Insulin analogs with reduced affinity to insulin receptor and use thereof
11396534 · 2022-07-26
Assignee
Inventors
- In Young CHOI (Hwaseong-si, KR)
- Sung Youb JUNG (Hwaseong-si, KR)
- Marcus Korn (Frankfurt am Main, DE)
- Stefan Guessregen (Frankfurt am Main, DE)
- Norbert TENNAGELS (Frankfurt am Main, DE)
Cpc classification
C12N15/70
CHEMISTRY; METALLURGY
C07K1/20
CHEMISTRY; METALLURGY
International classification
C12N15/70
CHEMISTRY; METALLURGY
Abstract
The present invention relates to a novel insulin analog, use thereof, and a method for preparing the analog.
Claims
1. An insulin analog comprising an A-chain of SEQ ID NO: 55 of the following Formula 1 and a B-chain of SEQ ID NO: 56 of the following Formula 2, wherein the insulin analog shows binding affinity to insulin receptors of about 99% or less and about 75% or greater, with respect to the binding affinity of native insulin to insulin receptors, as evaluated by Scintillation proximity assay (SPA), the binding affinity of native insulin to insulin receptors being 100%: TABLE-US-00008 Formula 1 (SEQ ID NO: 55) Xaa1-Ile-Val-Glu-Xaa5-Cys-Cys-Thr-Ser-Ile-Cys- Xaa12-Leu-Xaa14-Gln-Xaa16-Glu-Asn-Xaa19-Cys-Xaa21 Formula 2 (SEQ ID NO: 56) Phe-Val-Asn-Gln-His-Leu-Cys-Gly-Ser-His-Leu-Val-Glu -Ala-Leu-Xaa16-Leu-Val-Cys-Gly-Glu-Arg-Gly-Phe- Xaa25-Tyr-Xaa27-Xaa28-Lys-Thr, wherein (1) in Formula 1, Xaa1 is glycine, Xaa5 is glutamine, Xaa12 is serine, Xaa14 is histidine, Xaa16 is leucine, Xaa19 is tyrosine, and Xaa21 is asparagine; and in Formula 2, Xaa16 is tyrosine, Xaa25 is phenylalanine, Xaa27 is threonine, and Xaa28 is proline; (2) in Formula 1, Xaa1 is glycine, Xaa5 is glutamine, Xaa12 is serine, Xaa14 is lysine, Xaa16 is leucine, Xaa19 is tyrosine, and Xaa21 is asparagine; and in Formula 2, Xaa16 is tyrosine, Xaa25 is phenylalanine, Xaa27 is threonine, and Xaa28 is proline; (3) in Formula 1, Xaa1 is glycine, Xaa5 is glutamine, Xaa12 is serine, Xaa14 is alanine, Xaa16 is leucine, Xaa19 is tyrosine, and Xaa21 is asparagine; and in Formula 2, Xaa16 is tyrosine, Xaa25 is phenylalanine, Xaa27 is threonine, and Xaa28 is proline; or (4) in Formula 1, Xaa1 is glycine, Xaa5 is glutamine, Xaa12 is serine, Xaa14 is aspartic acid, Xaa16 is leucine, Xaa19 is tyrosine, and Xaa21 is asparagine; and in Formula 2, Xaa16 is tyrosine, Xaa25 is phenylalanine, Xaa27 is threonine, and Xaa28 is proline.
2. The insulin analog of claim 1, comprising an amino acid sequence selected from the group consisting of SEQ ID NOS: 28, 30, 44, and 46.
3. The insulin analog of claim 1, wherein in Formula 1, Xaa1 is glycine, Xaa5 is glutamine, Xaa12 is serine, Xaa14 is aspartic acid, Xaa16 is leucine, Xaa19 is tyrosine, and Xaa21 is asparagine; and in Formula 2, Xaa16 is tyrosine, Xaa25 is phenylalanine, Xaa27 is threonine, and Xaa28 is proline.
4. An isolated nucleic acid encoding the insulin analog of claim 1.
5. A recombinant expression vector comprising the nucleic acid of claim 4.
6. A transformant comprising the recombinant expression vector of claim 5.
7. The transformant of claim 6, wherein the transformant is E. coli.
8. A method of preparing the insulin analog of claim 1 comprising: a) expressing the insulin analog of claim 1 by culturing a transformant comprising a nucleic acid encoding the insulin analog; and b) isolating and purifying the expressed insulin analog.
9. The method of preparing the insulin analog of claim 8, wherein the b) the isolating and purifying comprise: b-1) obtaining the transformant from the culture in step a) and pulverizing the same; b-2) recovering the expressed insulin analog from the pulverized cell lysate followed by refolding the same; b-3) purifying the refolded insulin analog by cation exchange chromatography; b-4) treating the purified insulin analog with trypsin and carboxypeptidase B; and b-5) sequentially purifying the treated insulin analog by cation exchange chromatography, and anion exchange chromatography or reversed-phase chromatography.
10. A composition comprising the insulin analog of claim 1 as an active ingredient.
11. A method for treating a subject with diabetes, including administering the insulin analog of claim 1 or a composition containing the same to the subject.
Description
BRIEF DESCRIPTIONS OF THE DRAWINGS
(1)
(2)
(3)
(4)
DETAILED DESCRIPTION OF THE INVENTION
(5) Hereinbelow, exemplary embodiments of the present invention will be described in detail.
(6) Meanwhile, each of the explanations and exemplary embodiments disclosed herein can be applied to other explanations and exemplary embodiments. That is, all combinations of various factors disclosed herein belong to the scope of the present invention. Furthermore, the scope of the present invention should not be limited by the specific disclosure provided hereinbelow.
(7) Additionally, those skilled in the art will be able to recognize or confirm, based on routine experimentation, many equivalents to the specific embodiments of the present invention described in this application, and such equivalents are intended to be included in the present invention.
(8) Through the entire specification, the conventional 1-letter and 3-letter codes for the amino acids are used. Additionally, the amino acids mentioned in abbreviations herein are described according to the IUPAC-IUB rules.
(9) An aspect of the present invention provides a novel insulin analog, and specifically, an insulin analog which includes at least one modification in amino acid(s) selected from the group consisting of the 16.sup.th amino acid of the B-chain, the 25.sup.th amino acid of the B-chain, the 14.sup.th amino acid of the A-chain, and the 19.sup.th amino acid of the A-chain of native insulin.
