METHODS FOR PRODUCING ISOBUTENE FROM 3-METHYLCROTONIC ACID
20210403956 · 2021-12-30
Assignee
Inventors
- Mathieu Allard (Rigny-la-Nonneuse, FR)
- Maria Anissimova (Nozay, FR)
- Philippe MARLIÈRE (Luxembourg, LU)
Cpc classification
C12N9/1217
CHEMISTRY; METALLURGY
Y02E50/10
GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
C12Y604/01004
CHEMISTRY; METALLURGY
C12P5/026
CHEMISTRY; METALLURGY
C12P7/40
CHEMISTRY; METALLURGY
C12Y401/01063
CHEMISTRY; METALLURGY
C12Y205/01
CHEMISTRY; METALLURGY
C12Y301/02018
CHEMISTRY; METALLURGY
C12Y207/02014
CHEMISTRY; METALLURGY
C12N9/1029
CHEMISTRY; METALLURGY
C12N9/1085
CHEMISTRY; METALLURGY
International classification
C12N9/00
CHEMISTRY; METALLURGY
C12N9/12
CHEMISTRY; METALLURGY
Abstract
Described are methods for the production of isobutene comprising the enzymatic conversion of 3-methylcrotonic acid into isobutene wherein said 3-methylcrotonic acid is obtained by the enzymatic conversion of 3-methylcrotonyl-CoA into 3-methylcrotonic acid or wherein said 3-methylcrotonic acid is obtained by the enzymatic conversion of 3-hydroxyisovalerate (HIV) into 3-methylcrotonic acid. It is described that the enzymatic conversion of 3-methylcrotonic acid into isobutene can, e.g., be achieved by making use of a 3-methylcrotonic acid decarboxylase, preferably an FMN-dependent decarboxylase associated with an FMN prenyl transferase, an aconitate decarboxylase (EC 4.1.1.6), a methylcrotonyl-CoA carboxylase (EC 6.4.1.4), or a geranoyl-CoA carboxylase (EC 6.4.1.5).
Claims
1-36. (canceled)
37. A recombinant organism or microorganism capable of producing isobutene, wherein said microorganism expresses polypeptides comprising: a) at least one of: i. a CoA transferase (EC 2.8.3.-) and a thioester hydrolase (EC 3.1.2.-); or ii. (a) a phosphate butyryltransferase (EC 2.3.1.19) or a phosphate acetyltransferase (EC 2.3.1.8) and (b) a phosphotransferase with a carboxy group as acceptor (EC 2.7.2.-) and b) a 3-methylcrotonic acid decarboxylase selected from: i. an FMN-dependent decarboxylase associated with an FMN prenyl transferase (EC 2.5.1.-); ii. an aconitate decarboxylase (EC 4.1.1.6); iii. a methylcrotonyl-CoA carboxylase (EC 6.4.1.4); iv. a geranoyl-CoA carboxylase (EC 6.4.1.5); or v. a protocatechuate (PCA) decarboxylase (EC 4.1.1.63).
38. The recombinant organism or microorganism of claim 37, wherein the CoA transferase (EC 2.8.3.-) is selected from a propionate:acetate-CoA transferase (EC 2.8.3.1), an acetate CoA-transferase (EC 2.8.3.8) or a succinyl-CoA:acetate CoA-transferase (EC 2.8.3.18).
39. The recombinant organism or microorganism of claim 37, wherein the thioester hydrolase (EC 3.1.2.-) is selected from an acetyl-CoA hydrolase (EC 3.1.2.1), an ADP-dependent short-chain-acyl-CoA hydrolase (EC 3.1.2.18) or an acyl-CoA hydrolase (EC 3.1.2.20).
40. The recombinant organism or microorganism of claim 37, wherein the phosphotransferase with a carboxy group as acceptor (EC 2.7.2.-) is selected from a propionate kinase (EC 2.7.2.15), an acetate kinase (EC 2.7.2.1), a butyrate kinase (EC 2.7.2.7) or a branched-chain-fatty-acid kinase (EC 2.7.2.14).
41. The recombinant organism or microorganism of claim 37, wherein the recombinant organism or microorganism further expresses a polypeptide selected from a methylcrotonyl-CoA carboxylase (EC 6.4.1.4) or a geranoyl-CoA carboxylase (EC 6.4.1.5).
42. The recombinant organism or microorganism of claim 41, wherein the recombinant organism or microorganism further expresses a polypeptide selected from a 3-methylglutaconyl-coenzyme A hydratase (EC 4.2.1.18), a 3-hydroxyacyl-CoA dehydratase (EC 4.2.1.-) or an enoyl-CoA hydratase (EC 4.2.1.-).
43. The recombinant organism or microorganism of claim 42, wherein the recombinant organism or microorganism further expresses a polypeptide selected from a 3-hydroxy-3-methylglutaryl-CoA synthase.
44. The recombinant organism or microorganism of claim 37, wherein the 3-methylcrotonic acid decarboxylase is a FMN-dependent decarboxylase associated with an FMN prenyl transferase (EC 2.5.1.-).
45. The recombinant organism or microorganism of claim 38, wherein the 3-methylcrotonic acid decarboxylase is a FMN-dependent decarboxylase associated with an FMN prenyl transferase (EC 2.5.1.-).
46. The recombinant organism or microorganism of claim 39, wherein the 3-methylcrotonic acid decarboxylase is a FMN-dependent decarboxylase associated with an FMN prenyl transferase (EC 2.5.1.-).
47. The recombinant organism or microorganism of claim 46, wherein the thioester hydrolase (EC 3.1.2.-) is selected from an acetyl-CoA hydrolase (EC 3.1.2.1), an ADP-dependent short-chain-acyl-CoA hydrolase (EC 3.1.2.18) or an acyl-CoA hydrolase (EC 3.1.2.20).
48. The recombinant organism or microorganism of claim 40, wherein the 3-methylcrotonic acid decarboxylase is a FMN-dependent decarboxylase associated with an FMN prenyl transferase (EC 2.5.1.-).
49. The recombinant organism or microorganism of claim 48, wherein the thioester hydrolase (EC 3.1.2.-) is selected from an acetyl-CoA hydrolase (EC 3.1.2.1), an ADP-dependent short-chain-acyl-CoA hydrolase (EC 3.1.2.18) or an acyl-CoA hydrolase (EC 3.1.2.20).
50. The recombinant organism or microorganism of claim 41, wherein the 3-methylcrotonic acid decarboxylase is a FMN-dependent decarboxylase associated with an FMN prenyl transferase (EC 2.5.1.-).
51. The recombinant organism or microorganism of claim 50, wherein the thioester hydrolase (EC 3.1.2.-) is selected from an acetyl-CoA hydrolase (EC 3.1.2.1), an ADP-dependent short-chain-acyl-CoA hydrolase (EC 3.1.2.18) or an acyl-CoA hydrolase (EC 3.1.2.20).
52. The recombinant organism or microorganism of claim 42, wherein the 3-methylcrotonic acid decarboxylase is a FMN-dependent decarboxylase associated with an FMN prenyl transferase (EC 2.5.1.-).
53. The recombinant organism or microorganism of claim 52, wherein the thioester hydrolase (EC 3.1.2.-) is selected from an acetyl-CoA hydrolase (EC 3.1.2.1), an ADP-dependent short-chain-acyl-CoA hydrolase (EC 3.1.2.18) or an acyl-CoA hydrolase (EC 3.1.2.20).
54. The recombinant organism or microorganism of claim 43, wherein the 3-methylcrotonic acid decarboxylase is a FMN-dependent decarboxylase associated with an FMN prenyl transferase (EC 2.5.1.-).
55. The recombinant organism or microorganism of claim 54, wherein the thioester hydrolase (EC 3.1.2.-) is selected from an acetyl-CoA hydrolase (EC 3.1.2.1), an ADP-dependent short-chain-acyl-CoA hydrolase (EC 3.1.2.18) or an acyl-CoA hydrolase (EC 3.1.2.20).
56. The recombinant organism or microorganism of claim 44, wherein the 3-methylcrotonic acid decarboxylase is a FMN-dependent decarboxylase associated with an FMN prenyl transferase (EC 2.5.1.-).
57. The recombinant organism or microorganism of claim 56, wherein the thioester hydrolase (EC 3.1.2.-) is selected from an acetyl-CoA hydrolase (EC 3.1.2.1), an ADP-dependent short-chain-acyl-CoA hydrolase (EC 3.1.2.18) or an acyl-CoA hydrolase (EC 3.1.2.20).
58. The recombinant organism or microorganism of claim 45, wherein the 3-methylcrotonic acid decarboxylase is a FMN-dependent decarboxylase associated with an FMN prenyl transferase (EC 2.5.1.-).
59. The recombinant organism or microorganism of claim 58, wherein the thioester hydrolase (EC 3.1.2.-) is selected from an acetyl-CoA hydrolase (EC 3.1.2.1), an ADP-dependent short-chain-acyl-CoA hydrolase (EC 3.1.2.18) or an acyl-CoA hydrolase (EC 3.1.2.20).
Description
[0777] As regards the above-mentioned enzymes as well as preferred embodiments of said enzymes, the same applies to the recombinant organism or microorganism as has been set forth above for the methods according to the present invention.
[0778]
[0779]
[0780]
[0781]
[0782]
[0783]
[0784]
[0785]
[0786]
[0787]
[0788]
[0789]
[0790]
[0791]
[0792]
[0793]
[0794]
[0795]
[0796]
[0797]
[0798]
[0799]
[0800]
[0801]
[0802]
[0803]
[0804]
[0805]
[0806]
[0807]
[0808]
[0809]
[0810]
[0811]
[0812]
[0813]
[0814]
[0815]
[0816]
[0817]
[0818]
[0819]
[0820]
[0821]
[0822] In this specification, a number of documents including patent applications are cited. The disclosure of these documents, while not considered relevant for the patentability of this invention, is herewith incorporated by reference in its entirety. More specifically, all referenced documents are incorporated by reference to the same extent as if each individual document was specifically and individually indicated to be incorporated by reference.
