0 21.5 2164 2179 533530 5000.0 14.4 2164 2179 533530 10000.0 8 2164 2179 533599 625.0 31.3 2492 2507 533599 1250.0 21.9 2492 2507 533599 2500.0 13.1 2492 2507 533599 5000.0 8.8 2492 2507 533599 10000.0 7.3 2492 2507 533600 625.0 33.8 2493 2508 533600 1250.0 20.9 2493 2508 533600 2500.0 16.5 2493 2508 533600 5000.0 10.4 2493 2508 533600 10000.0 12.1 2493 2508

Example 6: Design of Antisense Oligonucleotides Targeting Human Dystrophia Myotonica Protein Kinase (hDMPK)

[0676] A series of antisense oligonucleotides (ASOs) were designed to target hDMPK. The newly designed ASOs were prepared using standard oligonucleotide synthesis well known in the art and are described in Table 10, below. Subscripts “s” indicate phosphorothioate internucleoside linkages; subscripts “k” indicate 6′-(S)—CH.sub.3 bicyclic nucleosides (cEt); subscripts “e” indicate 2′-O-methoxyethyl (MOE) modified nucleosides; and subscripts “d” indicate β-D-2′-deoxyribonucleosides. C indicates 5-methylcytosine nucleosides.

[0677] The antisense oligonucleotides are targeted to SEQ ID NO: 2 (the complement of GENBANK Accession No. NT_011109.15 truncated from nucleotides 18540696 to 18555106). “Start site” indicates the 5′-most nucleoside to which the gapmer is targeted in the human gene sequence. “Stop site” indicates the 3′-most nucleoside to which the gapmer is targeted human gene sequence.

TABLE-US-00010 TABLE 10 Design of antisense oligonucleotides targeting hDMPK Start Stop Site  Site Seq ISIS on Seq on Seq ID No. Sequence ID: 2 ID: 2 No. UTC N/A N/A N/A 486178 A.sub.ks.sup.mC.sub.ksA.sub.ksA.sub.dsT.sub.dsA.sub.dsA.sub.dsA.sub.ds 13836 13851  23 T.sub.dsA.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsG.sub.dsA.sub.ksG.sub.ksG.sub.k 533597 A.sub.es.sup.mC.sub.esT.sub.esT.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.dsG.sub.ds 13553 13568 422 A.sub.dsA.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.dsA.sub.ks.sup.mC.sub.ksG.sub.k 533603 A.sub.esA.sub.esA.sub.esG.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.dsT.sub.ds 13563 13578 423 G.sub.ds.sup.mC.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.ksT.sub.ksG.sub.k 533617 T.sub.es.sup.mC.sub.es.sup.mC.sub.es.sup.mC.sub.dsG.sub.dsA.sub.dsG.sub.dsT.sub.ds 13624 13639 424 A.sub.dsA.sub.dsG.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.ksG.sub.ks.sup.mC.sub.k 533649 G.sub.es.sup.mC.sub.esA.sub.esG.sub.ds.sup.mC.sub.dsG.sub.ds.sup.mC.sub.ds 13686 13701 425 A.sub.dsA.sub.dsG.sub.dsT.sub.dsG.sub.dsA.sub.dsG.sub.ksG.sub.ksA.sub.k 533694 G.sub.esT.sub.es.sup.mC.sub.esA.sub.dsG.sub.ds.sup.mG.sub.dsG.sub.dsA.sub.ds 13760 13775 426 G.sub.dsT.sub.ds.sup.mC.sub.dsG.sub.dsG.sub.dsA.sub.ksG.sub.ksG.sub.k 533697 .sup.mC.sub.es.sup.mC.sub.esT.sub.esG.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.ds 13763 13778 427 .sup.mC.sub.dsG.sub.dsA.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.ksG.sub.ksG.sub.k 533698 G.sub.es.sup.mC.sub.es.sup.mC.sub.esT.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.ds 13764 13779 428 G.sub.ds.sup.mC.sub.dsG.sub.dsA.sub.dsG.sub.dsT.sub.ks.sup.mC.sub.ksG.sub.k 533699 A.sub.esG.sub.es.sup.mC.sub.es.sup.mC.sub.dsT.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.ds 13765 13780 429 A.sub.dsG.sub.ds.sup.mC.sub.dsG.sub.dsA.sub.dsG.sub.ksT.sub.ks.sup.mC.sub.k 533711 G.sub.esG.sub.esG.sub.esT.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.ds 13813 13828 430 G.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.ks.sup.mC.sub.ks.sup.mC.sub.k 533721 A.sub.esG.sub.esG.sub.esT.sub.dsT.sub.dsT.sub.dsT.sub.dsT.sub.ds  2580  2595 431 .sup.mC.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.dsA.sub.dsG.sub.ksG.sub.ks.sup.mC.sub.k 533722 A.sub.esA.sub.esG.sub.esG.sub.dsT.sub.dsT.sub.dsT.sub.dsT.sub.ds  2581  2596 432 T.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.dsA.sub.ksG.sub.ksG.sub.k 533751 G.sub.esG.sub.esT.sub.es.sup.mC.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.ds  6446  6461 433 .sup.mC.sub.dsT.sub.dsG.sub.dsG.sub.dsG.sub.dsT.sub.ks.sup.mC.sub.ks.sup.mC.sub.k 533786 G.sub.esT.sub.esG.sub.esG.sub.dsT.sub.dsT.sub.dsT.sub.ds.sup.mC.sub.ds 11099 11114 434 T.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.ks.sup.mC.sub.ksT.sub.k 533787 .sup.mC.sub.esG.sub.esT.sub.esG.sub.dsG.sub.dsT.sub.dsT.sub.dsT.sub.ds 11100 11115 435 .sup.mC.sub.dsT.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.ksG.sub.ks.sup.mC.sub.k

Example 7: Dose Response for ASOs Targeted to a Human DMPK RNA Transcript in HepG2 Cells

[0678] Antisense oligonucleotides targeted to a human DMPK nucleic acid were tested for their effect on human DMPK RNA transcript in vitro. Cultured HepG2 cells at a density of 20,000 cells per well were transfected using electroporation with 625 nM, 1250 nM, 2500 nM, 5000 nM, and 10000.0 nM concentrations of each antisense oligonucleotide. After approximately 24 hours, RNA was isolated from the cells and DMPK RNA transcript levels were measured by quantitative real-time PCR using primer probe set RTS3164 (forward sequence AGCCTGAGCCGGGAGATG, designated herein as SEQ ID NO: 20; reverse sequence GCGTAGTTGACTGGCGAAGTT, designated herein as SEQ ID NO: 21; probe sequence AGGCCATCCGCACGGACAACCX, designated herein as SEQ ID NO: 22). Human DMPK RNA transcript levels were adjusted according to total RNA content, as measured by RIBOGREEN®. Results are presented as percent expression of human DMPK, relative to untreated control (UTC) cells and are shown in the table below. The tested antisense oligonucleotide sequences demonstrated dose-dependent inhibition of human DMPK mRNA levels under the conditions specified above.

TABLE-US-00011 TABLE 11 Inhibition of human DMPK RNA transcript in HepG2 cells targeting SEQ ID NO: 1 ISIS Dose % Target Start Site on Stop Site on No. (nM) Expression Seq ID: 2 Seq ID: 2 UTC NA 100 N/A N/A 486178 625.000 39.4 13836 13851 486178 1250.000 27.3 13836 13851 486178 2500.000 14 13836 13851 486178 5000.000 16.3 13836 13851 486178 10000.000 8.3 13836 13851 533597 625.000 42.4 13553 13568 533597 1250.000 30.3 13553 13568 533597 2500.000 15.3 13553 13568 533597 5000.000 10 13553 13568 533597 10000.000 10.6 13553 13568 533603 625.000 48.2 13563 13578 533603 1250.000 31.1 13563 13578 533603 2500.000 22.4 13563 13578 533603 5000.000 15.6 13563 13578 533603 10000.000 9.9 13563 13578 533617 625.000 38.4 13624 13639 533617 1250.000 26.3 13624 13639 533617 2500.000 21.6 13624 13639 533617 5000.000 15.8 13624 13639 533617 10000.000 14.6 13624 13639 533649 625.000 52.2 13686 13701 533649 1250.000 27.8 13686 13701 533649 2500.000 24.6 13686 13701 533649 5000.000 20.5 13686 13701 533649 10000.000 14.5 13686 13701 533694 625.000 53.3 13760 13775 533694 1250.000 29.4 13760 13775 533694 2500.000 23.6 13760 13775 533694 5000.000 18.7 13760 13775 533694 10000.000 13.5 13760 13775 533697 625.000 30.6 13763 13778 533697 1250.000 14.9 13763 13778 533697 2500.000 13.8 13763 13778 533697 5000.000 9.7 13763 13778 533697 10000.000 7.1 13763 13778 533698 625.000 23.4 13764 13779 533698 1250.000 15.5 13764 13779 533698 2500.000 13.8 13764 13779 533698 5000.000 12.4 13764 13779 533698 10000.000 10.2 13764 13779 533699 625.000 38.2 13765 13780 533699 1250.000 26.9 13765 13780 533699 2500.000 17.6 13765 13780 533699 5000.000 12.9 13765 13780 533699 10000.000 9.3 13765 13780 533711 625.000 35.1 13813 13828 533711 1250.000 34.6 13813 13828 533711 2500.000 22.4 13813 13828 533711 5000.000 22 13813 13828 533711 10000.000 13 13813 13828 533721 625.000 36.3 2580 2595 533721 1250.000 29.8 2580 2595 533721 2500.000 23.2 2580 2595 533721 5000.000 17.8 2580 2595 533721 10000.000 17.2 2580 2595 533722 625.000 48.5 2581 2596 533722 1250.000 28.6 2581 2596 533722 2500.000 21.9 2581 2596 533722 5000.000 28.1 2581 2596 533722 10000.000 13.8 2581 2596 533751 625.000 37.7 6446 6461 533751 1250.000 21.6 6446 6461 533751 2500.000 12.6 6446 6461 533751 5000.000 9.7 6446 6461 533751 10000.000 8.5 6446 6461 533786 625.000 53.6 11099 11114 533786 1250.000 26.6 11099 11114 533786 2500.000 14.7 11099 11114 533786 5000.000 9.6 11099 11114 533786 10000.000 5.5 11099 11114 533787 625.000 43.8 11100 11115 533787 1250.000 27.7 11100 11115 533787 2500.000 16.3 11100 11115 533787 5000.000 7 11100 11115 533787 10000.000 4.5 11100 11115

Example 8: ASOs Designed to Target a Human DMPK RNA Transcript

[0679] A series of antisense oligonucleotides (ASOs) were designed to target hDMPK. The newly designed ASOs were prepared using standard oligonucleotide synthesis well known in the art and are described in Table 12, below. Subscripts “s” indicate phosphorothioate internucleoside linkages; subscripts “k” indicate 6′-(S)—CH.sub.3 bicyclic nucleosides (cEt); subscripts “e” indicate 2′-O-methoxyethyl (MOE) modified nucleosides; and subscripts “d” indicate 3-D-2′-deoxyribonucleosides. “.sup.mC” indicates 5-methylcytosine nucleosides.

[0680] The antisense oligonucleotides targeted to a human DMPK nucleic acid were tested for their effect on DMPK RNA transcript in vitro. Cultured hSKMC cells at a density of 20,000 cells per well were transfected using electroporation with 800 nM antisense oligonucleotide. After approximately 24 hours, RNA was isolated from the cells and DMPK transcript levels were measured by quantitative real-time PCR. DMPK RNA transcript levels were adjusted according to total RNA content, as measured by RIBOGREEN®. Results are presented as percent expression of DMPK, relative to untreated control cells.

[0681] ‘Target start site’ indicates the 5′-most nucleoside to which the antisense oligonucleotide is targeted in the human genomic gene sequence. ‘Target stop site’ indicates the 3′-most nucleoside to which the antisense oligonucleotide is targeted in the human genomic sequence. All the antisense oligonucleotides listed in Table 12 target SEQ ID NO: 1 (GENBANK Accession No. NM_001081560.1).

[0682] Several of the antisense oligonucleotides demonstrated significant inhibition of DMPK mRNA levels under the conditions specified above.

