ISOLATED INTERLEUKIN-34 POLYPEPTIDE FOR USE IN PREVENTING TRANSPLANT REJECTION AND TREATING AUTOIMMUNE DISEASES

20210401940 · 2021-12-30

    Inventors

    Cpc classification

    International classification

    Abstract

    The invention relates to an isolated interleukin-34 (IL-34) polypeptide for use in preventing or treating graft rejection, autoimmune disease, unwanted immune response against therapeutic proteins and allergy. The invention also provides an in vitro method for determining whether a patient is at risk of transplant rejection, autoimmune diseases, unwanted immune response against therapeutic proteins or allergies, comprising a step of determining the expression level of IL-34 in a biological sample obtained from said patient, wherein the presence of IL-34 is indicative of a reduced risk of transplant rejection, autoimmune diseases, unwanted immune response against therapeutic proteins or allergies.

    Claims

    1. A method of preventing or treating an autoimmune disease, an unwanted immune response against a therapeutic protein or an allergy in a subject in need thereof, comprising administering interleukin-34 (IL-34) to said subject.

    2. The method according to claim 1, wherein IL-34 is administered to the subject in the form of an IL-34 polypeptide.

    3. The method according to claim 2, wherein the IL-34 polypeptide has an amino acid sequence sharing at least 80% of sequence identity with the amino acid sequence of SEQ ID NO: 1 while maintaining its ability to inhibit CD4.sup.+ and CD8.sup.+ T cell proliferation in a mixed lymphocyte reaction (MLR).

    4. The method according to claim 2, wherein the IL-34 polypeptide has an amino acid sequence sharing at least 80% of sequence identity with the amino acid sequence of SEQ ID NO: 1 while maintaining its ability to inhibit CD4.sup.+ and CD8.sup.+ T cell proliferation in a mixed lymphocyte reaction (MLR), and wherein the IL-34 polypeptide comprises one of an E123Q substitution, a S195T substitution, and a Q81 deletion.

    5. The method according to claim 2, wherein the IL-34 polypeptide is a full-length human IL-34 polypeptide with an amino acid sequence of SEQ ID NO: 1.

    6. The method according to claim 1, wherein IL-34 is administered to the subject in the form of a vector comprising a polynucleotide encoding an IL-34 polypeptide.

    7. The method according to claim 6, wherein the IL-34 polypeptide has an amino acid sequence sharing at least 80% of sequence identity with the amino acid sequence of SEQ ID NO: 1 while maintaining its ability to inhibit CD4.sup.+ and CD8.sup.+ T cell proliferation in a mixed lymphocyte reaction (MLR).

    8. The method according to claim 6, wherein the IL-34 polypeptide has an amino acid sequence sharing at least 80% of sequence identity with the amino acid sequence of SEQ ID NO: 1 while maintaining its ability to inhibit CD4.sup.+ and CD8.sup.+ T cell proliferation in a mixed lymphocyte reaction (MLR), and wherein the IL-34 polypeptide comprises one of an E123Q substitution, a S195T substitution, and a Q81 deletion.

    9. The method according to claim 6, wherein the IL-34 polypeptide is a full-length human IL-34 polypeptide with an amino acid sequence of SEQ ID NO: 1.

    10. The method according to claim 6, wherein the vector is a viral vector.

    11. The method according to claim 10, wherein the viral vector is selected from the group consisting of adeno-associated viruses, adenoviruses, retroviruses, SV40-type viruses, polyoma viruses, Epstein-Barr viruses, papilloma viruses, herpes viruses, vaccinia viruses, polio viruses, and RNA viruses.

    12. The method according to claim 10, wherein the viral vector is an adeno-associated virus (AAV) vector.

    13. The method according to claim 12, wherein the AAV vector is a serotype 8 AAV vector.

    14. The method according to claim 1, wherein the autoimmune disease is selected from the group consisting of rheumatoid arthritis, juvenile oligoarthritis, collagen-induced arthritis, adjuvant-induced arthritis, Sjogren's syndrome, multiple sclerosis, experimental autoimmune encephalomyelitis, inflammatory bowel disease, autoimmune gastric atrophy, pemphigus vulgaris, psoriasis, vitiligo, type 1 diabetes, non-obese diabetes, myasthenia gravis, Grave's disease, Hashimoto's thyroiditis, sclerosing cholangitis, sclerosing sialadenitis, systemic lupus erythematosus, autoimmune thrombocytopenia purpura, Goodpasture's syndrome, Addison's disease, systemic sclerosis, polymyositis, dermatomyositis, acquired hemophilia, and thrombotic thrombocytopenic purpura.

    15. The method according to claim 1, wherein the autoimmune disease is inflammatory bowel disease.

    16. The method according to claim 15, wherein inflammatory bowel disease is one of Crohn's disease and ulcerative colitis.

    17. The method according to claim 1, wherein the autoimmune disease is multiple sclerosis.

    18. The method of claim 1, wherein the therapeutic protein is selected from the group consisting of antibodies, cytokines, enzymes, and coagulation factors.

    19. The method of claim 1, wherein the allergy is selected from the group consisting of include eczema, hives, hay fever, asthma, food allergies, and reactions to venom of stinging insects.

    Description

    FIGURES:

    [0205] FIG. 1: Increased IL-34 expression in grafts and splenic CD8+Tregs following treatment with CD40Ig. A. FACS Aria-sorted CD8+CD45RClow Tregs from spleen of naive or 120 days old AdCD40Ig-treated recipients (n=6) were analysed for IL-34 mRNA expression by quantitative RT-PCR. Cardiac grafts (B) and spleen (C) from AdCD40Ig-treated recipients at day 5 (n=3) and 120 (n=7) after transplantation was compared with grafts from non-treated-recipients at day 5 (n=8), day 7 (n=8) and day 120 (n=6) and native hearts from naive animals (n=7) for IL-34 mRNA expression. (D) CD8+CD45RC.sup.low Tregs were sorted from the spleen of CD40Ig-treated rats and analyzed for their expression of IL-34 (black) after 7 hours stimulation with PMA ionomycin (24 μg/mL). Grey-filled histogram represents the isotype control staining. Mann Whitney, *p<0.05, ** p<0.01.