[0823] The invention will now be described by reference to the following examples which are merely illustrative and are not to be construed as a limitation of the scope of the present invention.
EXAMPLES
General Methods and Materials
[0824] All reagents and materials used in the experiences were obtained from Sigma-Aldrich Company (St. Louis, Mo.) unless otherwise specified. Materials and methods suitable for growth of bacterial cultures and protein expression are well known in the art.
Example 1
Gene Synthesis, Cloning and Expression of Recombinant Proteins
[0825] The sequences of the studied enzymes were generated by oligonucleotide concatenation to fit the codon usage of E. coli (genes were commercially synthesized by GeneArt®). A stretch of 6 histidine codons was inserted after the methionine initiation codon to provide an affinity tag for purification. The gene thus synthesized was cloned in a pET-25b (+) expression vector (vectors were constructed by GeneArt®). Vector pCAN contained gene coding for UbiX protein (3-octaprenyl-4-hydroxybenzoate carboxy-lyase partner protein) from Escherichia coli (Uniprot Accession Number: P0AG03) was purchased from NAIST (Nara Institute of Science and Technology, Japan, ASKA collection). Provided vector contained a stretch of 6 histidine codons after the methionine initiation codon.
[0826] Competent E. coli BL21 (DE3) cells (Novagen) were transformed with these vectors according to standard heat shock procedure. The transformed cells were grown with shaking (160 rpm) using ZYM-5052 auto-induction medium (Studier F W, Prot. Exp. Pur. 41, (2005), 207-234) for 6 h at 30° C. and protein expression was continued at 18° C. overnight (approximately 16 h). For the recombinant strain over-expressing UbiX from E. coli, 500 μM of Flavin Mononucleotide (FMN) were added to the growth medium. The cells were collected by centrifugation at 4° C., 10,000 rpm for 20 min and the pellets were stored at −80° C.
[0827] Protein Purification and Concentration
[0828] The pellets from 200 ml of cultured cells were thawed on ice and resuspended in 6 ml of 50 mM Tris-HCl buffer pH 7.5 containing 100 mM NaCl in the case of the recombinant strain overexpressing UbiX protein and in 6 ml of 50 mM Tris-HCl buffer pH 7.5, 10 mM MgCl.sub.2, 10 mM imidazole and 5 mM DTT in the case of the recombinant strain overexpressing UbiD protein. Twenty microliters of lysonase (Novagen) were added. Cells were then incubated 10 min at room temperature, returned to ice for 20 min and the lysis was completed by sonication 3×15 seconds. The cellular lysate contained UbiX protein was reserved on ice. The bacterial extracts contained UbiD proteins were then clarified by centrifugation at 4° C., 4000 rpm for 40 min. The clarified bacterial lysates were loaded onto a PROTINO-2000 Ni-TED column (Macherey-Nagel) allowing adsorption of 6-His tagged proteins. Columns were washed and the enzymes of interest were eluted with 6 ml of 100 mM Tris-HCl buffer pH 7.5 containing 100 mM NaCl and 250 mM imidazole. Eluates were then concentrated, desalted on Amicon Ultra-4 10 kDa filter unit (Millipore) and enzymes were resuspended in 50 mM Tris-HCl buffer pH 7.5, containing 50 mM NaCl and 5 mM DTT.
[0829] The purity of proteins thus purified varied from 80% to 90% as estimated by SDS-PAGE analysis. Protein concentration was determined by direct UV 280 nm measurement on the NanoDrop 1000 spectrophotometer (Thermo Scientific) and by Bradford assay (BioRad).
Example 2
In Vitro Decarboxylation of 3-Methylcrotonic Acid into Isobutene Catalyzed by an Association of Lysate, Containing UbiX Protein, with Purified UbiD Protein
[0830] 0.5 M stock solution of 3-methylcrotonic acid was prepared in water and adjusted to pH 7.0 with 10 M solution of NaOH.
[0831] Two UbiD proteins (Table C) were purified according to the procedure described in Example 1.
[0832] Enzymatic assays were carried out in 2 ml glass vials (Interchim) under the following conditions:
[0833] 50 mM Tris-HCl buffer pH 7.5
[0834] 20 mM NaCl
[0835] 10 mM MgCl.sub.2
[0836] 5 mM DTT
[0837] 50 mM 3-methylcrotonic acid
[0838] 1 mg/ml purified UbiD protein
[0839] 50 μl lysate contained UbiX protein
[0840] Total volume of the assays were 300 μl.
[0841] A series of control assays were performed in parallel (Table C).
[0842] The vials were sealed and incubated for 120 min at 30° C. The assays were stopped by incubating for 2 min at 80° C. and the isobutene formed in the reaction headspace was analysed by Gas Chromatography (GC) equipped with Flame Ionization Detector (FID).
[0843] For the GC analysis, one ml of the headspace gas was separated in a Bruker GC-450 system equipped with a GS-alumina column (30 m×0.53 mm) (Agilent) using isothermal mode at 130° C. Nitrogen was used as carrier gas with a flow rate of 6 ml/min.
[0844] The enzymatic reaction product was identified by comparison with an isobutene standard. Under these GC conditions, the retention time of isobutene was 2.42 min.
[0845] A significant production of isobutene from 3-methylcrotonic acid was observed in the combined assays (UbiD protein+UbiX protein). Incubation of lysate containing UbIX protein alone did not result in isobutene production. These data indicate that the two enzymes present in the assays cooperated to perform the decarboxylation of 3-methylcrotonic acid into isobutene. A typical chromatogram obtained in the assay with UbiD protein from Saccharomyces cerevisiae is shown on
TABLE-US-00003 TABLE C Isobutene production, arbitrary Assay composition units UbiD protein from C. dubliniensis 470 (Uniprot Acession Number: B9WJ66) + lysate contained UbiX protein from E. coli + substrate UbiD protein from C. dubliniensis (Uniprot 9.2 Acession Number: B9WJ66) + substrate UbiD protein from S. cervisiae (Uniprot 1923 Acession Number : Q03034) + lysate contained UbiX protein from E. coli + substrate UbiD protein from S. cerivisae (Uniprot 31 Acession Number: Q03034) + substrate Lysate contained UbiX protein 0 from E. coli + substrate “No substrate control”: UbiD protein from 0 C. dubliniensis (Uniprot Acession Number: B9WJ66) + lysate contained UbiX protein from E. coli, without substrate “No substrate control”: UbiD protein 0 from S. cervisiae (Uniprot Acession Number : Q03034) + lysate contained UbiX protein from E. coli, without substrate
Example 3
Conversion of 3-Methylcrotonyl-CoA and ADP into 3-Methylcrotonic Acid and ATP Catalysed by the Combined Action of Phosphate Butyryltransferase from Bacillus subtilis and Butyrate Kinase from Lactobacillus casei or Geobacillus sp
[0846] The corresponding enzymes were obtained and purified according to the procedure described in Example 1.
[0847] The enzymatic assays were conducted in a total reaction volume of 0.2 ml The standard reaction mixture contained:
[0848] 50 mM potassium phosphate buffer pH 7.5
[0849] 4 mM 3-methylcrotonyl-CoA
[0850] 4 mM ADP
[0851] 10 mM MgCl.sub.2
[0852] 10 mM NaCl
[0853] 0.2 mg/ml purified phosphate butyryltransferase from Bacillus subtilis (Uniprot Accession Number: P54530)
[0854] 0.2 mg/ml purified butyrate kinase from Lactobacillus casei (Uniprot Accession Number: K0N529) or Geobacillus sp. (Uniprot accession number: L8A0E1).
[0855] A series of controls were performed in parallel (Assays C-H Table D).
TABLE-US-00004 TABLE D Assay composition A B C D E F G H 3-methylcrotonyl-CoA + + + + + + + + ADP + + + + + + phosphate butyryltransferase + + + + + from Bacillus subtilis butyrate kinase from + + + Lactobacillus casei butyrate kinase from + + + Geobacillus sp
[0856] Assays were incubated for 20 min with shaking at 30° C.
[0857] After an incubation period, the reactions were stopped by heating the reaction medium 4 min at 90° C. The samples were centrifuged, filtered through a 0.22 μm filter and the clarified supernatants were transferred into a clean vial for the further analysis. The consumption of ADP and 3-methylcrotonyl-CoA, and the formation of ATP, 3-methylcrotonic acid and free coenzyme A (CoA-SH) were followed by using HPLC-based methods.
[0858] HPLC-Based Analysis of ADP and ATP
[0859] HPLC analysis was performed using 1260 Inifinity LC System (Agilent), equipped with column heating module and RI detector. 2 μl of samples were separated on Polaris C18-A column (150×4.6 mm, 5 μm particle size, column temp. 30° C.) with a mobile phase flow rate of 1.5 ml/min. The separation was performed using 8.4 mM sulfuric acid in H.sub.2O/MeOH mixed solution (99/1) (V/V). In these conditions, the retention time of ADP and ATP were 2.13 min and 2.33 min, respectively.
[0860] HPLC Based Analysis of 3-Methylcrotonyl-CoA, 3-Methylcrotonic Acid and Free Coenzyme A (CoA-SH)
[0861] HPLC analysis was performed using 1260 Inifinity LC System (Agilent), equipped with column heating module and UV detector (260 nm). 1 μl of samples were separated on Zorbax SB-Aq column (250×4.6 mm, 5 μm particle size, column temp. 30° C.), with a mobile phase flow rate of 1.5 ml/min. The separation was performed using mixed A (H.sub.2O containing 8.4 mM sulfuric acid) and B (acetonitrile) solutions in a linear gradient (0% B at initial time 0 min.fwdarw.70% B at 8 min). In these conditions, the retention time of 3-methylcrotonyl-CoA, 3-methylcrotonic acid and free coenzyme A (CoA-SH) were 5.38 min, 5.73 min and 4.07 min, respectively.