TABLE-US-00012 TABLE 12 Inhibition of human DMPK RNA transcript in HepG2 cells using ASOs targeting SEQ ID NO: 1 Start Stop Site Site ISIS % Target on Seq on Seq Seq No. Sequence Expression ID: 1 ID: 1 ID No. UTC N/A 100 N/A N/A 444401 T.sub.esT.sub.esG.sub.es.sup.mC.sub.esA.sub.es.sup.mC.sub.dsT.sub.dsT.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.dsG.sub.dsA.sub.dsA.sub.ds.sup.mC.sub.ds  25.2 2490 2509  33 .sup.mC.sub.esA.sub.esA.sub.es.sup.mC.sub.esG.sub.e 444436 G.sub.esT.sub.es.sup.mC.sub.esG.sub.eSG.sub.esA.sub.dsG.sub.dsG.sub.dsA.sub.ds.sup.mC.sub.dsG.sub.dsA.sub.dsG.sub.dsG.sub.dsT.sub.ds  30.8 2685 2704 264 .sup.mC.sub.esA.sub.esA.sub.esT.sub.esA.sub.e 486072 A.sub.ksA.sub.ksG.sub.ksA.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.dsT.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.dsA.sub.dsG.sub.dsG.sub.ksG.sub.ksT.sub.k  36.8 2081 2096 403 486073 .sup.mC.sub.ksG.sub.ksA.sub.ksA.sub.dsG.sub.dsA.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.dsT.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.dsA.sub.ksG.sub.ksG.sub.k  22.4 2083 2098 405 486075 G.sub.ksT.sub.ks.sup.mC.sub.ksG.sub.dsA.sub.dsA.sub.dsG.sub.dsA.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.dsT.sub.dsT.sub.ds.sup.mC.sub.ksT.sub.ksA.sub.k  41.3 2085 2100 407 486076 A.sub.ksG.sub.ksT.sub.ks.sup.mC.sub.dsG.sub.dsA.sub.dsA.sub.dsG.sub.dsA.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.dsT.sub.dsT.sub.ks.sup.mC.sub.ksT.sub.k  22.4 2086 2101 408 486077 G.sub.ksA.sub.ksG.sub.ksT.sub.ds.sup.mC.sub.dsG.sub.dsA.sub.dsA.sub.dsG.sub.dsA.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.dsT.sub.ksT.sub.ks.sup.mC.sub.k  35.2 2087 2102 409 486078 .sup.mC.sub.ksG.sub.ksG.sub.ksA.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.dsG.sub.dsA.sub.dsA.sub.dsG.sub.dsA.sub.ds.sup.mC.sub.dsA.sub.ksG.sub.ksT.sub.k  12.4 2089 2104 411 486079 .sup.mC.sub.ks.sup.mC.sub.ks.sup.mC.sub.ksG.sub.dsG.sub.dsA.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.dsG.sub.dsA.sub.dsA.sub.dsG.sub.dsA.sub.ks.sup.mC.sub.ksA.sub.k  36.5 2091 2106 413 486080 .sup.mC.sub.ks.sup.mC.sub.ks.sup.mC.sub.ks.sup.mC.sub.dsG.sub.dsG.sub.dsA.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.dsG.sub.dsA.sub.dsA.sub.dsG.sub.ksA.sub.ks.sup.mC.sub.k  19.9 2092 2107 414 486085 G.sub.ksA.sub.ksA.sub.ks.sup.mC.sub.dsT.sub.dsG.sub.dsG.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.dsG.sub.ds.sup.mC.sub.dsG.sub.dsG.sub.ksT.sub.ksG.sub.k  30.1 2155 2170 436 486086 T.sub.ksG.sub.ksT.sub.ksG.sub.dsA.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.dsG.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.dsG.sub.ks.sup.mC.sub.ksG.sub.k  17.2 2158 2173 437 486087 G.sub.ksG.sub.ksT.sub.ksT.sub.dsG.sub.dsT.sub.dsG.sub.dsA.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.dsG.sub.ds.sup.mC.sub.ksA.sub.ksG.sub.k  11.5 2161 2176 438 486088 G.sub.ksA.sub.ksG.sub.ks.sup.mC.sub.dsG.sub.dsG.sub.dsT.sub.dsT.sub.dsG.sub.dsT.sub.dsG.sub.dsA.sub.dsA.sub.ds.sup.mC.sub.ksT.sub.ksG.sub.k  21.7 2165 2180 439 486094 A.sub.ks.sup.mC.sub.ksT.sub.ksG.sub.dsG.sub.dsA.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.dsG.sub.dsG.sub.ds.sup.mC.sub.dsG.sub.ksG.sub.ksA.sub.k  30.2 2193 2208 440 486096 A.sub.ksG.sub.ksG.sub.ksA.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.dsG.sub.dsA.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.dsG.sub.ksG.sub.ks.sup.mC.sub.k  43.5 2196 2211 441 486097 T.sub.ks.sup.mC.sub.ksA.sub.ks.sup.mC.sub.dsA.sub.dsG.sub.dsG.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.dsG.sub.dsA.sub.dsG.sub.ks.sup.mC.sub.ksT.sub.k  54.5 2200 2215 442 486098 A.sub.ksT.sub.ks.sup.mC.sub.ksA.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.dsG.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.dsG.sub.dsA.sub.ksG.sub.ks.sup.mC.sub.k  77.3 2201 2216 443 486099 G.sub.ksG.sub.ksA.sub.ksT.sub.ds.sup.mC.sub.dsA.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.dsG.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.ksG.sub.ksA.sub.k  24.8 2203 2218 444 486101 .sup.mC.sub.ksA.sub.ksG.sub.ks.sup.mC.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.dsG.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsG.sub.dsA.sub.dsA.sub.dsA.sub.ksG.sub.ksA.sub.k  31.6 2386 2401 445 486102 .sup.mC.sub.ksT.sub.ks.sup.mC.sub.ksA.sub.dsG.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.dsG.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsG.sub.dsA.sub.ksA.sub.ksA.sub.k  35.1 2388 2403 446 486104 G.sub.ksT.sub.ks.sup.mC.sub.ksA.sub.dsG.sub.dsG.sub.dsG.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.ds.sup.mC.sub.ks.sup.mC.sub.ksT.sub.k  26.9 2396 2411 447 486105 .sup.mC.sub.ksG.sub.ksT.sub.ks.sup.mC.sub.dsA.sub.dsG.sub.dsG.sub.dsG.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.ks.sup.mC.sub.ks.sup.mC.sub.k  48.4 2397 2412 448 486110 T.sub.ksT.sub.ksT.sub.ksG.sub.ds.sup.mC.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.dsG.sub.dsA.sub.ksA.sub.ks.sup.mC.sub.k  31.6 2495 2510 449 486111 G.sub.ksA.sub.ksA.sub.ksA.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.ksT.sub.ksT.sub.k  31.9 2501 2516 450 486112 A.sub.ksA.sub.ksT.sub.ksT.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsG.sub.dsA.sub.dsG.sub.dsT.sub.dsA.sub.dsA.sub.ksG.sub.ks.sup.mC.sub.k  47.4 2565 2580 451 486115 G.sub.ks.sup.mC.sub.ksA.sub.ksA.sub.dsA.sub.dsT.sub.dsT.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsG.sub.dsA.sub.dsG.sub.ksT.sub.ksA.sub.k  20.8 2568 2583 452 486116 A.sub.ksG.sub.ks.sup.mC.sub.ksA.sub.dsA.sub.dsA.sub.dsT.sub.dsT.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsG.sub.dsA.sub.ksG.sub.ksT.sub.k  23.9 2569 2584 453 486117 A.sub.ksA.sub.ksG.sub.ks.sup.mC.sub.dsA.sub.dsA.sub.dsA.sub.dsT.sub.dsT.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsG.sub.ksA.sub.ksG.sub.k  22 2570 2585 454 486118 A.sub.ksA.sub.ksA.sub.ksG.sub.ds.sup.mC.sub.dsA.sub.dsA.sub.dsA.sub.dsT.sub.dsT.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.ksG.sub.ksA.sub.k  26.7 2571 2586 455 486119 A.sub.ksA.sub.ksA.sub.ksA.sub.dsG.sub.ds.sup.mC.sub.dsA.sub.dsA.sub.dsA.sub.dsT.sub.dsT.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.ks.sup.mC.sub.ksG.sub.k  33.5 2572 2587 456 486120 G.sub.ks.sup.mC.sub.ksA.sub.ksA.sub.dsA.sub.dsA.sub.dsG.sub.ds.sup.mC.sub.dsA.sub.dsA.sub.dsA.sub.dsT.sub.dsT.sub.dsT.sub.ks.sup.mC.sub.ks.sup.mC.sub.k  51.4 2574 2589 457 486121 G.sub.ksG.sub.ks.sup.mC.sub.ksA.sub.dsA.sub.dsA.sub.dsA.sub.dsG.sub.ds.sup.mC.sub.dsA.sub.dsA.sub.dsA.sub.dsT.sub.dsT.sub.ksT.sub.ks.sup.mC.sub.k  60.8 2575 2590 458 486123 T.sub.ksT.sub.ksG.sub.ksG.sub.ds.sup.mC.sub.dsA.sub.dsA.sub.dsA.sub.dsA.sub.dsG.sub.ds.sup.mC.sub.dsA.sub.dsA.sub.dsA.sub.ksT.sub.ksT.sub.k  39.8 2577 2592 459 486125 G.sub.ksT.sub.ksT.sub.ksT.sub.dsG.sub.dsG.sub.ds.sup.mC.sub.dsA.sub.dsA.sub.dsA.sub.dsA.sub.dsG.sub.ds.sup.mC.sub.dsA.sub.ksA.sub.ksA.sub.k  32.7 2579 2594 460 486126 G.sub.ksG.sub.ksT.sub.ksT.sub.dsT.sub.dsG.sub.dsG.sub.ds.sup.mC.sub.dsA.sub.dsA.sub.dsA.sub.dsA.sub.dsG.sub.ds.sup.mC.sub.ksA.sub.ksA.sub.k  19.2 2580 2595 461 486127 G.sub.ksG.sub.ksG.sub.ksT.sub.dsT.sub.dsT.sub.dsG.sub.dsG.sub.ds.sup.mC.sub.dsA.sub.dsA.sub.dsA.sub.dsA.sub.dsG.sub.ks.sup.mC.sub.ksA.sub.k  36.1 2581 2596 462 486128 G.sub.ks.sup.mC.sub.ksG.sub.ksG.sub.dsG.sub.dsT.sub.dsT.sub.dsT.sub.dsG.sub.dsG.sub.ds.sup.mC.sub.dsA.sub.dsA.sub.dsA.sub.ksA.sub.ksG.sub.k  39.1 2583 2598 463 486129 A.sub.ksG.sub.ks.sup.mC.sub.ksG.sub.dsG.sub.dsG.sub.dsT.sub.dsT.sub.dsT.sub.dsG.sub.dsG.sub.ds.sup.mC.sub.dsA.sub.dsA.sub.ksA.sub.ksA.sub.k  31.4 2584 2599 464 486130 A.sub.ksA.sub.ksG.sub.ks.sup.mC.sub.dsG.sub.dsG.sub.dsG.sub.dsT.sub.dsT.sub.dsT.sub.dsG.sub.dsG.sub.ds.sup.mC.sub.dsA.sub.ksA.sub.ksA.sub.k  35.7 2585 2600 465 486133 .sup.mC.sub.ksT.sub.ks.sup.mC.sub.ks.sup.mC.sub.dsG.sub.dsA.sub.dsG.sub.dsA.sub.dsG.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.ds.sup.mC.sub.dsG.sub.ks.sup.mC.sub.ksA.sub.k  45.9 2631 2646 466 486134 G.sub.ks.sup.mC.sub.ksT.sub.ks.sup.mC.sub.ds.sup.mC.sub.dsG.sub.dsA.sub.dsG.sub.dsA.sub.dsG.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.ds.sup.mC.sub.ksG.sub.ks.sup.mC.sub.k  29.5 2632 2647 467 486135 G.sub.ksG.sub.ks.sup.mC.sub.ksT.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsG.sub.dsA.sub.dsG.sub.dsA.sub.dsG.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.ks.sup.mC.sub.ksG.sub.k  51.4 2633 2648 468 486142 T.sub.ksA.sub.ksA.sub.ksA.sub.dsT.sub.dsA.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.dsA.sub.dsA.sub.ds.sup.mC.sub.ds.sup.mC.sub.ksG.sub.ks.sup.mC.sub.k  64.4 2671 2686 469 486147 G.sub.ksT.sub.ks.sup.mC.sub.ksA.sub.dsA.sub.dsT.sub.dsA.sub.dsA.sub.dsA.sub.dsT.sub.dsA.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.ksA.sub.ksA.sub.k  16.1 2676 2691 470 486148 A.sub.ksG.sub.ksG.sub.ksT.sub.ds.sup.mC.sub.dsA.sub.dsA.sub.dsT.sub.dsA.sub.dsA.sub.dsA.sub.dsT.sub.dsA.sub.dsT.sub.ks.sup.mC.sub.ks.sup.mC.sub.k  18.3 2678 2693 471 486149 .sup.mC.sub.ksG.sub.ksA.sub.ksG.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.dsA.sub.dsT.sub.dsA.sub.dsA.sub.dsA.sub.dsT.sub.ksA.sub.ksT.sub.k  37.9 2680 2695 472 486150 A.sub.ks.sup.mC.sub.ksG.sub.ksA.sub.dsG.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.dsA.sub.dsT.sub.dsA.sub.dsA.sub.dsA.sub.ksT.sub.ksA.sub.k  45.3 2681 2696 473 486151 G.sub.ksA.sub.ks.sup.mC.sub.ksG.sub.dsA.sub.dsG.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.dsA.sub.dsT.sub.dsA.sub.dsA.sub.ksA.sub.ksT.sub.k  52.2 2682 2697 474 486152 G.sub.ksG.sub.ksA.sub.ks.sup.mC.sub.dsG.sub.dsA.sub.dsG.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.dsA.sub.dsT.sub.dsA.sub.ksA.sub.ksA.sub.k  19.8 2683 2698 475 486153 A.sub.ksG.sub.ksG.sub.ksA.sub.ds.sup.mC.sub.dsG.sub.dsA.sub.dsG.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.dsA.sub.dsT.sub.ksA.sub.ksA.sub.k  19.9 2684 2699 476 486154 G.sub.ksA.sub.ksG.sub.ksG.sub.dsA.sub.ds.sup.mC.sub.dsG.sub.dsA.sub.dsG.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.dsA.sub.ksT.sub.ksA.sub.k  19.6 2685 2700 477 486155 G.sub.ksG.sub.ksA.sub.ksG.sub.dsG.sub.dsA.sub.ds.sup.mC.sub.dsG.sub.dsA.sub.dsG.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.ksA.sub.ksT.sub.k  38.3 2686 2701 478 486156 .sup.mC.sub.ksG.sub.ksG.sub.ksA.sub.dsG.sub.dsG.sub.dsA.sub.ds.sup.mC.sub.dsG.sub.dsA.sub.dsG.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.ksA.sub.ksA.sub.k  14.1 2687 2702 479 486157 T.sub.ks.sup.mC.sub.ksG.sub.ksG.sub.dsA.sub.dsG.sub.dsG.sub.dsA.sub.ds.sup.mC.sub.dsG.sub.dsA.sub.dsG.sub.dsG.sub.dsT.sub.ks.sup.mC.sub.ksA.sub.k  23.2 2688 2703 480 486158 G.sub.ksT.sub.ks.sup.mC.sub.ksG.sub.dsG.sub.dsA.sub.dsG.sub.dsG.sub.dsA.sub.ds.sup.mC.sub.dsG.sub.dsA.sub.dsG.sub.dsG.sub.ksT.sub.ks.sup.mC.sub.k  34.5 2689 2704 481 486159 A.sub.ksG.sub.ksT.sub.ks.sup.mC.sub.dsG.sub.dsG.sub.dsA.sub.dsG.sub.dsG.sub.dsA.sub.ds.sup.mC.sub.dsG.sub.dsA.sub.dsG.sub.ksG.sub.ksT.sub.k  23.7 2690 2705 482 486160 G.sub.ksA.sub.ksG.sub.ksT.sub.ds.sup.mC.sub.dsG.sub.dsG.sub.dsA.sub.dsG.sub.dsG.sub.dsA.sub.ds.sup.mC.sub.dsG.sub.dsA.sub.ksG.sub.ksG.sub.k  14.3 2691 2706 483 486161 .sup.mC.sub.ksG.sub.ksA.sub.ksG.sub.dsT.sub.ds.sup.mC.sub.dsG.sub.dsG.sub.dsA.sub.dsG.sub.dsG.sub.dsA.sub.ds.sup.mC.sub.dsG.sub.ksA.sub.ksG.sub.k  29 2692 2707 484 486162 A.sub.ksG.sub.ks.sup.mC.sub.ksG.sub.dsA.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.dsG.sub.dsG.sub.dsA.sub.dsG.sub.dsG.sub.dsA.sub.ks.sup.mC.sub.ksG.sub.k  20.6 2694 2709 485 486163 .sup.mC.sub.ksA.sub.ksG.sub.ks.sup.mC.sub.dsG.sub.dsA.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.dsG.sub.dsG.sub.dsA.sub.dsG.sub.dsG.sub.ksA.sub.ks.sup.mC.sub.k  29 2695 2710 486 486164 T.sub.ks.sup.mC.sub.ksA.sub.ksG.sub.ds.sup.mC.sub.dsG.sub.dsA.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.dsG.sub.dsG.sub.dsA.sub.dsG.sub.ksG.sub.ksA.sub.k  17 2696 2711 487 486165 G.sub.ksT.sub.ks.sup.mC.sub.ksA.sub.dsG.sub.ds.sup.mC.sub.dsG.sub.dsA.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.dsG.sub.dsG.sub.dsA.sub.ksG.sub.ksG.sub.k  14.2 2697 2712 426 486166 T.sub.ksG.sub.ksT.sub.ks.sup.mC.sub.dsA.sub.dsG.sub.ds.sup.mC.sub.dsG.sub.dsA.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.dsG.sub.dsG.sub.ksA.sub.ksG.sub.k  25.1 2698 2713 488 486167 .sup.mC.sub.ksT.sub.ksG.sub.ksT.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.ds.sup.mC.sub.dsG.sub.dsA.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.dsG.sub.ksG.sub.ksA.sub.k  15 2699 2714 489 486168 .sup.mC.sub.ks.sup.mC.sub.ksT.sub.ksG.sub.dsT.sub.ds.sup.mG.sub.dsA.sub.dsG.sub.ds.sup.mC.sub.dsG.sub.dsA.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.ksG.sub.ksG.sub.k  12.4 2700 2715 427 486169 G.sub.ks.sup.mC.sub.ks.sup.mC.sub.ksT.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.ds.sup.mC.sub.dsG.sub.dsA.sub.dsG.sub.dsT.sub.ks.sup.mC.sub.ksG.sub.k  24.5 2701 2716 428 486170 A.sub.ksG.sub.ks.sup.mC.sub.ks.sup.mC.sub.dsT.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.ds.sup.mC.sub.dsG.sub.dsA.sub.dsG.sub.ksT.sub.ks.sup.mC.sub.k  16.3 2702 2717 429 486171 .sup.mC.sub.ksA.sub.ksG.sub.ksT.sub.dsG.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.dsA.sub.dsA.sub.dsA.sub.ks.sup.mC.sub.ksG.sub.k  31.8 2744 2759 490 486172 T.sub.ks.sup.mC.sub.ksA.sub.ksG.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.dsA.sub.dsA.sub.ksA.sub.ks.sup.mC.sub.k  23.1 2745 2760 491 486173 .sup.mG.sub.ksT.sub.ks.sup.mC.sub.ksA.sub.dsG.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.dsA.sub.ksA.sub.ksA.sub.k  23 2746 2761 492 486174 T.sub.ks.sup.mC.sub.ksT.sub.ks.sup.mC.sub.dsA.sub.dsG.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.ksA.sub.ksA.sub.k  50.9 2747 2762 493 486175 G.sub.ksT.sub.ks.sup.mC.sub.ksT.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.ksA.sub.ksA.sub.k  17.2 2748 2763 494 486176 G.sub.ksG.sub.ksG.sub.ksT.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mG.sub.dsA.sub.dsG.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.ks.sup.mC.sub.ks.sup.mC.sub.k  37.6 2750 2765 430 486177 .sup.mC.sub.ksA.sub.ksA.sub.ksT.sub.dsA.sub.dsA.sub.dsA.sub.dsT.sub.dsA.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsG.sub.dsA.sub.dsG.sub.ksG.sub.ksA.sub.k  40 2772 2787 495 486178 A.sub.ks.sup.mC.sub.ksA.sub.ksA.sub.dsT.sub.dsA.sub.dsA.sub.dsA.sub.dsT.sub.dsA.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsG.sub.dsA.sub.ksG.sub.ksG.sub.k  11.3 2773 2788  23 486179 A.sub.ksG.sub.ksA.sub.ks.sup.mC.sub.dsA.sub.dsA.sub.dsT.sub.dsA.sub.dsA.sub.dsA.sub.dsT.sub.dsA.sub.ds.sup.mC.sub.ds.sup.mC.sub.ksG.sub.ksA.sub.k  13.5 2775 2790 496 486180 .sup.mC.sub.ksA.sub.ksG.sub.ksA.sub.ds.sup.mC.sub.dsA.sub.dsA.sub.dsT.sub.dsA.sub.dsA.sub.dsA.sub.dsT.sub.dsA.sub.ds.sup.mC.sub.ks.sup.mC.sub.ksG.sub.k  18.6 2776 2791 497

Example 9: ASOs Designed to Target a Human DMPK RNA Transcript

[0683] A series of antisense oligonucleotides (ASOs) were designed to target hDMPK. The newly designed ASOs were prepared using standard oligonucleotide synthesis well known in the art and are described in Table 13 to 18, below. Subscripts “s” indicate phosphorothioate internucleoside linkages; subscripts “k” indicate 6′-(S)—CH.sub.3 bicyclic nucleosides (cEt); subscripts “e” indicate 2′-methoxyethyl (MOE) modified nucleosides; and subscripts “d” indicate β-D-2′-deoxyribonucleosides. “.sup.mC” indicates 5-methylcytosine nucleosides.

[0684] The antisense oligonucleotides targeted to a human DMPK nucleic acid were tested for their effect on DMPK RNA transcript in vitro. Cultured HepG2 cells at a density of 20,000 cells per well were transfected using electroporation with 4,500 nM antisense oligonucleotide. After approximately 24 hours, RNA was isolated from the cells and DMPK transcript levels were measured by quantitative real-time PCR. DMPK RNA transcript levels were adjusted according to total RNA content, as measured by RIBOGREEN®. Results are presented as percent expression of DMPK, relative to untreated control cells, with “% Target Expression” representing the percent expression of DMPK relative to untreated control cells

[0685] All the antisense oligonucleotides listed in Table 13 target SEQ TD NO: 1 (GENBANK Accession No. NM_001081560.1). All the antisense oligonucleotides listed in Table 14 to 18 target SEQ ID NO: 2 (the complement of GENBANK Accession No. NT_011109.15 truncated from nucleotides 18540696 to 18555106). ‘Target start site’ indicates the 5′-most nucleoside to which the antisense oligonucleotide is targeted in the human genomic gene sequence. ‘Target stop site’ indicates the 3′-most nucleoside to which the antisense oligonucleotide is targeted in the human genomic sequence.

TABLE-US-00013 TABLE 13 Inhibition of human DMPK RNA transcript in HepG2 cells targeting SEQ ID NO: 1 Start Stop Site Site Seq ISIS % Target on Seq on Seq ID No. Sequence Expression ID: 1 ID: 1 No. UTC N/A 100 N/A N/A 445569 .sup.mC.sub.esG.sub.esG.sub.esA.sub.esG.sub.es.sup.mC.sub.dsG.sub.dsG.sub.dsT.sub.dsT.sub.dsG.sub.dsT.sub.dsG.sub.dsA.sub.dsA.sub.ds.sup.mC.sub.es  36.7 2163 2182  24 T.sub.esG.sub.esG.sub.es.sup.mC.sub.e 486178 A.sub.ks.sup.mC.sub.ksA.sub.ksA.sub.dsT.sub.dsA.sub.dsA.sub.dsA.sub.dsT.sub.dsA.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsG.sub.dsA.sub.ksG.sub.ksG.sub.k  21.3 2773 2788  23 569403 .sup.mC.sub.ksA.sub.ks.sup.mC.sub.ksG.sub.dsG.sub.dsA.sub.dsA.sub.dsG.sub.ds.sup.mC.sub.dsA.sub.ds.sup.mC.sub.dsG.sub.dsA.sub.ds.sup.mC.sub.ksA.sub.ks.sup.mC.sub.k  18.8  542  557 498 569404 T.sub.ks.sup.mC.sub.ksA.sub.ks.sup.mC.sub.dsG.sub.dsG.sub.dsA.sub.dsA.sub.dsG.sub.ds.sup.mC.sub.dsA.sub.ds.sup.mC.sub.dsG.sub.dsA.sub.ks.sup.mC.sub.ksA.sub.k  25.2  543  558 499 569405 .sup.mC.sub.ksT.sub.ks.sup.mC.sub.ksA.sub.ds.sup.mC.sub.dsG.sub.dsG.sub.dsA.sub.dsA.sub.dsG.sub.ds.sup.mC.sub.dsA.sub.ds.sup.mC.sub.dsG.sub.ksA.sub.ks.sup.mC.sub.k  21.2  544  559 500 569406 .sup.mC.sub.ks.sup.mC.sub.ksT.sub.ks.sup.mC.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.ds.sup.mC.sub.dsG.sub.dsG.sub.dsA.sub.ksA.sub.ksG.sub.k  27.9  550  565 343 569407 G.sub.ksT.sub.ks.sup.mC.sub.ks.sup.mC.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.ds.sup.mC.sub.ksG.sub.ksG.sub.k  30.9  553  568 501 569408 .sup.mC.sub.ksG.sub.ksT.sub.ks.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.ks.sup.mC.sub.ksG.sub.k  32.8  554  569 502 569409 .sup.mC.sub.ks.sup.mC.sub.ks.sup.mC.sub.ksA.sub.dsT.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.dsA.sub.ds.sup.mC.sub.dsA.sub.ks.sup.mC.sub.ksG.sub.k  33  568  583 503 569410 .sup.mC.sub.ks.sup.mC.sub.ks.sup.mC.sub.ks.sup.mC.sub.dsA.sub.dsT.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.dsA.sub.ds.sup.mC.sub.ksA.sub.ks.sup.mC.sub.k  42.1  569  584 504 569411 T.sub.ks.sup.mC.sub.ks.sup.mC.sub.ks.sup.mC.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.dsA.sub.ks.sup.mC.sub.ksA.sub.k  68.6  570  585 505 569412 G.sub.ksT.sub.ks.sup.mC.sub.ks.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.ksA.sub.ks.sup.mC.sub.k  60.7  571  586 506 569413 G.sub.ksG.sub.ksT.sub.ks.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.ds.sup.mC.sub.ds.sup.mC.sub.ksA.sub.ksA.sub.k  65.1  572  587 507 569414 .sup.mC.sub.ksG.sub.ksG.sub.ksT.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.ds.sup.mC.sub.ks.sup.mC.sub.ksA.sub.k  54.4  573  588 508 569415 .sup.mC.sub.ks.sup.mC.sub.ksG.sub.ksG.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.ks.sup.mC.sub.ks.sup.mC.sub.k  51.3  574  589 509 569416 G.sub.ks.sup.mC.sub.ks.sup.mC.sub.ksG.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.dsT.sub.ds.sup.mC.sub.ksA.sub.ks.sup.mC.sub.k  57.9  575  590 510 569417 .sup.mC.sub.ksG.sub.ks.sup.mC.sub.ks.sup.mC.sub.dsG.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.dsT.sub.ks.sup.mC.sub.ksA.sub.k  43.2  576  591 511 569418 .sup.mC.sub.ks.sup.mC.sub.ksG.sub.ks.sup.mC.sub.ds.sup.mC.sub.dsG.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.ksT.sub.ks.sup.mC.sub.k  79.3  577  592 512 569419 A.sub.ks.sup.mC.sub.ks.sup.mC.sub.ksG.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsG.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.ksT.sub.ksT.sub.k  36  578  593 513 569420 .sup.mC.sub.ksA.sub.ks.sup.mC.sub.ks.sup.mC.sub.dsG.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsG.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.ksA.sub.ksT.sub.k  36.2  579  594 514 569421 .sup.mC.sub.ks.sup.mC.sub.ksA.sub.ks.sup.mC.sub.ds.sup.mC.sub.dsG.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsG.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.ks.sup.mC.sub.ksA.sub.k  34.7  580  595 515 569422 T.sub.ks.sup.mC.sub.ks.sup.mC.sub.ksA.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsG.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsG.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.ks.sup.mC.sub.ks.sup.mC.sub.k  40  581  596 516 569423 A.sub.ksT.sub.ks.sup.mC.sub.ks.sup.mC.sub.dsA.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsG.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsG.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.ks.sup.mC.sub.ks.sup.mC.sub.k  31.6  582  597 517 569424 G.sub.ksA.sub.ksT.sub.ks.sup.mC.sub.ds.sup.mC.sub.dsA.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsG.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsG.sub.dsG.sub.dsT.sub.ks.sup.mC.sub.ks.sup.mC.sub.k  56  583  598 518 569425 T.sub.ksG.sub.ksA.sub.ksT.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsG.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsG.sub.dsG.sub.ksT.sub.ks.sup.mC.sub.k  53.9  584  599 519 569426 G.sub.ksT.sub.ksG.sub.ksA.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsG.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsG.sub.ksG.sub.ksT.sub.k  54.1  585  600 520 569427 .sup.mC.sub.ksG.sub.ksT.sub.ksG.sub.dsA.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsG.sub.ds.sup.mC.sub.ds.sup.mC.sub.ksG.sub.ksG.sub.k  34.8  586  601 521 569428 .sup.mC.sub.ksA.sub.ksT.sub.ks.sup.mC.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.dsG.sub.dsA.sub.dsA.sub.dsG.sub.dsG.sub.ds.sup.mC.sub.dsG.sub.ksA.sub.ksA.sub.k  71  611  626 522 569429 T.sub.ks.sup.mC.sub.ksA.sub.ksT.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.dsG.sub.dsA.sub.dsA.sub.dsG.sub.dsG.sub.ds.sup.mC.sub.ksG.sub.ksA.sub.k  51.1  612  627 523 569430 A.sub.ksG.sub.ksT.sub.ksT.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.dsG.sub.ksA.sub.ksA.sub.k  69.2  617  632 524 569431 T.sub.ksA.sub.ksG.sub.ksT.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.ksG.sub.ksA.sub.k  48.6  618  633 525 569432 G.sub.ksT.sub.ksA.sub.ksG.sub.dsT.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.ksG.sub.ksG.sub.k  29.6  619  634 526 569433 .sup.mC.sub.ksA.sub.ksG.sub.ksG.sub.dsT.sub.dsA.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.dsG.sub.dsT.sub.dsA.sub.dsG.sub.dsT.sub.ksT.sub.ks.sup.mC.sub.k  36.5  628  643 527 569434 .sup.mC.sub.ks.sup.mC.sub.ksA.sub.ksG.sub.dsG.sub.dsT.sub.dsA.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.dsG.sub.dsT.sub.dsA.sub.dsG.sub.ksT.sub.ksT.sub.k  51  629  644 528 569435 G.sub.ksA.sub.ks.sup.mC.sub.ks.sup.mC.sub.dsA.sub.dsG.sub.dsG.sub.dsT.sub.dsA.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.dsG.sub.dsT.sub.ksA.sub.ksG.sub.k  49.9  631  646 529 569436 .sup.mC.sub.ksT.sub.ks.sup.mC.sub.ks.sup.mC.sub.dsA.sub.dsT.sub.dsG.sub.dsA.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.dsG.sub.dsT.sub.ksA.sub.ks.sup.mC.sub.k  41  637  652 530 569437 A.sub.ks.sup.mC.sub.ksT.sub.ks.sup.mC.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.dsG.sub.dsA.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.dsG.sub.ksT.sub.ksA.sub.k  32.9  638  653 531 569438 T.sub.ksA.sub.ks.sup.mC.sub.ksT.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.dsG.sub.dsA.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.ksG.sub.ksT.sub.k  25.7  639  654 532 569439 A.sub.ksT.sub.ksA.sub.ks.sup.mC.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.dsG.sub.dsA.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.ksG.sub.ksG.sub.k  9.4  640  655 533 569440 A.sub.ksA.sub.ksTA.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.dsG.sub.dsA.sub.ds.sup.mC.sub.ds.sup.mC.sub.ksA.sub.ksG.sub.k  21.2  641  656 534 569441 T.sub.ksA.sub.ksA.sub.ksT.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.dsG.sub.dsA.sub.ds.sup.mC.sub.ks.sup.mC.sub.ksA.sub.k  30.8  642  657 535 569442 G.sub.ksT.sub.ksA.sub.ksA.sub.dsT.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.dsG.sub.dsA.sub.ks.sup.mC.sub.ks.sup.mC.sub.k  29.8  643  658 536 569443 .sup.mC.sub.ksG.sub.ksT.sub.ksA.sub.dsA.sub.dsT.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.dsG.sub.ksA.sub.ks.sup.mC.sub.k  25.3  644  659 537 569444 .sup.mC.sub.ksT.sub.ksT.sub.ksG.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.dsT.sub.dsG.sub.ksT.sub.ks.sup.mC.sub.k  19.3  676  691 538 569445 A.sub.ks.sup.mC.sub.ksT.sub.ksT.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.dsT.sub.ksG.sub.ksT.sub.k  35  677  692 539 569446 A.sub.ksA.sub.ks.sup.mC.sub.ksT.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.ksT.sub.ksG.sub.k  30  678  693 540 569447 A.sub.ksA.sub.ksA.sub.ks.sup.mC.sub.dsT.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.ds.sup.mC.sub.dsA.sub.ksG.sub.ksT.sub.k  32.2  679  694 344 569448 .sup.mC.sub.ks.sup.mC.sub.ksA.sub.ksA.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.ks.sup.mC.sub.ksA.sub.k  30.1  681  696 346 569449 .sup.mC.sub.ks.sup.mC.sub.ks.sup.mC.sub.ksA.sub.dsA.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.ksG.sub.ks.sup.mC.sub.k  18.4  682  697 347 569450 .sup.mC.sub.ks.sup.mC.sub.ks.sup.mC.sub.ks.sup.mC.sub.dsA.sub.dsA.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.ksA.sub.ksG.sub.k  44.8  683  698 348 569451 G.sub.ks.sup.mC.sub.ksT.sub.ks.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.dsA.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.dsG.sub.ks.sup.mC.sub.ksT.sub.k  47  686  701 541 569452 .sup.mC.sub.ksG.sub.ks.sup.mC.sub.ksT.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.dsA.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.ksG.sub.ks.sup.mC.sub.k  35.4  687  702 542 569453 .sup.mC.sub.ks.sup.mC.sub.ksG.sub.ks.sup.mC.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.dsA.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.ksT.sub.ksG.sub.k  46.6  688  703 543 569454 T.sub.ks.sup.mC.sub.ks.sup.mC.sub.ksG.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.dsA.sub.dsA.sub.ds.sup.mC.sub.ksT.sub.ksT.sub.k  29.4  689  704 544 569455 A.sub.ksT.sub.ks.sup.mC.sub.ks.sup.mC.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.dsA.sub.dsA.sub.ks.sup.mC.sub.ksT.sub.k  36.9  690  705 545 569456 A.sub.ksA.sub.ksT.sub.ks.sup.mC.sub.ds.sup.mC.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.dsA.sub.ksA.sub.ks.sup.mC.sub.k  32.9  691  706 546 569457 G.sub.ksA.sub.ksA.sub.ksT.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.ksA.sub.ksA.sub.k  41.7  692  707 547 569458 G.sub.ksG.sub.ksA.sub.ksA.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.ksA.sub.ksA.sub.k  36.4  693  708 548 569459 .sup.mC.sub.ksG.sub.ksG.sub.ksA.sub.dsA.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.ks.sup.mC.sub.ksA.sub.k  30  694  709 549 569460 .sup.mC.sub.ks.sup.mC.sub.ksG.sub.ksG.sub.dsA.sub.dsA.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.ks.sup.mC.sub.ks.sup.mC.sub.k  26.5  695  710 550 569461 G.sub.ks.sup.mC.sub.ks.sup.mC.sub.ksG.sub.dsG.sub.dsA.sub.dsA.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.ks.sup.mC.sub.ks.sup.mC.sub.k  36.5  696  711 551 569462 A.sub.ksG.sub.ksA.sub.ksA.sub.dsG.sub.ds.sup.mC.sub.dsG.sub.ds.sup.mC.sub.dsG.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.ds.sup.mC.sub.ksT.sub.ks.sup.mC.sub.k  26  713  728 552 569463 T.sub.ksA.sub.ksG.sub.ksA.sub.dsA.sub.dsG.sub.ds.sup.mC.sub.dsG.sub.ds.sup.mC.sub.dsG.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.ks.sup.mC.sub.ksT.sub.k  40.3  714  729 553 569464 G.sub.ksT.sub.ksA.sub.ksG.sub.dsA.sub.dsA.sub.dsG.sub.ds.sup.mC.sub.dsG.sub.ds.sup.mC.sub.dsG.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.ksT.sub.ks.sup.mC.sub.k  28.9  715  730 554 569465 G.sub.ksG.sub.ksT.sub.ksA.sub.dsG.sub.dsA.sub.dsA.sub.dsG.sub.ds.sup.mC.sub.dsG.sub.ds.sup.mC.sub.dsG.sub.ds.sup.mC.sub.ds.sup.mC.sub.ksA.sub.ksT.sub.k  35.7  716  731 555 569466 A.sub.ksG.sub.ksG.sub.ksT.sub.dsA.sub.dsG.sub.dsA.sub.dsA.sub.dsG.sub.ds.sup.mC.sub.dsG.sub.ds.sup.mC.sub.dsG.sub.ds.sup.mC.sub.ks.sup.mC.sub.ksA.sub.k  31.1  717  732 556 569467 .sup.mC.sub.ksA.sub.ksG.sub.ksG.sub.dsT.sub.dsA.sub.dsG.sub.dsA.sub.dsA.sub.dsG.sub.ds.sup.mC.sub.dsG.sub.ds.sup.mC.sub.dsG.sub.ks.sup.mC.sub.ks.sup.mC.sub.k  14.8  718  733 557 569468 .sup.mC.sub.ks.sup.mC.sub.ksA.sub.ksG.sub.dsG.sub.dsT.sub.dsA.sub.dsG.sub.dsA.sub.dsA.sub.dsG.sub.ds.sup.mC.sub.dsG.sub.ds.sup.mC.sub.ksG.sub.ks.sup.mC.sub.k  32.1  719  734 558 569469 G.sub.ks.sup.mC.sub.ks.sup.mC.sub.ksA.sub.dsG.sub.dsG.sub.dsT.sub.dsA.sub.dsG.sub.dsA.sub.dsA.sub.dsG.sub.ds.sup.mC.sub.dsG.sub.ks.sup.mC.sub.ksG.sub.k  54.5  720  735 559 569470 .sup.mC.sub.ksG.sub.ks.sup.mC.sub.ks.sup.mC.sub.dsA.sub.dsG.sub.dsG.sub.dsT.sub.dsA.sub.dsG.sub.dsA.sub.dsA.sub.dsG.sub.ds.sup.mC.sub.ksG.sub.ks.sup.mC.sub.k  50.5  721  736 560 569471 .sup.mC.sub.ks.sup.mC.sub.ksG.sub.ks.sup.mC.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.dsG.sub.dsT.sub.dsA.sub.dsG.sub.dsA.sub.dsA.sub.dsG.sub.ks.sup.mC.sub.ksG.sub.k  56.6  722  737 561 569472 T.sub.ks.sup.mC.sub.ks.sup.mC.sub.ksG.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.dsG.sub.dsT.sub.dsA.sub.dsG.sub.dsA.sub.dsA.sub.ksG.sub.ks.sup.mC.sub.k  44.1  723  738 562 569473 G.sub.ksA.sub.ks.sup.mC.sub.ksA.sub.dsA.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsG.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.ksG.sub.ksG.sub.k  14.2  730  745  29 569474 T.sub.ksG.sub.ksA.sub.ks.sup.mC.sub.dsA.sub.dsA.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsG.sub.ds.sup.mC.sub.ds.sup.mC.sub.ksA.sub.ksG.sub.k  25.9  731  746 563 569475 A.sub.ksT.sub.ksG.sub.ksA.sub.ds.sup.mC.sub.dsA.sub.dsA.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsG.sub.ds.sup.mC.sub.ks.sup.mC.sub.ksA.sub.k  28.7  732  747 564 569476 .sup.mC.sub.ksA.sub.ksT.sub.ksG.sub.dsA.sub.ds.sup.mC.sub.dsA.sub.dsA.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsG.sub.ks.sup.mC.sub.ks.sup.mC.sub.k  27.4  733  748 565 569477 .sup.mC.sub.ks.sup.mC.sub.ksA.sub.ksT.sub.dsG.sub.dsA.sub.ds.sup.mC.sub.dsA.sub.dsA.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.ksG.sub.ks.sup.mC.sub.k  52.4  734  749 566 569478 G.sub.ks.sup.mC.sub.ks.sup.mC.sub.ksA.sub.dsT.sub.dsG.sub.dsA.sub.ds.sup.mC.sub.dsA.sub.dsA.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.ks.sup.mC.sub.ksG.sub.k  50.5  735  750 567 569479 G.sub.ksG.sub.ks.sup.mC.sub.ks.sup.mC.sub.dsA.sub.dsT.sub.dsG.sub.dsA.sub.ds.sup.mC.sub.dsA.sub.dsA.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.ks.sup.mC.sub.ks.sup.mC.sub.k  48.4  736  751 568