(10) As used herein, the term “insulin analog” refers to non-native insulin which is different from native insulin.
(11) The insulin analog includes non-native human insulin which is different from native human insulin. Such an insulin analog includes analogs in which a part of the amino acid of native insulin is modified by addition, deletion, or substitution.
(12) Specifically, the insulin analog of the present invention may be one which has a sequence identify of at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, or at least 95%, comparing its sequence identity to that of native insulin sequence. Additionally, the insulin analog of the present invention may be one which has a reduced receptor binding affinity compared to that of native insulin while having the above sequence identity. Additionally, the insulin analog may have a glucose uptake ability as in native insulin and/or have an ability to lower the in-vivo blood glucose levels.
(13) More specifically, the insulin analog of the present invention may exhibit a binding affinity to insulin receptors of about 99% or less, about 95% or less, about 90% or less, about 85% or less, about 80% or less, about 75% or less, about 70% or less, about 65% or less, about 60% or less, about 55% or less, about 50% or less, about 45% or less, about 40% or less, about 35% or less, about 30% or less, about 25% or less, about 20% or less, about 15% or less, about 10% or less, about 9% or less, about 8% or less, about 7% or less, about 6% or less, about 5% or less, about 4% or less, about 3% or less, about 2% or less, about 1% or less, or about 0.1% or less, compared to the binding affinity of native insulin to insulin receptors (100%) (however, the binding affinity of the insulin analog of the present invention to insulin receptors does not correspond to 0%).
(14) The binding affinity of insulin analogs to insulin receptors may be evaluated by Scintillation proximity assay (SPA), which utilizes the competitive reaction between an insulin analog and I.sup.125-tagged insulin in a cell membrane which overexpresses recombinant human insulin receptors. This method can also be used for the evaluation of binding affinity of insulin analogs to insulin receptors. As an exemplary embodiment of the method, the method used in Example 8 may be used.
(15) As used herein, the term “about” refers to a range including ±0.5, ±0.4, ±0.3, ±0.2, ±0.1, etc., and the term “about” includes any numerical value that is equivalent or in the range being similar to the numerical value following the term, but is not limited to.
(16) Additionally, the insulin analog of the present invention may have glucose uptake ability as in native insulin.
(17) Specifically, the insulin analog of the present invention may be one which has glucose uptake ability of about 10% or more, about 20% or more, about 30% or more, about 40% or more, about 50% or more, about 55% or more, about 60% or more, about 65% or more, about 70% or more, about 75% or more, about 80% or more, about 85% or more, about 90% or more, about 95% or more, about 100% or more, about 110% or more, about 120% or more, about 130% or more, about 140% or more, about 150% or more, about 160% or more, about 170% or more, about 180% or more, about 190% or more, or about 200% or more, compared to the glucose uptake ability of native insulin (100%).
(18) The measurement of glucose uptake ability can be achieved by various methods for measuring glucose uptake ability known in the art, and for example, can be achieved by the method for measuring glucose uptake ability described in Example 9, but the measurement method is not limited thereto.
(19) Specifically, the insulin analogs to be applied in the present invention may be in the form of a single polypeptide chain or two polypeptide chains, more preferably two polypeptide chain, but the insulin analogs are not particularly limited thereto.
(20) The insulin analog in the form of two polypeptide chains may be composed of two polypeptides, i.e., a polypeptide corresponding to the A-chain of native insulin and a polypeptide corresponding to the B-chain of native insulin. In particular, corresponding to the A-chain or B-chain of native insulin may refer to cases in which any one chain of the polypeptides of the two polypeptide chains has a sequence identify of at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, or at least 95%, compared to that of the A-chain or B-chain of native insulin, but is not particularly limited thereto, and those skilled in the art can easily determine the same by comparison between the sequence constituting the two polypeptide chains and that of the A-chain or B-chain of native insulin.
(21) Native insulin is a hormone secreted by the pancreas and generally have the role of promoting intracellular glucose absorption and inhibiting fat breakdown, thereby controlling in-vivo blood glucose levels. Insulin, which can control blood glucose levels, is generated from the processing of its precursor, proinsulin, which does not have the function of controlling blood glucose levels. Insulin is composed of two polypeptide chains, i.e., the A-chain and the B-chain, which include 21 and 30 amino acids, respectively, and are interlinked by two disulfide bridges. Each of the A-chain and the B-chain may include the amino acid sequences represented by SEQ ID NOS: 53 and 54 shown below.
(22) TABLE-US-00001 A-chain: (SEQ ID NO: 53) Gly-Ile-Val-Glu-Gln-Cys-Cys-Thr-Ser-Ile-Cys-Ser- Leu-Tyr-Gln-Leu-Glu-Asn-Tyr-Cys-Asn B-chain: (SEQ ID NO: 54) Phe-Val-Asn-Gln-His-Leu-Cys-Gly-Ser-His-Leu-Val- Glu-Ala-Leu-Tyr-Leu-Val-Cys-Gly-Glu-Arg-Gly-Phe- Phe-Tyr-Thr-Pro-Lys-Thr
(23) In an exemplary embodiment, the insulin analogs described in the present invention may be those with a reduced binding affinity to receptors while having the function of controlling the in-vivo blood glucose levels like the native insulin. More specifically, the insulin analog may possess the ability of lowering in-vivo blood glucose levels.
(24) Additionally, in an exemplary embodiment, the kind and size of the insulin analogs may not be particularly limited as long as they can exhibit the reduced receptor-mediated internalization or receptor-mediated clearance. Accordingly, the insulin analogs of the present invention can exhibit improved half-life in the blood compared to native insulin. The insulin analogs of the present invention include inverted insulin, derivatives of native insulin, fragments of native insulin, etc. The insulin analogs can be prepared not only by a recombinant method but also by a solid phase synthesis, and the preparation method is not limited thereto.
(25) As used herein, the term “derivatives of native insulin” refers to a peptide which has at least one difference in the amino acid sequence compared to that of the native insulin, a peptide prepared by modification of the native insulin sequence, and a native insulin mimic which can control the in-vivo blood glucose levels like the native insulin. Such derivatives of native insulin may be those which have the function of controlling in-vivo blood glucose levels.