[0862] Typical chromatograms obtained for the enzymatic assay A and enzyme-free assay H are shown on
[0863] The results of HPLC analysis are summarized in
[0864] The obtained data indicate that 3-methylcrotonyl-CoA was converted into 3-methylcrotonic acid with the concomitant generation of ATP from ADP in a two-step reaction, catalyzed respectively by two enzymes (assays A and B). Thus, the conversion occurred through the formation of the intermediate 3-methylcrotonyl phosphate followed by the transfer of phosphate group from this intermediate on ADP thereby releasing ATP.
[0865] A certain quantity of 3-methylcrotonic acid was produced without simultaneous generation of ATP, when phosphate butyryltransferase was used alone (assay E). This production is due to a spontaneous hydrolysis of 3-methylcrotonyl phosphate generated by the action of phosphate butyryltransferase.
[0866] The production of 3-methylcrotonic acid was observed in the same manner for the control assays without ADP (assays C and D). This production was also due to a hydrolysis of the 3-methylcrotonyl phosphate generated by the action of phosphate butyryltransferase.
Example 4
Conversion of 3-Methylcrotonyl-CoA and ADP into 3-Methylcrotonic Acid and ATP Catalysed by the Combined Action of the Phosphate Butyryltransferase from Enterococcus faecalis and Butyrate Kinase from Lactobacillus casei or Geobacillus sp
[0867] The corresponding enzymes were obtained and purified according to the procedure described in Example 1.
[0868] The enzymatic assays were conducted in a total reaction volume of 0.2 ml
[0869] The standard reaction mixture contained:
[0870] 50 mM potassium phosphate buffer pH 7.5
[0871] 4 mM 3-methylcrotonyl-CoA
[0872] 4 mM ADP
[0873] 10 mM MgCl.sub.2
[0874] 10 mM NaCl
[0875] 0.2 mg/ml purified phosphate butyryltransferase from Enterococcus faecalis (Uniprot Accession Number: S4BZL5)
[0876] 0.2 mg/ml purified butyrate kinase from Lactobacillus casei (Uniprot Accession Number: K0N529) or Geobacillus sp. (Uniprot Accession Number: L8A0E1)
[0877] A series of controls were performed in parallel (Assays C-H Table E).
TABLE-US-00005 TABLE E Assay composition A B C D E F G H 3-methylcrotonyl-CoA + + + + + + + + ADP + + + + + + phosphate + + + + + butyryltransferase from Enterococcus faecalis butyrate kinase from + + + Lactobacillus casei butyrate kinase from + + + Geobacillus sp
[0878] Assays were incubated for 20 min with shaking at 30° C.
[0879] After an incubation period, the reactions were stopped by heating the reaction medium 4 min at 90° C. The samples were centrifuged, filtered through a 0.22 μm filter and the clarified supernatants were transferred into a clean vial for further analysis. The consumption of ADP and 3-methylcrotonyl-CoA, and the formation of ATP and 3-methylcrotonic acid and free coenzyme A (CoA-SH) were followed by HPLC analysis according to the methods described in Example 3.
[0880] The results of HPLC analysis are summarized in
[0881] The obtained data indicate that 3-metylcrotonyl-CoA was converted into 3-methylcrotonic acid with the concomitant generation of ATP from ADP in a two-step reaction, catalyzed respectively by two enzymes (assays A and B). Thus, the conversion occurred through the formation of the intermediate 3-methylcrotonyl phosphate followed by transfer of phosphate group from this intermediate on ADP thereby releasing ATP.
[0882] A significant production of 3-methylcrotonic acid, without simultaneous generation of ATP, was observed when phosphate butyryltransferase was used alone (assay E). This production was due to a hydrolysis of 3-methylcrotonyl phosphate generated by the action of phosphate butyryltransferase.
[0883] The production of 3-methylcrotonic acid was observed in the same manner for the control assays without ADP (assays C and D). This production was also due to a hydrolysis of the 3-methylcrotonyl phosphate generated by the action of phosphate butyryltransferase.
Example 5
Enzyme-Catalyzed Hydrolysis of 3-Methylcrotonyl-CoA into 3-Methylcrotonic Acid and Free Coenzyme A
[0884] The gene coding for acyl-CoA thioesterase II from Pseudomonas putida was synthesized according to the procedure described in Example 1.
[0885] Vector pCAN contained gene encoding acyl-CoA thioesterase 2 (TesB) from Escherichia coli were purchased from NAIST (Nara Institute of Science and Technology, Japan, ASKA collection). Provided vector contained a stretch of 6 histidine codons after the methionine initiation codon. The corresponding enzymes were produced according to the procedure described in Example 1.
[0886] The enzymatic assays were conducted in a total reaction volume of 0.2 ml.
[0887] The standard reaction mixture contained:
[0888] 50 mM HEPES pH 7.0
[0889] 10 mM 3-methylcrotonyl-CoA
[0890] 20 mM MgCl2
[0891] 20 mM NaCl
[0892] 1 mg/ml purified recombinant thioesterase.
[0893] Control assays were performed in which either no enzyme was added, or no substrate was added.
[0894] The assays were incubated for 30 min with shaking at 30° C., the reactions were stopped by the addition of 0.1 ml acetonitrile and the samples were then analysed by HPLC-based procedure.
[0895] HPLC based analysis of the consumption of 3-methylcrotonyl-CoA and the formation of 3-methylcrotonic acid and free coenzyme A (CoA-SH)
[0896] HPLC analysis was performed using 1260 Inifinity LC System (Agilent), equipped with column heating module and UV detector (210 nm). 5 μl of samples were separated on Zorbax SB-Aq column (250×4.6 mm, 5 μm particle size, column temp. 30° C.), with a mobile phase flow rate of 1.5 ml/min. The separation was performed using mixed A (H.sub.2O containing 8.4 mM sulfuric acid) and B (acetonitrile) solutions in a linear gradient (0% B at initial time 0 min.fwdarw.70% B at 8 min). Commercial 3-methylcrotonyl-CoA, 3-methylcrotonic acid (Sigma-Aldrich) and CoA-SH (Sigma-Aldrich) were used as references. In these conditions, the retention time of free coenzyme A (CoA-SH), 3-methylcrotonyl-CoA and 3-methylcrotonic acid were 4.05, 5.38 and 5.83 min, respectively.
[0897] No 3-methylcrotonic acid signal was observed in control assays.
[0898] The both studied thioesterases catalyzed the hydrolysis of 3-methylcrotonyl-CoA with the formation of 3-methylcrotonic acid. An example of chromatogram obtained with acyl-CoA thioesterase II from Pseudomonas putida is shown on
[0899] The production of 3-methylcrotonic acid observed in the enzymatic assays are shown in Table F.
TABLE-US-00006 TABLE F Uniprot Accession 3-methylcrotonic Gene name Organism Number acid produced, mM tesB Escherichia coli POAGG2 0.6 tesB Pseudomonas putida Q88DR1 3.1
Example 6
In Vivo Decarboxylation of 3-Methylcrotonic Acid Into Isobutene Catalyzed by an Association of UbiX Protein from Escherichia coli and UbiD Protein from Saccharomyces cerevisiae
[0900] The gene coding for UbiD protein from S. cerevisiae (Uniprot Accession Number: Q03034) was codon optimized for expression in E. coli and synthesized by GeneArt® (Life Technologies). This studied gene was then PCR amplified from the pMK-RQ vector (master plasmid provided by GeneArt) using forward primer with Ncol restriction site and a reverse primer, containing BamHl restriction site. The gene coding for UbiX protein from E. coli (Uniprot Accession Number: P0AG03) was amplified by PCR with a forward primer, containing Ndel restriction site and a reverse primer containing Kpnl restriction site. The previously described pCAN vector (Example 1) served as template for this PCR step. These two obtained PCR products (UbiD protein and UbiX protein) were cloned into pETDuet™-1 co-expression vector (Novagen). The constructed recombinant plasmid was verified by sequencing. Competent E. coli BL21(DE3) cells (Novagen) were transformed with this vector according to standard heat shock procedure and plated out onto LB agar plates supplemented with ampicillin (0.1 mg/ml) (termed “strain A”).
[0901] BL21(DE3) strain transformed with pET-25b(+) vector, carrying only the gene of UbiD protein from S. cerevisae was also used in this study (termed “strain B”). BL21(DE3) strain transformed with an empty pET-25b(+) vector was used as a negative control in the subsequent assays (termed “strain C”).
[0902] Single transformants were used to inoculate LB medium, supplemented with ampicillin, followed by incubation at 30° C. overnight. 1 ml of this overnight culture was used to inoculate 300 ml of ZYM-5052 auto-inducing media (Studier FW (2005), local citation). The cultures were grown for 20 hours at 30° C. and 160 rpm shaking.
[0903] A volume of cultures corresponding to OD600 of 30 was removed and centrifuged. The pellet was resuspended in 30 ml of MS medium (Richaud C., Mengin-Leucreulx D., Pochet S., Johnson E J., Cohen G N. and MarHere P, The Journal of Biological Chemistry, 268, (1993), 26827-26835), containing glucose (45 g/L) and MgSO4 (1 mM) and supplemented with 10 mM 3-methylcrotonic acid. These cultures were then incubated in 160 ml bottles, sealed with a screw cap, at 30° C. with shaking for 22 h. The pH value of the cultures was adjusted to 8.5 after 8 hours of incubation by using 30% NH.sub.4OH.