TABLE-US-00014 TABLE 14 Inhibition of human DMPK RNA transcript in HepG2 cells targeting SEQ ID NO: 2 Start Stop Site Site Seq ISIS % Target on Seq on Seq ID No. Sequence Expression ID: 2 ID: 2 No. UTC N/A 100 N/A N/A 445569 .sup.mC.sub.esG.sub.esG.sub.esA.sub.esG.sub.es.sup.mC.sub.dsG.sub.dsG.sub.dsT.sub.dsT.sub.dsG.sub.dsT.sub.dsG.sub.dsA.sub.dsA.sub.ds  31.4 13226 13245  24 .sup.mC.sub.esT.sub.esG.sub.esG.sub.es.sup.mC.sub.e 486178 A.sub.ks.sup.mC.sub.ksA.sub.ksA.sub.dsT.sub.dsA.sub.dsA.sub.dsA.sub.dsT.sub.dsA.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsG.sub.dsA.sub.ksG.sub.ksG.sub.k  25.3 13836 13851  23 570801 .sup.mC.sub.ks.sup.mC.sub.ksA.sub.ksA.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.dsT.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.ksA.sub.ksG.sub.k  22.7 10165 10180 569 570802 A.sub.ksA.sub.ks.sup.mC.sub.ks.sup.mC.sub.dsA.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.dsT.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.ksT.sub.ksT.sub.k  22.6 10167 10182 570 570803 .sup.mC.sub.ks.sup.mC.sub.ksA.sub.ksG.sub.dsT.sub.dsA.sub.dsA.sub.dsT.sub.dsA.sub.dsA.sub.dsA.sub.dsA.sub.dsG.sub.ds.sup.mC.sub.ksT.sub.ksG.sub.k  37.4 10190 10205 571 570804 G.sub.ksT.sub.ks.sup.mC.sub.ks.sup.mC.sub.dsA.sub.dsG.sub.dsT.sub.dsA.sub.dsA.sub.dsT.sub.dsA.sub.dsA.sub.dsA.sub.dsA.sub.ksG.sub.ks.sup.mC.sub.k  24.9 10192 10207 572 570805 G.sub.ksT.sub.ksT.sub.ksG.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.dsT.sub.dsA.sub.dsA.sub.dsT.sub.dsA.sub.ksA.sub.ksA.sub.k  23.8 10195 10210 573 570806 A.sub.ksT.sub.ksG.sub.ksT.sub.dsT.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.dsT.sub.dsA.sub.dsA.sub.ksT.sub.ksA.sub.k  21.9 10197 10212 574 570807 T.sub.ksA.sub.ksA.sub.ksT.sub.dsG.sub.dsT.sub.dsT.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.dsT.sub.ksA.sub.ksA.sub.k  20 10199 10214 575 570808 T.sub.ksG.sub.ksT.sub.ksA.sub.dsA.sub.dsT.sub.dsG.sub.dsT.sub.dsT.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.ksG.sub.ksT.sub.k  11.5 10201 10216  31 570809 T.sub.ksT.sub.ks.sup.mC.sub.ksA.sub.dsA.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.dsA.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.ksA.sub.ks.sup.mC.sub.k  34.7 10279 10294 576 570810 G.sub.ksG.sub.ksT.sub.ksT.sub.ds.sup.mC.sub.dsA.sub.dsA.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.dsA.sub.ds.sup.mC.sub.ks.sup.mC.sub.ks.sup.mC.sub.k  76.4 10281 10296 577 570811 T.sub.ksG.sub.ksG.sub.ksG.sub.dsT.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.dsA.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.ksA.sub.ks.sup.mC.sub.k  72.4 10283 10298 578 570812 G.sub.ksA.sub.ksT.sub.ksG.sub.dsG.sub.dsG.sub.dsT.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.dsA.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.ksT.sub.ksG.sub.k  49 10285 10300 579 570813 A.sub.ksG.sub.ksG.sub.ksA.sub.dsT.sub.dsG.sub.dsG.sub.dsG.sub.dsT.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.dsA.sub.dsT.sub.ks.sup.mC.sub.ks.sup.mC.sub.k  80.8 10287 10302 580 570814 A.sub.ksG.sub.ksA.sub.ksG.sub.dsG.sub.dsA.sub.dsT.sub.dsG.sub.dsG.sub.dsG.sub.dsT.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.ksA.sub.ksT.sub.k  43.3 10289 10304 581 570815 A.sub.ksT.sub.ksA.sub.ksG.sub.dsA.sub.dsG.sub.dsG.sub.dsA.sub.dsT.sub.dsG.sub.dsG.sub.dsG.sub.dsT.sub.dsT.sub.ks.sup.mC.sub.ksA.sub.k  63.2 10291 10306 582 570816 .sup.mC.sub.ks.sup.mC.sub.ks.sup.mC.sub.ksT.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.dsT.sub.dsG.sub.dsG.sub.dsG.sub.dsA.sub.dsA.sub.ks.sup.mC.sub.ksA.sub.k  38.8 10349 10364 583 570817 G.sub.ksT.sub.ks.sup.mC.sub.ks.sup.mC.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.dsT.sub.dsG.sub.dsG.sub.dsG.sub.ksA.sub.ksA.sub.k  91 10351 10366 584 570818 .sup.mC.sub.ksA.sub.ksG.sub.ksT.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.dsT.sub.dsG.sub.ksG.sub.ksG.sub.k  64.8 10353 10368 585 570819 A.sub.ksG.sub.ks.sup.mC.sub.ksA.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.ksT.sub.ksG.sub.k  28.5 10355 10370 586 570820 A.sub.ks.sup.mC.sub.ksT.sub.ks.sup.mC.sub.dsA.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.dsT.sub.dsG.sub.dsG.sub.dsG.sub.dsA.sub.ksA.sub.ksG.sub.k  62.9 10417 10432 587 570821 .sup.mC.sub.ks.sup.mC.sub.ks.sup.mC.sub.ksA.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.dsT.sub.dsG.sub.ksG.sub.ksG.sub.k  79.9 10420 10435 588 570822 A.sub.ks.sup.mC.sub.ks.sup.mC.sub.ks.sup.mC.sub.ds.sup.mC.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.ksT.sub.ksG.sub.k  47.5 10422 10437 589 570823 A.sub.ks.sup.mC.sub.ksA.sub.ks.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.ds.sup.mC.sub.ksT.sub.ksG.sub.k  78.1 10424 10439 590 570824 G.sub.ks.sup.mC.sub.ksA.sub.ks.sup.mC.sub.dsA.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.ksG.sub.ks.sup.mC.sub.k  82.5 10426 10441 591 570825 T.sub.ks.sup.mC.sub.ksA.sub.ksG.sub.ds.sup.mC.sub.dsA.sub.ds.sup.mC.sub.dsA.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.ds.sup.mC.sub.ksT.sub.ks.sup.mC.sub.k  52.6 10429 10444 592 570826 G.sub.ksT.sub.ksG.sub.ksG.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.dsA.sub.dsA.sub.dsG.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.ksG.sub.ksG.sub.k  30.9 10474 10489 593 570827 G.sub.ksA.sub.ksT.sub.ksG.sub.dsT.sub.dsG.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.dsA.sub.dsA.sub.dsG.sub.ksA.sub.ks.sup.mC.sub.k  25.5 10477 10492 594 570828 .sup.mC.sub.ksA.sub.ksG.sub.ksA.sub.dsT.sub.dsG.sub.dsT.sub.dsG.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.dsA.sub.ksA.sub.ksG.sub.k  18.6 10479 10494 595 570829 .sup.mC.sub.ks.sup.mC.sub.ksT.sub.ks.sup.mC.sub.ds.sup.mC.sub.dsA.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.dsA.sub.dsT.sub.dsG.sub.dsT.sub.dsG.sub.ksG.sub.ksT.sub.k  44.5 10485 10500 596 570830 .sup.mC.sub.ksA.sub.ks.sup.mC.sub.ks.sup.mC.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.dsA.sub.dsT.sub.dsG.sub.ksT.sub.ksG.sub.k  67.4 10487 10502 597 570831 G.sub.ksG.sub.ks.sup.mC.sub.ks.sup.mC.sub.dsA.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.ksA.sub.ksT.sub.k  56.3 10490 10505 598 570832 T.sub.ksG.sub.ks.sup.mC.sub.ksT.sub.dsT.sub.dsG.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.dsG.sub.ds.sup.mC.sub.ks.sup.mC.sub.ksA.sub.k  42.4 10501 10516 599 570833 A.sub.ks.sup.mC.sub.ksT.sub.ksG.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.dsG.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.ksG.sub.ks.sup.mC.sub.k  16 10503 10518 600 570834 A.sub.ksG.sub.ksA.sub.ks.sup.mC.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.dsG.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.ksT.sub.ksG.sub.k  47.5 10505 10520 601 570835 G.sub.ksG.sub.ksA.sub.ksG.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.dsG.sub.dsG.sub.ds.sup.mC.sub.ksT.sub.ks.sup.mC.sub.k  37.2 10507 10522 602 570836 T.sub.ksG.sub.ks.sup.mC.sub.ksA.sub.dsG.sub.dsA.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.ks.sup.mC.sub.ksT.sub.k  63.1 10556 10571 603 570837 .sup.mC.sub.ksT.sub.ks.sup.mC.sub.ks.sup.mC.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.dsG.sub.dsA.sub.ds.sup.mC.sub.dsA.sub.ksT.sub.ksG.sub.k  60.7 10579 10594 604 570838 .sup.mC.sub.ks.sup.mC.sub.ksA.sub.ksG.sub.dsA.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.dsG.sub.dsT.sub.ksT.sub.ks.sup.mC.sub.k  42.9 10609 10624 605 570839 G.sub.ksT.sub.ks.sup.mC.sub.ks.sup.mC.sub.dsA.sub.dsG.sub.dsA.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.ksG.sub.ksT.sub.k  64.3 10611 10626 606 570840 G.sub.ksG.sub.ksG.sub.ksT.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.dsA.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.ksA.sub.ksT.sub.k  68.5 10613 10628 607 570841 A.sub.ks.sup.mC.sub.ks.sup.mC.sub.ksT.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.dsG.sub.dsG.sub.dsA.sub.ks.sup.mC.sub.ksT.sub.k  14.9 10631 10646 608 570842 T.sub.ksA.sub.ksA.sub.ksA.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.ksG.sub.ksG.sub.k  51.7 10634 10649 609 570843 G.sub.ksA.sub.ksA.sub.ksA.sub.dsA.sub.dsG.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.ks.sup.mC.sub.ksT.sub.k  46.3 10684 10699 610 570844 T.sub.ksA.sub.ksG.sub.ksG.sub.dsA.sub.dsA.sub.dsA.sub.dsA.sub.dsG.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.ks.sup.mC.sub.ks.sup.mC.sub.k  52.3 10687 10702 611 570845 .sup.mC.sub.ksT.sub.ksT.sub.ksA.sub.dsG.sub.dsG.sub.dsA.sub.dsA.sub.dsA.sub.dsA.sub.dsG.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.ksT.sub.ksG.sub.k  53.8 10689 10704 612 570846 T.sub.ksG.sub.ks.sup.mC.sub.ksT.sub.dsT.sub.dsA.sub.dsG.sub.dsG.sub.dsA.sub.dsA.sub.dsA.sub.dsA.sub.dsG.sub.ds.sup.mC.sub.ks.sup.mC.sub.ks.sup.mC.sub.k  47.8 10691 10706 613 570847 T.sub.ks.sup.mC.sub.ksT.sub.ksG.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.dsA.sub.dsG.sub.dsG.sub.dsA.sub.dsA.sub.dsA.sub.dsA.sub.ksG.sub.ks.sup.mC.sub.k  43.9 10693 10708 614 570848 .sup.mC.sub.ksT.sub.ks.sup.mC.sub.ks.sup.mC.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.dsA.sub.dsG.sub.dsG.sub.ksA.sub.ksA.sub.k  67.9 10697 10712 615 570849 .sup.mC.sub.ks.sup.mC.sub.ks.sup.mC.sub.ksT.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.dsA.sub.ksG.sub.ksG.sub.k  50.8 10699 10714 616 570850 .sup.mC.sub.ksT.sub.ksG.sub.ksA.sub.dsT.sub.dsT.sub.dsT.sub.dsG.sub.dsA.sub.dsG.sub.dsG.sub.dsA.sub.dsA.sub.dsG.sub.ksG.sub.ksG.sub.k  41.1 10759 10774 617 570851 T.sub.ks.sup.mC.sub.ks.sup.mC.sub.ksT.sub.dsG.sub.dsA.sub.dsT.sub.dsT.sub.dsT.sub.dsG.sub.dsA.sub.dsG.sub.dsG.sub.dsA.sub.ksA.sub.ksG.sub.k  87.4 10761 10776 618 570852 .sup.mC.sub.ks.sup.mC.sub.ksT.sub.ks.sup.mC.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.dsA.sub.dsT.sub.dsT.sub.dsT.sub.dsG.sub.dsA.sub.dsG.sub.ksG.sub.ksA.sub.k  75.8 10763 10778 619 570853 G.sub.ksA.sub.ks.sup.mC.sub.ks.sup.mC.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.dsA.sub.dsT.sub.dsT.sub.dsT.sub.dsG.sub.ksA.sub.ksG.sub.k  87.4 10765 10780 620 570854 A.sub.ksA.sub.ksG.sub.ksA.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.dsA.sub.dsT.sub.dsT.sub.ksT.sub.ksG.sub.k  60.3 10767 10782 621 570855 .sup.mC.sub.ks.sup.mC.sub.ksA.sub.ksA.sub.dsG.sub.dsA.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.dsA.sub.ksT.sub.ksT.sub.k  61.4 10769 10784 622 570856 .sup.mC.sub.ksT.sub.ksG.sub.ks.sup.mC.sub.dsT.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.dsA.sub.dsG.sub.dsA.sub.ds.sup.mC.sub.ds.sup.mC.sub.ksT.sub.ks.sup.mC.sub.k  40.4 10775 10790 623 570857 A.sub.ksG.sub.ks.sup.mC.sub.ksT.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.dsA.sub.dsG.sub.dsA.sub.ks.sup.mC.sub.ks.sup.mC.sub.k  48.5 10777 10792 624 570858 G.sub.ks.sup.mC.sub.ksA.sub.ksG.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.dsA.sub.ksG.sub.ksA.sub.k  87.7 10779 10794 625 570859 .sup.mC.sub.ksT.sub.ksG.sub.ksG.sub.dsT.sub.dsG.sub.dsG.sub.dsA.sub.dsG.sub.dsA.sub.dsA.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.ksG.sub.ksA.sub.k  92.6 10816 10831 626 570860 .sup.mC.sub.ksT.sub.ks.sup.mC.sub.ksT.sub.dsG.sub.dsG.sub.dsT.sub.dsG.sub.dsG.sub.dsA.sub.dsG.sub.dsA.sub.dsA.sub.ds.sup.mC.sub.ks.sup.mC.sub.ksA.sub.k  86.6 10818 10833 627 570861 T.sub.ksT.sub.ks.sup.mC.sub.ksT.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.dsG.sub.dsT.sub.dsG.sub.dsG.sub.dsA.sub.dsG.sub.dsA.sub.ksA.sub.ks.sup.mC.sub.k  82.6 10820 10835 628 570862 G.sub.ksA.sub.ksT.sub.ksT.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.dsG.sub.dsT.sub.dsG.sub.dsG.sub.dsA.sub.ksG.sub.ksA.sub.k  76.1 10822 10837 629 570863 A.sub.ks.sup.mC.sub.ksT.sub.ksT.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.dsT.sub.dsT.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.ks.sup.mC.sub.ks.sup.mC.sub.k  80.6 10981 10996 630 570864 .sup.mC.sub.ksG.sub.ksG.sub.ksA.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.ksT.sub.ks.sup.mC.sub.k  58.7 11002 11017 631 570865 G.sub.ksA.sub.ks.sup.mC.sub.ksG.sub.dsG.sub.dsA.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.ks.sup.mC.sub.ks.sup.mC.sub.k  61.5 11004 11019 632 570866 .sup.mC.sub.ksT.sub.ksG.sub.ksA.sub.ds.sup.mC.sub.dsG.sub.dsG.sub.dsA.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.ks.sup.mC.sub.ks.sup.mC.sub.k  47.6 11006 11021 633 570867 .sup.mC.sub.ks.sup.mC.sub.ks.sup.mC.sub.ksT.sub.dsG.sub.dsA.sub.ds.sup.mC.sub.dsG.sub.dsG.sub.dsA.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.ks.sup.mC.sub.ksT.sub.k  69.5 11008 11023 634 570868 A.sub.ksA.sub.ksG.sub.ks.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.dsT.sub.ksT.sub.ks.sup.mC.sub.k  54 11036 11051 635 570869 G.sub.ksG.sub.ksA.sub.ksA.sub.dsG.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.ksT.sub.ksT.sub.k  37.5 11038 11053 636 570870 .sup.mC.sub.ksG.sub.ksG.sub.ksG.sub.dsA.sub.dsA.sub.dsG.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.ds.sup.mC.sub.ks.sup.mC.sub.ksT.sub.k  70.7 11040 11055 637 570871 .sup.mC.sub.ks.sup.mC.sub.ks.sup.mC.sub.ksG.sub.dsG.sub.dsG.sub.dsA.sub.dsA.sub.dsG.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.ksA.sub.ks.sup.mC.sub.k  71.2 11042 11057 638 570872 .sup.mC.sub.ksA.sub.ks.sup.mC.sub.ks.sup.mC.sub.ds.sup.mC.sub.dsG.sub.dsG.sub.dsG.sub.dsA.sub.dsA.sub.dsG.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.ksT.sub.ks.sup.mC.sub.k  51.6 11044 11059 639 570873 G.sub.ks.sup.mC.sub.ks.sup.mC.sub.ksA.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsG.sub.dsG.sub.dsG.sub.dsA.sub.dsA.sub.dsG.sub.ds.sup.mC.sub.ks.sup.mC.sub.ks.sup.mC.sub.k  45.8 11046 11061 640 570874 A.sub.ks.sup.mC.sub.ksG.sub.ks.sup.mC.sub.ds.sup.mC.sub.dsA.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsG.sub.dsG.sub.dsG.sub.dsA.sub.dsA.sub.ksG.sub.ks.sup.mC.sub.k  31.8 11048 11063 641 570875 .sup.mC.sub.ksT.sub.ksG.sub.ksT.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.dsG.sub.dsA.sub.dsA.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.ks.sup.mC.sub.ks.sup.mC.sub.k  14.3 11082 11097 642 570876 T.sub.ksT.sub.ks.sup.mC.sub.ksT.sub.dsG.sub.dsT.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.dsG.sub.dsA.sub.dsA.sub.dsG.sub.ksT.sub.ks.sup.mC.sub.k  18 11084 11099 643 570877 G.sub.ks.sup.mC.sub.ksT.sub.ksT.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.dsT.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.dsG.sub.dsA.sub.ksA.sub.ksG.sub.k  44 11086 11101 644