(26) Specifically, the derivatives of native insulin may be prepared via modification by any one method of substitution, addition, deletion, and modification in a part of the amino acid of the native insulin, or a combination of the methods.
(27) Specifically, the derivatives of native insulin may have a homology of 80% or higher to each of the amino acid sequences of the A-chain and the B-chain of native insulin and/or a part of the groups in an amino acid residue may be modified by chemical substitution (e.g., alpha-methylation, alpha-hydroxylation), deletion (e.g., deamination), or modification (e.g., N-methylation), etc., but are not limited thereto.
(28) The derivatives of native insulin applied in the present invention may be prepared by a combination of various methods used for preparing derivatives.
(29) Additionally, such modification for the preparation of the derivatives of native insulin includes a modification using L-type or D-type amino acid(s), and/or non-natural amino acid(s); and/or a modification of the native sequence or post-translational modification (e.g., methylation, acylation, ubiquitination, intermolecular covalent bond, etc.).
(30) Additionally, those insulins in which one or more amino acids are added to the amino and/or carboxy end of the native insulin are all included.
(31) For the substitution or insertion of the amino acid(s), not only the 20 amino acids conventionally observed in human proteins but also atypical or unnatural amino acids may be used. The commercial origin of the atypical amino acids may include Sigma-Aldrich, ChemPep, Genzyme pharmaceuticals, etc. The sequences of the peptides containing these amino acids and typical peptides may be synthesized by or purchased from commercial peptide synthesis companies, such as American Peptide Company, Bachem (USA), and Anygen (Korea), but is not particularly limited thereto.
(32) As used herein, the term “fragments of native insulin or fragments of derivatives of native insulin” refers to a form of insulin in which at least one amino acid at the amino end or carboxy end of native insulin or a derivative of native insulin is removed. Such insulin fragment can possess the function of controlling in-vivo blood glucose levels.
(33) Additionally, the insulin analogs of the present invention may be those which were prepared using the method(s) for preparing the derivatives and fragments of the native insulin independently or in combination.
(34) Specifically, the insulin analogs according to the present invention may include those having a modification in the A-chain and B-chain of native insulin described above, and specifically, those in which a particular amino acid residue(s) of A-chain of native insulin is(are) modified and/or a particular amino acid residue(s) of B-chain of native insulin is(are) modified.
(35) Specifically, the insulin analogs may be those, in which at least one modification in amino acid, which is selected from the group consisting of the 16.sup.th amino acid of the B-chain, the 25.sup.th amino acid of the B-chain, the 14.sup.th amino acid of the A-chain, and the 19.sup.th amino acid of the A-chain of native insulin, is substituted with a different amino acid, and specifically, it may be substituted with glutamic acid, serine, threonine, aspartic acid, histidine, lysine, or alanine, but is not limited thereto.
(36) Specifically, the insulin analogs may be those, in which at least one, at least two, at least three, or four amino acids among the amino acids described above is(are) substituted with other amino acid(s).
(37) Specifically, the modification may be a modification of the 16.sup.th amino acid of the B-chain of insulin (i.e., tyrosine) into glutamic acid, serine, threonine, or aspartic acid; a modification of the 25.sup.th amino acid of the B-chain of insulin (i.e., phenylalanine) into aspartic acid or glutamic acid; a modification of the 14.sup.th amino acid of the A-chain of insulin (i.e., tyrosine) into histidine, lysine, alanine, or aspartic acid; or a modification of the 19.sup.th amino acid of the A-chain of insulin (i.e., tyrosine) into glutamic acid, serine, or threonine.
(38) Accordingly, the insulin analogs may include a modification of the 16.sup.th amino acid of the B-chain of native insulin (i.e., tyrosine) into glutamic acid, serine, threonine, or aspartic acid; and/or a modification of the 25.sup.th amino acid of the B-chain of native insulin (i.e., phenylalanine) into aspartic acid or glutamic acid; and/or a modification of the 14.sup.th amino acid of the A-chain of native insulin (i.e., tyrosine) into histidine, lysine, alanine, or aspartic acid; and/or a modification of the 19.sup.th amino acid of the A-chain of native insulin (i.e., tyrosine) into glutamic acid, serine, or threonine, but the modification is not limited thereto.
(39) More specifically, the insulin analogs may be those including the A-chain of SEQ ID NO: 55 represented by General Formula 1 below and the B-chain of SEQ ID NO: 56 represented by General Formula 2 below. These insulin analogs may be in the form where the A-chain and the B-chain are interlinked by a disulfide bond, or in the form of a proinsulin, but are not limited thereto.
(40) TABLE-US-00002 [General Formula 1] (SEQ ID NO: 55) Xaa1-Ile-Val-Glu-Xaa5-Cys-Cys-Thr-Ser-Ile-Cys- Xaa12-Leu-Xaa14-Gln-Xaa16-Glu-Asn-Xaa19-Cys- Xaa21
(41) In General Formula 1,
(42) Xaa1 is alanine, glycine, glutamine, histidine, glutamic acid, or asparagine,
(43) Xaa5 is alanine, glutamic acid, glutamine, histidine, or asparagine,
(44) Xaa12 is alanine, serine, glutamine, glutamic acid, histidine, or asparagine,
(45) Xaa14 is tyrosine, histidine, lysine, alanine, or aspartic acid,
(46) Xaa16 is alanine, leucine, tyrosine, histidine, glutamic acid, or asparagine,
(47) Xaa19 is tyrosine, glutamic acid, serine, or threonine, and
(48) Xaa21 is asparagine, glycine, histidine, or alanine.
(49) TABLE-US-00003 [General Formula 2] (SEQ ID NO: 56) Phe-Val-Asn-Gln-His-Leu-Cys-Gly-Ser-His-Leu- Val-Glu-Ala-Leu-Xaa16-Leu-Val-Cys-Gly-G1u-Arg- Gly-Phe-Xaa25-Tyr-Xaa27-Xaa28-Lys-Thr
(50) In General Formula 2,
(51) Xaa16 is tyrosine, glutamic acid, serine, threonine, or aspartic acid,
(52) Xaa25 is phenylalanine, aspartic acid, or glutamic acid,
(53) Xaa27 is threonine, or is absent, and
(54) Xaa28 is proline, glutamic acid, or aspartic acid, or is absent.
(55) Herein, the peptides including the A-chain of SEQ ID NO: 53 and the B-chain of SEQ ID NO: 54 may be excluded.