[0904] After an incubation period, the isobutene produced in the headspace was analysed by Gas Chromatography (GC) equipped Flame Ionization Detector (FID). One ml of the headspace gas phase was separated and analysed according to the method described in Example 2.
[0905] No isobutene was formed with the control strain C carrying an empty vector. The highest production of isobutene was observed for the strain A over-expressing the both genes, UbiD protein from S. cerevisiae and UbiX protein from E. coli. A significant production of isobutene was observed for the strain B over-expressing UbiD protein alone. Thus, endogenous UbiX of E. coli can probably contribute to activate UbiD protein from S. cerivisae (
Example 7
One Pot Enzymatic Synthesis of Isobutene from 3-Methylcrotonyl-CoA Catalyzed by an Association of Phosphotransbutyrylase from Bacillus subtilis, Butyrate Kinase from Geobacillus sp. and UbiD Protein from Saccharomyces cerevisiae
[0906] A pETDuet™-1 co-expression vector, carrying the UbiD gene from Saccharomyces cerevisiae (Uniprot Accession Number Q03034) and the UbiX gene from Escherichia coli (Uniprot Accession Number P0AG03) (Example 6), was used to produce and purify UbiD protein according to the protocol described in Example 1. The phosphotransbutyrylase from Bacillus subtilis and the butyrate kinase from Geobacillus sp. were purified as described in Example 4.
[0907] The enzymatic assays were conducted in a total reaction volume of 0.3 ml.
[0908] The standard reaction mixture contained:
[0909] 50 mM Tris-HCl pH 7.5
[0910] 10 mM 3-methylcrotonyl-CoA
[0911] 10 mM MgCl.sub.2
[0912] 10 mM NaCl
[0913] 10 mM potassium phosphate buffer pH 7.5.
[0914] 10 mM ADP
[0915] 0.02 mg/ml purified phosphotransbutyrylase from B. subtilis
[0916] 0.02 mg/ml purified butyrate kinase from Geobacillus sp.
[0917] 1 mg/ml purified UbiD from S. cerevisiae
[0918] Catalysis was conducted at 30° C. during 18 h.
[0919] A series of control assays were performed in parallel in which either no UbiD protein (control A) or phosphotransbutyrylase (control B) or butyrate kinase (control C) were added or no substrate was added (control D). After the incubation period, the isobutene produced in the headspace was analysed by Gas Chromatography (GC) equipped Flame Ionization Detector (FID). One ml of the headspace gas phase was separated and analysed according to the method described in Example 2. An overlay of typical chromatogram obtained for the whole enzymatic assay, and the corresponding controls is shown on
[0920] The highest production of isobutene was observed in the assay comprised phosphotransbutyrylase, butyrate kinase and UbiD protein. The control assay without phosphotransbutyrylase (control B) and control assay without butyrate kinase (control C) also showed a significant production of isobutene. These results could be explained by spontaneous hydrolysis of 3-methylcrotonyl-CoA into 3-methylcrotonic acid. Enzymatic production of isobutene from 3-methylcrotonyl-CoA can thus be achieved by three consecutive steps, through the formation of 3-methylcrotonyl phosphate and 3-methylcrotonic acid as intermediates.
Example 8
In Vitro Screening of the UbiD Proteins for the Decarboxylation of 3-Methylcrotonic Acid Into Isobutene
[0921] Several genes coding for UbiD protein were codon optimized for the expression in E. coli and synthesized by GeneArt® (Thermofisher). The corresponding enzymes were purified according to the procedure described in Example 1. The list of the studied enzymes is shown in Table G.
[0922] Enzymatic assays were carried out in 2 ml glass vials (Interchim) under the following conditions:
[0923] 50 mM Tris-HCl buffer pH 7.5
[0924] 20 mM NaCl
[0925] 10 mM MgCl2
[0926] 1 mM DTT
[0927] 50 mM 3-methylcrotonic acid
[0928] 1 mg/ml purified UbiD protein
[0929] 100 μl lysate contained UbiX protein from E. coli
[0930] Total volume of the assays were 300 μl.
[0931] A series of control assays were performed in parallel, in which either no UbiD protein was added, or no enzymes were added (Table G).
[0932] The vials were sealed and incubated for 60 min at 30° C. The assays were stopped by incubating for 2 min at 80° C. and the isobutene formed in the reaction headspace was analysed by Gas Chromatography (GC) equipped with Flame Ionization Detector (FID), according to the procedure described in Example 2.
[0933] The results of the GC analysis are shown in Table G. No isobutene production was observed in control reactions. These results show that all the UbiD proteins, studied under the conditions of this screening assay, were able to perform the decarboxylation of 3-methylcrotonic acid into isobutene in presence of E. coli cell lysate contained UbiX protein.
TABLE-US-00007 TABLE G Isobutene produced, Candidate UbiD protein Assay composition arbitrary units Saccharomyces cerevisae UbiD protein alone 9 (Uniprot Accession UbiD protein + Cell lysate 945 Number: Q03034) contained UbiX protein Sphaerulina musiva (Uniprot UbiD protein alone 70 Accession Number: M3DF95) UbiD protein + Cell lysate 3430 contained UbiX protein Penicillium roqueforti (Uniprot UbiD protein alone 34 Accession Number: W6QKP7) UbiD protein + Cell lysate 1890 contained UbiX protein Hypocrea atroviridis (Uniprot UbiD protein alone 60 Accession Number: G9NLP8) UbiD protein + Cell lysate 5200 contained UbiX protein Fusarium oxysporum sp. UbiD protein alone 13 lycopersici (Uniprot Accession UbiD protein + Cell lysate 1390 Number: W9LTH3) contained UbiX protein Saccharomyces kudriavzevii UbiD protein alone 10 (Uniprot Accession Number: UbiD protein + Cell lysate 920 J8TRN5) contained UbiX protein «No UbiD control»: Cell lysate contained UbiX protein alone 0 Control without any enzymes 0
Example 9
Conversion of 3-Methylcrotonyl-CoA and Acetate into 3-Methylcrotonic Acid and acetyl-CoA Catalysed by Coenzyme A Transferase from Megasphaera sp
[0934] The enzyme was produced and purified according to the procedure described in Example 1.
[0935] The enzymatic assays were conducted in a total reaction volume of 0.2 ml
[0936] The standard reaction mixture contained:
[0937] 50 mM Tris-HCl buffer pH 7.5
[0938] 5 mM 3-methylcrotonyl-CoA
[0939] 10 mM sodium acetate
[0940] 10 mM MgCl.sub.2
[0941] 10 mM NaCl
[0942] 3 mg/ml purified CoA-transferase from Megasphaera sp. (Uniprot Accession Number: S7HFR5).
[0943] Control assays were performed in which either no enzyme was added, or no 3-methylcrotonyl-CoA was added. The assays were incubated for 6 h at 30° C. The assays were stopped by adding 100 μl MeCN in the medium. The samples were centrifuged, filtered through a 0.22 μm filter and the clarified supernatants were transferred into a clean vial for the HPLC-based analysis.
[0944] HPLC analysis was performed using 1260 Inifinity LC System (Agilent), equipped with a column heating module and UV detector (260 nm). 5 μl of samples were separated on Zorbax SB-Aq column (250×4.6 mm, 5 μm particle size, column temp. 30° C.), with a mobile phase flow rate of 1.5 ml/min. The separation was performed using mixed A (H.sub.2O containing 8.4 mM sulfuric acid) and B (acetonitrile) solutions in a linear gradient (0% B at initial time 0 min.fwdarw.70% B at 8 min). In these conditions, the retention time of 3-methylcrotonyl-CoA, 3-methylcrotonic acid and acetyl-CoA were 5.22 min, 5.70 min and 4.25 min, respectively.
[0945] Significant amounts of acetyl-CoA and 3-methylcrotonic acid were observed in the enzyme assay while none of the two compounds was not observed in control Significant amounts of acetyl-CoA and 3-methylcrotonic acid were observed in the enzyme assay while none of these two compounds was formed in control assays.
[0946] Typical chromatograms for enzymatic and control assays are shown on
Example 10
Enzymatic Decarboxylation of 3-Methylcrotonic Acid Into Isobutene Catalyzed in the Presence of a Lysate Containing UbiX Protein and with Purified Decarboxylase
[0947] 0.5 M stock solution of 3-methylcrotonic acid was prepared in water and adjusted to pH 7.0 with 10 M solution of NaOH.
[0948] Proteins encoded by the aroY gene and one protein annotated as UbiD protein were produced according to the procedure described in Example 1.
[0949] Enzymatic assays were carried out in 2 ml glass vials (Interchim) under the following conditions:
[0950] 50 mM potassium phosphate buffer pH 7.5
[0951] 20 mM NaCl
[0952] 10 mM MgCl.sub.2
[0953] 5 mM DTT
[0954] 50 mM 3-methylcrotonic acid
[0955] 1 mg/ml purified AroY or UbiD protein
[0956] 50 μl lysate contained UbiX protein
[0957] Total volume of the assays were 300 μl.
[0958] A series of control assays were performed in parallel (Table H).
[0959] The vials were sealed and incubated for 120 min at 30° C. The assays were stopped by incubating for 2 min at 80° C. and the isobutene formed in the reaction headspace was analysed by Gas Chromatography (GC) equipped with Flame Ionization Detector (FID).
[0960] For the GC analysis, one ml of the headspace gas was separated in a Bruker GC-450 system equipped with a GS-alumina column (30 m×0.53 mm) (Agilent) using isothermal mode at 130° C. Nitrogen was used as carrier gas with a flow rate of 6 ml/min.
[0961] The enzymatic reaction product was identified by comparison with an isobutene standard. Under these GC conditions, the retention time of isobutene was 2.42 min.