    [0206] FIG. 2: IL-34 and CD115, but not M-CSF, were involved in CD8+CD45RClow Treg-mediated suppression. The relative proportion of CFSE-labeled LEW.1A dividing

    [0207] CD4+CD25− T cells stimulated with donor LEW.1W pDCs was analyzed after 6 days of culture, in the presence of LEW.1A CD8+CD45RClow Tregs at a 1:1 effector:suppressor ratio. The proliferation after addition of an anti-IL-34-blocking Ab (A), an anti-M-CSF blocking Ab (B) or an anti-CD115 blocking Ab (C) was evaluated compared to isotypic control (n=4 in triplicates). Results are expressed as mean ±SEM of normalized percentage of proliferation vs. proliferation in the absence of CD8+ Tregs (100%).*, p<0.01.

    [0208] FIG. 3: Detection of IL-34 using an AAV-IL-34 and inhibition of allo-T cell responses. A. Supernatants of AAV-IL-34 or AAV-GFP-transduced cells were tested for suppression of CD4.sup.+CD25.sup.− T cell proliferation in response to allogeneic pDCs and analysed by flow cytometry for CFSE dilution after 5 days of culture. CD8.sup.+ Tregs were used as positive control of suppression. n=3 in duplicates; Results are expressed as mean ±SEM of normalized percentage of proliferation vs. proliferation in the absence of CD8.sup.+ Tregs (100%). Representative histogram of 1 experiment; filled grey: proliferation of CD4.sup.+ T cells cocultured with pDC with 20% AAVGFP-transduced cell supernatent; black line: with 20% AAV-IL-34-transduced cells supernatant. B. Serial dilution of sera from AAV-IL-34 or AAV-GFP-treated rats or naive animals were tested for suppression of CD4.sup.+CD25.sup.− T cell proliferation in response to allogeneic pDCs and analysed by flow cytometry for CFSE dilution after 5 days of culture. CD8.sup.+ Tregs were used as positive control of suppression. n=3 in duplicates; Results are expressed as mean ±SEM of normalized percentage of proliferation vs. proliferation in the absence of CD8.sup.+ Tregs (100%). *, p<0.01; **, p<0.001; ***, p<0.0001 vs. sera from naïve animals

    [0209] FIG. 4: IL-34 gene transfer prolongs allograft survival in a dominant manner. Recipients received intravenously 10.sup.12 vg/rat of AAV-IL-34 or non-coding AAV or untreated, were grafted 30 days later with no additional treatment or in combination with suboptimal dose of rapamycin (14 days, starting day 0). Graft survival was evaluated by palpation through the abdominal wall. ***p<0.0001.

    [0210] FIG. 5: Serial tolerance mediated by Tregs after IL-34 induction. A. LEW.1A recipients were sublethally irradiated (4.5 Gy) at day −1 and received heart allografts and i.v. injections of 1,5.10.sup.8 splenocytes from long surviving recipient or naive animals at day 0. Graft survival was monitored by abdominal palpation. B. LEW.1A recipients were sublethally irradiated (4.5 Gy) at day −1 and received heart allografts and i.v. injections of total splenocytes or purified sub-populations (T cells : 4.10.sup.7; B cells : 6.10.sup.7, CD11b/c+cells : 1,5.10.sup.7; CD8.sup.+CD45RC.sup.low Tregs : 4×10.sup.6; CD4.sup.+CD25.sup.high Tregs: 4×10.sup.6) from long surviving recipient at day 0. Graft survival was monitored by abdominal palpation. Log Rank test, ** p<0.01, *p<0.05.

    [0211] FIG. 6: M-CSF mediated dose dependent suppression of anti-donor effector CD4.sup.+CD25.sup.−T cells responses. (A) FACS Aria-sorted CD8.sup.+CD45RC.sup.low Tregs from spleen of naive or 120 days old AdCD40Ig-treated recipients (n=6) were analysed for M-CSF mRNA expression by quantitative RT-PCR. *p<0.05. (B) Rat M-CSF (0.1 to 2 μg/ml final concentration) was tested for suppressive activity on CFSE-labelled CD4.sup.+CD25.sup.− T-cell proliferation after 6 days of culture. CD8.sup.+Tregs were used as positive control of suppression. n=3 in triplicates. Results are expressed as mean±SEM of normalized percentage of proliferation vs. proliferation in the absence of CD8.sup.+Tregs (100%). *, p<0.01.

    [0212] FIGS. 7A-B: Transcript accumulation in macrophages following IL34 treatment. mRNA expression was assessed by real-time quantitative PCR on sorted macrophages from untreated spleen or AAV-IL34-treated spleen, blood and graft of recipients at day 15 post-transplantation. Results are normalized to HPRT and expressed as 2.sup.−ddCT+/−SEM. Kruskal Wallis and Dunn's post test, *, p<0.01.

    [0213] FIG. 8: Macrophages depletion resulted in allograft rejection following IL34 treatment. Recipients receiving at day −30 intravenously 10.sup.12 vg/rat of AAV-IL34 or non-coding AAV or were untreated with or without weekly intraperitoneal administration of clodronate liposomes from day −25 to day 3, and were grafted at day 0 in combination with suboptimal dose of rapamycin (10 days, starting day 0). Graft survival was evaluated by palpation through the abdominal wall. Log Rank test, **p<0.01.

    [0214] FIG. 9: IL34 is involved in human CD4+ and CD8+ Treg's suppressive activity, that can inhibit anti-donor immune responses. (A) Soluble IL34 was tested for suppression of CD4.sup.+CD25.sup.−T cell proliferation in response to allogeneic T-depleted PBMCs and analyzed by flow cytometry for CFSE dilution after 5 days of culture. n=2 to 5 in duplicates; Results are expressed as mean ±SEM of relative proportion of dividing CD4.sup.+CD25.sup.− T cells. (B) The relative proportion of CFSE-labeled dividing CD4.sup.+CD25.sup.− T cells stimulated with allogeneic T-depleted PBMCs was analyzed after 5 days of culture, in the presence of CD8.sup.+CD45RC.sup.low or CD4.sup.+CD25.sup.high Tregs at 1:1 effector:suppressor ratios. The proliferation after addition of anti-IL34-blocking Ab was evaluated and compared to isotypic control (n=5-6 in triplicates). The proportion of dividing CD4.sup.+CD25.sup.− T cells in the control proliferation condition with allogeneic T-depleted PBMCs only represented approximately 60% of the cells on day 5 and was given a value of 100 in each experiment. Results are expressed as mean ±SEM of the relative proportion of dividing CD4.sup.+CD25.sup.− T cells.