(56) Additionally, those peptides which have a homology of 70% or higher, specifically 80% or higher, more specifically 90% or higher, and even more specifically 95% or higher to the sequence of the corresponding insulin analog including the A-chain of General Formula 1 above and the B-chain of General Formula 2 above, while including the characteristic modification (i.e., amino acid residues not present in native insulin) described above, specifically, the 14.sup.th and/or the 19.sup.th amino acids of the A-chain, and/or the 16.sup.th and/or the 25.sup.th amino acids of the B-chain, and have a reduced binding affinity to receptors compared to the native insulin are also included in the scope of the present invention.
(57) As used herein, the term “homology” refers to a level of similarity with regard to the amino acid sequence of a wild type protein or a polynucleotide sequence encoding the same, and includes the sequences having a sequence with the above percentage or higher of the same sequence with the amino acid sequence or polynucleotide sequence of the present invention. This homology may be determined via comparison by the naked eye, or may be determined via a bioinformatic algorithm, which analyzes the degree of homology by arranging the two sequences. The homology between the two amino acid sequences may be indicated in percentage. Useful automated algorithms can be used at both GAP, BESTFIT, and FASTA of Wisconsin Genetics Software Package (Genetics Computer Group, Madison, Wis., USA) and TFASTA computer software module. The automated array algorithms include the sequence array algorithms of Needleman & Wunsch, Pearson & Lipman, and Smith & Waterman. The determination on algorithm and homology is automated in software including FASTP, BLAST, BLAST2, PSIBLAST, and CLUSTAL W.
(58) In an exemplary embodiment, the insulin analog may be an insulin analog including the A-chain of SEQ ID NO: 55 represented by General Formula 1 above and the B-chain of SEQ ID NO: 54; or an insulin analog including the A-chain of SEQ ID NO: 53 and the B-chain of SEQ ID NO: 56 represented by General Formula 2 above, but is not particularly limited thereto.
(59) More specifically, the insulin analog may be an insulin analog, wherein in General Formula 1, Xaa1 is glycine, Xaa5 is glutamine, Xaa12 is serine, Xaa14 is tyrosine, histidine, lysine, alanine, or aspartic acid, Xaa16 is leucine, Xaa19 is tyrosine, glutamic acid, serine, or threonine, and Xaa21 is asparagine; and in General Formula 2, Xaa16 is tyrosine, glutamic acid, serine, threonine, or aspartic acid, Xaa25 is phenylalanine, aspartic acid, or glutamic acid, Xaa27 is threonine, and Xaa28 is proline, but is not limited thereto.
(60) More specifically, the insulin analog may be an insulin analog, wherein in General Formula 1, Xaa1 is glycine, Xaa5 is glutamine, Xaa12 is serine, Xaa14 is tyrosine, Xaa16 is leucine, Xaa19 is tyrosine, glutamic acid, or serine, and Xaa21 is asparagine; and in General Formula 2, Xaa16 is tyrosine, glutamic acid, serine, or aspartic acid, Xaa25 is phenylalanine, aspartic acid, or glutamic acid, Xaa27 is threonine, and Xaa28 is proline, but is not limited thereto.
(61) More specifically, the insulin analog may be an insulin analog, wherein in General Formula 1, Xaa1 is glycine, Xaa5 is glutamine, Xaa12 is serine, Xaa14 is tyrosine or aspartic acid, Xaa16 is leucine, Xaa19 is tyrosine, glutamic acid, serine, or threonine, and Xaa21 is asparagine; and in General Formula 2, Xaa16 is tyrosine, Xaa25 is phenylalanine, aspartic acid, or glutamic acid, Xaa27 is threonine, and Xaa28 is proline, but is not limited thereto.
(62) In an exemplary embodiment, the insulin analog according to the present invention may correspond to the following insulin analogs:
(63) (1) in General Formula 1, Xaa1 is glycine, Xaa5 is glutamine, Xaa12 is serine, Xaa14 is histidine, Xaa16 is leucine, Xaa19 is tyrosine, and Xaa21 is asparagine; and in General Formula 2, Xaa16 is tyrosine, Xaa25 is phenylalanine, Xaa27 is threonine, and Xaa28 is proline;
(64) (2) in General Formula 1, Xaa1 is glycine, Xaa5 is glutamine, Xaa12 is serine, Xaa14 is lysine, Xaa16 is leucine, Xaa19 is tyrosine, and Xaa21 is asparagine; and in General Formula 2, Xaa16 is tyrosine, Xaa25 is phenylalanine, Xaa27 is threonine, and Xaa28 is proline;
(65) (3) in General Formula 1, Xaa1 is glycine, Xaa5 is glutamine, Xaa12 is serine, Xaa14 is tyrosine, Xaa16 is leucine, Xaa19 is glutamic acid, and Xaa21 is asparagine; and in General Formula 2, Xaa16 is tyrosine, Xaa25 is phenylalanine, Xaa27 is threonine, and Xaa28 is proline;
(66) (4) in General Formula 1, Xaa1 is glycine, Xaa5 is glutamine, Xaa12 is serine, Xaa14 is tyrosine, Xaa16 is leucine, Xaa19 is serine, and Xaa21 is asparagine; and in General Formula 2, Xaa16 is tyrosine, Xaa25 is phenylalanine, Xaa27 is threonine, and Xaa28 is proline;
(67) (5) in General Formula 1, Xaa1 is glycine, Xaa5 is glutamine, Xaa12 is serine, Xaa14 is tyrosine, Xaa16 is leucine, Xaa19 is threonine, and Xaa21 is asparagine; and in General Formula 2, Xaa16 is tyrosine, Xaa25 is phenylalanine, Xaa27 is threonine, and Xaa28 is proline;
(68) (6) in General Formula 1, Xaa1 is glycine, Xaa5 is glutamine, Xaa12 is serine, Xaa14 is tyrosine, Xaa16 is leucine, Xaa19 is tyrosine, and Xaa21 is asparagine; and in General Formula 2, Xaa16 is glutamic acid, Xaa25 is phenylalanine, Xaa27 is threonine, and Xaa28 is proline;
(69) (7) in General Formula 1, Xaa1 is glycine, Xaa5 is glutamine, Xaa12 is serine, Xaa14 is tyrosine, Xaa16 is leucine, Xaa19 is tyrosine, and Xaa21 is asparagine; and in General Formula 2, Xaa16 is serine, Xaa25 is phenylalanine, Xaa27 is threonine, and Xaa28 is proline;
(70) (8) in General Formula 1, Xaa1 is glycine, Xaa5 is glutamine, Xaa12 is serine, Xaa14 is tyrosine, Xaa16 is leucine, Xaa19 is tyrosine, and Xaa21 is asparagine; and in General Formula 2, Xaa16 is threonine, Xaa25 is phenylalanine, Xaa27 is threonine, and Xaa28 is proline;