[0962] A significant production of isobutene from 3-methylcrotonic acid was observed in the combined assays (AroY or UbiD protein+UbiX protein). Incubation of lysate containing UbiX protein alone did not result in isobutene production. These data indicate that the proteins encoded by aroY gene in association with UbiX protein can catalyze the decarboxylation of 3-methylcrotonic acid into isobutene.
TABLE-US-00008 TABLE H Isobutene production, Assay composition arbitrary units AroY protein from K. pneumoniae 10.5 (Uniprot Acession Number: B9A9M6) + lysate contained UbiX protein from E. coli + substrate AroY protein from K. pneumoniae 0 (Uniprot Acession Number: B9A9M6) + substrate UbiD protein from E. cloacae (Uniprot 8 Acession Number: V3DX94) + lysate, contained UbiX protein from E. coli + substrate UbiD protein from E. cloacae (Uniprot 0 Acession Number: V3DX94) + substrate AroY protein from Leptolyngbya sp. 5.5 (Uniprot Acession Number: A0A0S3U6D8) +lysate, contained UbiX protein from E. coli + substrate AroY protein from Leptolyngbya sp. 0 (Uniprot Acession Number: A0A0S3U6D8) + substrate AroY protein from Phascolarctobacterium 5.5 sp. (Uniprot Acession Number: R6I1V6) + lysate, contained UbiX protein from E. coli + substrate AroY protein from Phascolarctobacterium 0 sp. (Uniprot Acession Number: R6I1V6) + substrate Lysate contained UbiX protein from E. 0 coli + substrate
Example 11
Enzyme-Catalyzed Dehydration of 3-Hydroxy-3-Methylglutaryl-CoA into 3-Methylglutaconyl-CoA
[0963] The genes coding for 3-hydroxyacyl-CoA dehydratases (also termed enoyl-CoA hydratases, abbreviated in the following by ECH) (Table I) were synthesized and the corresponding enzymes were further produced according to the procedure described in Example 1. Stock solution of 20 mM 3-hydroxy-3-methylglutaryl-CoA (HMG-CoA) was prepared in water. The enzymatic assays were conducted in total volume of 0.2 ml in the following conditions:
[0964] 50 mM Tris-HCl buffer pH 7.5
[0965] 100 mM NaCl
[0966] 2 mM of 3-hydroxy-3-methylglutaryl-CoA (HMG-CoA)
[0967] 0.1 mg/ml purified 3-hydroxyacyl-CoA dehydratase.
[0968] Enzymatic assays were started by adding the 20 μl of 20 mM substrate, were run for 10 min at 30° C. run for and stopped by adding 100 μL of acetonitrile in the reaction medium. All the enzymatic assays were
[0969] performed in duplicate. The samples were then centrifuged, filtered through a 0.22 μm filter and the clarified supernatants were transferred into a clean vial for HPLC based analysis.
[0970] The analysis was performed using 1260 Inifinity LC System (Agilent), equipped with column heating module and UV detector (260 nm). 5 μl of samples were separated on Zorbax SB-Aq column (250×4.6 mm, 5 μm particle size, column temp. 30° C.), with a mobile phase flow rate of 1.5 ml/min. The separation was performed using mixed A (H.sub.2O containing 8.4 mM sulfuric acid) and B (acetonitrile) solutions in a linear gradient (0% B at initial time 0 min.fwdarw.70% B at 8 min). In these conditions, the retention time of HMG-CoA, 3-methylglutaconyl-CoA (MG-CoA) and free coenzyme A were respectively 4.26 min, 4.76 min and 3.96 min.
TABLE-US-00009 TABLE I Enzyme's abbreviation Source and Uniprot Accession Numbers LiuC 3-hydroxybutyryl-CoA dehydratase from Myxococcus xanthus (Q1D5Y4) ECH Um Putative enoyl-CoA hydratase from Ustilago maydis (Q4PEN0) ECH Bs Methylglutaconyl-CoA hydratase from Bacillus sp. GeD10 (N1LWG2) ECH LI Methylglutaconyl-CoA hydratase from Labilithrix luteola (A0A0K1PN19) ECH Pa Putative isohexenylglutaconyl-CoA hydratase from Pseudomonas aeruginosa (Q9HZV7) ECH Ms Enoyl-CoA hydratase from Marinobacter santoriniensis (M7CV63) ECH Ab Enoyl-CoA hydratase from Acinetobacter baumannii (A0A0D5YDD4) ECH Pp Isohexenylglutaconyl-CoA hydratase from Pseudomonas pseudoalcaligenes (L8MQT6)
Example 12
Microorganism for the Production of Isobutene from acetyl-CoA via 3-Methylcrotonic Acid
[0971] This example shows the direct production of isobutene by a recombinant E. coli strain which expresses exogenous genes, thereby constituting the isobutene pathway. Like most organisms, E. coli converts glucose to acetyl-CoA. The enzymes used in this study to convert acetyl-CoA into isobutene via 3-methylcrotonic acid (
TABLE-US-00010 TABLE J Uniprot Gene Accession Step Enzyme abbreviation NCB reference number XIII Acetyl-CoA thIA WP_ P45359 transferase from 010966157.1 Clostridium acetobulyticum (ThIA) IX Hydroxymethylglutaryl- mvaS WP_ Q9FD71 CoA synthase from 002357756.1 Enterococcus faecalis (MvaS) VIII Isohexenylglutaconyl- ppKF707_ WP_ L8MQT6 CoA hydratase from 3831 004422368.1 Pseudomonas pseudoalcaligenes KF707 (ECH) VII Glutaconate CoA- MXAN_ WP_ Q1D4I3 transferase from 4264 011554268.1 Myxococcus xanthus MXAN_ WP_ Q1D4I4 (AibA/B) 4265 011554267.1 VI Acyl-CoA tesB WP_ P0AGG2 thioesterase 2 from 000075876.1 Escherichia coli (TesB) I Ferulic acid FDC1 XP_ G9NLP8 decarboxylase 013946967.1 from Hypocrea atroviridis (UbiD) Flavin prenyl ubiX WP_ P0AG03 transferase from 000825700.1 Escherichia coli (UbiX)
[0972] Expression of Isobutene Biosynthetic Pathway in E. coli
[0973] All the corresponding genes were codon optimized for the expression in E. coli and synthesized by GeneArt® (Life Technologies), except the gene encoding for UbiX protein which was directly amplified from the genomic DNA of E. coli MG1655. The modified version of pUC18 (New England Biolabs), containing a modified Multiple Cloning Site (pUC18 MCS) (WO 2013/007786), was used for the overexpression of the ubiX gene. This plasmid conferred ampicillin resistance to the recombinant strain. The constructed vector was named pGB 5796 and the corresponding nucleotidic sequence is indicated in Table K.