    EXAMPLE 1

    INTERLEUKIN-34, A NEW TREG-SPECIFIC CYTOKINE MEDIATOR OF TRANSPLANT TOLERANCE

    Material & Methods

    [0215] Healthy volunteer blood collection and PBMC separation: Blood was collected from healthy donors, after informed consent was given, at the Etablissement Francais du Sang (Nantes, France). Blood was diluted 2-fold with PBS before PBMCs were isolated by Ficoll-Paque density-gradient centrifugation (Eurobio) at 2000 rpm for 30 min at room temperature without braking. Collected PBMCs were washed in 50 mL PBS at 1800 rpm for 10 min.

    [0216] Animals and cardiac transplantation models: Heart allotransplantation was performed between whole MHC incompatible male LEW-1W (donors) and LEW-1A (recipients) rats as previously described (15). Heart survival was evaluated by palpation through the abdominal wall and heart beating was graded from +++to −. The experiments were approved by the regional ethical committee for animal experimentation.

    [0217] IL-34 quantitative RT-PCR: The isolation and retrotranscription of mRNA as well as the quantification of specific mRNA levels using Taqman technology after normalization to HPRT values have been described (15). The probes sequences were for forward primer 5′ CTGGCTGTCCTCTACCCTGA 3′ (SEQ ID NO: 2) and for reverse primer 5′ TGTCGTGGCAAGATATGGCAA 3′ (SEQ ID NO: 3).

    [0218] Cell sorting, monoclonal antibodies and flow cytometry: Macrophages were sorted on TCRαβ (R7/3) and TCRγδ (V65) negative cells, CD45RA-FITC (OX33), and CD11b/c-APC (OX42) positive cells. Naive LEW.1A CD4.sup.+CD25.sup.− T cells, LEW.1W pDC and LEW.1A CD8.sup.+CD45RC.sup.low Tregs subsets were sorted as previously described (16). The antibodies used for T cells (TCRαβ, clone R7/3), CD4.sup.+CD25.sup.− T cells (clones OX35 and OX39), CD8.sup.+ T cells (clone OX8), CD8.sup.+CD45RC.sup.low T cells (clones OX8 and OX22), and CD4.sup.+CD45R.sup.+85C7.sup.+ pDCs (clones His24, OX35 and 85C7) sorting were obtained from the European Collection of Cell Culture (Salisbury, UK). All biotin-labelled mAbs were visualized using Strepavidin-PE-Cy7 (BD Biosciences) or Streptavidin-Alexa405. Human CD4.sup.+CD25.sup.− T cells were sorted by gating on CD3.sup.+CD4.sup.+CD25.sup.− cells (clones SKY7, L-200 and MA251), CD4.sup.+ Tregs by gating on CD25high and CD127low cells (clone HIL7-R M21), and CD8.sup.+ Tregs by gating on CD3+CD4-CD45RClow cells (clone MT2). IL-34-Myc was detected using an anti-myc antibody (9E10, Sigma). IL-34, CD115, and MCSF were blocked with the anti-IL-34 (PAB16574, Abnova), anti-CD115 (MCA1898, Serotec) and anti-M-CSF (AB-416-NA, R and D system) antibodies. Antibodies against MHC-II (OX6), CD11b and CD45RA.sup.+ B cells (OX33) were analysed to characterize cell's phenotype. Antibodies against CD3-PeCy7 (SKY7), CD4-PercPCy5.5 (L200), CD25-APCCy7 (M-A251), CD127-PE (HIL7-R M21, BD Bioscience), CD45RC-FITC (MT2, IQ Product), Foxp3-APC (236A/E7, ebiosciences) and IL34-PE (578416, R&D) were used to characterize human cell phenotypes. A FACS ARIA I (BD Biosciences, Mountain View, Calif.) was used to sort cells. A Canto II cytometer (BD Biosciences, Mountain View, Calif.) was used to measure fluorescence, and data were analyzed using the FLOWJO software (Tree Star, Inc. USA). Cells were first gated by their morphology excluding dead cells by selecting DAPI viable cells.

    [0219] AAV generation and use in vitro and in vivo: Complete cDNA sequence of rat IL-34 containing Q81 (9), or GFP as control, were positionned downstream a RSV promotor. Plasmids were first tested in HEK293T cells transfected with lipofectamine reagent (Life Technologies, Carlsbad, Nouveau-Mexique). Cells were analysed for GFP and IL-34-myc expression 48 h later by FACS with anti-myc Ab. Then, plasmids were used to produce AAV vectors of serotype 8 (LTG platform, INSERM UMR 1089, Nantes). HEK293T cells were transduced with 10 000, 100 000 to 1 000 000 MOI vector genome copies/cell of AAV-IL-34 or AAV-GFP and 5 000 MOI AdLacZ. 24 h later, cells were harvested and analysed for IL-34-Myc expression by FACS, and supernatent was tested for suppression activity on CD4+ Tcells responding to allogeneic pDCs, at a 1/10 and ⅕ dilution. Recombinant AAV-IL-34 and AAV-GFP (4.5.10.sup.10, 1.10.sup.12, and 2.10.sup.12 vector genomes/rat) vectors were injected i.v. in 4-weeks-old rats one month before transplantation to allow optimal expression from AAV vectors (23) Blood samples were taken for donor allospecific antibodies quantification.

    [0220] Adoptive cell transfer : Rat cells were sorted as previously described (5, 8) by FACS Aria (BD Biosciences, Mountain View, Calif.) by gating on TCRαβ-APC (R7/3), CD45RA-FITC (OX33), and CD11b/c-biotin-Streptavidine PECy7 (OX42) positive cells. Recipients that received splenocytes from IL34-treated rats are defined as 1.sup.st transferred and then iterative transfers were defined as 2.sup.nd-to 3.sup.rd transferred. Total splenocytes (1.5×10.sup.8 cells) and FACS Aria-sorted CD45RA.sup.+ B cells (6×10.sup.7), T cells (4×10.sup.7), CD11b/c.sup.+ cells (1.5×10.sup.7), CD4.sup.+CD25.sup.high Tregs (4×10.sup.6) or CD8.sup.+CD45RC.sup.low Tregs (4×10.sup.6) were adoptively transferred i. v. the day before heart transplantation into naive LEW-1A recipients that had received 4.5 Gy of whole-body irradiation the same day.