(71) (9) in General Formula 1, Xaa1 is glycine, Xaa5 is glutamine, Xaa12 is serine, Xaa14 is alanine, Xaa16 is leucine, Xaa19 is tyrosine, and Xaa21 is asparagine; and in General Formula 2, Xaa16 is tyrosine, Xaa25 is phenylalanine, Xaa27 is threonine, and Xaa28 is proline;
(72) (10) in General Formula 1, Xaa1 is glycine, Xaa5 is glutamine, Xaa12 is serine, Xaa14 is aspartic acid, Xaa16 is leucine, Xaa19 is tyrosine, and Xaa21 is asparagine; and in General Formula 2, Xaa16 is tyrosine, Xaa25 is phenylalanine, Xaa27 is threonine, and Xaa28 is proline;
(73) (11) in General Formula 1, Xaa1 is glycine, Xaa5 is glutamine, Xaa12 is serine, Xaa14 is tyrosine, Xaa16 is leucine, Xaa19 is tyrosine, and Xaa21 is asparagine; and in General Formula 2, Xaa16 is aspartic acid, Xaa25 is phenylalanine, Xaa27 is threonine, and Xaa28 is proline;
(74) (12) in General Formula 1, Xaa1 is glycine, Xaa5 is glutamine, Xaa12 is serine, Xaa14 is tyrosine, Xaa16 is leucine, Xaa19 is tyrosine, and Xaa21 is asparagine; and in General Formula 2, Xaa16 is tyrosine, Xaa25 is aspartic acid, Xaa27 is threonine, and Xaa28 is proline; and
(75) (13) in General Formula 1, Xaa1 is glycine, Xaa5 is glutamine, Xaa12 is serine, Xaa14 is tyrosine, Xaa16 is leucine, Xaa19 is tyrosine, and Xaa21 is asparagine; and in General Formula 2, Xaa16 is tyrosine, Xaa25 is glutamic acid, Xaa27 is threonine, and Xaa28 is proline.
(76) Additionally, in an exemplary embodiment, the insulin analog may be an insulin analog including an amino acid sequence selected from the group consisting of SEQ ID NOS: 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, and 52, but is not limited thereto.
(77) The insulin analog according to the present invention may be a peptide including the specific sequence described above, a peptide consisting (essentially) of the above-described specific sequence, but is not limited to.
(78) Meanwhile, although it is described as “peptide or insulin analog consisting of a specific SEQ ID NO” in the present invention, it does not exclude any addition of nonsense sequences upstream or downstream of the amino acid sequence of the corresponding SEQ ID NO or naturally-occurring mutations, or silent mutations thereof, as long as the peptide has the same or equivalent activity as the peptide or the insulin analog consisting of the amino acid sequence of the corresponding SEQ ID NO, and it is obvious that such a sequence addition or mutation is also within the scope of the present invention.
(79) Meanwhile, the insulin analog includes all of the peptide itself, salts thereof (e.g., a pharmaceutically acceptable salt of the peptide), or solvates thereof.
(80) Additionally, the peptide or insulin analog may be in any pharmaceutically acceptable form.
(81) The kind of the salt is not particularly limited. However, it is preferred that the salt be in a safe and effective form for a subject (for example, mammals), but is not particularly limited thereto.
(82) As used herein, the term “pharmaceutically acceptable” refers to a material which can be effectively used for a desired purpose without causing excessive toxicity, irritation, allergic response, etc., within the scope of pharmaco-medical decision.
(83) As used herein, the term “pharmaceutically acceptable salt” includes a salt derived from pharmaceutically acceptable inorganic acids, organic acids, or bases. Examples of the suitable acids may include hydrochloric acid, bromic acid, sulfuric acid, nitric acid, perchloric acid, fumaric acid, maleic acid, phosphoric acid, glycolic acid, lactic acid, salicylic acid, succinic acid, toluene-p-sulfonic acid, tartaric acid, acetic acid, citric acid, methanesulfonic acid, formic acid, benzoic acid, malonic acid, naphthalene-2-sulfonic acid, benzenesulfonic acid, etc. Salts derived from suitable bases may include alkali metals such as sodium, potassium, etc., alkaline earth metals such as magnesium, etc., ammonium, etc.
(84) Additionally, as used herein, the term “solvate” refers to a complex which is formed between the peptide according to the present invention or a salt thereof and a solvent molecule.
(85) In another aspect, the present invention provides an isolated nucleic acid encoding the insulin analog, a recombinant expression vector including the nucleic acid, and a transformant including the recombinant expression vector.
(86) The insulin analog is the same as explained above.
(87) As used herein, the term “nucleic acid” refers to a deoxyribonucleotide (DNA) or ribonucleotide (RNA) present in the form of a single strand or double strand, including genomic DNA, cDNA, and RNA being transcribed therefrom, and a nucleotide as the basic constituting unit in a nucleic acid molecule not only includes natural nucleotides but also includes analogs having modifications in a sugar or base (Scheit, Nucleotide Analogs, John Wiley, New York, 1980; Uhlman and Peyman, Chemical Reviews, 90: 543-584, 1990). The nucleic acid of the present invention may be isolated or prepared using standard technology in molecular biology. For example, the nucleic acid of the present invention may be prepared by PCR amplification using appropriate primer sequences based on the gene sequence of native insulin (NM_000207.2, NCBI), and may be prepared by standard synthesis technology using an automated DNA synthesizer.
(88) Specifically, the nucleic acid of the present invention includes the nucleotide sequences represented by SEQ ID NO: 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, or 51. In an exemplary embodiment, the nucleic acid of the present invention not only includes the nucleotide sequences represented by SEQ ID NO: 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, or 51, but also includes all sequences which have a sequence homology of at least 70% to the above sequences, preferably at least 80%, more preferably at least 90%, even more preferably at least 95%, and most preferably at least 98%, in which the peptide encoded by the above nucleic acid exhibits a reduced binding affinity to receptors compared to the native insulin while substantially having the function of controlling in-vivo blood glucose levels.