TABLE-US-00011 TABLE K Plasmid name Nucleotidic sequence pGB 5796 tcgcgcgtttcggtgatgacggtgaaaacctctgacacatgcagctcccggagacggtcacagcttgt ctgtaagcggatgccgggagcagacaagcccgtcagggcgcgtcagcgggtgttggcgggtgtcg gggctggcttaactatgcggcatcagagcagattgtactgagagtgcaccatatgcggtgtgaaata ccgcacagatgcgtaaggagaaaataccgcatcaggcgccattcgccattcaggctgcgcaactgt tgggaagggcgatcggtgcgggcctcttcgctattacgccagctggcgaaagggggatgtgctgca aggcgattaagttgggtaacgccagggttttcccagtcacgacgttgtaaaacgacggccagtgccA AGCTTGCGGCCGCGGGGTTAATTAATTTCTCCTCTTTAATAAAGCAA ATAAATTTTTTATGATTTGTTTAAACCTAGGCATGCCtctagaTTAttaTGC GCCCTGCCAGCGGGCAAAGAGATCTTCAGGAAGGGTTATCGCAAAC TGGTCAAGAACACGATTAACCGTCTGATTTATCACATCATCAAGGGA TTGCGGGCGATGATAAAACGCCGGAACGGGAGGCATAATCACCGCA CCGATTTCTGCCGCCTGAGTCATTAAACGCAGATGGCCTAAGTGCA ATGGTGTTTCACGCACGCAGAGCACCAACGGGCGACGCTCTTTCAG CACCACATCTGCCGCACGGGTCAGTAAGCCATCAGTATAGCTATGG ACAATGCCGGAAAGGGTTTTGATTGAACAGGGTAAAATCACCATCCC CAGCGTCTGGAAAGAACCGGAAGAGATGCTGGCGGCAATATCGCG CGCATCGTGCGTGACATCGGCTAATGCCTGCACTTCGCGCAGAGAA AAATCCGTTTCGAGGGATAAGGTCTGGCGCGCTGCCTGGCTCATCA CCAGATGCGTTTCGATATCTGTGACATCGCGCAGAACCTGTAATAAG CGCACGCCATAAATCGCGCCGCTGGCACCGCTGATGCCTACAATGA GTCGTTTcatAAAAAAAATGTATATCTCCTTCggtaccGAGCTCGAACCT GCAGGAATTCgtaatcatggtcatagctgtttcctgtgtgaaattgttatccgctcacaattccaca caacatacgagccggaagcataaagtgtaaagcctggggtgcctaatgagtgagctaactcacatt aattgcgttgcgctcactgcccgctttccagtcgggaaacctgtcgtgccagctgcattaatgaatcgg ccaacgcgcggggagaggcggtttgcgtattgggcgctcttccgcttcctcgctcactgactcgctgc gctcggtcgttcggctgcggcgagcggtatcagctcactcaaaggcggtaatacggttatccacaga atcaggggataacgcaggaaagaacatgtgagcaaaaggccagcaaaaggccaggaaccgta aaaaggccgcgttgctggcgtttttccataggctccgcccccctgacgagcatcacaaaaatcgacg ctcaagtcagaggtggcgaaacccgacaggactataaagataccaggcgtttccccctggaagctc cctcgtgcgctctcctgttccgaccctgccgcttaccggatacctgtccgcctttctcccttcgggaagcg tggcgctttctcatagctcacgctgtaggtatctcagttcggtgtaggtcgttcgctccaagctgggctgt gtgcacgaaccccccgttcagcccgaccgctgcgccttatccggtaactatcgtcttgagtccaaccc ggtaagacacgacttatcgccactggcagcagccactggtaacaggattagcagagcgaggtatgt aggcggtgctacagagttcttgaagtggtggcctaactacggctacactagaaggacagtatttggta tctgcgctctgctgaagccagttaccttcggaaaaagagttggtagctcttgatccggcaaacaaacc accgctggtagcggtggtttttttgtttgcaagcagcagattacgcgcagaaaaaaaggatctcaaga agatcctttgatcttttctacggggtctgacgctcagtggaacgaaaactcacgttaagggattttggtca tgagattatcaaaaaggatcttcacctagatccttttaaattaaaaatgaagttttaaatcaatctaaagt atatatgagtaaacttggtctgacagttaccaatgcttaatcagtgaggcacctatctcagcgatctgtct atttcgttcatccatagttgcctgactccccgtcgtgtagataactacgatacgggagggcttaccatctg gccccagtgctgcaatgataccgcgagacccacgctcaccggctccagatttatcagcaataaacc agccagccggaagggccgagcgcagaagtggtcctgcaactttatccgcctccatccagtctattaa ttgttgccgggaagctagagtaagtagttcgccagttaatagtttgcgcaacgttgttgccattgctaca ggcatcgtggtgtcacgctcgtcgtttggtatggcttcattcagctccggttcccaacgatcaaggcgag ttacatgatcccccatgttgtgcaaaaaagcggttagctccttcggtcctccgatcgttgtcagaagtaa gttggccgcagtgttatcactcatggttatggcagcactgcataattctcttactgtcatgccatccgtaa gatgcttttctgtgactggtgagtactcaaccaagtcattctgagaatagtgtatgcggcgaccgagttg ctcttgcccggcgtcaatacggg ataataccgcgccacatagcagaactttaaaagtgctcatcattg gaaaacgttcttcggggcgaaaactctcaaggatcttaccgctgttgagatccagttcgatgtaaccc actcgtgcacccaactgatcttcagcatcttttactttcaccagcgtttctgggtgagcaaaaacaggaa ggcaaaatgccgcaaaaaagggaataagggcgacacggaaatgttgaatactcatactcttcctttt tcaatattattgaagcatttatcagggttattgtctcatgagcggatacatatttgaatgtatttagaaaaat aaacaaataggggttccgcgcacatttccccgaaaagtgccacctgacgtctaagaaaccattatta tcatgacattaacctataaaaataggcgtatcacgaggccctttcgtc (SEQ ID NO: 93)
[0974] An expression vector containing the origin of replication pSC was used for the expression of the genes: thIA, MvaS, ppKF707_3831, MXAN_4264/MXAN_4265, FDC1. This plasmid conferred spectinomycin resistance to the recombinant strain. The constructing vector was named pGB 5771 and the corresponding nucleotidic sequence is indicated in Table L.
TABLE-US-00012 TABLE L Plasmid name Nucleotidic sequence pGB 5771 ctcactactttagtcagttccgcagtattacaaaaggatgtcgcaaacgctgtttgctcctctacaaaac agaccttaaaaccctaaaggcttaagtagcaccctcgcaagctcgggcaaatcgctgaatattcctttt gtctccgaccatcaggcacctgagtcgctgtctttttcgtgacattcagttcgctgcgctcacggctctgg cagtgaatgggggtaaatggcactacaggcgccttttatggattcatgcaaggaaactacccataat acaagaaaagcccgtcacgcttctcagggcgttttatggcgggtctgctatgtggtgctatctgacttttt gctgttcagcagttcctgccctctgattttccagtctgaccctagtcaaggccttaagtgagtcgtattacg gactggccgtcgttttacaacgtcgtgactgggaaaaccctggcgttacccaacttaatcgccttgcag cacatccccctttcgccagctggcgtaatagcgaagaggcccgcaccgatcgcccttcccaacagtt gcgcagcctgaatggcgaatggcgcctgatgcggtattttctccttacgcatctgtgcggtatttcacac cgCCCGGGGAACTATAgtttaaacTTTTCAATGAATTCATTTaaGCGGCCG CatcaatTCTAGAatttaaatagtcaaaagcctccgaccggaggcttttgactgACCTATTG ACAATTAAAGGCTAAAATGCTATAATTCCACtaatagaaataattttgtttaacttta ggtctctatcgtaaGAAGGAGATATatgaaagaagtggtgattgccagcgcagttcgtaccgc aattggtagctatggtaaaagcctgaaagatgttccggcagttgatctgggtgcaaccgcaattaaag aagcagttaaaaaagccggtattaaaccggaagatgtgaacgaagttattctgggtaatgttctgcaa gcaggtctgggtcagaatccggcacgtcaggcctcgtttaaagcaggtctgccggttgaaattccgg caatgaccattaacaaagtttgtggtagcggtctgcgtaccgttagcctggcagcacagattatcaaa gccggtgatgcagatgttattattgccggtggtatggaaaatatgagccgtgcaccgtatctggcaaat aatgcacgttggggttatcgtatgggtaatgccaaatttgtggatgagatgattaccgatggtctgtggg atgcctttaatgattatcacatgggtattaccgcagagaatattgcagaacgttggaatattagccgtga agaacaggatgaatttgcactggcaagccagaaaaaagcagaagaagcaattaaaagcggtca gttcaaagatgaaattgtgccggttgttatcaaaggtcgtaaaggtgaaaccgttgttgataccgatga acatccgcgttttggtagcaccattgaaggtctggcaaaactgaaaccggcattcaaaaaagatggc accgttaccgcaggtaatgcaagcggtctgaatgattgtgcagcagttctggttattatgagcgcaga aaaagcaaaagaactgggtgttaaaccgctggcaaaaattgtgagctatggtagtgccggtgttgat ccggcaattatgggttatggtccgttttatgcaaccaaagcagcaattgaaaaagcaggttggaccgt tgatgaactggatctgattgaaagcaatgaagcatttgcagcacagagcctggcagttgcaaaaga cctgaaattcgatatgaataaagtgaatgtgaatggcggtgcaattgccctgggtcatccgattggtgc aagcggtgcacgtattctggttaccctggttcatgcaatgcagaaacgtgatgcaaaaaaaggtctg gccaccctgtgtattggtggtggtcagggcaccgcaattctgctggaaaaatgctaataagcttGAA GGAGATATAATGACCATTGGTATTGATAAAATCAGCTTTTTCGTGCCT CCGTACTATATTGATATGACCGCACTGGCCGAAGCACGTAATGTTGA TCCGGGTAAATTTCATATTGGTATTGGTCAGGATCAGATGGCCGTTA ATCCGATTAGCCAGGATATTGTTACCTTTGCAGCAAATGCAGCAGAA GCAATTCTGACCAAAGAAGATAAAGAGGCCATTGATATGGTTATTGT TGGCACCGAAAGCAGCATTGATGAAAGCAAAGCAGCAGCAGTTGTT CTGCATCGTCTGATGGGTATTCAGCCGTTTGCACGTAGCTTTGAAAT TAAAGAAGCATGTTACGGAGCAACCGCAGGTCTGCAACTGGCAAAA AATCATGTTGCACTGCATCCGGATAAAAAAGTTCTGGTTGTTGCAGC AGATATTGCCAAATATGGTCTGAATAGCGGTGGTGAACCGACCCAG GGTGCCGGTGCAGTTGCAATGCTGGTTGCAAGCGAACCGCGTATTC TGGCACTGAAAGAAGATAATGTTATGCTGACCCAGGATATTTATGAT TTTTGGCGTCCGACCGGTCATCCGTATCCGATGGTTGATGGTCCGC TGAGCAATGAAACCTATATTCAGAGCTTTGCACAGGTGTGGGATGAA CATAAAAAACGTACCGGTCTGGATTTCGCAGATTATGATGCACTGGC ATTTCATATCCCGTATACCAAAATGGGTAAAAAAGCACTGCTGGCCA