    [0221] Mixed lymphocyte reaction: Naive Lewis 1A CD4.sup.+ T cells, naïve Lewis 1W pDC, and AdCD40Ig-treated Lewis 1A CD8.sup.+CD45RC.sup.low Tregs subsets were sorted as previously described (16). Serum from AAV-IL-34-treated, AdCD40Ig-treated recipients and naïve rats were added in coculture to reach 3.12%, 6.25%, and 12.5% final concentration. Supernatent of transduced cells was added to CD4.sup.+T cells and pDC from 10% to 20% final concentration for suppressive activity test. Rat IL-34, CD115 or M-CSF-blocking Ab or isotypic control were tested for blocking activity from 1.25 to 30 μg/ml in presence or not of CD8.sup.+CD40Ig Tregs. M-CSF protein (ab56288, ABCAM) was tested from 0.1 to 2 μg/ml. Proliferation of CFSE-labelled CD4.sup.+CD25.sup.− T cells was analyzed by flow cytometry 6 days later, by gating on TCR.sup.+CD4.sup.+ cells (R7/3-APC, Ox35-PECY7) among living cells (DAPI negative).

    [0222] Sorted human CD4.sup.+CD25.sup.− T cells were plated in triplicate with allogeneic human T-depleted PBMCs in 200 μl of complete RPMI-1640 medium in round or conic bottom 96-well plates, respectively, at 37° C. and 5% CO2. Human IL34 Ab was used at 50 μg/ml, and variable numbers of Tregs were added. Isotype control Ab were used at the highest concentration displayed in the respective graph. M-CSF protein (ab56288, ABCAM) was tested from 0.1 to 2 μg/ml. Soluble human IL34 (eBiosciences) was added at a concentration of 1, 2 or 5 μg/ml for the suppressive activity test.

    [0223] Donor specific alloantibodies quantification: Donor spleens were digested by collagenase D, stopped with 400 μl EDTA 0.1 mM, and red cells were lysed. Serum of recipients were added to donor splenocytes at a dilution ⅛, and incubated with either anti-rat IgG-FITC (Jackson ImmunoResearch Labs INC, Baltimore, USA), anti-rat IgG1 (MCA 194, Serotec), anti-rat IgG2a (MCA 278, Serotec), or anti-rat IgG2b (STAR114F, Serotec) and anti-Ms Ig-FITC(115-095-164, Jackson ImmunoResearch). A FACS Canto (BD Biosciences, Mountain View, Calif.) was used to measure fluorescence, and data were analyzed using the FLOWJO software (Tree Star, Inc. USA). Geometric mean of fluorescence (MFI) of tested sera was divided by mean of 5 naive Lewis 1A sera MFI as control.

    [0224] Statistical analysis: One Way ANOVA Kruskal Wallis test and Dunn's posttest was used for PCR and coculture experiments, Two-Way ANOVA test and Bonferroni posttests was applied for donor-directed antibodies, and splenocytes phenotype characterization, and Mantel Cox test was used to analyse survival curves.

    [0225] Clodronate liposomes in vivo treatment: Clodronate liposomes for macrophage depletion were purchased from Vrije University, The Netherlands (www.clodronateliposomes.org) and prepared as recommended (5041). Briefly, 2.5 ml of suspended solution was administered weekly intra-peritonealy from day −25 to day 3.

    [0226] Quantitative RT-PCR: Total RNA was isolated from cells using Trizol reagent (Invitrogen) or an RNeasy Mini Kit (Qiagen). RNA from macrophages was amplified with MessageAmpTMII aRNA Amplification Kit according to the manufacturer instructions (Life Technologies) and reverse transcripted with random primers and M-MLV reverse transcriptase (Life Technologies). Real-time PCR was done using the Fast SYBR Green technology in a 20 μL final reaction volume containing 10 μL of Master Mix 2X (Life Technologies), 0.6 μL of primers (10 μM), 1 μL of cDNA and 8.4 μL of water. The reaction was performed on the Applied Biosystems StepOne™ (Life Technologies). The thermal conditions were the following: 3 sec at 95° C., 30 sec at 60° C. and 15 sec at TM-5° C. with a final melting curve stage.

    Results

    [0227] IL-34 was expressed by splenic CD8.sup.+CD45RC.sup.low Treg and the tolerant allograft: DNA microarray analysis of CD8.sup.+CD40Ig Tregs vs. naive CD8.sup.+CD45RC.sup.low Tregs from spleen, highlighted IL-34 upregulation (among the most upregulated genes) by CD8.sup.+CD40Ig Tregs, with a fold change of 4.05. This upregulation was confirmed by qPCR with >11 fold increase of IL-34 mRNA expression in long-term splenic CD8.sup.+CD40Ig Tregs compared with naive CD8.sup.+CD45RC.sup.low Tregs (p<0.05, FIG. 1A).

    [0228] Looking at whole organs, IL-34 mRNA was expressed endogenously in spleen and heart of naive animals (as observed by Lin et al. (18)) (FIG. 1B), and slightly decreased during acute allograft rejection in both spleen and graft (NT, FIG. 1B and 1C). In correlation with our previous observations that CD8.sup.+CD40Ig Tregs accumulated in the graft during the first week (16), IL-34 mRNA expression was significantly increased at day 5 in AdCD40Ig-treated graft and spleen (FIG. 1B and 1C). This significant increase was still detectable in AdCD40Ig-treated graft 120 days after transplantation; however in the total spleen IL-34 mRNA level had return to normal.

    [0229] To confirm the protein expression of IL-34, we labeled CD8.sup.+CD40Ig Tregs with a mouse anti-rat IL-34 antibody (Ab) that we generated. With this Ab, we confirmed the significant expression of IL-34 by CD8.sup.+CD40Ig Tregs compared to naive CD8.sup.+CD45RC.sup.low Tregs (FIG. 1D).

    [0230] Altogether, these results demonstrated for the first time that IL-34 can be expressed by induced CD8.sup.+CD45RC.sup.low Tregs, as well as tolerated allograft. Moreover, the early expression of IL-34 in graft and spleen suggest its early involvement in the inhibition of acute graft rejection and thus the establishment of allograft tolerance.

    [0231] IL-34 expressed by CD8.sup.+CD45RC.sup.low Treg, but not M-CSF, is involved in Treg-mediated suppression: We previously demonstrated that CD8.sup.+CD40Ig Tregs suppress anti-donor proliferation of CD4.sup.+ effector T cells in response to allogeneic pDCs ex vivo (16). In addition, we demonstrated the involvement of IFNγ and FGL2 in this process; however some suppression remained after blockade of IFNγ and FGL2 inhibitory effect (15, 16). To address whether IL-34 was involved in CD8.sup.+CD40Ig Treg suppression, we tested a neutralizing anti-IL-34 antibody in the suppressive MLR assay (FIG. 2A). The addition at increased concentration of blocking anti-IL-34 Ab resulted in a dose dependent increased of CD4.sup.+ proliferation up to 59% reversal of CD8.sup.+ Tregs-mediated inhibition.