(89) The recombinant vector according to the present invention may be constructed as a vector for typical cloning or for expression, and may be constructed as a vector using a eukaryotic cell or prokaryotic cell as a host cell.
(90) As used herein, the term “vector” refers to a recombinant vector capable of expressing a target protein in an appropriate host cell, which is a nucleic acid construct including essential regulatory factors operably linked to enable the expression of a nucleic acid insert. The present invention can prepare a recombinant vector which includes a nucleic acid encoding an insulin analog, and the insulin analog of the present invention may be obtained via transformation or transfection of the recombinant vector into a host cell.
(91) In the present invention, the nucleic acid encoding the insulin analog can be operably linked to a promoter.
(92) As used herein, the term “operably linked” refers to a functional connection between a regulatory sequence for nucleic acid expression (e.g., a promoter, a signal sequence, a ribosome-binding site, a transcription termination sequence, etc.) and a different nucleotide sequence, and the regulatory sequence can regulate the transcription and/or translation of the different nucleotide sequence by the same.
(93) As used herein, the term “promoter” refers to an untranslated nucleic acid sequence which may be located upstream of a coding region, includes a polymerase-binding site and has the activity of initiating transcription of a gene located downstream of a promoter into mRNA, i.e., a DNA region to which polymerase binds and initiates the transcription of a gene, and it may be located at the 5′ region of mRNA transcription initiation.
(94) For example, when the vector of the present invention is a recombinant vector and uses a prokaryotic cell as a host cell, in general, a strong promoter (e.g., tac promoter, lac promoter, lacUV5 promoter, lpp promoter, pLλ promoter, pRλ promoter, racy promoter, amp promoter, recA promoter, SP6 promoter, trp promoter, T7 promoter, etc.) capable of executing transcription, a ribosome-binding site for the initiation of translation, and transcription/translation termination sequences are generally included.
(95) Additionally, the vector to be used in the present invention may be prepared by manipulating the plasmids (e.g., pSC101, pGV1106, pACYC177, ColE1, pKT230, pME290, pBR322, pUC8/9, pUC6, pBD9, pHC79, pIJ61, pLAFR1, pHV14, pGEX series, pET series, pPICZα series, pUC19, etc.), phages (e.g., λgt4-λB, λ-Charon, λΔz1, M13, etc.), or viruses (e.g., SV40, etc.), which are commonly used in the art.
(96) Meanwhile, when the vector of the present invention is a recombinant vector and uses a eukaryotic cell as a host cell, promoters derived from the genomes of mammalian cells (e.g., metallothionein promoter) or promoters derived from the mammalian viruses (e.g., adenovirus late promoter, 7.5K promoter of papillomavirus, SV40 promoter, cytomegalovirus promoter, and tk promoter of HSV) may be used, and in general, the vector includes a polyadenylated sequence (e.g., bovine growth hormone terminator and a polyadenylated sequence derived from SV40) as a transcription termination sequence.
(97) Additionally, the recombinant vector of the present invention includes an antibiotic-resistance gene commonly used in the art as a selective marker, and may include, for example, genes having resistance to ampicillin, gentamycin, carbenicillin, chloramphenicol, streptomycin, kanamycin, geneticin, neomycin, and tetracycline.
(98) The recombinant vector of the present invention may additionally include a different sequence to facilitate the purification of target proteins being collected, i.e., a single-chain insulin analog, proinsulin, or an analog thereof. The sequence to be additionally included may be a tag sequence for protein purification, e.g., glutathione S-transferase (Pharmacia, USA), a maltose-binding protein (NEB, USA), FLAG (IBI, USA), 6-histidine, etc., but the kinds of the sequence necessary for the purification of target proteins are not limited thereto.
(99) Fusion proteins expressed by the recombinant vector including the above tag sequence may be purified by affinity chromatography. For example, when glutathione S-transferase is fused, glutathione, which is the substrate for the enzyme, may be used, whereas when 6-histidine tag is used, a desired target protein may be easily collected by a Ni-NTA column.
(100) As used herein, the term “transformation” refers to a process of introducing DNA into a host cell and making the DNA replicable therein as a chromosomal factor or by completion of chromosomal integration, which is a phenomenon of artificially causing a genetic change by introducing exogenous DNA into a cell.
(101) The method of transformation used in the present invention may be any transformation method, and it may be easily performed according to the conventional method used in the art. Examples of the commonly used transformation method may include a CaCl.sub.2 precipitation method, the Hanahan method with improved efficiency using dimethyl sulfoxide (DMSO) as a reducing agent in the CaCl.sub.2 precipitation method, electroporation, a CaPO.sub.4 precipitation method, a protoplast fusion method, a stirring method using silicon carbide fiber, an agrobacteria-mediated transformation, a transformation using PEG, dextran sulfate-, lipofectamine-, and dry/suppression-mediated transformations, etc.
(102) The method for transforming the recombinant vector including a nucleic acid encoding an insulin analog according to the present invention may not be limited to these methods, but any method for transformation or transfection commonly used in the art may be used without limitation.
(103) The transformant of the present invention may be obtained by introducing a recombinant vector including the target nucleic acid which encodes an insulin analog into a host cell.
(104) An appropriate host to be used in the present invention may not be particularly limited as long as it can express the nucleic acid of the present invention. Examples of the appropriate host may include a bacteria belonging to the genus Escherichia such as E. coli, a bacteria belonging to the genus Bacillus such as Bacillus subtilis, a bacteria belonging to the genus Pseudomonas such as Pseudomonas putida, yeasts such as Pichia pastoris, Saccharomyces cerevisiae, and Schizosaccharomyces pombe, an insect cell such as Spodoptera frugiperda (SF9), and animal cells such as CHO, COS, and BSC. Specifically, E. coli may be used as a host cell, but is not limited thereto.
(105) In another aspect to achieve the objects of the present invention, there is provided a method for preparing insulin analogs using the transformant.
(106) Specifically, a method for preparing the insulin analog may include the following:
(107) a) expressing an insulin analog by culturing a transformant including the nucleic acid encoding the insulin analog; and
(108) b) isolating and purifying the expressed insulin analog.