TABLE-US-00015 TABLE 15 Inhibition of human DMPK RNA transcript in HepG2 cells targeting SEQ ID NO: 2 Start Stop Site Site Seq ISIS % Target on Seq on Seq ID No. Sequence Expression ID: 2 ID: 2 No. UTC N/A 100 N/A N/A 445569 .sup.mC.sub.esG.sub.esG.sub.esA.sub.esG.sub.es.sup.mC.sub.dsG.sub.dsG.sub.dsT.sub.dsT.sub.dsG.sub.dsT.sub.dsG.sub.dsA.sub.dsA.sub.ds.sup.mC.sub.esT.sub.es  55 13226 13245  24 G.sub.esG.sub.es.sup.mC.sub.e 486178 A.sub.ks.sup.mC.sub.ksA.sub.ksA.sub.dsT.sub.dsA.sub.dsA.sub.dsA.sub.dsT.sub.dsA.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsG.sub.dsA.sub.ksG.sub.ksG.sub.k  33.9 13836 13851  23 570647 G.sub.ks.sup.mC.sub.ksT.sub.ksT.sub.dsG.sub.dsG.sub.dsG.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.ks.sup.mC.sub.ksT.sub.k  80.3  5718  5733 645 570648 A.sub.ksG.sub.ksG.sub.ks.sup.mC.sub.dsT.sub.dsT.sub.dsG.sub.dsG.sub.dsG.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.ds.sup.mC.sub.ks.sup.mC.sub.ks.sup.mC.sub.k  92.3  5720  5735 646 570649 .sup.mC.sub.ksG.sub.ksA.sub.ksG.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.dsG.sub.dsG.sub.dsG.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.ksA.sub.ks.sup.mC.sub.k 100.7  5722  5737 647 570650 A.sub.ksG.sub.ks.sup.mC.sub.ksG.sub.dsA.sub.dsG.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.dsG.sub.dsG.sub.dsG.sub.ds.sup.mC.sub.ks.sup.mC.sub.ks.sup.mC.sub.k  75.8  5724  5739 648 570651 A.sub.ksG.sub.ksA.sub.ksG.sub.ds.sup.mC.sub.dsG.sub.dsA.sub.dsG.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.dsG.sub.dsG.sub.ksG.sub.ks.sup.mC.sub.k  99.8  5726  5741 649 570652 G.sub.ks.sup.mC.sub.ksA.sub.ksG.sub.dsA.sub.dsG.sub.ds.sup.mC.sub.dsG.sub.dsA.sub.dsG.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.ksG.sub.ksG.sub.k 135.4  5728  5743 650 570653 G.sub.ksA.sub.ksG.sub.ks.sup.mC.sub.dsA.sub.dsG.sub.dsA.sub.dsG.sub.ds.sup.mC.sub.dsG.sub.dsA.sub.dsG.sub.dsG.sub.ds.sup.mC.sub.ksT.sub.ksT.sub.k 111.5  5730  5745 651 570654 A.sub.ksA.sub.ksA.sub.ksG.sub.dsG.sub.dsA.sub.dsG.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.dsA.sub.dsG.sub.ds.sup.mC.sub.dsG.sub.ksA.sub.ksG.sub.k  87.5  5734  5749 652 570655 .sup.mC.sub.ksA.sub.ksA.sub.ksA.sub.dsA.sub.dsG.sub.dsG.sub.dsA.sub.dsG.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.dsA.sub.dsG.sub.ks.sup.mC.sub.ksG.sub.k  94.5  5736  5751 653 570656 T.sub.ksG.sub.ksG.sub.ksA.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.dsA.sub.dsA.sub.dsA.sub.dsG.sub.dsG.sub.dsA.sub.dsG.sub.ks.sup.mC.sub.ksA.sub.k  75.4  5741  5756 654 570657 .sup.mC.sub.ks.sup.mC.sub.ksT.sub.ksG.sub.dsG.sub.dsA.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.dsA.sub.dsA.sub.dsA.sub.dsG.sub.dsG.sub.ksA.sub.ksG.sub.k  87.3  5743  5758 655 570658 .sup.mC.sub.ksA.sub.ks.sup.mC.sub.ks.sup.mC.sub.dsT.sub.dsG.sub.dsG.sub.dsA.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.dsA.sub.dsA.sub.dsA.sub.ksG.sub.ksG.sub.k  93.2  5745  5760 656 570659 .sup.mC.sub.ksG.sub.ks.sup.mC.sub.ksA.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.dsG.sub.dsA.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.dsA.sub.ksA.sub.ksA.sub.k  70  5747  5762 657 570660 G.sub.ksA.sub.ks.sup.mC.sub.ks.sup.mC.sub.dsG.sub.ds.sup.mC.sub.dsA.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.dsG.sub.dsA.sub.ds.sup.mC.sub.ks.sup.mC.sub.ksA.sub.k  46.4  5750  5765 658 570661 A.sub.ks.sup.mC.sub.ks.sup.mC.sub.ksT.sub.dsT.sub.dsG.sub.dsT.sub.dsA.sub.dsG.sub.dsT.sub.dsG.sub.dsG.sub.dsA.sub.ds.sup.mC.sub.ksG.sub.ksA.sub.k  44  5951  5966 659 570662 T.sub.ks.sup.mC.sub.ksA.sub.ks.sup.mC.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.dsG.sub.dsT.sub.dsA.sub.dsG.sub.dsT.sub.dsG.sub.dsG.sub.ksA.sub.ks.sup.mC.sub.k  76.8  5953  5968 660 570663 G.sub.ks.sup.mC.sub.ksT.sub.ks.sup.mC.sub.dsA.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.dsG.sub.dsT.sub.dsA.sub.dsG.sub.dsT.sub.ksG.sub.ksG.sub.k  69.5  5955  5970 661 570664 G.sub.ksG.sub.ksA.sub.ksG.sub.dsA.sub.dsG.sub.dsG.sub.dsA.sub.dsG.sub.dsG.sub.ds.sup.mC.sub.dsG.sub.dsA.sub.dsT.sub.ksA.sub.ksG.sub.k  88.2  6015  6030 662 570665 A.sub.ksG.sub.ksG.sub.ksG.sub.dsA.sub.dsG.sub.dsA.sub.dsG.sub.dsG.sub.dsA.sub.dsG.sub.dsG.sub.ds.sup.mC.sub.dsG.sub.ksA.sub.ksT.sub.k  96.9  6017  6032 663 570666 .sup.mC.sub.ksT.sub.ks.sup.mC.sub.ks.sup.mC.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.dsA.sub.dsG.sub.dsG.sub.ksG.sub.ksA.sub.k  74.7  6028  6043 664 570667 G.sub.ksT.sub.ksG.sub.ks.sup.mC.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.ksA.sub.ksG.sub.k  77.5  6031  6046 665 570668 A.sub.ksG.sub.ksG.sub.ksT.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.ksA.sub.ksG.sub.k  76.7  6033  6048 666 570669 A.sub.ksG.sub.ksA.sub.ksG.sub.dsG.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.ksT.sub.ks.sup.mC.sub.k  43.3  6035  6050 667 570670 A.sub.ksG.sub.ksA.sub.ksG.sub.dsA.sub.dsG.sub.dsG.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.ksG.sub.ks.sup.mC.sub.k  27.1  6037  6052 668 570671 A.sub.ks.sup.mC.sub.ks.sup.mC.sub.ks.sup.mC.sub.ds.sup.mC.sub.dsG.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.ks.sup.mC.sub.ksA.sub.k  42.6  6291  6306 669 570672 .sup.mC.sub.ksT.sub.ksA.sub.ks.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsG.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsG.sub.ks.sup.mC.sub.ksT.sub.k  44.9  6293  6308 670 570673 A.sub.ks.sup.mC.sub.ks.sup.mC.sub.ksT.sub.dsA.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsG.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.ks.sup.mC.sub.ksG.sub.k  36.6  6295  6310 671 570674 G.sub.ksT.sub.ksA.sub.ks.sup.mC.sub.ds.sup.mC.sub.dsT.sub.dsA.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsG.sub.ds.sup.mC.sub.ds.sup.mC.sub.ks.sup.mC.sub.ks.sup.mC.sub.k  52  6297  6312 672 570675 A.sub.ksG.sub.ksG.sub.ksT.sub.dsA.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.dsA.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsG.sub.ks.sup.mC.sub.ks.sup.mC.sub.k  56.4  6299  6314 673 570676 G.sub.ksG.sub.ksG.sub.ksA.sub.dsG.sub.dsG.sub.dsT.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsG.sub.ds.sup.mC.sub.dsA.sub.ksG.sub.ks.sup.mC.sub.k  51.4  6329  6344 674 570677 G.sub.ksT.sub.ks.sup.mC.sub.ks.sup.mC.sub.dsT.sub.dsT.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.dsA.sub.ds.sup.mC.sub.ksT.sub.ksT.sub.k  28  6360  6375 675 570678 .sup.mC.sub.ksT.sub.ksG.sub.ksT.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.ksA.sub.ks.sup.mC.sub.k  33.6  6362  6377 676 570679 .sup.mC.sub.ksA.sub.ks.sup.mC.sub.ksT.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.ks.sup.mC.sub.ksA.sub.k   7.9  6364  6379 677 570680 G.sub.ksG.sub.ks.sup.mC.sub.ksA.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.dsA.sub.ds.sup.mC.sub.ksT.sub.ks.sup.mC.sub.k  20.2  6366  6381 678 570681 T.sub.ksA.sub.ksG.sub.ksG.sub.ds.sup.mC.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.ksA.sub.ks.sup.mC.sub.k  38.3  6368  6383 679 570682 G.sub.ksG.sub.ksT.sub.ksA.sub.dsG.sub.dsG.sub.ds.sup.mC.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.ksT.sub.ksT.sub.k  13.9  6370  6385 680 570683 G.sub.ksT.sub.ks.sup.mC.sub.ksA.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.dsG.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.ks.sup.mC.sub.ksT.sub.k  29  6445  6460 681 570684 G.sub.ksG.sub.ksT.sub.ks.sup.mC.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.dsG.sub.dsG.sub.dsT.sub.ks.sup.mC.sub.ks.sup.mC.sub.k  21.3  6446  6461  43 570685 A.sub.ksG.sub.ksG.sub.ksT.sub.ds.sup.mC.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.dsG.sub.dsG.sub.ksT.sub.ks.sup.mC.sub.k  16.9  6447  6462 682 570686 .sup.mC.sub.ksT.sub.ksA.sub.ksG.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.ksG.sub.ksG.sub.k  19.6  6449  6464 683 570687 G.sub.ksT.sub.ks.sup.mC.sub.ksT.sub.dsA.sub.dsG.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.ksT.sub.ksG.sub.k  15.7  6451  6466 684 570688 A.sub.ksA.sub.ksG.sub.ksT.sub.ds.sup.mC.sub.dsT.sub.dsA.sub.dsG.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.ksG.sub.ks.sup.mC.sub.k  16.6  6453  6468 685 570689 G.sub.ks.sup.mC.sub.ksA.sub.ks.sup.mC.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.dsT.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.ks.sup.mC.sub.ksA.sub.k  13.2  6530  6545 686 570690 .sup.mC.sub.ksT.sub.ksG.sub.ks.sup.mC.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.dsT.sub.dsG.sub.dsT.sub.ks.sup.mC.sub.ksT.sub.k  50.1  6532  6547 687 570691 .sup.mC.sub.ks.sup.mC.sub.ks.sup.mC.sub.ksT.sub.dsG.sub.ds.sup.mC.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.dsT.sub.ksG.sub.ksT.sub.k  48.4  6534  6549 688 570692 .sup.mC.sub.ks.sup.mC.sub.ks.sup.mC.sub.ks.sup.mC.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.ksT.sub.ksT.sub.k  74  6536  6551 689 570693 .sup.mC.sub.ksT.sub.ksT.sub.ksG.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.dsA.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.dsG.sub.ksA.sub.ksG.sub.k  25.3  6559  6574 690 570694 T.sub.ks.sup.mC.sub.ks.sup.mC.sub.ksT.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.dsA.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.ksG.sub.ksG.sub.k  39.5  6561  6576 691 570695 .sup.mC.sub.ksT.sub.ksT.sub.ks.sup.mC.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.dsA.sub.dsG.sub.dsT.sub.ks.sup.mC.sub.ksA.sub.k  22.9  6563  6578 692 570696 A.sub.ks.sup.mC.sub.ks.sup.mC.sub.ksT.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.dsA.sub.ksG.sub.ksT.sub.k  52.5  6565  6580 693 570697 G.sub.ksG.sub.ksA.sub.ks.sup.mC.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.ksG.sub.ksA.sub.k  37.6  6567  6582 694 570698 .sup.mC.sub.ksA.sub.ksG.sub.ksG.sub.dsA.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.dsG.sub.ks.sup.mC.sub.ksT.sub.k  44.2  6569  6584 695 570699 A.sub.ksG.sub.ks.sup.mC.sub.ks.sup.mC.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.dsG.sub.dsA.sub.ds.sup.mC.sub.ds.sup.mC.sub.ksT.sub.ksT.sub.k  26.6  6576  6591 696 570700 T.sub.ksA.sub.ksG.sub.ks.sup.mC.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.ksA.sub.ksG.sub.k  33.6  6594  6609 697 570701 G.sub.ksA.sub.ksT.sub.ksA.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.ks.sup.mC.sub.ks.sup.mC.sub.k  20.4  6596  6611 698 570702 .sup.mC.sub.ksA.sub.ksG.sub.ksA.sub.dsT.sub.dsA.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.ks.sup.mC.sub.ksT.sub.k  33.8  6598  6613 699 570703 .sup.mC.sub.ksT.sub.ks.sup.mC.sub.ksA.sub.dsG.sub.dsA.sub.dsT.sub.dsA.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.ks.sup.mC.sub.ksA.sub.k  25.8  6600  6615 700 570704 A.sub.ksG.sub.ks.sup.mC.sub.ksT.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.dsA.sub.dsT.sub.dsA.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.ks.sup.mC.sub.ks.sup.mC.sub.k  29.1  6602  6617 701 570705 T.sub.ks.sup.mC.sub.ksA.sub.ksG.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.dsA.sub.dsT.sub.dsA.sub.dsG.sub.ds.sup.mC.sub.ksT.sub.ks.sup.mC.sub.k  47.4  6604  6619 702 570706 T.sub.ks.sup.mC.sub.ksT.sub.ks.sup.mC.sub.dsA.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.dsA.sub.dsT.sub.dsA.sub.ksG.sub.ks.sup.mC.sub.k  33.4  6606  6621 703 570707 G.sub.ksA.sub.ksG.sub.ksT.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.ksT.sub.ksT.sub.k  49  6636  6651 704 570708 G.sub.ksG.sub.ksA.sub.ksG.sub.dsG.sub.dsA.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.ks.sup.mC.sub.ksT.sub.k  79.2  6640  6655 705 570709 G.sub.ksA.sub.ksG.sub.ksG.sub.dsA.sub.dsG.sub.dsG.sub.dsA.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.ksT.sub.ks.sup.mC.sub.k  63.3  6642  6657 706 570710 .sup.mC.sub.ksA.sub.ksA.sub.ksA.sub.dsA.sub.dsG.sub.dsG.sub.dsG.sub.ds.sup.mC.sub.dsA.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.ksG.sub.ksA.sub.k  38.8  6713  6728 707 570711 A.sub.ksG.sub.ks.sup.mC.sub.ksA.sub.dsA.sub.dsA.sub.dsA.sub.dsG.sub.dsG.sub.dsG.sub.ds.sup.mC.sub.dsA.sub.ds.sup.mC.sub.ds.sup.mC.sub.ks.sup.mC.sub.ksA.sub.k  13.7  6715  6730 708 570712 G.sub.ksG.sub.ksA.sub.ksT.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.dsT.sub.dsA.sub.dsT.sub.dsT.sub.ksG.sub.ksT.sub.k  45.8  6733  6748 709 570713 .sup.mC.sub.ksT.sub.ksG.sub.ksG.sub.dsA.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.dsT.sub.dsA.sub.ksT.sub.ksT.sub.k  45.6  6735  6750 710 570714 T.sub.ksG.sub.ks.sup.mC.sub.ksT.sub.dsG.sub.dsG.sub.dsA.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.ksT.sub.ksA.sub.k  43.6  6737  6752 711 570715 A.sub.ksT.sub.ksT.sub.ks.sup.mC.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.dsA.sub.dsG.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.ksA.sub.ksA.sub.k  18.3  6789  6804 712 570716 T.sub.ksA.sub.ksA.sub.ksT.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.dsA.sub.dsG.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.ksG.sub.ks.sup.mC.sub.k  15.1  6791  6806 713 570717 T.sub.ks.sup.mC.sub.ksT.sub.ksA.sub.dsA.sub.dsT.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.dsA.sub.dsG.sub.dsA.sub.ks.sup.mC.sub.ksT.sub.k  49.9  6793  6808 714 570718 T.sub.ks.sup.mC.sub.ksT.sub.ks.sup.mC.sub.dsT.sub.dsA.sub.dsA.sub.dsT.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.dsA.sub.ksG.sub.ksA.sub.k  77.6  6795  6810 715 570719 .sup.mC.sub.ksT.sub.ks.sup.mC.sub.ks.sup.mC.sub.dsA.sub.dsT.sub.dsA.sub.dsA.sub.dsT.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.ksA.sub.ksA.sub.k  42  6804  6819 716 570720 A.sub.ks.sup.mC.sub.ksT.sub.ks.sup.mC.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.dsA.sub.dsA.sub.dsT.sub.dsT.sub.ds.sup.mC.sub.ksT.sub.ks.sup.mC.sub.k  28.5  6807  6822 717 570721 A.sub.ks.sup.mC.sub.ksA.sub.ks.sup.mC.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.dsA.sub.dsA.sub.dsT.sub.ksT.sub.ks.sup.mC.sub.k  27.4  6809  6824 718 570722 .sup.mC.sub.ks.sup.mC.sub.ksA.sub.ks.sup.mC.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.dsA.sub.ksA.sub.ksT.sub.k  35.4  6811  6826 719 570723 T.sub.ksG.sub.ks.sup.mC.sub.ks.sup.mC.sub.dsA.sub.ds.sup.mC.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.ksT.sub.ksA.sub.k  45  6813  6828 720