    [0232] Given that IL-34 has similarities with M-CSF, that we observed a significant expression of M-CSF by CD8.sup.+CD40Ig Tregs compared to naive CD8.sup.+CD45RC.sup.low Tregs (FIG. 6A), and compete for the same receptor (18, 19), we wanted to address the possibility that M-CSF could play a role in the inhibition of the proliferation of effector T cells. First of all, we tested the suppressive potential of M-CSF in the MLR assay described before. Interestingly, we observed that M-CSF efficiently suppressed up in a dose dependent manner up to 93.5% of CD4.sup.+ CD25.sup.− T cells proliferation (FIG. 6B), suggesting that M-CSF-mediated suppression, as for IL-34, acts through pDCs expressing the CSF1-R (20, 21). However, the addition of a blocking anti-M-CSF Ab in co-culture suppressive assays in the presence of CD8.sup.+ Tregs did not restore CD4.sup.+ T cell proliferation, demonstrating that M-CSF was not involved in CD8.sup.+CD40Ig Treg-mediated suppression (FIG. 2B).

    [0233] We next tested the involvement of CSF1-R, the only peripheral receptor described until now for IL-34 (18, 19) expressed by monocytes/macrophages, cDCs and pDCs (20, 21). Thus, we used an anti-CSF1-R-blocking Ab that has been previously shown to inhibit M-CSF actions in both rats and mice (22). We demonstrated that blocking of CSF1-R significantly abrogated CD8.sup.+ Treg-mediated suppression on CD4.sup.+ T cell proliferation in presence of pDCs (FIG. 2C).

    [0234] In conclusion, we demonstrated the involvement of IL-34/CFS1-R interactions, but not M-CSF/CSF1-R interactions, in the suppressive effect of CD8.sup.+CD40Ig Tregs.

    [0235] Generation of an adeno-associated viral (AAV) vector for sustained expression of IL-34: To further analyze the suppressive activity of IL-34, and since recombinant IL-34 rat cytokine was not commercially available and difficult to produce for in vivo experiments, we generated a recombinant AAV vector encoding IL-34 rat molecule, as we have done for other molecules in primates (23) and rats (24). In this vector, the rat IL-34 cDNA was fused with a C-terminal Myc tag and both plasmid (pIIL-34) and lentivirus were first used to stably transfect or transduced HEK293 T cell lines. IL-34 expression was indicated by flow cytometry for the Myc-tag. Myc staining was not detectable on untransfected or AAV-GFP transduced HEK293 T cells, as well as on HEK293 T cells stained with isotypic control Ab. However, HEK293 T cells transfected with pIIL-34 or transduced with AAV-IL-34 expressed strong amount of IL-34 protein in a dose dependent manner, demonstrating the secretion of IL-34 and the functionality of the vector.

    [0236] We then tested the suppressive potential of AAV-IL34 transduced HEK293 T cells culture supernatant (FIG. 3A) and sera of AAV-IL34 treated-rats (FIG. 3B), that both contain high amount of IL-34 protein, as shown previously. We observed that both supernatant from AAVIL-34 -transduced cells and sera from AAV-IL34 treated rats significantly inhibited the proliferative response of CD4.sup.+ effector T cells stimulated by allogeneic pDCs (in a dose dependent manner) in comparison to controls (FIG. 3A and 3B).

    [0237] Altogether, these results demonstrated the functionality of the vector and the suppressive efficacy of IL-34 in inhibiting effector T cells proliferation, thus suggesting its potential in vivo in transplantation.

    [0238] Therapeutic effect of IL-34 in allograft tolerance induction: To further determine the suppressive potential of IL-34 in vivo as a therapeutic strategy, we treated recipients with either AAV-IL-34 1.10.sup.12 vg/rat or a control non-coding AAV, i.v. one month before transplantation. Such treatment with IL-34 alone resulted in a significant prolongation of allograft survival (mean survival time 32.6±7.8 days) vs. controls injected with non-coding AAV (14.2±1.8 days) or untreated recipients (7.8±0.6 days) (FIG. 4). To improve allograft survival, recipients were then treated with a suboptimal dose of rapamycin (during 14 days) in addition to the AAV vector. 14 days of rapamycin alone did not significantly extend allograft survival (FIG. 4, black circle). In contrast, we observed an indefinite allograft survival in 75% of the recipients that had received the combined therapy AAV-IL34 and rapamycine compared to controls (p<0.001, FIG. 4). Analysis of graft of long-surviving recipients for signs of chronic rejection revealed a complete absence of vascular lesions i.e. normal vessel structure and absence of leukocyte infiltration in the myocardium in all recipients analyzed. In addition, analysis of presence of anti-donor antibodies in the sera of long-surviving recipients revealed a significant inhibition of total IgG, IgG1, IgG2a and IgG2b anti-donor Abs versus recipient treated with the non coding AAV.

    [0239] Altogether, we were able to demonstrate for the first time that IL-34 is a valuable therapeutic strategy for tolerance induction in combination with rapamycin and resulted in abrogation of all allogeneic immune responses.

    [0240] IL-34 potently induces regulatory T cells capable of infectious tolerance: As demonstrated above, IL34 is produced specifically by CD8.sup.+CD40Ig Tregs. We next assessed whether regulatory cells were induced in the context of IL34-treatment and involved in the long-term allograft survival generated by AAV-IL34 and rapamycin combination. To do so, we performed adoptive cell transfer experiments using splenocytes of long-surviving recipients into naive grafted irradiated recipients, as we have done before (15). First adoptive transfer of 1,5.10.sup.8 splenocytes into secondary naive grafted irradiated recipients resulted in significant prolongation of allograft survival of 60% of the recipients (FIG. 5A), demonstrating that IL-34 efficiently induces regulatory cells. We investigated the anatomopathological status of the graft of first adoptively transferred long-term splenocytes recipients and observed a complete absence of vascular lesions and obstructions (i.e. no signs of chronic rejection). We then determined whether this prolongation of allograft survival can be serially transferred to second and third recipients and we observed that tolerance can be serially transferred at least 3 times into naive grafted irradiated recipients (FIG. 5, 2.sup.nd and 3.sup.rd Transfer).