(109) The medium used in culturing the transformants in the present invention may meet the requirements for host cell cultivation in an appropriate manner. The carbon sources to be contained in the medium for the growth of a host cell may be appropriately selected by the decision of a skilled person in the art according to the transformants prepared thereof, and appropriate cultivation conditions may be selected to control the period and amount of cultivation.
(110) Examples of the sugar source to be used may include sugars and carbohydrates such as glucose, saccharose, lactose, fructose, maltose, starch, and cellulose; oils and fats such as soybean oil, sunflower oil, castor oil, and coconut oil; fatty acids such as palmitic acid, stearic acid, and linoleic acid; alcohols such as glycerol and ethanol; and organic acids such as acetic acid. These materials may be used alone or in combination.
(111) Examples of the nitrogen source to be used may include peptone, yeast extract, meat gravy, malt extract, corn steep liquor, soybean flour, and urea, or inorganic compounds such as ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate, and ammonium nitrate. The nitrogen source may also be used alone or in combination.
(112) Examples of the phosphorous source to be used may include potassium dihydrogen phosphate or dipotassium hydrogen phosphate or a corresponding sodium-containing salt. Additionally, the culture media may contain a metal salt such as magnesium sulfate or iron sulfate necessary for the growth of the transformant.
(113) Lastly, essential growth materials such as amino acids and vitamins may be used. Additionally, appropriate precursors for culture media may also be used. The above sources may be appropriately added to a culture during cultivation by a batch culture or continuous culture. The pH of the culture may be appropriately adjusted using a basic compound such as sodium hydroxide, potassium hydroxide, and ammonia, or an acid compound such as phosphoric acid or sulfuric acid. Additionally, an antifoaming agent such as fatty acid polyglycol ester may be added to prevent foam generation. Additionally, in order to maintain the aerobic state of the culture, oxygen or an oxygen-containing gas (e.g., air) may be injected into the culture.
(114) The transformant of the present invention may be cultured at 20° C. to 45° C., and specifically, 25° C. to 40° C. Additionally, the cultivation is continued until the maximum amount of production of the desired insulin analogs is obtained, and in this regard, the cultivation may normally be continued for 10 hours to 160 hours.
(115) As described above, the transformant of the present invention can produce insulin analogs when appropriate culture conditions are provided according to host cells, and the insulin analogs produced according to the vector constitution and characteristics of a host cell may be secreted within the cytoplasm or into the periplasmic space of the host cell or extracellularly.
(116) The proteins expressed within or outside of the host cell may be purified by a conventional method. Examples of the purification method may include salting-out (e.g., ammonium sulfate precipitation, ammonium phosphate precipitation, etc.), solvent precipitation (e.g., protein fraction precipitation using acetone or ethanol, etc.), dialysis, gel filtration, ion exchange, or chromatography such as reversed column chromatography, ultrafiltration, etc. and these methods may be used alone or in combination.
(117) In an exemplary embodiment, the present invention may further include the following steps for separation and purification of the insulin analog expressed in the form of inclusion bodies from the transformant:
(118) b-1) obtaining the transformant from the culture in step a) and pulverizing the same;
(119) b-2) recovering the expressed insulin analog from the pulverized cell lysate followed by refolding the same;
(120) b-3) purifying the refolded insulin analog by cation exchange chromatography;
(121) b-4) treating the purified insulin analog with trypsin and carboxypeptidase B; and
(122) b-5) sequentially purifying the treated insulin analog by cation exchange chromatography, and anion exchange chromatography or reversed-phase chromatography.
(123) In still another aspect, the present invention provides a composition (e.g., a pharmaceutical composition) for treating diabetes containing the insulin analog as an active ingredient.
(124) The pharmaceutical composition may be a pharmaceutical composition for treating insulin-related diseases (e.g., diabetes).
(125) The insulin analog is the same as explained above.
(126) As used herein, the term “insulin-related disease” refers to a disease that occurs or progresses in the absence or low level of physiological activity of insulin, for example including diabetes, but is not particularly limited thereto.
(127) The pharmaceutical composition containing the insulin analog of the present invention may include pharmaceutically acceptable carriers.
(128) As used herein, the term “pharmaceutically acceptable” refers to the properties of having a sufficient amount to exhibit a therapeutic effect and not causing adverse effects, and may be easily determined by a skilled person in the art based on the factors well-known in the medical field, such as the kind of disease, age, body weight, health status, sex, drug sensitivity of a patient, administration route, administration method, administration frequency, duration of treatment, a drug(s) to be mixed or administered simultaneously, etc.
(129) For oral administration, the pharmaceutically acceptable carrier may contain a binder, a lubricant, a disintegrator, an excipient, a solubilizer, a dispersing agent, a stabilizer, a suspending agent, a coloring agent, a perfume, etc. For injectable preparations, the pharmaceutically acceptable carrier may contain a buffering agent, a preservative, an analgesic, a solubilizer, an isotonic agent, and a stabilizer. For preparations for topical administration, the pharmaceutically acceptable carrier may contain a base, an excipient, a lubricant, a preservative, etc. The pharmaceutical composition of the present invention may be formulated into various dosage forms in combination with the aforementioned pharmaceutically acceptable carriers. For example, for oral administration, the pharmaceutical composition may be formulated into tablets, troches, capsules, elixirs, suspensions, syrups, or wafers. For injectable preparations, the pharmaceutical composition may be formulated into a single-dose ampule or multidose container. The pharmaceutical composition may also be formulated into solutions, suspensions, tablets, pills, capsules, and sustained-release preparations.
(130) Meanwhile, examples of carriers, excipients, and diluents suitable for formulation may include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methylcellulose, microcrystalline cellulose, polyvinylpyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, mineral oils, etc. Additionally, the pharmaceutical formulations may further contain a filler, an anti-coagulant, a lubricant, a humectant, a flavoring agent, an emulsifier, a preservative, etc.
(131) Additionally, the insulin analogs of the present application may be included in an amount of 0.001 wt % to 10 wt % based on the total weight of the composition of the present application, but the amount is not particularly limited thereto.
(132) In still another aspect, the present invention provides a method for treating insulin-related diseases (e.g., diabetes) including administering the insulin analog or a pharmaceutical composition containing the insulin analog to a subject in need thereof.