TABLE-US-00016 TABLE 16 Inhibition of human DMPK RNA transcript in HepG2 cells targeting SEQ ID NO: 2 Start Stop Site Site Seq ISIS % Target on Seq on Seq ID No. Sequence Expression ID: 2 ID: 2 No. UTC N/A 100 N/A N/A 445569 .sup.mC.sub.esG.sub.esG.sub.esA.sub.esG.sub.es.sup.mC.sub.dsG.sub.dsG.sub.dsT.sub.dsT.sub.dsG.sub.dsT.sub.dsG.sub.dsA.sub.dsA.sub.ds.sup.mC.sub.es  33.9 13226 13245  24 T.sub.esG.sub.esG.sub.es.sup.mC.sub.e 486178 A.sub.ks.sup.mC.sub.ksA.sub.ksA.sub.dsT.sub.dsA.sub.dsA.sub.dsA.sub.dsT.sub.dsA.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsG.sub.dsA.sub.ksG.sub.ksG.sub.k  21.5 13836 13851  23 570339 .sup.mC.sub.ks.sup.mC.sub.ks.sup.mC.sub.ksA.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.ksG.sub.ks.sup.mC.sub.k  56.2  1534  1549 721 570340 G.sub.ksG.sub.ksA.sub.ks.sup.mC.sub.dsA.sub.dsG.sub.dsA.sub.dsG.sub.dsA.sub.dsA.sub.dsA.sub.dsT.sub.dsG.sub.dsT.sub.ksT.sub.ksG.sub.k  46.7  1597  1612 722 570341 G.sub.ksG.sub.ks.sup.mC.sub.ksA.sub.dsT.sub.dsA.sub.dsG.sub.dsG.sub.dsA.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.dsA.sub.dsG.sub.ksA.sub.ksA.sub.k  35.6  1603  1618 723 570342 G.sub.ksT.sub.ksG.sub.ksG.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.dsA.sub.dsG.sub.dsG.sub.dsA.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.ksA.sub.ksG.sub.k  34.8  1605  1620 724 570343 T.sub.ksG.sub.ksG.sub.ksT.sub.dsG.sub.dsG.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.dsA.sub.dsG.sub.dsG.sub.dsA.sub.ds.sup.mC.sub.ksA.sub.ksG.sub.k  60.3  1607  1622 725 570344 .sup.mC.sub.ksT.sub.ksT.sub.ksA.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.ks.sup.mC.sub.ks.sup.mC.sub.k  49.6  1627  1642 726 570345 A.sub.ks.sup.mC.sub.ks.sup.mC.sub.ksT.sub.dsT.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.ks.sup.mC.sub.ksT.sub.k  48.6  1629  1644 727 570346 T.sub.ksG.sub.ksA.sub.ks.sup.mC.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.ks.sup.mC.sub.ks.sup.mC.sub.k  36.8  1631  1646 728 570347 G.sub.ks.sup.mC.sub.ksT.sub.ksG.sub.dsA.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.ksG.sub.ks.sup.mC.sub.k  53.5  1633  1648 729 570348 .sup.mC.sub.ksT.sub.ksG.sub.ks.sup.mC.sub.dsT.sub.dsG.sub.dsA.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.ks.sup.mC.sub.ksT.sub.k  59  1635  1650 730 570349 .sup.mC.sub.ksT.sub.ks.sup.mC.sub.ksT.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.dsA.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.dsA.sub.ks.sup.mC.sub.ksT.sub.k  70.8  1637  1652 731 570350 G.sub.ks.sup.mC.sub.ks.sup.mC.sub.ksT.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.dsA.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.ksT.sub.ksA.sub.k  54  1639  1654 732 570351 .sup.mC.sub.ks.sup.mC.sub.ksA.sub.ksT.sub.dsG.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.dsA.sub.dsG.sub.dsT.sub.ks.sup.mC.sub.ksA.sub.k  52.6  1666  1681 733 570352 A.sub.ksG.sub.ks.sup.mC.sub.ks.sup.mC.sub.dsA.sub.dsT.sub.dsG.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.dsA.sub.ksG.sub.ksT.sub.k  60.7  1668  1683 734 570353 T.sub.ksA.sub.ksA.sub.ksG.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.dsG.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.ksG.sub.ksA.sub.k  82.3  1670  1685 735 570354 T.sub.ksA.sub.ksG.sub.ks.sup.mC.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.dsT.sub.dsG.sub.dsA.sub.ds.sup.mC.sub.ksT.sub.ks.sup.mC.sub.k  40.8  1687  1702 736 570355 A.sub.ksT.sub.ksG.sub.ksG.sub.dsG.sub.dsA.sub.dsG.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.dsT.sub.dsT.sub.dsG.sub.ksG.sub.ks.sup.mC.sub.k  90.7  1707  1722 737 570356 .sup.mC.sub.ks.sup.mC.sub.ksA.sub.ksT.sub.dsG.sub.dsG.sub.dsG.sub.dsA.sub.dsG.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.dsT.sub.ksT.sub.ksG.sub.k  73.9  1709  1724 738 570357 G.sub.ksG.sub.ks.sup.mC.sub.ks.sup.mC.sub.dsA.sub.dsT.sub.dsG.sub.dsG.sub.dsG.sub.dsA.sub.dsG.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.ksG.sub.ksT.sub.k  94.9  1711  1726 739 570358 G.sub.ksT.sub.ksG.sub.ks.sup.mC.sub.dsA.sub.dsG.sub.dsA.sub.dsG.sub.dsA.sub.dsG.sub.dsG.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.ksT.sub.ksG.sub.k  73.5  1720  1735 740 570359 G.sub.ksA.sub.ksG.sub.ks.sup.mC.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.dsG.sub.ksA.sub.ks.sup.mC.sub.k  70.2  1759  1774 741 570360 A.sub.ksG.sub.ksG.sub.ksG.sub.dsA.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.ds.sup.mC.sub.ksA.sub.ksT.sub.k  56.1  1762  1777 742 570361 G.sub.ks.sup.mC.sub.ks.sup.mC.sub.ksA.sub.dsT.sub.dsA.sub.dsG.sub.dsA.sub.dsG.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.ds.sup.mC.sub.ksT.sub.ksT.sub.k  54.9  1799  1814 743 570362 G.sub.ksG.sub.ksG.sub.ks.sup.mC.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.dsA.sub.dsG.sub.dsA.sub.dsG.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.ksA.sub.ks.sup.mC.sub.k  78.1  1801  1816 744 570363 A.sub.ksT.sub.ksG.sub.ks.sup.mC.sub.dsT.sub.dsG.sub.dsG.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.ksG.sub.ksG.sub.k  76.2  1848  1863 745 570364 A.sub.ksG.sub.ks.sup.mC.sub.ksT.sub.dsG.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.ksG.sub.ksG.sub.k  92.6  1857  1872 746 570365 .sup.mC.sub.ksG.sub.ks.sup.mC.sub.ks.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.dsG.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.ksG.sub.ks.sup.mC.sub.k  73.6  1867  1882 747 570366 T.sub.ksG.sub.ks.sup.mC.sub.ksG.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.dsG.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.ks.sup.mC.sub.ksT.sub.k  76.6  1869  1884 748 570367 G.sub.ks.sup.mC.sub.ksT.sub.ksG.sub.ds.sup.mC.sub.dsG.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.dsG.sub.ds.sup.mC.sub.ksA.sub.ksG.sub.k  79.1  1871  1886 749 570368 .sup.mC.sub.ksG.sub.ksG.sub.ks.sup.mC.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.dsG.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.ksG.sub.ks.sup.mC.sub.k  82.9  1873  1888 750 570369 G.sub.ksT.sub.ks.sup.mC.sub.ksG.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.dsG.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.ksT.sub.ksG.sub.k  47.5  1875  1890 751 570370 .sup.mC.sub.ksT.sub.ksG.sub.ksT.sub.ds.sup.mC.sub.dsG.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.dsG.sub.ds.sup.mC.sub.ds.sup.mC.sub.ks.sup.mC.sub.ks.sup.mC.sub.k  79.6  1877  1892 752 570371 G.sub.ks.sup.mC.sub.ks.sup.mC.sub.ksT.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.dsG.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.dsG.sub.ks.sup.mC.sub.ks.sup.mC.sub.k  58.4  1879  1894 753 570372 .sup.mC.sub.ksT.sub.ksG.sub.ks.sup.mC.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.dsG.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.ks.sup.mC.sub.ksG.sub.k  49.9  1881  1896 754 570373 A.sub.ks.sup.mC.sub.ks.sup.mC.sub.ksT.sub.dsG.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.dsG.sub.dsG.sub.ds.sup.mC.sub.ksT.sub.ksG.sub.k  27.4  1883  1898 755 570374 A.sub.ks.sup.mC.sub.ksA.sub.ks.sup.mC.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.dsG.sub.ksG.sub.ks.sup.mC.sub.k  54.3  1885  1900 756 570375 G.sub.ksA.sub.ksA.sub.ks.sup.mC.sub.dsA.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.dsT.sub.ks.sup.mC.sub.ksG.sub.k  50.5  1887  1902 757 570376 .sup.mC.sub.ks.sup.mC.sub.ksG.sub.ksA.sub.dsA.sub.ds.sup.mC.sub.dsA.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.ksG.sub.ksT.sub.k  57.7  1889  1904 758 570377 .sup.mC.sub.ksG.sub.ks.sup.mC.sub.ks.sup.mC.sub.dsG.sub.dsA.sub.dsA.sub.ds.sup.mC.sub.dsA.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.ks.sup.mC.sub.ksT.sub.k  69.3  1891  1906 759 570378 .sup.mC.sub.ks.sup.mC.sub.ksT.sub.ksG.sub.dsG.sub.dsG.sub.ds.sup.mC.sub.dsA.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.dsT.sub.dsT.sub.ksG.sub.ksG.sub.k 188.2  1925  1940 760 570379 G.sub.ksT.sub.ksG.sub.ks.sup.mC.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.dsG.sub.dsG.sub.ds.sup.mC.sub.dsA.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.ksG.sub.ksT.sub.k 111.5  1928  1943 761 570380 .sup.mC.sub.ksG.sub.ks.sup.mC.sub.ks.sup.mC.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.ks.sup.mC.sub.ksT.sub.k  78  1938  1953 762 570381 A.sub.ks.sup.mC.sub.ks.sup.mC.sub.ksG.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.dsT.sub.ksG.sub.ks.sup.mC.sub.k  74.9  1940  1955 763 570382 T.sub.ks.sup.mC.sub.ksA.sub.ks.sup.mC.sub.ds.sup.mC.sub.dsG.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.ksG.sub.ksT.sub.k  71.6  1942  1957 764 570383 A.sub.ksG.sub.ksT.sub.ks.sup.mC.sub.dsA.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsG.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.ks.sup.mC.sub.kA.sub.k  62.1  1944  1959 765 570384 T.sub.ksG.sub.ksA.sub.ksG.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsG.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.ks.sup.mC.sub.ks.sup.mC.sub.k  65.6  1946  1961 766 570385 .sup.mC.sub.ksG.sub.ksT.sub.ksG.sub.dsA.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsG.sub.ds.sup.mC.sub.ds.sup.mC.sub.ks.sup.mC.sub.ksT.sub.k  37.3  1948  1963 767 570386 .sup.mC.sub.ksA.sub.ksA.sub.ksA.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.dsG.sub.dsT.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.ks.sup.mC.sub.ks.sup.mC.sub.k  30.5  1974  1989 768 570387 T.sub.ksG.sub.ks.sup.mC.sub.ksA.sub.dsA.sub.dsA.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.dsG.sub.dsT.sub.dsT.sub.ds.sup.mC.sub.ksT.sub.ks.sup.mC.sub.k  35.8  1976  1991 769 570388 T.sub.ks.sup.mC.sub.ksT.sub.ksG.sub.ds.sup.mC.sub.dsA.sub.dsA.sub.dsA.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.dsG.sub.dsT.sub.ksT.sub.ks.sup.mC.sub.k  30.1  1978  1993 770 570389 T.sub.ksG.sub.ksT.sub.ks.sup.mC.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.dsA.sub.dsA.sub.dsA.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.ksG.sub.ksT.sub.k  50.1  1980  1995 771 570390 .sup.mC.sub.ks.sup.mC.sub.ksT.sub.ksG.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.dsA.sub.dsA.sub.dsA.sub.dsG.sub.ds.sup.mC.sub.ksT.sub.ksG.sub.k  36  1982  1997 772 570391 .sup.mC.sub.ksG.sub.ks.sup.mC.sub.ks.sup.mC.sub.dsT.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.dsA.sub.dsA.sub.dsA.sub.ksG.sub.ks.sup.mC.sub.k  31.1  1984  1999 773 570392 T.sub.ksT.sub.ksG.sub.ksT.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.dsG.sub.dsA.sub.ksT.sub.ks.sup.mC.sub.k  62.9  2022  2037 774 570393 A.sub.ksG.sub.ksT.sub.ksT.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.ksG.sub.ksA.sub.k  57.1  2024  2039 775 570394 A.sub.ksA.sub.ksA.sub.ksG.sub.dsT.sub.dsT.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.ksT.sub.ksG.sub.k  56.2  2026  2041 776 570395 .sup.mC.sub.ks.sup.mC.sub.ksA.sub.ksA.sub.dsA.sub.dsG.sub.dsT.sub.dsT.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.ks.sup.mC.sub.ks.sup.mC.sub.k  48.9  2028  2043 777 570396 A.sub.ks.sup.mC.sub.ks.sup.mC.sub.ks.sup.mC.sub.dsA.sub.dsA.sub.dsA.sub.dsG.sub.dsT.sub.dsT.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.ks.sup.mC.sub.ksT.sub.k  59.9  2030  2045 778 570397 G.sub.ksA.sub.ksA.sub.ks.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.dsA.sub.dsA.sub.dsG.sub.dsT.sub.dsT.sub.dsG.sub.dsT.sub.ks.sup.mC.sub.ks.sup.mC.sub.k  47.9  2032  2047 779 570398 G.sub.ksA.sub.ksA.sub.ksG.sub.dsA.sub.dsA.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.dsA.sub.dsA.sub.dsG.sub.dsT.sub.ksT.sub.ksG.sub.k  60  2035  2050 780 570399 .sup.mC.sub.ks.sup.mC.sub.ksA.sub.ksG.sub.dsA.sub.dsA.sub.dsG.sub.dsA.sub.dsA.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.dsA.sub.ksA.sub.ksG.sub.k  51.2  2038  2053 781 570400 .sup.mC.sub.ksA.sub.ks.sup.mC.sub.ks.sup.mC.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.dsA.sub.dsA.sub.dsG.sub.dsA.sub.dsA.sub.ds.sup.mC.sub.ds.sup.mC.sub.ks.sup.mC.sub.ksA.sub.k  51.1  2041  2056 782 570401 G.sub.ks.sup.mC.sub.ksA.sub.ksG.sub.dsA.sub.dsA.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.dsA.sub.ds.sup.mC.sub.dsA.sub.dsA.sub.dsA.sub.ksA.sub.ksG.sub.k  44.9  2066  2081 783 570402 G.sub.ksT.sub.ksG.sub.ks.sup.mC.sub.dsA.sub.dsG.sub.dsA.sub.dsA.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.dsA.sub.ds.sup.mC.sub.dsA.sub.ksA.sub.ksA.sub.k  53  2068  2083 784 570403 G.sub.ksG.sub.ksG.sub.ksT.sub.dsG.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.dsA.sub.dsA.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.dsA.sub.ks.sup.mC.sub.ksA.sub.k  51.5  2070  2085 785 570404 G.sub.ksT.sub.ksG.sub.ksG.sub.dsG.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.dsA.sub.dsA.sub.ds.sup.mC.sub.ds.sup.mC.sub.ksT.sub.ksA.sub.k  57.4  2072  2087 786 570405 .sup.mC.sub.ks.sup.mC.sub.ksA.sub.ks.sup.mC.sub.dsA.sub.ds.sup.mC.sub.dsG.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.dsA.sub.ksG.sub.ksG.sub.k  54.3  2116  2131 787 570406 A.sub.ks.sup.mC.sub.ks.sup.mC.sub.ks.sup.mC.sub.dsA.sub.ds.sup.mC.sub.dsA.sub.ds.sup.mC.sub.dsG.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.ksT.sub.ksA.sub.k  43.6  2118  2133 788 570407 T.sub.ksG.sub.ksA.sub.ks.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.ds.sup.mC.sub.dsA.sub.ds.sup.mC.sub.dsG.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.ks.sup.mC.sub.ksA.sub.k  44  2120  2135 789 570408 G.sub.ks.sup.mC.sub.ksT.sub.ksG.sub.dsA.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.ds.sup.mC.sub.dsA.sub.ds.sup.mC.sub.dsG.sub.dsG.sub.ks.sup.mC.sub.ksT.sub.k  56.5  2122  2137 790 570409 T.sub.ksG.sub.ksG.sub.ks.sup.mC.sub.dsT.sub.dsG.sub.dsA.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.ds.sup.mC.sub.dsA.sub.ds.sup.mC.sub.ksG.sub.ksG.sub.k  54.8  2124  2139 791 570410 G.sub.ksG.sub.ksT.sub.ksG.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.dsA.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.ds.sup.mC.sub.ksA.sub.ks.sup.mC.sub.k  46.8  2126  2141 792 570411 A.sub.ksT.sub.ksG.sub.ksG.sub.dsT.sub.dsG.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.dsA.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.ksA.sub.ks.sup.mC.sub.k  73.8  2128  2143 793 570412 G.sub.ksA.sub.ksA.sub.ksT.sub.dsG.sub.dsG.sub.dsT.sub.dsG.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.dsA.sub.ds.sup.mC.sub.ks.sup.mC.sub.ks.sup.mC.sub.k  43.5  2130  2145 794 570413 .sup.mC.sub.ksT.sub.ksA.sub.ksA.sub.dsA.sub.dsG.sub.dsG.sub.dsA.sub.ds.sup.mC.sub.dsG.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.dsG.sub.ksG.sub.ksA.sub.k  54.4  2159  2174 795 570414 A.sub.ksA.sub.ks.sup.mC.sub.ksT.sub.dsA.sub.dsA.sub.dsA.sub.dsG.sub.dsG.sub.dsA.sub.ds.sup.mC.sub.dsG.sub.ds.sup.mC.sub.dsA.sub.ksG.sub.ksG.sub.k  49.1  2161  2176 796 570415 G.sub.ksA.sub.ksG.sub.ksA.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.dsA.sub.dsA.sub.dsA.sub.dsG.sub.dsG.sub.dsA.sub.ds.sup.mC.sub.ksG.sub.ks.sup.mC.sub.k  35.4  2164  2179 797