    [0241] Given that IL-34 was recently described to induce regulatory macrophages (25), we investigated the regulatory population allowing serial adoptive tolerance transfer including macrophages. To do so, we purified sub-populations of the different main subsets (B cells, T cells and macrophages) from tolerant recipients treated with IL34 and performed adoptive cell transfer into naive irradiated grafted recipients (FIG. 5B). To our surprise, we observed that tolerance transfer was achieved only with T-cell transfer, and not macrophages as suggested by others, demonstrating for the first time that IL-34 can induce regulatory T cells and that in our model, macrophages were not potent enough to inhibit acute allograft rejection. However, regulatory T cells do not express the IL-34' s receptor suggesting that macrophages are a necessary intermediate in regulatory T cells functions. To further determine which Treg population (i.e. CD4.sup.+CD25.sup.high or CD8.sup.+CD45RC.sup.low T cells) could give tolerance to newly grafted recipients, we sorted CD4.sup.+CD25.sup.high and CD8.sup.+CD45RC.sup.low Tregs and performed adoptive cell transfer (FIG. 5B). We observed that both adoptive transfers of CD4.sup.+CD25.sup.high and CD8.sup.+CD45RC.sup.low Tregs resulted in 50% of long-term allograft survival in recipients, suggesting that both populations of Tregs had been equally potentiated by the IL34-modified macrophages.

    [0242] Altogether, these in vivo results demonstrate that efficient Tregs are generated following IL34-treatment in the context of reduced inflammation and transplantation, and that those Tregs can induce serial tolerance in a dominant fashion.

    Treg Induction is Mediated by IL34 Modified-Macrophages Infiltrating the Graft

    [0243] In an attempt to further identify the role of IL-34-induced macrophages in the induction of tolerance, we characterized the effect of IL34 on macrophages in the context of tolerance induction to an allograft. We first sorted macrophages from spleen, blood and graft of AAV-IL34 treated recipients at day 15 following transplantation (i.e. day 45 post-AAV injection) and macrophages from naive rats and analyzed by qPCR a number of genes (FIG. 7). Interestingly, we observed that macrophages in the graft from AAV-IL34-treated recipients strongly upregulated arginase 1 and inducible NO synthase (iNOS), both implicated in the metabolism of essential amino acids and described as common mechanism of immunoregulation of suppressive macrophages by limiting proliferation of T lymphocytes (34), compared to naive macrophages. We also observed an increased expression of CD14 and a decreased expression of CD23, CD86 and IL10, mostly in the graft, but also in the spleen and the blood of AAV-IL34 treated macrophages compared to naive macrophages. Finally, we observed no significant differences for CD16, CD32, ILL TGFβ and TNFα expression. It is also interesting to note that there were significant differences between macrophages located in the blood versus the graft, suggesting that IL34-modified regulatory macrophages migrate and locate in the graft quickly after transplantation. We further depleted the macrophages populations using clodronate-loaded liposomes from day −25 before transplantation to day 3 after transplantation and treated simultaneously with IL34 or non-coding AAV plus sub-optimal dose of rapamycin during 10 days, as previously described by others. Unfortunately, this therapy resulted in itself in allograft survival and could not be used to reveal the role of IL-34-induced macrophages. By doing so, AAV-IL34 injected 30 days before transplantation could not act through macrophages that were depleted at that same time. Significantly, by the time the liposome depletion started, most of the AAV serotype 8 had been integrated in the hepatocytes from the liver. We observed that recipients treated with clodronate-loaded liposomes rejected their graft more quickly after transplantation compared to the control group, demonstrating that macrophages are essential in tolerance induction by IL34 (FIG. 8).

    [0244] IL34 possesses a strong suppressive potential: As we suspected a suppressive potential of IL34 in human, we added different doses of soluble human IL34 to a MLR where CD4.sup.+CD25.sup.−CFSE-labeled effector T cells were cultured in presence of T-cell depleted allogeneic PBMCs as APCs (FIG. 9A). We observed a significant dose-dependent inhibition of effector T-cell proliferation in the presence of IL34, thus confirming the suppressive potential of IL34 on anti-donor immune response. Finally, to demonstrate the involvement of IL34 in CD4.sup.+CD25.sup.high CD127.sup.low and CD8.sup.+CD45RC.sup.low Treg-mediated suppressive activity on anti-donor immune responses, we added either anti-human IL34 blocking Ab or a control isotype Ab to a MLR where CFSE-labeled CD4.sup.+CD25.sup.− effector T-cell proliferation in the presence of allogeneic T-depleted PBMCs is inhibited by Tregs (FIG. 9B). We observed that blocking IL34 significantly reverted Treg-mediated suppression for both CD4.sup.+ and CD8.sup.+ Tregs compared with isotype control Ab, demonstrating the key role of IL34 in Tregs' suppressive activity.

    [0245] Altogether, these data prove the relevance of our findings and provide the proof of concept of IL34 as a Treg-specific protein and a potential therapeutic target in manipulating the anti-donor immune response.

    DISCUSSION

    [0246] The biological relevance of IL-34 remains to date largely unknown and controversial. The current understanding of the role of IL-34 was mostly driven by study on pathological situations were IL-34 was found to exert inflammatory functions, such as M-CSF. Various studies have shown that M-CSF administration increases inflammation in a model of collagen-induced RA (26) and that IL-34 correlates with severity of synovitis, inflammation in a model of RA (13) and can be induced by TNFα, as M-CSF (27). Furthermore, both IL-34 and M-CSF induce proinflammatory cytokines as IL-6, IP10/CXCL10, IL-8/CXCL8, MCP1/CCL2 (28). In contrast with these studies, it has also been shown that M-CSF and more recently IL-34, alone or in combination with other cytokines, can induce regulatory macrophages (25, 29-32). In transplantation, it has been demonstrated that M-CSF pre-treatment of mice expand macrophages and inhibit GVHD (33). In addition, combination of M-CSF and IFNy differentiate monocytes in regulatory macrophages capable to prolong heart allograft survival in an iNOS dependent manner (34). These studies underlie the paradoxical role of IL-34. In our study, in an attempt to unravel the complex mechanisms of tolerance induction in transplantation, we provide evidences, for the first time, of the unexpected properties of IL-34 as a master regulator of immune responses and tolerance. We also provide the first proof that IL-34 can be expressed by tolerated allografts and CD8.sup.+CD45RC.sup.low Tregs, and most importantly can induce potent regulatory T cells.