AAATTAGCGATCAGACCGAAGCCGAACAAGAACGCATTCTGGCACG TTATGAAGAAAGCATTGTTTATAGCCGTCGTGTGGGTAATCTGTATA CCGGTAGCCTGTATCTGGGTCTGATTAGCCTGCTGGAAAATGCAAC CACCCTGACCGCAGGTAATCAGATTGGTCTGTTTAGCTATGGTAGC GGTGCCGTTGCAGAATTTTTCACAGGTGAACTGGTTGCAGGTTATCA GAATCATCTGCAAAAAGAAACCCATCTGGCACTGCTGGATAATCGTA CCGAACTGAGCATTGCAGAATATGAAGCAATGTTTGCAGAAACCCTG GATACCGATATTGATCAGACCCTGGAAGATGAACTGAAATATAGCAT TAGCGCCATTAATAACACCGTGCGTAGCTATCGTAACTAATAAggtaG AAGGAGATATACATatgagtcaggcgctaaaaaatttactgacattgttaaatctggaaaaa attgaggaaggactctttcgcggccagagtgaag atttaggtttacgccaggtgtttggcggccaggt cgtgggtcaggccttgtatgctgcaaaagagacGgtccctgaagaAcggctggtacattcgtttcac agctactttcttcgccctggcgatagtaagaagccgattatttatgatgtcgaaacgctgcgtgacggta acagcttcagcgcccgccgggttgctgctattcaaaacggcaaaccgattttttatatgactgcctctttc caggcaccagaagcgggtttcgaacatcaaaaaacaatgccgtccgcgccagcgcctgatggcct cccttcggaaacgcaaatcgcccaatcgctggcgcacctgctgccgccagtgctgaaagataaatt catctgcgatcgtccgctggaagtccgtccggtggagtttcataacccactgaaaggtcacgtcgcag aaccacatcgtcaggtgtggatTcgcgcaaatggtagcgtgccggatgacctgcgcgttcatcagta tctgctcggttacgcttctgatcttaacttcctgccggtagctctacagccgcacggcatcggttttctcga accggggattcagattgccaccattgaccattccatgtggttccatcgcccgtttaatttgaatgaatgg ctgctgtatagcgtggagagcacctcggcgtccagcgcacgtggctttgtgcgcggtgagttttatacc caagacggcgtactggttgcctcgaccgttcaggaaggggtgatgcgtaatcacaattaataag aac GAAGGAGATATAAtgAAAACCGCACGTTGGTGTAGCCTGGAAGAAGC AGTTGCAAGCATTCCGGATGGTGCAAGCCTGGCAACCGGTGGTTTT ATGCTGGGTCGTGCACCGATGGCACTGGTTATGGAACTGATTGCAC AGGGTAAACGTGATCTGGGTCTGATTAGCCTGCCGAATCCGCTGCC AGCAGAATTTCTGGTTGCCGGTGGTTGTCTGGCTCGTCTGGAAATT GCATTTGGTGCACTGAGTCTGCAAGGTCGTGTTCGTCCGATGCCGT GTCTGAAACGTGCAATGGAACAGGGCACCCTGGCATGGCGTGAACA TGATGGTTATCGTGTTGTTCAGCGTCTGCGTGCAGCAAGCATGGGT CTGCCGTTTATTCCGGCACCGGATGCAGATGTTAGCGGTCTGGCAC GTACCGAACCGCCTCCGACCGTTGAAGATCCGTTTACCGGTCTGCG TGTTGCAGTTGAACCGGCATTTTATCCGGATGTTGCACTGCTGCACG CACGTGCAGCCGATGAACGTGGTAATCTGTATATGGAAGATCCGAC CACCGATCTGCTGGTTGCGGGTGCAGCAAAACGTGTTATTGCAACC GTTGAAGAACGTGTTGCAAAACTGCCTCGTGCAACCCTGCCTGGTTT TCAGGTTGATCGTATTGTTCTGGCACCGGGTGGTGCACTGCCGACC GGTTGTGCAGGTCTGTATCCGCATGATGATGAAATGCTGGCACGTT ATCTGAGCCTGGCAGAAACCGGTCGTGAAGCCGAATTTCTGGAAAC CCTGCTGACCCGTCGTGCAGCATAATGAggatccGAAGGAGATATACA TAtgAGCGCAACCCTGGATATTACACCGGCAGAAACCGTTGTTAGCC TGCTGGCACGTCAGATTGATGATGGTGGTGTTGTTGCAACCGGTGT TGCAAGTCCGCTGGCAATTCTGGCCATTGCAGTTGCACGTGCCACC CATGCACCGGATCTGACCTATCTGGCATGTGTTGGTAGCCTGGACC CGGAAATTCCGACCCTGCTGCCGAGCAGCGAAGACCTGGGTTATCT GGATGGTCGTAGCGCAGAAATTACCATTCCGGACCTGTTTGATCATG CACGTCGTGGTCGTGTTGATACCGTTTTTTTTGGTGCAGCCGAAGTT GATGCCGAAGGTCGTACCAATATGACCGCAAGCGGTAGTCTGGATA AACCGCGTACCAAATTTCCGGGTGTTGCCGGTGCAGCCACCCTGCG TCAGTGGGTTCGTCGTCCGGTTCTGCTGGTTCCGCGTCAGAGCCGT CGTAATCTGGTTCCGGAAGTTCAGGTTGCAACCACCCGTGATCCGC GTCGTCCGGTGACCCTGATTAGCGATCTGGGTGTTTTTGAACTGGG TGCAAGCGGTGCACGTCTGCTGGCACGCCATCCGTGGGCAAGCGA AGAACATATTGCAGAACGTACCGGTTTTGCATTTCAGGTTAGCGAAG CACTGAGCGTTACCAGCCTGCCGGATGCACGTACCGTTGCAGCAAT TCGTGCAATTGATCCGCATGGCTATCGTGATGCACTGGTTGGTGCAT AATTAgtcagaaggagatataCATATGAGCCTGCCGCATTGTGAAACCCTG CTGCTGGAACCGATTGAAGGTGTTCTGCGTATTACCCTGAATCGTCC GCAGAGCCGTAATGCAATGAGCCTGGCAATGGTTGGTGAACTGCGT GCAGTTCTGGCAGCAGTTCGTGATGATCGTAGCGTTCGTGCACTGG TTCTGCGTGGTGCAGATGGTCATTTTTGTGCCGGTGGTGATATTAAA GATATGGCAGGCGCACGTGCAGCCGGTGCAGAAGCATATCGTACAC TGAATCGTGCATTTGGTAGCCTGCTGGAAGAAGCACAGGCAGCACC GCAGCTGCTGGTTGCACTGGTTGAAGGTGCCGTTCTGGGTGGTGGT TTTGGTCTGGCATGTGTTAGTGATGTTGCAATTGCAGCAGCAGATGC ACAGTTTGGTCTGCCGGAAACCAGCCTGGGTATTCTGCCTGCACAG ATTGCACCGTTTGTTGTTCGTCGTATTGGTCTGACCCAGGCACGTCG TCTGGCACTGACCGCAGCACGTTTTGATGGTCGTGAAGCACTGCGT CTGGGTCTGGTTCATTTTTGTGAAGCAGATGCAGATGCACTGGAACA GCGTCTGGAAGAAACCCTGGAACAGCTGCGTCGTTGTGCACCGAAT GCAAATGCAGCAACCAAAGCACTGCTGCTGGCAAGCGAAAGCGGTG AACTGGGTGCACTGCTGGATGATGCAGCACGTCAGTTTGCCGAAGC AGTTGGTGGTGCAGAAGGTAGCGAAGGCACCCTGGCATTTGTTCAG AAACGTAAACCGGTTTGGGCACAGTAATAAtgaaagagaccagcctgatacag attaaatcagaacgcagaagcggtctgataaaacagaatttgcctggcggcagtagcgcggtggtc ccacctgaccccatgccgaactcagaagtgaaacgccgtagcgccgatggtagtgtggggtcacc ccatgcgagagtagggaactgccaggcatcaaataaaacgaaaggctcagtcgaaagactgggc ctttcgttttatctgttgtttgtcggtgaactACTAGAatttaaatagtcaaaagcctccgaccggaggc ttttgactgACCTATTGACAATTAAAGGCTAAAATGCTATAATTCCACtaatag aaataattttgtttaactttaggtctctatcgaccataaTTAATTAActttaagaaggagatataCAT atgAGCAGCACCACCTATAAAAGCGAAGCATTTGATCCGGAACCGCC TCATCTGAGCTTTCGTAGCTTTGTTGAAGCACTGCGTCAGGATAATG ATCTGGTGGATATTAATGAACCGGTTGATCCGGATCTGGAAGCAGC AGCAATTACCCGTCTGGTTTGTGAAACCGATGATAAAGCACCGCTGT TTAATAACGTGATTGGTGCAAAAGATGGTCTGTGGCGTATTCTGGGT GCACCGGCAAGCCTGCGTAGCAGCCCGAAAGAACGTTTTGGTCGTC TGGCACGTCATCTGGCACTGCCTCCGACCGCAAGCGCAAAAGATAT TCTGGATAAAATGCTGAGCGCCAATAGCATTCCGCCTATTGAACCGG TTATTGTTCCGACCGGTCCGGTTAAAGAAAATAGCATTGAAGGCGAA AACATTGATCTGGAAGCCCTGCCTGCACCGATGGTTCATCAGAGTG ATGGTGGCAAGTATATCCAGACCTATGGTATGCATGTTATCCAGAGT CCGGATGGTTGTTGGACCAATTGGAGCATTGCCCGTGCAATGGTTA GCGGTAAACGTACCCTGGCAGGTCTGGTTATTAGTCCGCAGCATAT TCGTAAAATTCAGGATCAGTGGCGTGCAATTGGTCAAGAAGAAATTC CTTGGGCACTGGCATTTGGTGTTCCGCCTACCGCAATTATGGCAAG CAGTATGCCGATTCCGGATGGTGTTAGCGAAGCAGGTTATGTTGGT GCAATTGCCGGTGAACCGATTAAACTGGTTAAATGCGATACCAACAA TCTGTATGTTCCGGCAAATAGCGAAATTGTTCTGGAAGGCACCCTGA GCACCACCAAAATGGCACCGGAAGGTCCGTTTGGTGAAATGCATGG TTATGTTTATCCGGGTGAAAGCCATCCGGGTCCGGTTTATACCGTTA ACAAAATTACCTATCGCAACAATGCAATTCTGCCGATGAGCGCATGT GGTCGTCTGACCGATGAAACCCAGACCATGATTGGCACCCTGGCAG CAGCAGAAATTCGTCAGCTGTGTCAGGATGCAGGTCTGCCGATTAC CGATGCATTTGCACCGTTTGTTGGTCAGGCAACCTGGGTTGCACTG AAAGTTGATACCAAACGTCTGCGTGCAATGAAAACCAATGGTAAAGC ATTTGCAAAACGTGTTGGTGATGTTGTGTTTACCCAGAAACCGGGTT TTACCATTCATCGTCTGATTCTGGTTGGTGATGATATTGATGTGTATG ACGATAAAGATGTGATGTGGGCATTTACCACCCGTTGTCGTCCGGG TACAGATGAAGTTTTTTTTGATGATGTTGTGGGCTTTCAGCTGATCCC GTATATGAGTCATGGTAATGCCGAAGCAATTAAAGGTGGTAAAGTTG TTAGTGATGCACTGCTGACCGCAGAATATACCACCGGTAAAGATTGG GAAAGCGCAGATTTCAAAAACAGCTATCCGAAAAGCATCCAGGATAA AGTTCTGAATAGCTGGGAACGCCTGGGTTTCAAAAAACTGGATTAAT AACCATGGttataagagagaccagcctGACTCCTGTTGATAGATCCAGTAAT GACCTCAGAACTCCATCTGGATTTGTTCAGAACGCTCGGTTGCCGC CGGGCGTTTTTTATTGGTGAGAATaactACTAGTtggcggGCGGCCGCtta gctCTGCAGatgagaaattcttgaagacgaaagggcctcgtgatacgcctatttttataggttaatg tcatgataataatggtttAAGCTTcttagaataGCTCTTCTATGaggtggcacttttcgggga aaGATATCcgcatatatggtgcactctcagtacaatctgctctgatgccgcatagttaagccagtat acactccgctatcgctacgtgactgggtcatggctgcgccccgacacccgccaacacccgctgacg cgccctgacgggcttgtctgctcccggcatccgcttacagacaagctgtgaccgtctccgggagctgc