TABLE-US-00017 TABLE 17 Inhibition of human DMPK RNA transcript in HepG2 cells targeting SEQ ID NO: 2 Start Stop Site Site Seq ISIS % Target on Seq on Seq ID No. Sequence Expression ID: 2 ID: 2 No. UTC N/A 100 N/A N/A 445569 .sup.mC.sub.esG.sub.esG.sub.esA.sub.esG.sub.es.sup.mC.sub.dsG.sub.dsG.sub.dsT.sub.dsT.sub.dsG.sub.dsT.sub.dsG.sub.dsA.sub.dsA.sub.ds.sup.mC.sub.es  41.4 13226 13245  24 T.sub.esG.sub.esG.sub.es.sup.mC.sub.e 486178 A.sub.ks.sup.mC.sub.ksA.sub.ksA.sub.dsT.sub.dsA.sub.dsA.sub.dsA.sub.dsT.sub.dsA.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsG.sub.dsA.sub.ksG.sub.ksG.sub.k  24 13836 13851  23 570493 A.sub.ksT.sub.ksT.sub.ksG.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.dsA.sub.dsG.sub.ds.sup.mC.sub.ds.sup.mC.sub.ks.sup.mC.sub.ks.sup.mC.sub.k 112.1  3973  3988 798 570494 .sup.mC.sub.ks.sup.mC.sub.ksA.sub.ksT.sub.dsT.sub.dsG.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.dsA.sub.dsG.sub.ks.sup.mC.sub.ks.sup.mC.sub.k  91.3  3975  3990 799 570495 G.sub.ks.sup.mC.sub.ks.sup.mC.sub.ks.sup.mC.sub.dsA.sub.dsT.sub.dsT.sub.dsG.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.ksA.sub.ksG.sub.k 103.4  3977  3992 800 570496 A.sub.ks.sup.mC.sub.ksG.sub.ks.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.dsT.sub.dsG.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.ks.sup.mC.sub.ksA.sub.k  67.8  3979  3994 801 570497 .sup.mC.sub.ks.sup.mC.sub.ksA.sub.ks.sup.mC.sub.dsG.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.dsT.sub.dsG.sub.dsG.sub.dsT.sub.ks.sup.mC.sub.ks.sup.mC.sub.k  77.3  3981  3996 802 570498 .sup.mC.sub.ksA.sub.ks.sup.mC.sub.ks.sup.mC.sub.dsA.sub.ds.sup.mC.sub.dsG.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.dsT.sub.dsG.sub.ksG.sub.ksT.sub.k  98.3  3983  3998 803 570499 A.sub.ksG.sub.ksA.sub.ks.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.ds.sup.mC.sub.ks.sup.mC.sub.ks.sup.mC.sub.k  63.7  4036  4051 804 570500 T.sub.ks.sup.mC.sub.ksA.sub.ks.sup.mC.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.dsG.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.ksT.sub.ksT.sub.k  43  4181  4196 805 570501 .sup.mC.sub.ks.sup.mC.sub.ksT.sub.ks.sup.mC.sub.dsA.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.dsG.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.ksT.sub.ks.sup.mC.sub.k  38.1  4183  4198 806 570502 A.sub.ksG.sub.ks.sup.mC.sub.ks.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.dsG.sub.ks.sup.mC.sub.ks.sup.mC.sub.k  85.4  4187  4202 807 570503 .sup.mC.sub.ksT.sub.ks.sup.mC.sub.ksA.sub.dsA.sub.dsA.sub.dsG.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.ks.sup.mC.sub.ksG.sub.k 115.8  4210  4225 808 570504 A.sub.ksT.sub.ks.sup.mC.sub.ks.sup.mC.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.dsA.sub.dsA.sub.dsG.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.ks.sup.mC.sub.ks.sup.mC.sub.k 114.5  4213  4228 809 570505 G.sub.ksG.sub.ksA.sub.ksT.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.dsA.sub.dsA.sub.dsG.sub.ds.sup.mC.sub.ds.sup.mC.sub.ks.sup.mC.sub.ks.sup.mC.sub.k  88.1  4215  4230 810 570506 G.sub.ks.sup.mC.sub.ksG.sub.ksG.sub.dsA.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.dsA.sub.dsA.sub.dsG.sub.ks.sup.mC.sub.ks.sup.mC.sub.k  93.1  4217  4232 811 570507 G.sub.ks.sup.mC.sub.ksG.sub.ks.sup.mC.sub.dsG.sub.dsG.sub.dsA.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.dsA.sub.ksA.sub.ksG.sub.k 102.9  4219  4234 812 570508 G.sub.ksG.sub.ksG.sub.ks.sup.mC.sub.dsG.sub.ds.sup.mC.sub.dsG.sub.dsG.sub.dsA.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.ksA.sub.ksA.sub.k  78.5  4221  4236 813 570509 G.sub.ksA.sub.ksG.sub.ks.sup.mC.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsG.sub.dsG.sub.dsA.sub.ksG.sub.ksA.sub.k 192.2  4239  4254 814 570510 A.sub.ksG.sub.ksG.sub.ksA.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsG.sub.ksG.sub.ksA.sub.k 219.8  4241  4256 815 570511 .sup.mC.sub.ksG.sub.ksG.sub.ksA.sub.dsG.sub.dsG.sub.dsA.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.ks.sup.mC.sub.ks.sup.mC.sub.k 128.6  4244  4259 816 570512 A.sub.ks.sup.mC.sub.ks.sup.mC.sub.ks.sup.mC.sub.dsG.sub.dsG.sub.dsA.sub.dsG.sub.dsG.sub.dsA.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.ks.sup.mC.sub.ksA.sub.k  89.9  4247  4262 817 570513 G.sub.ks.sup.mC.sub.ksA.sub.ks.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsG.sub.dsG.sub.dsA.sub.dsG.sub.dsG.sub.dsA.sub.dsG.sub.ds.sup.mC.sub.ksT.sub.ksG.sub.k  96.1  4249  4264 818 570514 G.sub.ksG.sub.ksG.sub.ks.sup.mC.sub.dsA.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsG.sub.dsG.sub.dsA.sub.dsG.sub.dsG.sub.dsA.sub.ksG.sub.ks.sup.mC.sub.k  67.8  4251  4266 819 570515 .sup.mC.sub.ksA.sub.ksG.sub.ksG.sub.dsG.sub.ds.sup.mC.sub.dsA.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsG.sub.dsG.sub.dsA.sub.dsG.sub.ksG.sub.ksA.sub.k  64.2  4253  4268 820 570516 T.sub.ksG.sub.ks.sup.mC.sub.ksA.sub.dsG.sub.dsG.sub.dsG.sub.ds.sup.mC.sub.dsA.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsG.sub.dsG.sub.ksA.sub.ksG.sub.k  62.2  4255  4270 821 570517 .sup.mC.sub.ks.sup.mC.sub.ksT.sub.ksG.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.dsG.sub.dsG.sub.ds.sup.mC.sub.dsA.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.ksG.sub.ksG.sub.k  77.7  4257  4272 822 570518 .sup.mC.sub.ksG.sub.ksA.sub.ks.sup.mC.sub.dsA.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.dsG.sub.dsG.sub.ks.sup.mC.sub.ksA.sub.k  79  4262  4277 823 570519 .sup.mC.sub.ksA.sub.ks.sup.mC.sub.ksG.sub.dsA.sub.ds.sup.mC.sub.dsA.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.ksG.sub.ksG.sub.k  68.5  4264  4279 824 570520 A.sub.ksG.sub.ks.sup.mC.sub.ksA.sub.ds.sup.mC.sub.dsG.sub.dsA.sub.ds.sup.mC.sub.dsA.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.ksA.sub.ksG.sub.k  39.8  4266  4281 825 570521 G.sub.ksA.sub.ksA.sub.ksG.sub.ds.sup.mC.sub.dsA.sub.ds.sup.mC.sub.dsG.sub.dsA.sub.ds.sup.mC.sub.dsA.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.ksG.sub.ks.sup.mC.sub.k  32.4  4268  4283 826 570522 .sup.mC.sub.ks.sup.mC.sub.ksA.sub.ksG.sub.dsG.sub.dsT.sub.dsA.sub.dsG.sub.dsT.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.ksT.sub.ks.sup.mC.sub.k  41  4353  4368 827 570523 .sup.mC.sub.ksA.sub.ks.sup.mC.sub.ks.sup.mC.sub.dsA.sub.dsG.sub.dsG.sub.dsT.sub.dsA.sub.dsG.sub.dsT.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.ks.sup.mC.sub.ksA.sub.k  71.9  4355  4370 828 570524 .sup.mC.sub.ksT.sub.ks.sup.mC.sub.ksA.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.dsG.sub.dsT.sub.dsA.sub.dsG.sub.dsT.sub.dsT.sub.ks.sup.mC.sub.ksT.sub.k 105.9  4357  4372 829 570525 A.sub.ksG.sub.ks.sup.mC.sub.ksT.sub.ds.sup.mC.sub.dsA.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.dsG.sub.dsT.sub.dsA.sub.dsG.sub.ksT.sub.ksT.sub.k  99.3  4359  4374 830 570526 G.sub.ksG.sub.ksA.sub.ksG.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.dsG.sub.dsT.sub.ksA.sub.ksG.sub.k  85.2  4361  4376 831 570527 .sup.mC.sub.ks.sup.mC.sub.ksG.sub.ksG.sub.dsA.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.ksG.sub.ksT.sub.k  82.5  4363  4378 832 570528 G.sub.ks.sup.mC.sub.ks.sup.mC.sub.ks.sup.mC.sub.dsG.sub.dsG.sub.dsA.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.ds.sup.mC.sub.ds.sup.mC.sub.ksA.sub.ksG.sub.k  60.5  4365  4380 833 570529 T.sub.ksA.sub.ksG.sub.ksA.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.ks.sup.mC.sub.ks.sup.mC.sub.k  35.4  4435  4450 834 570530 .sup.mC.sub.ks.sup.mC.sub.ksT.sub.ksA.sub.dsG.sub.dsA.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.ksT.sub.ks.sup.mC.sub.k  29.4  4437  4452 835 570531 A.sub.ksT.sub.ks.sup.mC.sub.ks.sup.mC.sub.dsT.sub.dsA.sub.dsG.sub.dsA.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.ksT.sub.ks.sup.mC.sub.k  30.4  4439  4454 836 570532 .sup.mC.sub.ksA.sub.ksA.sub.ksT.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.dsA.sub.dsG.sub.dsA.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.ks.sup.mC.sub.ks.sup.mC.sub.k  30.3  4441  4456 837 570533 .sup.mC.sub.ks.sup.mC.sub.ks.sup.mC.sub.ksA.sub.dsA.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.dsA.sub.dsG.sub.dsA.sub.dsG.sub.ds.sup.mC.sub.ksT.sub.ksT.sub.k  54.1  4443  4458 838 570534 .sup.mC.sub.ks.sup.mC.sub.ks.sup.mC.sub.ks.sup.mC.sub.ds.sup.mC.sub.dsA.sub.dsA.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.dsA.sub.dsG.sub.dsA.sub.ksG.sub.ks.sup.mC.sub.k  60.1  4445  4460 839 570535 .sup.mC.sub.ksA.sub.ks.sup.mC.sub.ks.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.dsA.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.dsA.sub.ksG.sub.ksA.sub.k  68.5  4447  4462 840 570536 A.sub.ksG.sub.ks.sup.mC.sub.ksA.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.dsA.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.ksT.sub.ksA.sub.k  37.5  4449  4464 841 570537 G.sub.ks.sup.mC.sub.ksA.sub.ksG.sub.ds.sup.mC.sub.dsA.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.dsA.sub.dsT.sub.ks.sup.mC.sub.ks.sup.mC.sub.k  50.9  4451  4466 842 570538 G.sub.ksG.sub.ksG.sub.ks.sup.mC.sub.dsA.sub.dsG.sub.ds.sup.mC.sub.dsA.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.ksA.sub.ksT.sub.k  67.7  4453  4468 843 570539 T.sub.ksG.sub.ksA.sub.ks.sup.mC.sub.dsA.sub.ds.sup.mC.sub.dsA.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.ksA.sub.ks.sup.mC.sub.k  55.9  4498  4513 844 570540 .sup.mC.sub.ks.sup.mC.sub.ksT.sub.ksG.sub.dsA.sub.ds.sup.mC.sub.dsA.sub.ds.sup.mC.sub.dsA.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.ksT.sub.ksT.sub.k  45.1  4500  4515 845 570541 .sup.mC.sub.ksA.sub.ks.sup.mC.sub.ks.sup.mC.sub.dsT.sub.dsG.sub.dsA.sub.ds.sup.mC.sub.dsA.sub.ds.sup.mC.sub.dsA.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.ksT.sub.ks.sup.mC.sub.k  30.9  4502  4517 846 570542 T.sub.ks.sup.mC.sub.ks.sup.mC.sub.ksA.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.dsA.sub.ds.sup.mC.sub.dsA.sub.ds.sup.mC.sub.dsA.sub.ds.sup.mC.sub.ks.sup.mC.sub.ks.sup.mC.sub.k  35  4504  4519 847 570543 .sup.mC.sub.ksA.sub.ksT.sub.ks.sup.mC.sub.ds.sup.mC.sub.dsA.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.dsA.sub.ds.sup.mC.sub.dsA.sub.ds.sup.mC.sub.ksA.sub.ks.sup.mC.sub.k  48  4506  4521 848 570544 .sup.mC.sub.ksT.sub.ks.sup.mC.sub.ksA.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.dsA.sub.ds.sup.mC.sub.ksA.sub.ks.sup.mC.sub.k  37.1  4508  4523 849 570545 .sup.mC.sub.ks.sup.mC.sub.ks.sup.mC.sub.ksT.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.ksA.sub.ks.sup.mC.sub.k  46  4510  4525 850 570546 G.sub.ks.sup.mC.sub.ks.sup.mC.sub.ks.sup.mC.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.ds.sup.mC.sub.ds.sup.mC.sub.ksT.sub.ksG.sub.k  79.2  4512  4527 851 570547 A.sub.ksG.sub.ksG.sub.ks.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.ks.sup.mC.sub.ks.sup.mC.sub.k  40.7  4514  4529 852 570548 G.sub.ksA.sub.ksA.sub.ksG.sub.dsG.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.ds.sup.mC.sub.ks.sup.mC.sub.ksA.sub.k  35.9  4516  4531 853 570549 A.sub.ksG.sub.ksG.sub.ksT.sub.dsA.sub.dsA.sub.dsG.sub.dsA.sub.dsG.sub.dsA.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.ks.sup.mC.sub.ks.sup.mC.sub.k  18.8  4613  4628 854 570550 .sup.mC.sub.ks.sup.mC.sub.ksA.sub.ksG.sub.dsG.sub.dsT.sub.dsA.sub.dsA.sub.dsG.sub.dsA.sub.dsG.sub.dsA.sub.ds.sup.mC.sub.ds.sup.mC.sub.ks.sup.mC.sub.ks.sup.mC.sub.k  16.2  4615  4630 855 570551 T.sub.ksT.sub.ks.sup.mC.sub.ks.sup.mC.sub.dsA.sub.dsG.sub.dsG.sub.dsT.sub.dsA.sub.dsA.sub.dsG.sub.dsA.sub.dsG.sub.dsA.sub.ks.sup.mC.sub.ks.sup.mC.sub.k  38.9  4617  4632 856 570552 .sup.mC.sub.ks.sup.mC.sub.ksA.sub.ksT.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.dsG.sub.dsT.sub.dsA.sub.dsA.sub.dsG.sub.ksA.sub.ksG.sub.k  28.6  4620  4635 857 570553 T.sub.ks.sup.mC.sub.ks.sup.mC.sub.ks.sup.mC.sub.dsA.sub.dsT.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.dsG.sub.dsT.sub.dsA.sub.ksA.sub.ksG.sub.k  42.6  4622  4637 858 570554 T.sub.ksA.sub.ksT.sub.ks.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.dsG.sub.ksT.sub.ksA.sub.k  31.8  4624  4639 859 570555 .sup.mC.sub.ks.sup.mC.sub.ksT.sub.ksA.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.ksG.sub.ksG.sub.k  62  4626  4641 860 570556 G.sub.ksA.sub.ks.sup.mC.sub.ks.sup.mC.sub.dsT.sub.dsA.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.dsT.sub.ds.sup.mC.sub.ks.sup.mC.sub.ksA.sub.k  20  4628  4643 861 570557 A.sub.ksA.sub.ksG.sub.ksA.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.dsA.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.ksT.sub.ks.sup.mC.sub.k  29.8  4630  4645 862 570558 T.sub.ksG.sub.ksA.sub.ksA.sub.dsG.sub.dsA.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.dsA.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.ksA.sub.ksT.sub.k  45.5  4632  4647 863 570559 T.sub.ksG.sub.ksG.sub.ks.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsG.sub.dsT.sub.dsT.sub.dsA.sub.dsG.sub.dsA.sub.dsA.sub.ksT.sub.ksT.sub.k  72.7  4650  4665 864 570560 A.sub.ksG.sub.ksT.sub.ksG.sub.dsG.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsG.sub.dsT.sub.dsT.sub.dsA.sub.dsG.sub.ksA.sub.ksA.sub.k  33.7  4652  4667 865 570561 G.sub.ks.sup.mC.sub.ksA.sub.ksG.sub.dsT.sub.dsG.sub.dsG.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsG.sub.dsT.sub.dsT.sub.ksA.sub.ksG.sub.k  17.5  4654  4669 866 570562 A.sub.ksG.sub.ksG.sub.ks.sup.mC.sub.dsA.sub.dsG.sub.dsT.sub.dsG.sub.dsG.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsG.sub.ksT.sub.ksT.sub.k  27.9  4656  4671 867 570563 .sup.mC.sub.ksT.sub.ksA.sub.ksG.sub.dsG.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.dsT.sub.dsG.sub.dsG.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.ks.sup.mC.sub.ksG.sub.k  31.3  4658  4673 868 570564 .sup.mC.sub.ks.sup.mC.sub.ks.sup.mC.sub.ksT.sub.dsA.sub.dsG.sub.dsG.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.dsT.sub.dsG.sub.dsG.sub.ds.sup.mC.sub.ks.sup.mC.sub.ks.sup.mC.sub.k  23.8  4660  4675 869 570565 A.sub.ksG.sub.ksG.sub.ksT.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.dsA.sub.ds.sup.mC.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.ks.sup.mC.sub.ks.sup.mC.sub.k  17.2  4678  4693 870 570566 A.sub.ksT.sub.ksA.sub.ksG.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.dsA.sub.ds.sup.mC.sub.dsA.sub.ks.sup.mC.sub.ksT.sub.k  33.1  4680  4695 871 570567 G.sub.ksA.sub.ksA.sub.ksT.sub.dsA.sub.dsG.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.dsA.sub.ks.sup.mC.sub.ksA.sub.k  51.8  4682  4697 872 570568 G.sub.ksA.sub.ksG.sub.ksA.sub.dsA.sub.dsT.sub.dsA.sub.dsG.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.ksG.sub.ksA.sub.k  20.3  4684  4699 873 570569 .sup.mC.sub.ksA.sub.ksG.sub.ksA.sub.dsG.sub.dsA.sub.dsA.sub.dsT.sub.dsA.sub.dsG.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.ks.sup.mC.sub.ksA.sub.k  19  4686  4701 874