    [0247] We previously demonstrated that treatment of cardiac graft recipients with an adenovirus encoding CD40Ig lead to indefinite allograft survival in 93% of the recipients, and that this acceptance was mediated by CD8.sup.+CD45RC.sup.low Treg in a IFNγ, IDO and FGL2 dependent manner. We more recently demonstrated that CD8.sup.+CD45RC.sup.low Treg recombined a biased restricted Vβ11 repertoire to recognize a dominant MCH class II derived peptide, and that this peptide induces regulatory Tregs and induces tolerance (17). In the present specification, we show that IL-34 was expressed at high level by tolerated grafts of AdCD40Ig—treated recipients, and importantly, also by splenic CD8.sup.+CD45RC.sup.low Tregs from the same recipients. Furthermore, CD8.sup.+CD45RC.sup.low Tregs mediated suppression can be partially abrogated by blockade of IL-34. Thus, IL-34 possesses immunosuppressive properties that have never been studied until now, and acts in synergy with FGL2, IDO and IFNγ in the CD40Ig model of suppression mediated by CD8.sup.+CD45RC.sup.low Tregs (16).

    [0248] We also demonstrated that this property was specific of IL-34 since we observed that M-CSF was not involved in this model. Accumulating evidences suggest that IL-34 and M-CSF exhibit specific and non-redundant properties. This is underlined by structural analysis comparison showing that IL-34 and M-CSF bind differently to CD115 (11, 19). The identification more recently of a second distinct receptor for IL-34 reinforces this interpretation (10). Very recently, IL-34-deficient mice have been generated and showed disappearance of certain cell subsets such as Langerhan's cells and microglia (12), effects that had not been observed in M-CSF KO mice and demonstrating, not only a different temporal and spatial expression role, but also different functional effects for IL-34 vs. M-CSF.

    [0249] The therapeutic value of this molecule was evidenced with the generation of an AAV encoding IL-34. With this vector, we were able to show for the first time the potent immunosuppressive properties of IL-34 in vitro and, most importantly in vivo where we obtained indefinite allograft survival in 80% of the recipients when combined with a sub-optimal dose of rapamycin. We also demonstrated that such therapy resulted in abrogation of all allogeneic immune responses and the induction of tolerance. Previous studies demonstrated that both M-CSF and IL-34 can differentiate monocytes in regulatory macrophages (25, 34) and the regulatory macrophages induced in vitro by M-CSF and IFNy can be used in vivo to prolong heart allograft survival in mice (34). Another study demonstrated in mice that administration of M-CSF before transplant can expand macrophages and thus limit donor T cell expansion and GVHD (33). Chen et al. showed in mice treated with soluble IL-34 protein an increase of the CD11b.sup.+ population (35). Moreover, other studies noticed a decrease in pDC and cDC in CSF-1-deficient osteopetrotic mice (21), and a CFS1-induced increase in DC number (20). Surprisingly, and in contrast with other study, in vivo IL-34 tolerogenic effect following administration was mediated by regulatory T cells. Indeed, we demonstrated that the tolerance obtained in AAV-IL-34-treated recipients could be transferred in newly grafted irradiated recipients for at least 3 generations and that this effect was mediated by Tregs, but, despite the increase observed for the CD11b.sup.+ cell population, not by macrophages. However, since Tregs do not express IL-34's receptor, we can hypothesize that IL-34 mediated its effect on Tregs through macrophages as it has been shown in the literature that regulatory macrophages can anergizing CD4 effector T cells (36), converting T cells in Tregs (37) or inhibiting other APCs presentation (38). We could not conclude that IL-34 induces regulatory macrophages in our model, but these are necessary intermediate in IL-34 induced Tregs. These results highlight the functional differences of IL-34 and M-CSF and the controversy on this topic as several studies showed the pro-inflammatory role of MCSF that increases macrophage proliferation and accumulation in rejected renal allograft (39).

    [0250] In conclusion, we described here the role in transplantation tolerance of a new cytokine, IL-34, and we revealed its potential as a therapy in transplantation or as a biomarker associated with better prognosis in transplantation, but also by extension in other diseases. We also demonstrated for the first time that this cytokine can be produced by CD8.sup.+ Tregs and can in turn, induce Tregs capable of tolerance induction in a dominant manner, opening new possibilities in the generation of Tregs transferrable to the human setting.