atgtgtcagaggttttcaccgtcatcaccgaaacgcgcgaggcagctgcggtaaagctcatcagcgt ggtcgtgaagcgattcacagatgtctgcctgttcatcGGTACCtttcatgatatatctcccaatttgtgt agggcttattatgcacgcttaaaaataataaaagcagacttgacctgatagtttggctgtgagcaattat gtgcttagtgcatctaacgcttgagttaagccgcgccgcgaagcggcgtcggcttgaacgaattgtta gacattatttgccgactaccttggtgatctcgcctttcacgtagtggacaaattcttccaactgatctgcgc gcgaggccaagcgatcttcttcttgtccaagataagcctgtctagcttcaagtatgacgggctgatact gggccggcaggcgctccattgcccagtcggcagcgacatccttcggcgcgattttgccggttactgc gctgtaccaaatgcgggacaacgtaagcactacatttcgctcatcgccagcccagtcgggcggcg a gttccatagcgttaaggtttcatttagcgcctcaaatagatcctgttcaggaaccggatcaaagagttcc tccgccgctggacctaccaaggcaacgctatgttctcttgcttttgtcagcaagatagccagatcaatgt cgatcgtggctggctcgaagatacctgcaagaatgtcattgcgctgccattctccaaattgcagttcgc gcttagctgg ataacgccacgg aatgatgtcgtcgtgcacaacaatggtgacttctacagcgcggag aatctcgctctctccaggggaagccgaagtttccaaaaggtcgttgatcaaagctcgccgcgttgtttc atcaagccttacggtcaccgtaaccagcaaatcaatatcactgtgtggcttcaggccgccatccactg cggagccgtacaaatgtacggccagcaacgtcggttcgagatggcgctcgatgacgccaactacct ctgatagttgagtcgatacttcggcgatcaccgcttccctcatgatgtttaactttgttttagggcgactgc cctgctgcgtaacatcgttgctgctccataacatcaaacatcgacccacggcgtaacgcgcttgctgct tggatgcccgaggcatagactgtaccccaaaaaaacagtcataacaagccatgaaaaccgccac GAGCTCctgtcagaccaagtttacgagctcgcttggactcctgttgatagatccagtaatgacctca gaactccatctggatttgttcagaacgctcggttgccgccgggcgttttttattggtgagaatccaagca ctagggacagtaagacgggtaagcctgttgatgataccgctgccttactgggtgcattagccagtctg aatgacctgtcacgggataatccgaagtggtcagactggaaaatcagagggcaggaactgctgaa cagcaaaaagtcagatagcaccacatagcagacccgccataaaacgccctgagaagcccgtga cgggcttttcttgtattatgggtagtttccttgcatgaatccataaaaggcgcctgtagtgccatttacccc cattcactgccagagccgtgagcgcagcgaactgaatgtcacgaaaaagacagcgactcaggtg cctgatggtcggagacaaaaggaatattcagcgatttgcccgagcttgcgagggtgctacttaagcct ttagggttttaaggtctgttttgtag aggagcaaacagcgtttgcgacatccttttgtaatactgcgg aact gactaaagtagtgagttatacacagggctgggatctattctttttatctttttttattctttctttattctataaatt ataaccacttgaatataaacaaaaaaaacacacaaaggtctagcggaatttacagagggtctagc agaatttacaagttttccagcaaaggtctagcagaatttacagatacccacaactcaaaggaaaag gacatgtaattatcattgactagcccatctcaattggtatagtgattaaaatcacctagaccaattgaga tgtatgtctgaattagttgttttcaaagcaaatgaactagcgattagtcgctatgacttaacggagcatga aaccaagctaattttatgctgtgtggcactactcaaccccacgattg aaaaccctacaaggaaagaa cggacggtatcgttcacttataaccaatacgctcagatgatgaacatcagtagggaaaatgcttatgg tgtattagctaaagcaaccagagagctgatgacgagaactgtggaaatcaggaatcctttggttaaa ggctttgagattttccagtggacaaactatgccaagttctcaagcg aaaaattagaattagtttttagtga agagatattgccttatcttttccagttaaaaaaattcataaaatataatctggaacatgttaagtcttttgaa aacaaatactctatgaggatttatgagtggttattaaaagaactaacacaaaagaaaactcacaagg caaatatagagattagccttgatgaatttaagttcatgttaatgcttgaaaataactaccatgagtttaaa aggcttaaccaatgggttttgaaaccaataagtaaagatttaaacacttacagcaatatgaaattggtg gttgataagcgaggccgcccgactgatacgttgattttccaagttgaactagatagacaaatggatctc gtaaccgaacttgagaacaaccagataaaaatgaatggtgacaaaataccaacaaccattacatc agattcctacctacgtaacggactaagaaaaacactacacgatgctttaactgcaaaaattcagctc accagttttgaggcaaaatttttgagtgacatgcaaagtaagcatg atctcaatggttcgttctcatggct cacgcaaaaacaacgaaccacactagagaacatactggctaaatacggaaggatctgaggttctt atggctcttgtatctatcagtgaagcatcaagactaacaaacaaaagtagaacaactgttcaccgtta gatatcaaagggaaaactgtccataagcacagatgaaaacggtgtaaaaaagatagatacatcag agcttttacgagtttttggtgcatttaaagctgttcaccatgaacagatcgacaatgtaacGCATGCa ccgagcgcagcgagtcagtgagcgaggaagcggaacagcgcctg (SEQ ID NO: 94)
[0975] These recombinant pGBE 5771 and pGBE5796 plasmids were verified by sequencing.
[0976] MG1655 E. coli strain was made electrocompetent and was transformed with pGBE5771 and pGBE5796 or with the corresponding empty vectors (pUC18 MCS and pGB2021) in order to create negative controls. The strains thus produced are summarized in Table M.
TABLE-US-00013 TABLE M Strain number Vectors Strain 1 (metabolic pUC18_MCS + pGB 2021 pathway-free control), containing the empty vectors. Strain 2, expressing only pGB 5796 + pGB 2021 UbiX protein Strain 3, expressing the pUC18_MCS + PGB 5771 whole metabolic pathway, without overexpression of UbiX protein on plasmid. Strain 4, expressing the pGB 5796 + pGB 5771 whole metabolic pathway, comprising overexpression of UbiX protein on plasmid.
[0977] The transformed cells were then plated on LB plates, supplied with ampicillin (100 μg/ml) and spectinomycin (100 μg/ml). Plates were incubated overnight at 30° C. Isolated colonies were used to inoculate 1.4 ml of ZYM-5052 auto-inducing media (Studier FW, Prot. Exp. Pur. 41, (2005), 207-234) supplemented with ampicillin, spectinomycin and 0.5 mM flavin mononucleotide. These cultures were grown for 16 h at 30° C. and 700 rpm shaking in 96 deep-well microplates. Then the cultures were centrifuged and the pellets were resuspended in 0.4 ml of MS medium (Richaud C., Mengin-Leucreulx D., Pochet S., Johnson E J., Cohen G N. and Marlière P, The Journal of Biological Chemistry, 268, (1993), 26827-26835) containing glucose (45 g/L), and MgSO.sub.4 (1 mM). The cultures were further incubated in 96 deep-well sealed microplates at 30° C., 700 rpm shaking for 24 hours. The production of isobutene was stopped by incubating the microplates for 5 min at 80° C. and the isobutene formed in the reaction headspace was analysed by Gas Chromatography (GC) equipped with Flame Ionization Detector (FID). 100 μL of headspace gases from each enzymatic reaction are injected in a Brucker GC-450 system equipped with a Flame Ionization Detector (FID). Compounds present in samples were separated by chromatography using a GS-alumina column (30 m×0.53 mm) (Agilent) using isothermal mode at 130° C. Nitrogen was used as carrier gas with a flow rate of 6 ml/min. Upon injection, peak areas of isobutene were calculated; Table N.
TABLE-US-00014 TABLE N IBN production, Strain number Vectors arbitrary units Strain 1 (metabolic pUC18_MCS + pGB 2021 950 pathway-free control), containing the empty vectors Strain 2, expressing only pGB 5796 + pGB 2021 710 UbiX proteine Strain 3, expressing the pUC18_MCS + PGB 5771 625 whole metabolic pathway, without overexpression of UbiX protein on plasmid Strain 4, expressing the pGB 5796 + pGB 5771 15192 whole metabolic pathway, comprising overexpression of UbiX protein on plasmid