TABLE-US-00018 TABLE 18 Inhibition of human DMPK RNA transcript in HepG2 cells targeting SEQ ID NO: 2 Start Stop Site Site Seq ISIS % Target on Seq on Seq ID No. Sequence Expression ID: 2 ID: 2 No. UTC N/A 100 N/A N/A 445569 .sup.mC.sub.esG.sub.esG.sub.esA.sub.esG.sub.es.sup.mC.sub.dsG.sub.dsG.sub.dsT.sub.dsT.sub.dsG.sub.dsT.sub.dsG.sub.dsA.sub.dsA.sub.ds.sup.mC.sub.es  33.8 13226 13245  24 T.sub.esG.sub.esG.sub.es.sup.mC.sub.e 486178 A.sub.ks.sup.mC.sub.ksA.sub.ksA.sub.dsT.sub.dsA.sub.dsA.sub.dsA.sub.dsT.sub.dsA.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsG.sub.dsA.sub.ksG.sub.ksG.sub.k  24.4 13836 13851  23 570647 G.sub.ks.sup.mC.sub.ksT.sub.ksT.sub.dsG.sub.dsG.sub.dsG.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.ks.sup.mC.sub.ksT.sub.k  60.6  5718  5733 645 570648 A.sub.ksG.sub.ksG.sub.ks.sup.mC.sub.dsT.sub.dsT.sub.dsG.sub.dsG.sub.dsG.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.ds.sup.mC.sub.ks.sup.mC.sub.ks.sup.mC.sub.k  82  5720  5735 646 570649 .sup.mC.sub.ksG.sub.ksA.sub.ksG.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.dsG.sub.dsG.sub.dsG.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.ksA.sub.ks.sup.mC.sub.k 133.4  5722  5737 647 570650 A.sub.ksG.sub.ks.sup.mC.sub.ksG.sub.dsA.sub.dsG.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.dsG.sub.dsG.sub.dsG.sub.ds.sup.mC.sub.ks.sup.mC.sub.ks.sup.mC.sub.k  54.1  5724  5739 648 570651 A.sub.ksG.sub.ksA.sub.ksG.sub.ds.sup.mC.sub.dsG.sub.dsA.sub.dsG.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.dsG.sub.dsG.sub.ksG.sub.ks.sup.mC.sub.k  88.5  5726  5741 649 570652 G.sub.ks.sup.mC.sub.ksA.sub.ksG.sub.dsA.sub.dsG.sub.ds.sup.mC.sub.dsG.sub.dsA.sub.dsG.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.ksG.sub.ksG.sub.k 162.9  5728  5743 650 570653 G.sub.ksA.sub.ksG.sub.ks.sup.mC.sub.dsA.sub.dsG.sub.dsA.sub.dsG.sub.ds.sup.mC.sub.dsG.sub.dsA.sub.dsG.sub.dsG.sub.ds.sup.mC.sub.ksT.sub.ksT.sub.k 130  5730  5745 651 570654 A.sub.ksA.sub.ksA.sub.ksG.sub.dsG.sub.dsA.sub.dsG.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.dsA.sub.dsG.sub.ds.sup.mC.sub.dsG.sub.ksA.sub.ksG.sub.k  66.5  5734  5749 652 570655 .sup.mC.sub.ksA.sub.ksA.sub.ksA.sub.dsA.sub.dsG.sub.dsG.sub.dsA.sub.dsG.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.dsA.sub.dsG.sub.ks.sup.mC.sub.ksG.sub.k  79  5736  5751 653 570656 T.sub.ksG.sub.ksG.sub.ksA.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.dsA.sub.dsA.sub.dsA.sub.dsG.sub.dsG.sub.dsA.sub.dsG.sub.ks.sup.mC.sub.ksA.sub.k  57.4  5741  5756 654 570657 .sup.mC.sub.ks.sup.mC.sub.ksT.sub.ksG.sub.dsG.sub.dsA.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.dsA.sub.dsA.sub.dsA.sub.dsG.sub.dsG.sub.ksA.sub.ksG.sub.k 129.2  5743  5758 655 570658 .sup.mC.sub.ksA.sub.ks.sup.mC.sub.ks.sup.mC.sub.dsT.sub.dsG.sub.dsG.sub.dsA.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.dsA.sub.dsA.sub.dsA.sub.ksG.sub.ksG.sub.k  66.3  5745  5760 656 570659 .sup.mC.sub.ksG.sub.ks.sup.mC.sub.ksA.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.dsG.sub.dsA.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.dsA.sub.ksA.sub.ksA.sub.k  58.7  5747  5762 657 570660 G.sub.ksA.sub.ks.sup.mC.sub.ks.sup.mC.sub.dsG.sub.ds.sup.mC.sub.dsA.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.dsG.sub.dsA.sub.ds.sup.mC.sub.ks.sup.mC.sub.ksA.sub.k  55.4  5750  5765 658 570661 A.sub.ks.sup.mC.sub.ks.sup.mC.sub.ksT.sub.dsT.sub.dsG.sub.dsT.sub.dsA.sub.dsG.sub.dsT.sub.dsG.sub.dsG.sub.dsA.sub.ds.sup.mC.sub.ksG.sub.ksA.sub.k  45.4  5951  5966 659 570662 T.sub.ks.sup.mC.sub.ksA.sub.ks.sup.mC.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.dsG.sub.dsT.sub.dsA.sub.dsG.sub.dsT.sub.dsG.sub.dsG.sub.ksA.sub.ks.sup.mC.sub.k  63.5  5953  5968 660 570663 G.sub.ks.sup.mC.sub.ksT.sub.ks.sup.mC.sub.dsA.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.dsG.sub.dsT.sub.dsA.sub.dsG.sub.dsT.sub.ksG.sub.ksG.sub.k  56.6  5955  5970 661 570664 G.sub.ksG.sub.ksA.sub.ksG.sub.dsA.sub.dsG.sub.dsG.sub.dsA.sub.dsG.sub.dsG.sub.ds.sup.mC.sub.dsG.sub.dsA.sub.dsT.sub.ksA.sub.ksG.sub.k 125.6  6015  6030 662 570665 A.sub.ksG.sub.ksG.sub.ksG.sub.dsA.sub.dsG.sub.dsA.sub.dsG.sub.dsG.sub.dsA.sub.dsG.sub.dsG.sub.ds.sup.mC.sub.dsG.sub.ksA.sub.ksT.sub.k  64.2  6017  6032 663 570666 .sup.mC.sub.ksT.sub.ks.sup.mC.sub.ks.sup.mC.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.dsA.sub.dsG.sub.dsG.sub.ksG.sub.ksA.sub.k  59  6028  6043 664 570667 G.sub.ksT.sub.ksG.sub.ks.sup.mC.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.ksA.sub.ksG.sub.k  82.3  6031  6046 665 570668 A.sub.ksG.sub.ksG.sub.ksT.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.ksA.sub.ksG.sub.k  96.2  6033  6048 666 570669 A.sub.ksG.sub.ksA.sub.ksG.sub.dsG.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.ksT.sub.ks.sup.mC.sub.k  26.2  6035  6050 667 570670 A.sub.ksG.sub.ksA.sub.ksG.sub.dsA.sub.dsG.sub.dsG.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.ksG.sub.ks.sup.mC.sub.k  18.2  6037  6052 668 570671 A.sub.ks.sup.mC.sub.ks.sup.mC.sub.ks.sup.mC.sub.ds.sup.mC.sub.dsG.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.ks.sup.mC.sub.ksA.sub.k  29.2  6291  6306 669 570672 .sup.mC.sub.ksT.sub.ksA.sub.ks.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsG.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsG.sub.ks.sup.mC.sub.ksT.sub.k  50.3  6293  6308 670 570673 A.sub.ks.sup.mC.sub.ks.sup.mC.sub.ksT.sub.dsA.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsG.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.ks.sup.mC.sub.ksG.sub.k  26.8  6295  6310 671 570674 G.sub.ksT.sub.ksA.sub.ks.sup.mC.sub.ds.sup.mC.sub.dsT.sub.dsA.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsG.sub.ds.sup.mC.sub.ds.sup.mC.sub.ks.sup.mC.sub.ks.sup.mC.sub.k  40.8  6297  6312 672 570675 A.sub.ksG.sub.ksG.sub.ksT.sub.dsA.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.dsA.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsG.sub.ks.sup.mC.sub.ks.sup.mC.sub.k  56.1  6299  6314 673 570676 G.sub.ksG.sub.ksG.sub.ksA.sub.dsG.sub.dsG.sub.dsT.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsG.sub.ds.sup.mC.sub.dsA.sub.ksG.sub.ks.sup.mC.sub.k  95  6329  6344 674 570677 G.sub.ksT.sub.ks.sup.mC.sub.ks.sup.mC.sub.dsT.sub.dsT.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.dsA.sub.ds.sup.mC.sub.ksT.sub.ksT.sub.k  23  6360  6375 675 570678 .sup.mC.sub.ksT.sub.ksG.sub.ksT.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.ksA.sub.ks.sup.mC.sub.k  23.4  6362  6377 676 570679 .sup.mC.sub.ksA.sub.ks.sup.mC.sub.ksT.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.ks.sup.mC.sub.ksA.sub.k   7.4  6364  6379 677 570680 G.sub.ksG.sub.ks.sup.mC.sub.ksA.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.dsA.sub.ds.sup.mC.sub.ksT.sub.ks.sup.mC.sub.k  20.6  6366  6381 678 570681 T.sub.ksA.sub.ksG.sub.ksG.sub.ds.sup.mC.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.ksA.sub.ks.sup.mC.sub.k  29  6368  6383 679 570682 G.sub.ksG.sub.ksT.sub.ksA.sub.dsG.sub.dsG.sub.ds.sup.mC.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.ksT.sub.ksT.sub.k  10.5  6370  6385 680 570683 G.sub.ksT.sub.ks.sup.mC.sub.ksA.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.dsG.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.ks.sup.mC.sub.ksT.sub.k  23  6445  6460 681 570684 G.sub.ksG.sub.ksT.sub.ks.sup.mC.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.dsG.sub.dsG.sub.dsT.sub.ks.sup.mC.sub.ks.sup.mC.sub.k  22.5  6446  6461 433 570685 A.sub.ksG.sub.ksG.sub.ksT.sub.ds.sup.mC.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.dsG.sub.dsG.sub.ksT.sub.ks.sup.mC.sub.k  10.2  6447  6462 682 570686 .sup.mC.sub.ksT.sub.ksA.sub.ksG.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.ksG.sub.ksG.sub.k  11.1  6449  6464 683 570687 G.sub.ksT.sub.ks.sup.mC.sub.ksT.sub.dsA.sub.dsG.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.ksT.sub.ksG.sub.k  11.7  6451  6466 684 570688 A.sub.ksA.sub.ksG.sub.ksT.sub.ds.sup.mC.sub.dsT.sub.dsA.sub.dsG.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.ksG.sub.ks.sup.mC.sub.k  14.6  6453  6468 685 570689 G.sub.ks.sup.mC.sub.ksA.sub.ks.sup.mC.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.dsT.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.ks.sup.mC.sub.ksA.sub.k  10.1  6530  6545 686 570690 .sup.mC.sub.ksT.sub.ksG.sub.ks.sup.mC.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.dsT.sub.dsG.sub.dsT.sub.ks.sup.mC.sub.ksT.sub.k  35.4  6532  6547 687 570691 .sup.mC.sub.ks.sup.mC.sub.ks.sup.mC.sub.ksT.sub.dsG.sub.ds.sup.mC.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.dsT.sub.ksG.sub.ksT.sub.k  33.6  6534  6549 688 570692 .sup.mC.sub.ks.sup.mC.sub.ks.sup.mC.sub.ks.sup.mC.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.ksT.sub.ksT.sub.k  77.3  6536  6551 689 570693 .sup.mC.sub.ksT.sub.ksT.sub.ksG.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.dsA.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.dsG.sub.ksA.sub.ksG.sub.k  18.9  6559  6574 690 570694 T.sub.ks.sup.mC.sub.ks.sup.mC.sub.ksT.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.dsA.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.ksG.sub.ksG.sub.k  30.9  6561  6576 691 570695 .sup.mC.sub.ksT.sub.ksT.sub.ks.sup.mC.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.dsA.sub.dsG.sub.dsT.sub.ks.sup.mC.sub.ksA.sub.k  21  6563  6578 692 570696 A.sub.ks.sup.mC.sub.ks.sup.mC.sub.ksT.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.dsA.sub.ksG.sub.ksT.sub.k  50.3  6565  6580 693 570697 G.sub.ksG.sub.ksA.sub.ks.sup.mC.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.ksG.sub.ksA.sub.k  28.3  6567  6582 694 570698 .sup.mC.sub.ksA.sub.ksG.sub.ksG.sub.dsA.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.dsT.sub.dsG.sub.ks.sup.mC.sub.ksT.sub.k  47.6  6569  6584 695 570699 A.sub.ksG.sub.ks.sup.mC.sub.ks.sup.mC.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.dsG.sub.dsA.sub.ds.sup.mC.sub.ds.sup.mC.sub.ksT.sub.ksT.sub.k  17.9  6576  6591 696 570700 T.sub.ksA.sub.ksG.sub.ks.sup.mC.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.ksA.sub.ksG.sub.k  24.1  6594  6609 697 570701 G.sub.ksA.sub.ksT.sub.ksA.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.ks.sup.mC.sub.ks.sup.mC.sub.k  12.9  6596  6611 698 570702 .sup.mC.sub.ksA.sub.ksG.sub.ksA.sub.dsT.sub.dsA.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.ks.sup.mC.sub.ksT.sub.k  24  6598  6613 699 570703 .sup.mC.sub.ksT.sub.ks.sup.mC.sub.ksA.sub.dsG.sub.dsA.sub.dsT.sub.dsA.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.ks.sup.mC.sub.ksA.sub.k  22.3  6600  6615 700 570704 A.sub.ksG.sub.ks.sup.mC.sub.ksT.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.dsA.sub.dsT.sub.dsA.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.ks.sup.mC.sub.ks.sup.mC.sub.k  31.8  6602  6617 701 570705 T.sub.ks.sup.mC.sub.ksA.sub.ksG.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.dsA.sub.dsT.sub.dsA.sub.dsG.sub.ds.sup.mC.sub.ksT.sub.ks.sup.mC.sub.k  33.9  6604  6619 702 570706 T.sub.ks.sup.mC.sub.ksT.sub.ks.sup.mC.sub.dsA.sub.dsG.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.dsA.sub.dsT.sub.dsA.sub.ksG.sub.ks.sup.mC.sub.k  28.1  6606  6621 703 570707 G.sub.ksA.sub.ksG.sub.ksT.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.ksT.sub.ksT.sub.k  37.2  6636  6651 704 570708 G.sub.ksG.sub.ksA.sub.ksG.sub.dsG.sub.dsA.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.ks.sup.mC.sub.ksT.sub.k  66.3  6640  6655 705 570709 G.sub.ksA.sub.ksG.sub.ksG.sub.dsA.sub.dsG.sub.dsG.sub.dsA.sub.dsG.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.ksT.sub.ks.sup.mC.sub.k  52.7  6642  6657 706 570710 .sup.mC.sub.ksA.sub.ksA.sub.ksA.sub.dsA.sub.dsG.sub.dsG.sub.dsG.sub.ds.sup.mC.sub.dsA.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.ksG.sub.ksA.sub.k  31.8  6713  6728 707 570711 A.sub.ksG.sub.ks.sup.mC.sub.ksA.sub.dsA.sub.dsA.sub.dsA.sub.dsG.sub.dsG.sub.dsG.sub.ds.sup.mC.sub.dsA.sub.ds.sup.mC.sub.ds.sup.mC.sub.ks.sup.mC.sub.ksA.sub.k  12.3  6715  6730 708 570712 G.sub.ksG.sub.ksA.sub.ksT.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.dsT.sub.dsA.sub.dsT.sub.dsT.sub.ksG.sub.ksT.sub.k  37.1  6733  6748 709 570713 .sup.mC.sub.ksT.sub.ksG.sub.ksG.sub.dsA.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.dsT.sub.dsA.sub.ksT.sub.ksT.sub.k  42.4  6735  6750 710 570714 T.sub.ksG.sub.ks.sup.mC.sub.ksT.sub.dsG.sub.dsG.sub.dsA.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.dsG.sub.ksT.sub.ksA.sub.k  31.4  6737  6752 711 570715 A.sub.ksT.sub.ksT.sub.ks.sup.mC.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.dsA.sub.dsG.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.dsG.sub.ds.sup.mC.sub.ksA.sub.ksA.sub.k  12.1  6789  6804 712 570716 T.sub.ksA.sub.ksA.sub.ksT.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.dsA.sub.dsG.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.ksG.sub.ks.sup.mC.sub.k   9  6791  6806 713 570717 T.sub.ks.sup.mC.sub.ksT.sub.ksA.sub.dsA.sub.dsT.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.dsA.sub.dsG.sub.dsA.sub.ks.sup.mC.sub.ksT.sub.k  32.1  6793  6808 714 570718 T.sub.ks.sup.mC.sub.ksT.sub.ks.sup.mC.sub.dsT.sub.dsA.sub.dsA.sub.dsT.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.dsA.sub.ksG.sub.ksA.sub.k  71.4  6795  6810 715 570719 .sup.mC.sub.ksT.sub.ks.sup.mC.sub.ks.sup.mC.sub.dsA.sub.dsT.sub.dsA.sub.dsA.sub.dsT.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.ksA.sub.ksA.sub.k  36.9  6804  6819 716 570720 A.sub.ks.sup.mC.sub.ksT.sub.ks.sup.mC.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.dsA.sub.dsA.sub.dsT.sub.dsT.sub.ds.sup.mC.sub.ksT.sub.ks.sup.mC.sub.k  17.1  6807  6822 717 570721 A.sub.ks.sup.mC.sub.ksA.sub.ks.sup.mC.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.dsA.sub.dsA.sub.dsT.sub.ksT.sub.ks.sup.mC.sub.k  23.7  6809  6824 718 570722 .sup.mC.sub.ks.sup.mC.sub.ksA.sub.ks.sup.mC.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.dsT.sub.dsA.sub.ksA.sub.ksT.sub.k  34.4  6811  6826 719 570723 T.sub.ksG.sub.ks.sup.mC.sub.ks.sup.mC.sub.dsA.sub.ds.sup.mC.sub.dsA.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.dsT.sub.ds.sup.mC.sub.ds.sup.mC.sub.dsA.sub.ksT.sub.ksA.sub.k  38.7  6813  6828 720

Example 10: Dose Response Studies with Antisense Oligonucleotides Targeting Human Dystrophia Myotonica-Protein Kinase (DMPK) in HepG2 Cells

[0686] Antisense oligonucleotides targeted to a human DMPK nucleic acid were tested for their effect on human DMPK RNA transcript in vitro. Cultured HepG2 cells at a density of 20,000 cells per well were transfected using electroporation with 61.7 nM, 185.2 nM, 555.6 nM, 1666.7 nM, 5000.0 nM, and 15000.0 nM concentrations of each antisense oligonucleotide. After approximately 24 hours, RNA was isolated from the cells and DMPK RNA transcript levels were measured by quantitative real-time PCR using primer probe set RTS3164 (forward sequence AGCCTGAGCCGGGAGATG, designated herein as SEQ ID NO: 20; reverse sequence GCGTAGTTGACTGGCGAAGTT, designated herein as SEQ ID NO: 21; probe sequence AGGCCATCCGCACGGACAACCX, designated herein as SEQ ID NO: 22). Human DMPK RNA transcript levels were adjusted according to total RNA content, as measured by RIBOGREEN®. Results are presented as percent expression of human DMPK, relative to untreated control (UTC) cells. For example, if the UTC is 100 and a dose of 5000 nM of ISIS No. 445569 yields a % Expression of human DMPK of 35 then the 5000 nM dose of ISIS reduced expression of human DMPK by 65% relative to the UTC. The half maximal inhibitory concentration (IC.sub.50) of each oligonucleotide is presented in the table below and was calculated by plotting the concentrations of oligonucleotides used versus the percent inhibition of human DMPK mRNA expression achieved at each concentration, and noting the concentration of oligonucleotide at which 50% inhibition of human DMPK mRNA expression was achieved compared to the control. The results are presented in Table 19.

[0687] The tested antisense oligonucleotide sequences demonstrated dose-dependent inhibition of human DMPK mRNA levels under the conditions specified above.

TABLE-US-00019 TABLE 19 Dose response studies for with antisense oligonucleotides targeting hDMPK in HepG2 Cells ISIS Dose % Expression of No. (nM) human DMPK IC.sub.50 UTC ND 100 ND 445569 61.7 115.3 2.3 185.2 87.9 555.6 69.0 1666.7 57.2 5000.0 35.0 15000.0 22.6 512497 61.7 108.6 2 185.2 98.4 555.6 77.9 1666.7 57.2 5000.0 28.0 15000.0 12.8 486178 61.7 88.2 0.7 185.2 67.1 555.6 49.4 1666.7 32.8 5000.0 26.7 15000.0 11.8 569473 61.7 107.9 0.6 185.2 66.5 555.6 33.6 1666.7 23.5 5000.0 12.8 15000.0 9.2 570808 61.7 77.2 0.2 185.2 52.7 555.6 20.6 1666.7 8.1 5000.0 7.2 15000.0 5.4 594292 61.7 96.2 5.5 185.2 99.6 555.6 80.0 1666.7 59.0 5000.0 45.5 15000.0 42.8 594300 61.7 101.7 >15 185.2 104.3 555.6 101.6 1666.7 93.6 5000.0 74.9 15000.0 66.8 598768 61.7 95.5 1.2 185.2 83.6 555.6 70.6 1666.7 40.7 5000.0 22.2 15000.0 7.3 598769 61.7 103.9 1.9 185.2 105.3 555.6 76.1 1666.7 50.4 5000.0 29.8 15000.0 12.1 598777 61.7 96.4 0.9 185.2 69.4 555.6 41.8 1666.7 42.8 5000.0 16.4 15000.0 27.1

Example 11: Dose Response Studies with Antisense Oligonucleotides Targeting Human Dystrophia Myotonica-Protein Kinase (hDMPK) in Steinert DM1 Myoblast Cells

[0688] Antisense oligonucleotides targeted to a human DMPK nucleic acid were tested for their effect on human DMPK RNA transcript in vitro. Cultured Steinert DM1 myoblast cells at a density of 20,000 cells per well were transfected using electroporation with 61.7 nM, 185.2 nM, 555.6 nM, 1666.7 nM, 5000.0 nM, and 15000.0 nM concentrations of each antisense oligonucleotide. After approximately 24 hours, RNA was isolated from the cells and DMPK RNA transcript levels were measured by quantitative real-time PCR using primer probe set RTS3164 described above. Human DMPK RNA transcript levels were adjusted according to total RNA content, as measured by RIBOGREEN®. Results are presented as percent (%) expression of human DMPK, relative to untreated control (UTC) cells. The half maximal inhibitory concentration (IC.sub.50) of each oligonucleotide is presented in the table below and was calculated by plotting the concentrations of oligonucleotides used versus the percent inhibition of human DMPK mRNA expression achieved at each concentration, and noting the concentration of oligonucleotide at which 5000 inhibition of human DMPK mRNA expression was achieved compared to the control. The results are presented in Table 20.

[0689] The tested antisense oligonucleotide sequences demonstrated dose-dependent inhibition of human DMPK mRNA levels under the conditions specified above.

TABLE-US-00020 TABLE 20 Dose response studies for with antisense oligonucleotides targeting hDMPK in Steinert DM1 Cells ISIS Dose % Expression of No. (nM) human DMPK IC.sub.50 UTC ND 100 ND 445569 61.7 58.3 0.4 185.2 56.7 555.6 58.5 1666.7 40.9 5000.0 26.0 15000.0 23.5 512497 61.7 78.1 5.1 185.2 77.5 555.6 98.8 1666.7 71.2 5000.0 51.3 15000.0 22.8 486178 61.7 78.0 0.5 185.2 61.3 555.6 43.3 1666.7 27.4 5000.0 24.6 15000.0 16.9 569473 61.7 83.3 0.6 185.2 54.8 555.6 64.5 1666.7 26.1 5000.0 19.4 15000.0 15.4 570808 61.7 103.6 0.9 185.2 77.8 555.6 46.7 1666.7 25.2 5000.0 20.8 15000.0 19.3 594292 61.7 100.1 5.6 185.2 109.7 555.6 72.6 1666.7 66.2 5000.0 39.5 15000.0 45.7 594300 61.7 96.2 5.6 185.2 87.1 555.6 70.3 1666.7 66.4 5000.0 58.1 15000.0 33.2 598768 61.7 77.0 0.7 185.2 62.9 555.6 62.0 1666.7 35.6 5000.0 24.5 15000.0 21.0 598769 61.7 70.3 0.4 185.2 49.2 555.6 55.3 1666.7 33.2 5000.0 27.1 15000.0 13.4 598777 61.7 87.7 1 185.2 61.7 555.6 57.3 1666.7 37.9 5000.0 30.0 15000.0 29.7

Example 12: Dose Response Studies with Antisense Oligonucleotides Targeting Rhesus Monkey Dystrophia Myotonica-Protein Kinase (DMPK) in Cynomolgus Monkey Primary Hepatocytes

[0690] Antisense oligonucleotides targeted to a rhesus monkey DMPK nucleic acid were tested for their effect on rhesus monkey DMPK RNA transcript in vitro. Cultured cynomolgus monkey primary hepatocytes cells at a density of 20,000 cells per well were transfected using electroporation with 61.7 nM, 185.2 nM, 555.6 nM, 1666.7 nM, 5000.0 nM, and 15000.0 nM concentrations of each antisense oligonucleotide. After approximately 24 hours, RNA was isolated from the cells and DMPK RNA transcript levels were measured by quantitative real-time PCR using primer probe set RTS3164 described above. Rhesus monkey DMPK RNA transcript levels were adjusted according to total RNA content, as measured by RIBOGREEN®. Results are presented as percent (%) expression of rhesus monkey DMPK, relative to untreated control (UTC) cells. The half maximal inhibitory concentration (IC.sub.50) of each oligonucleotide is presented in the table below and was calculated by plotting the concentrations of oligonucleotides used versus the percent inhibition of rhesus monkey DMPK mRNA expression achieved at each concentration, and noting the concentration of oligonucleotide at which 50% inhibition of rhesus monkey DMPK mRNA expression was achieved compared to the control.

[0691] The tested antisense oligonucleotide sequences demonstrated dose-dependent inhibition of rhesus monkey DMPK mRNA levels under the conditions specified above.

TABLE-US-00021 TABLE 21 Dose response studies for with antisense oligonucleotides targeting rhesus monkey DMPK in cynomolgus monkey primary hepatocytes ISIS Dose % Expression of No. (nM) human DMPK IC.sub.50 UTC ND 100 ND 445569 61.7 79.7 1.4 185.2 41.1 555.6 58.1 1666.7 33.5 5000.0 46.9 15000.0 50.0 512497 61.7 123.4 1.5 185.2 63.7 555.6 44.8 1666.7 34.1 5000.0 51.2 15000.0 23.5 486178 61.7 51.1 <.06 185.2 30.6 555.6 22.0 1666.7 23.5 5000.0 9.8 15000.0 19.2 569473 61.7 82.1 .2 185.2 39.4 555.6 17.7 1666.7 28.5 5000.0 20.0 15000.0 15.6 570808 61.7 74.6 0.1 185.2 27.6 555.6 16.4 1666.7 25.6 5000.0 8.8 15000.0 21.9 594292 61.7 93.0 >15 185.2 82.1 555.6 106.0 1666.7 91.1 5000.0 62.2 15000.0 70.4 594300 61.7 105.5 >15 185.2 91.8 555.6 114.9 1666.7 65.7 5000.0 110.2 15000.0 118.8 598768 61.7 70.3 0.4 185.2 57.8 555.6 58.5 1666.7 16.5 5000.0 24.0 15000.0 13.4 598769 61.7 76.5 1.1 185.2 65.1 555.6 64.0 1666.7 34.4 5000.0 60.9 15000.0 8.6 598777 61.7 161.4 2.1 185.2 51.7 555.6 47.5 1666.7 34.6 5000.0 27.8 15000.0 52.9

Example 13: In Vivo Antisense Inhibition of hDMPK in DMSXL Transgenic Mice

[0692] To test the effect of antisense inhibition for the treatment of myotonic dystrophy type 1 (DM1), an appropriate mouse model was required. The transgenic mouse model, DMSXL carrying the hDMPK gene with large expansions of over 1000 CTG repeats was generated (Huguet et al., PLOS Genetics, 2012, 8(11), e1003034-e1003043). These DMSXL mice express the mutant hDMPK allele and display muscle weakness phenotype similar to that seen in DM1 patients.