    REFERENCES

    [0251] Throughout this application, various references describe the state of the art to which this invention pertains. The disclosures of these references are hereby incorporated by reference into the present disclosure. [0252] 1. Nankivell B J, et al. (2003) The natural history of chronic allograft nephropathy. N Engl J Med 349(24):2326-2333. [0253] 2. Srinivas T R & Kaplan B (2012) Transplantation in 2011: New agents, new ideas and new hope. Nat Rev Nephrol 8(2):74-75. [0254] 3. Londono M C, et al. (2012) A need for biomarkers of operational tolerance in liver and kidney transplantation. Am J Transplant 12(6):1370-1377. [0255] 4. Wood K J, Bushell A, & Hester J (2012) Regulatory immune cells in transplantation. Nat Rev Immunol 12(6):417-430. [0256] 5. Niederkorn J Y (2008) Emerging concepts in CD8(+) T regulatory cells. Curr Opin Immunol 20(3):327-331. [0257] 6. Picarda E, Anegon I, & Guillonneau C (2011) T-cell receptor specificity of CD8(+) Tregs in allotransplantation. Immunotherapy 3(4 Suppl):35-37. [0258] 7. Guillonneau C, Picarda E, & Anegon I (2010) CD8+regulatory T cells in solid organ transplantation. Curr Opin Organ Transplant 15(6):751-756. [0259] 8. Menoret S, et al. (2011) Phenotypic and functional characterization of CD8(+) T regulatory cells. Methods Mol Biol 677:63-83. [0260] 9. Wei S, et al. (2010) Functional overlap but differential expression of CSF-1 and IL-34 in their CSF-1 receptor-mediated regulation of myeloid cells. J Leukoc Biol 88(3):495-505. [0261] 10. Nandi S, et al. (2013) Receptor-type protein-tyrosine phosphatase zeta is a functional receptor for interleukin-34. J Biol Chem 288(30):21972-21986. [0262] 11. Chihara T, et al. (2010) IL-34 and M-CSF share the receptor Fms but are not identical in biological activity and signal activation. Cell Death Differ 17(12):1917-1927. [0263] 12. Wang Y, et al. (2012) IL-34 is a tissue-restricted ligand of CSF1R required for the development of Langerhans cells and microglia. Nat Immunol 13(8):753-760. [0264] 13. Chemel M, et al. (2012) Interleukin 34 expression is associated with synovitis severity in rheumatoid arthritis patients. Ann Rheum Dis 71(1):150-154. [0265] 14. Baud'huin M, et al. (2010) Interleukin-34 is expressed by giant cell tumours of bone and plays a key role in RANKL-induced osteoclastogenesis. J Pathol 221(1):77-86. [0266] 15. Guillonneau C, et al. (2007) CD40Ig treatment results in allograft acceptance mediated by CD8CD45RC T cells, IFN-gamma, and indoleamine 2,3-dioxygenase. J Clin Invest 117(4):1096-1106. [0267] 16. Li X L, et al. (2010) Mechanism and localization of CD8 regulatory T cells in a heart transplant model of tolerance. J Immunol 185(2):823-833. [0268] 17. Picarda E, et al. (2014) MHC-derived allopeptide activates TCR-biased CD8+Tregs and suppresses organ rejection. J Clin Invest. [0269] 18. Lin H, et al. (2008) Discovery of a cytokine and its receptor by functional screening of the extracellular proteome. Science 320(5877):807-811. [0270] 19. Garceau V, et al. (2010) Pivotal Advance: Avian colony-stimulating factor 1 (CSF-1), interleukin-34 (IL-34), and CSF-1 receptor genes and gene products. J Leukoc Biol 87(5):753-764. [0271] 20. Fancke B, Suter M, Hochrein H, & O'Keeffe M (2008) M-CSF: a novel plasmacytoid and conventional dendritic cell poietin. Blood 111(1):150-159. [0272] 21. MacDonald K P, et al. (2005) The colony-stimulating factor 1 receptor is expressed on dendritic cells during differentiation and regulates their expansion. J Immunol 175(3):1399-1405. [0273] 22. Gilmore G L & Shadduck R K (1995) Inhibition of day-12 spleen colony-forming units by a monoclonal antibody to the murine macrophage/monocyte colony-stimulating factor receptor. Blood 85(10):2731-2734. [0274] 23. Toromanoff A, et al. (2008) Safety and efficacy of regional intravenous (r.i.) versus intramuscular (i.m.) delivery of rAAV1 and rAAV8 to nonhuman primate skeletal muscle. Mol Ther 16(7):1291-1299. [0275] 24. Le Texier L, et al. (2012) Immunoregulatory function of IL-27 and TGF-betal in cardiac allograft transplantation. Transplantation 94(3):226-233. [0276] 25. Foucher ED, et al. (2013) IL-34 induces the differentiation of human monocytes into immunosuppressive macrophages. antagonistic effects of GM-CSF and IFNgamma. PLoS One 8(2):e56045. [0277] 26. Campbell I K, Rich M J, Bischof R J, & Hamilton J A (2000) The colony-stimulating factors and collagen-induced arthritis: exacerbation of disease by M-CSF and G-CSF and requirement for endogenous M-CSF. J Leukoc Biol 68(1):144-150. [0278] 27. Hamilton J A (2008) Colony-stimulating factors in inflammation and autoimmunity. Nat Rev Immunol 8(7):533-544. [0279] 28. Eda H, et al. (2010) Macrophage-colony stimulating factor and interleukin-34 induce chemokines in human whole blood. Cytokine 52(3):215-220. [0280] 29. Doyle A G, Halliday W J, Barnett C J, Dunn T L, & Hume D A (1992) Effect of recombinant human macrophage colony-stimulating factor 1 on immunopathology of experimental brucellosis in mice. Infect Immun 60(4):1465-1472. [0281] 30. Sakurai T, Wakimoto N, Yamada M, Shimamura S, & Motoyoshi K (1998) Effect of macrophage colony-stimulating factor (M-CSF) on mouse immune responses in vivo. Immunopharmacol Immunotoxicol 20(1):79-102. [0282] 31. Sakurai T, Yamada M, Simamura S, & Motoyoshi K (1996) Recombinant human macrophage-colony stimulating factor suppresses the mouse mixed lymphocyte reaction. Cell Immunol 171(1):87-94. [0283] 32. Duluc D, et al. (2007) Tumor-associated leukemia inhibitory factor and IL-6 skew monocyte differentiation into tumor-associated macrophage-like cells. Blood 110(13):4319-4330. [0284] 33. Hashimoto D, et al. (2011) Pretransplant CSF-1 therapy expands recipient macrophages and ameliorates GVHD after allogeneic hematopoietic cell transplantation. J Exp Med 208(5):1069-1082. [0285] 34. Riquelme P, et al. (2013) IFN-gamma-induced iNOS expression in mouse regulatory macrophages prolongs allograft survival in fully immunocompetent recipients. Mol Ther 21(2):409-422. [0286] 35. Chen Z, Buki K, Vaaraniemi J, Gu G, & Vaananen HK (2011) The critical role of IL-34 in osteoclastogenesis. PLoS One 6(4):e18689. [0287] 36. Tzachanis D, Berezovskaya A, Nadler L M, & Boussiotis V A (2002) Blockade of B7/CD28 in mixed lymphocyte reaction cultures results in the generation of alternatively activated macrophages, which suppress T-cell responses. Blood 99(4):1465-1473. [0288] 37. Liu G, et al. (2011) An instructive role of donor macrophages in mixed chimeras in the induction of recipient CD4(+)Foxp3(+) Treg cells. Immunol Cell Biol 89(8):827-835. [0289] 38. Holt P G, Schon-Hegrad M A, & Oliver J (1988) MHC class II antigen-bearing dendritic cells in pulmonary tissues of the rat. Regulation of antigen presentation activity by endogenous macrophage populations. J Exp Med 167(2):262-274. [0290] 39. Jose M D, Le Meur Y, Atkins R C, & Chadban S J (2003) Blockade of macrophage colony-stimulating factor reduces macrophage proliferation and accumulation in renal allograft rejection. Am J Transplant 3(3):294-300. [0291] 40. Ma X, Lin W Y, Chen Y, Stawicki S, Mukhyala K, Wu Y, Martin F, Bazan J F, Starovasnik (2012) MA Structural basis for the dual recognition of helical cytokines IL-34 and CSF-1 by CSF-1R. Structure Apr 4;20(4):676-87. [0292] 41. Van Rooijen, N., and Sanders, A. 1994. Liposome mediated depletion of macrophages: mechanism of action, preparation of liposomes and applications. J Immunol Methods 174:83-93. [0293] 42. Jain N K, Mishra V, Mehra N K. Targeted drug delivery to macrophages. Expert Opin Drug Deliv. 2013 Mar;10(3):353-67.