[0693] ISIS 486178 from Table 1 was selected and tested for antisense inhibition of hDMPK transcript in vivo. ISIS 445569 was included in the study for comparison.

Treatment

[0694] DMSXL mice were maintained on a 12-hour light/dark cycle and fed ad libitum normal Purina mouse chow. Animals were acclimated for at least 7 days in the research facility before initiation of the experiment. Antisense oligonucleotides (ASOs) were prepared in PBS and sterilized by filtering through a 0.2 micron filter. ASOs were dissolved in 0.9% PBS for injection.

[0695] DMSXL mice received subcutaneous injections of ISIS 445569 at 50 mg/kg or ISIS 486178 at 25 mg/kg twice per week for 4 weeks. The control group received subcutaneous injections of PBS twice weekly for 4 weeks. Each treatment group consisted of 4 animals.

Inhibition of hDMPK mRNA Levels

[0696] Twenty four hours after the final dose, the mice were sacrificed and tissues were collected. mRNA was isolated for real-time PCR analysis of hDMPK and normalized to 18s RNA. Human primer probe set RTS3164 was used to measure mRNA levels. The results are expressed as the average percent of hDMPK mRNA levels for each treatment group, relative to PBS control.

[0697] Human primer probe set RTS3164 (forward sequence AGCCTGAGCCGGGAGATG, designated herein as SEQ ID NO: 20; reverse sequence GCGTAGTTGACTGGCGAAGTT, designated herein as SEQ ID NO: 21; probe sequence AGGCCATCCGCACGGACAACCX, designated herein as SEQ ID NO: 22).

[0698] As presented in Table 22 below, treatment with antisense oligonucleotides reduced hDMPK transcript expression. The results indicate that treatment with ISIS 445569 and 486178 resulted in reduction of hDMPK mRNA levels in DMSXL mice.

TABLE-US-00022 TABLE 22 Effect of antisense oligonucleotides on hDMPK inhibition in DMSXL mice hDMPK ISIS Dosage Tissue mRNA levels Motif/ No. (mg/kg) Type (% PBS) Length PBS 0 486178 25 Tibialis 70.7 kkk-d10-kkk Anterior (16 mer) Soleus 67.3 Quadriceps 73.9 Latissiumus 71.0 grand dorsi Triceps 67.1 Diaphragm 68.9 Heart 30.8 Brain 11.8 445569 50 Tibialis 38.4 e5-d10-e5 Anterior (20 mer) Soleus 47.5 Quadriceps 41.3 Latissiumus 35.7 grand dorsi Triceps 30.5 Diaphragm 44.7 Heart 7.6 Brain 13.1

Example 14: Effect of ASO Treatment on Muscle Strength in DMSXL Mice Targeting hDMPK

Griptest

[0699] Mice were assessed for grip strength performance in wild-type (WT) and DMSXL forelimb using a commercial grip strength dynamometer as described in the literature ((Huguet et al., PLOS Genetics, 2012, 8(11), e1003034-e1003043).

[0700] DMSXL mice received subcutaneous injections of ISIS 486178 at 25 mg/kg or ISIS 445569 at 50 mg/kg twice per week for 4 weeks. The control DMSXL group received subcutaneous injections of PBS twice weekly for 4 weeks. Each treatment group consisted of 4 animals. The forelimb force for each treatment group and WT was measured at day 0, 30, and 60 using the griptest. The grip strength performance was determined by measuring the force difference between day 60 and day 0. Results are presented as the average forelimb force from each group.

[0701] As illustrated in Table 23, below, treatment with ASOs targeting hDMPK improved muscle strength in DMSXL mice compared to untreated control. ISIS 486178, an ASO with cEt modifications, demonstrated substantial improvement in the forelimb strength (+3.4) compared to ISIS 445569 with MOE modifications (+0.38).

TABLE-US-00023 TABLE 23 Effect of ASO treatment on muscle strength in DMSXL mice targeting hDMPK Forelimb force (g) Treatment group Day 0 Day 30 Day 60 Δ = Day 60 − Day 0 Untreated control 72.2 70.2 67.5 −4.6 ASO 486178 62.3 65.7 65.6 +3.4 ASO 445569 64.3 68 64.7 +0.38 Wild type (WT) 75.2 76.5 78.4 +3.2

Example 15: Effect of ASO Treatment on Muscle Fiber Distribution in DMSXL Mice Targeting hDMPK

[0702] The muscle fiber distribution in DMSXL mice targeting hDMPK in the presence and absence of ISIS 445569 and 486178 was also assessed. Both ASOs were previously described in Table 1, above.

[0703] DMSXL mice received subcutaneous injections of ISIS 486178 at 25 mg/kg or ISIS 445569 at 50 mg/kg twice per week for 4 weeks. The control DMSXL group received subcutaneous injections of PBS twice weekly for 4 weeks. Each treatment group consisted of 4 animals. The muscle fiber distribution was assessed and the results are presented Table 44, below.

[0704] As illustrated, treatment with ASOs targeting hDMPK decreased the distribution of DM1 Associated Type 2c muscle fiber in the tibialis anterior (TA) of DMSXL mice compared to untreated control. The results demonstrated that normal pattern of fiber distribution in the skeletal muscles can be restored with ASO treatment. ISIS 445569 demonstrated an improvement in the muscle fiber distribution as compared to the untreated control; however ISIS 486178, an ASO with cEt modifications, demonstrated muscle fiber distribution that was more consistent with the muscle fiber distribution found in the wild-type mice.

TABLE-US-00024 TABLE 24 Effect of ASO treatment on muscle fiber distribution in DMSXL mice targeting hDMPK Fiber Type Distribution in TA muscle Treatment group Fiber 1 Fiber 2a Fiber 2c Untreated control   4% 25% 5.90% ASO 486178 3.10% 15% 0.70% ASO 445569   4% 21%   2% Wild type (WT) 3.30% 15% 0.00%

Example 16: Dose-Dependent Antisense Inhibition of hDMPK in DMSXL Transgenic Mice

[0705] The newly designed ASOs from Table 1, above, were further evaluated in a dose-response study for antisense inhibition of hDMPK transcript in vivo. ISIS 445569 was included in the study for comparison.

Treatment

[0706] DMSXL mice were maintained on a 12-hour light/dark cycle and fed ad libitum normal Purina mouse chow. Animals were acclimated for at least 7 days in the research facility before initiation of the experiment. Antisense oligonucleotides (ASOs) were prepared in PBS and sterilized by filtering through a 0.2 micron filter. ASOs were dissolved in 0.9% PBS for injection.

[0707] DMSXL mice received subcutaneous injections of PBS or ASOs from Table 1, above, targeting hDMPK. The ASO was dosed twice per week for 4 weeks at the indicated doses in Table 25, below. The control group received subcutaneous injections of PBS twice weekly for 4 weeks. Each treatment group consisted of 4 animals.

Inhibition of hDMPK mRNA Levels

[0708] Forty eight hours after the final dose, the mice were sacrificed and tissue from the tibialis anterior muscles, quadriceps muscles (left), gastrocnlemius muscles, heart and diaphragm was isolated. mRNA was isolated for real-time PCR analysis of hDMPK and normalized to RIBOGREEN®. Human primer probe set RTS3164 was used to measure mRNA levels. The results summarized in Table 25, below, were independently generated from various dose-response studies. The results are presented as the average percent of hDMPK mRNA expression levels for each treatment group, relative to PBS control.

[0709] As presented, treatment with antisense oligonucleotides reduced hDMPK transcript expression in a dose-dependent manner.

TABLE-US-00025 TABLE 25 Dose-dependent inhibition of hDMPK mRNA levels in DMSXL mice ISIS mg/ hDMPK mRNA levels (% PBS) No. kg/wk TA Quad (Left) Gastroc Heart Diaphragm PBS 0 100 100 100 100 100 445569 50 54.7 80.3 97.1 55.4 21.7 100 28.3 42.1 71.3 48.9 19.7 200 22.2 33.9 45.2 34.2 10.0 512497 50 23.8 48.9 52.9 44.4 35.0 100 9.7 28.7 24.8 43.8 24.2 200 11.4 22.4 16.4 42.0 15.2 486178 25 59.1 56.1 63.1 75.3 39.1 50 33.8 61.9 58.7 59.2 32.5 100 36.6 65.8 51.6 47.3 26.2 570808 25 26.3 41.1 39.8 44.9 17.3 50 12.2 13.0 36.3 18.4 8.1 100 6.1 5.4 7.9 10.2 3.0 594292 25 48.8 32.2 68.8 70.6 72.7 50 32.0 30.4 41.1 85.1 48.3 100 31.6 39.6 53.3 63.9 40.2 598768 25 16.9 27.1 27.5 56.3 26.9 50 10.2 33.6 24.1 30.8 20.2 100 6.8 22.0 25.5 22.6 13.1 598769 25 21.6 50.8 48.1 61.0 30.3 50 12.7 25.1 42.3 36.4 16.7 100 12.8 18.4 33.2 32.0 20.2 569473 25 42.0 21.8 48.9 51.8 34.8 50 41.6 16.2 47.6 55.6 23.6 100 31.9 19.2 31.9 35.6 20.5 594300 25 114.5 56.7 96.2 91.0 62.6 50 44.3 22.3 52.8 69.3 54.7 100 73.0 22.6 56.6 78.3 44.5 598777 25 49.4 28.8 76.1 97.1 58.7 50 44.8 13.6 36.5 87.4 40.8 100 31.8 10.1 22.5 86.8 33.6 TA = Tibialis Anterior; Quad = Quadriceps; Gastroc = Gastrocnemius

Example 17: Six Week In Vivo Tolerability Study in CD-1 Mice

[0710] The newly designed ASOs from Table 1, above, were further evaluated in a 6 week study to assess plasma chemistry, body/organ weights and histology. Groups of CD-1 mice were administered 100 mg/kg/wk of ISIS 445569 or ISIS 512497. Further groups of CD-1 mice were administered 50 mg/kg/wk of ISIS 486178, ISIS 570808, ISIS 594292, ISIS 598768, ISIS 598769, ISIS 569473, ISIS 594300, and ISIS 598777. After six weeks and two days after each group of mice received the last dose, the mice were sacrificed and tissues were collected for analysis. For each group of mice, analysis to measure alanine transaminase levels, aspartate aminotransferase levels, blood urea nitrogen (BUN) levels, albumin levels, total bilirubin, and creatine levels was measured. Additionally, organ weights were also measured, the results of which are presented in the tables below.

TABLE-US-00026 TABLE 26 Plasma Chemistry in CD-1 mice ISIS ALT AST BUN Albumin T. Bil Creatinine No. (U/L) (U/L) (mg/dL) (g/dL) (mg/dL) (mg/dL) PBS 31.75 60.75 32.73 2.99 0.23 0.16 486178 65.00 103.00 27.18 2.90 0.19 0.13 445569 162.75 195.25 29.70 3.38 0.26 0.14 570808 313.50 332.50 32.40 2.81 0.28 0.15 594292 58.75 133.00 28.15 2.94 0.21 0.13 598768 45.50 92.00 26.85 2.90 0.21 0.11 598769 69.25 94.25 32.73 2.89 0.18 0.13 512497 101.25 144.50 26.90 2.90 0.19 0.12 569473 75.75 137.00 28.98 3.05 0.26 0.13 594300 46.00 76.75 24.70 2.94 0.18 0.11 598777 186.50 224.25 24.68 2.97 0.30 0.11

TABLE-US-00027 TABLE 27 Body & Organ Weights in CD-1 mice ISIS *Kidney *Liver *Spleen No. % BW % BW % BW PBS 1.00 1.00 1.00 486178 1.05 1.05 1.03 445569 1.07 1.09 1.23 570808 0.94 1.27 1.43 594292 1.03 1.03 1.16 598768 1.14 1.08 0.97 598769 0.97 1.05 1.04 512497 0.99 1.17 1.38 569473 1.02 1.01 1.09 594300 1.14 1.07 1.02 598777 1.05 1.20 1.01 *Fold change over Saline control group

Example 18: Six Week In Vivo Tolerability Study in Sprague-Dawley Rats

[0711] The newly designed ASOs from Table 1, above, were further evaluated in a 6 week study to assess plasma chemistry, body/organ weights and histology. Groups of Sprague-Dawley rats were administered 100 mpk/wk of ISIS 445569 or ISIS 512497. Further groups of Groups of Sprague-Dawley rats were administered 50 mpk/wk of ISIS 486178, ISIS 570808, ISIS 594292, ISIS 598768, ISIS 598769, ISIS 569473, ISIS 594300, and ISIS 598777. After six weeks and two days after each group of mice received the last dose, the mice were sacrificed and tissues were collected for analysis. For each group of mice, analysis to measure alanine transaminase levels, aspartate aminotransferase levels, blood urea nitrogen (BUN) levels, albumin levels, total bilirubin, creatine levels, and urinary creatine levels was measured. Additionally, organ weights were also measured, the results of which are presented in the tables below.

TABLE-US-00028 TABLE 28 Plasma Chemistry & Urine Analysis in Sprague-Dawley Rats ISIS ALT AST BUN Total protein T. Bil Creatinine Urine No. (U/L) (U/L) (mg/dl) (mg/dl) (mg/dl) (mg/dl) MTP/Creatine Saline 59.25 100.35 18.05 3.47 0.158 0.30 1.09 569473 101 198.25 25.9 2.74 0.195 0.4025 4.59 512497 211 240.25 19.32 3.58 0.17 0.39 6.18 598768 78.2 103.5 20.6 3.36 0.14 0.38 3.85 598769 84.5 104.5 18.6 3.52 0.15 0.34 3.02 570808 82 141 23.8 3.08 0.21 0.4 2.71 598777 109 119.5 21.65 3.79 0.22 0.37 2.56 445569 117.5 163.2 22.45 3.86 0.18 0.47 6.4 594300 66 80.75 17.53 3.59 0.12 0.29 4.72 486178 56.8 80.75 23.3 5.28 0.08 3.0 4.5 594292 64.5 80.5 19.62 3.38 0.098 0.29 5.17

TABLE-US-00029 TABLE 29 Plasma Chemistry & Urine Analysis in Sprague-Dawley Rats ISIS Kidney Liver Spleen No. (fold)* (fold)* (fold)* Saline 1 1 1 569473 1.46 1.20 0.82 512497 1.03 1.22 1.94 598768 0.92 0.92 1.49 598769 0.93 1.04 0.98 570808 1.18 0.98 2.43 598777 1.07 0.93 2.31 445569 1 1.13 3.25 594300 1.03 1.04 1.94 486178 0.87 0.89 1.45 594292 1.08 1.01 2.04 *Fold change over Saline control group

Example 19: Thirteen (13) Week In Vivo Study in Cynomolgus Monkeys

[0712] Groups of 4 cynomolgus male monkeys were administered 40 mg/kg/wk of ISIS 445569, ISIS 512497, ISIS 486178, ISIS 570808, ISIS 594292, ISIS 598768, ISIS 598769, ISIS 569473, ISIS 594300, and ISIS 598777 via subcutaneous injection. Thirteen weeks after the first dose, the animals were sacrificed and tissue analysis was performed. mRNA was isolated for real-time PCR analysis of rhesus monkey DMPK and normalized to RIBOGREEN®. Primer probe set RTS3164 (described above) was used to measure mRNA levels and the results are shown in Table 30 below. Additionally, further mRNA was isolated for real-time PCR analysis of rhesus monkey DMPK and normalized to RIBOGREEN® using primer probe set RTS4447 and the results are shown in Table 31 below. RTS4447 (forward sequence AGCCTGAGCCGGGAGATG, designated herein as SEQ ID NO: 20; reverse sequence GCGTAGTTGACTGGCAAAGTT, designated herein as SEQ ID NO: 21; probe sequence AGGCCATCCGCATGGCCAACC, designated herein as SEQ ID NO: 22).

TABLE-US-00030 TABLE 30 Dose-dependent inhibition of DMPK mRNA levels in Cynomolgus Monkeys using Primer Probe Set RTS3164 ISIS mg/ hDMPK mRNA levels (% PBS) No. kg/wk TA Quad (Left) Gastroc Kidney Heart Liver PBS 0 100 100 100 100 100 100 486178 40 26.1 30.8 49.3 55.3 45.8 44.9 445569 40 68.5 82.2 128.9 65.6 91.2 113.5 512497 40 60.3 58.7 66.7 61.9 74.2 68.1 598768 40 69.1 64.9 80.7 58.1 70.6 100.8 594300 40 73.6 80.2 106.0 57.9 97.5 91.6 594292 40 55.6 52.0 71.9 46.2 72.1 81.6 569473 40 44.8 31.7 61.6 44.0 58.7 28.0 598769 40 31.7 28.9 49.7 26.8 45.0 38.6 570808 40 2.5 4.4 6.4 29.7 17.5 7.2 598777 40 53.3 31.8 76.4 42.7 44.6 111.6

TABLE-US-00031 TABLE 31 Dose-dependent inhibition of DMPK mRNA levels in Cynomolgus Monkeys using Primer Probe Set RTS4447 ISIS mg/ hDMPK mRNA levels (% PBS) No. kg/wk TA Quad (Left) Gastroc Kidney Heart Liver PBS 0 100.0 100.0 100.0 100.0 100.0 100.0 486178 40 26.7 29.0 32.9 57.0 49.4 58.1 445569 40 85.4 87.4 147.1 77.1 97.2 93.6 512497 40 66.4 70.4 94.2 81.9 87.6 79.5 598768 40 48.3 76.4 106.7 73.7 81.0 85.1 594300 40 100.9 113.5 219.6 96.9 131.0 118.9 594292 40 76.5 75.7 151.7 86.6 107.1 108.6 569473 40 52.6 51.7 114.2 72.9 87.2 53.7 598769 40 45.2 57.6 86.3 56.6 65.4 72.5 570808 40 6.6 8.3 14.8 60.7 27.9 35.0 598777 40 55.1 56.8 124.1 78.6 88.9 131.2

Example 20: Thirteen (13) Week In Vivo Tolerability Study in Cynomolgus Monkeys

[0713] Groups of cynomolgus male monkeys were administered 40 mg/kg of ISIS 445569, ISIS 512497, ISIS 486178, ISIS 570808, ISIS 594292, ISIS 598768, ISIS 598769, ISIS 569473, ISIS 594300, and ISIS 598777 via subcutaneous injection on days 1, 3, 5, and 7. Following administration on day 7, each monkey was administered 40 mg/kg/wk of ISIS 445569, ISIS 512497, ISIS 486178, ISIS 570808, ISIS 594292, ISIS 598768, ISIS 598769, ISIS 569473, ISIS 594300, and ISIS 598777 via subcutaneous injection.

[0714] 48 hours after each monkey received a subcutaneous dose on days 28 and 91, blood and urine samples were taken for analysis. Some of the monkeys had blood and urine taken 48 hours after the dose given on day 56. Alanine aminotransferase (ALT), aspartate aminotransferase (AST), lactate dehydrogenase (LDH), and creatine kinase (CK) were measured for each animal in a treatment group and the average values are presented in the table below. Day of Sample values with a negative represent time point before treatment began. For example, a Day of Treatment value of −7 represents a sample taken 7 days before the first dose. Thirteen weeks after the first dose, the animals were sacrificed and tissue analysis was performed.

TABLE-US-00032 TABLE 32 Plasma Chemistry & Urine Analysis in Cynomolgus Monkeys ISIS Day of ALT AST LDH CK No. Sample (U/L) (U/L) (mg/dl) (mg/dl) Saline −14 34.2 25.9 604.0 160.8 −7 38.8 27.8 861.3 249.0 30 43.0 34.4 1029.0 300.0 93 66.1 43.0 1257.3 898.8 486178 −14 37.6 40.5 670.0 236.8 −7 49.8 55.0 1039.8 380.8 30 47.0 41.2 875.4 415.0 93 59.7 43.6 960.6 809.6 594292 −14 38.9 32.0 776.3 375.8 −7 37.8 38.4 877.3 210.0 30 35.4 39.6 666.0 93.8 93 49.8 46.3 958.5 339.0 569473 −14 49.4 49.8 1185.3 365.3 −7 50.4 59.7 1609.5 261.0 30 46.7 52.5 1390.8 107.8 93 56.3 49.8 1483.3 524.5 570808 −14 47.1 46.8 896.0 448.3 −7 44.4 63.6 913.3 257.3 30 47.1 57.7 660.5 125.0 93 79.8 92.2 813.5 294.0 598768 −14 37.9 41.6 666.3 253.8 −7 41.4 53.5 754.0 231.5 30 37.2 38.9 652.3 106.3 93 45.8 41.5 721.3 238.3 598769 −14 44.2 36.1 1106.8 456.8 −7 45.7 41.5 1323.3 214.0 30 40.3 42.0 981.0 147.8 58 56.7 49.9 1101.5 552.3 93 69.0 50.3 1167.3 749.5 512497 −14 31.5 34.3 689.3 293.8 −7 39.0 45.4 1110.3 286.0 30 47.2 60.2 960.5 202.5 93 69.6 87.1 997.0 1118.5 594300 −14 42.0 34.0 935.5 459.5 −7 42.1 53.6 1020.5 272.0 30 28.0 34.6 620.8 124.5 58 42.9 48.5 883.5 169.8 93 45.7 45.7 835.5 252.3 598777 −14 45.6 37.7 707.0 558.5 −7 43.3 50.0 705.8 200.3 30 50.2 47.3 585.3 159.3 93 79.2 56.1 1029.0 785.0 445569 −14 40.2 44.2 835.8 404.0 −7 41.0 46.1 1074.3 305.5 30 45.9 61.7 994.8 283.0 58 51.6 85.1 739.0 117.8 93 99.3 97.5 1583.5 2114.0