(133) The insulin analog and the pharmaceutical composition are the same as explained above.
(134) As used herein, the term “administration” refers to introduction of a particular material to a patient by an appropriate manner, and the insulin analog of the present invention may be administered by any of the common routes as long as the drug can arrive at a target tissue. For example, intraperitoneal, intravenous, intramuscular, subcutaneous, intradermal, oral, topical, intranasal, intrapulmonary, and intrarectal administration may be performed, but the administration route is not limited thereto. However, since peptides are digested upon oral administration, active ingredients of a composition for oral administration should be coated or formulated for protection against degradation in the stomach. Preferably, the present composition may be administered in an injectable form. Additionally, the pharmaceutical composition may be administered using a certain apparatus capable of transporting the active ingredients into a target cell.
(135) Additionally, the pharmaceutical composition of the present invention may be determined by the types of the drug as an active component as well as by several related factors including the types of diseases to be treated, administration routes, age, sex, and body weight of a patient, and severity of the illness. Since the pharmaceutical composition of the present invention has excellent in-vivo duration, it can considerably reduce the administration frequency and dose of pharmaceutical drugs of the present invention.
(136) The total effective dose of the composition of the present invention may be administered to a patient in a single dose or may be administered for a long period of time in multiple doses according to a fractionated treatment protocol. The amount of active ingredient(s) contained in the pharmaceutical composition of the present invention may vary depending on the disease severity. Specifically, the total daily dose of the insulin analog of the present invention may be about 0.0001 mg to 500 mg per 1 kg of body weight of a patient.
(137) However, the effective dose of the insulin analog is determined considering various factors including patient's age, body weight, health conditions, sex, disease severity, diet, and excretion rate, in addition to administration route and treatment frequency of the pharmaceutical composition. In this regard, those skilled in the art may easily determine the effective dose suitable for the particular use of the pharmaceutical composition of the present invention. The pharmaceutical composition according to the present invention is not particularly limited to the formulation and administration route and mode, as long as it shows the effects of the present invention.
(138) To achieve the present invention, another aspect of the present invention provides a use of the insulin analog in the preparation of a medicament.
(139) In an embodiment, the medicament is for preventing or treating insulin-related diseases, but the use is not particularly limited thereto.
(140) In an embodiment, the medicament is for preventing or treating diabetes, but the use is not particularly limited thereto.
(141) To achieve the present invention, still another aspect of the present invention provides a use of the insulin analog in the treatment of insulin-related diseases, specifically diabetes.
(142) The insulin analog and insulin-related diseases are the same as explained above.
(143) Hereinafter, the present invention will be described in more detail with reference to the following examples. However, these examples are provided for illustrative purposes only, and the scope of the present invention should not be limited thereto in any manner.
Example 1: Preparation of a Single-Chain Insulin Analog Expression Vector
(144) In order to prepare insulin analogs having a single modified amino acid in the A chain or the B chain, respectively, using the native insulin-expressing vector under possession as a template, forward and reverse oligonucleotides were synthesized (Table 2), and then PCR was performed to amplify each of the genes for the analogs.
(145) The amino acid sequences modified in the A chain or the B chain and analog names are shown in Table 1 below. In Table 1, Analog 1 represents an analog in which the 14.sup.th amino acid of the A chain (i.e., tyrosine, Y) is substituted with histidine (H), and Analog 6 represents an analog in which the 16.sup.th amino acid of the B chain (i.e., tyrosine, Y) is substituted with glutamic acid (E).
(146) TABLE-US-00004 TABLE 1 Insulin Analog No. Sequence Modification Analog 1 A .sup.14Y .fwdarw. H Analog 2 A .sup.14Y .fwdarw. K Analog 3 A .sup.19Y .fwdarw. E Analog 4 A .sup.19Y .fwdarw. S Analog 5 A .sup.19Y .fwdarw. T Analog 6 B .sup.16Y .fwdarw. E Analog 7 B .sup.16Y .fwdarw. S Analog 8 B .sup.16Y .fwdarw. T Analog 9 A .sup.14Y .fwdarw. A Analog 10 A .sup.14Y .fwdarw. D Analog 11 B .sup.16Y .fwdarw. D Analog 12 B .sup.25F .fwdarw. D Analog 13 B .sup.25F .fwdarw. E
(147) Primers for insulin analog amplification are shown in Table 2 below.
(148) TABLE-US-00005 TABLE 2 SEQ ID Analog Sequence NO Analog 5′ CAGCATCTGCTCCCTCCATCAGCTGGAGAACTAC 3′ 1 1 5′ GTAGTTCTCCAGCTGATGGAGGGAGCAGATGCTG 3′ 2 Analog 5′ CAGCATCTGCTCCCTCAAGCAGCTGGAGAACTAC 3′ 3 2 5′ GTAGTTCTCCAGCTGCTTGAGGGAGCAGATGCTG 3′ 4 Analog 5′ CTACCAGCTGGAGAACGAGTGCAACTGAGGATCC 3′ 5 3 5′ GGATCCTCAGTTGCACTCGTTCTCCAGCTGGTAG 3′ 6 Analog 5′ CTACCAGCTGGAGAACTCCTGCAACTGAGGATCC 3′ 7 4 5′ GGATCCTCAGTTGCAGGAGTTCTCCAGCTGGTAG 3′ 8 Analog 5′ CTACCAGCTGGAGAACACCTGCAACTGAGGATCC 3′ 9 5 5′ GGATCCTCAGTTGCAGGTGTTCTCCAGCTGGTAG 3′ 10 Analog 5′ CTGGTGGAAGCTCTCGAGCTAGTGTGCGGGGAAC 3′ 11 6 5′ GTTCCCCGCACACTAGCTCGAGAGCTTCCACCAG 3′ 12 Analog 5′ CTGGTGGAAGCTCTCTCCCTAGTGTGCGGGGAAC 3′ 13 7 5′ GTTCCCCGCACACTAGGGAGAGAGCTTCCACCAG 3′ 14 Analog 5′ CTGGTGGAAGCTCTCACCCTAGTGTGCGGGGAAC 3′ 15 8 5′ GTTCCCCGCACACTAGGGTGAGAGCTTCCACCAG 3′ 16 Analog 5′ CAGCATCTGCTCCCTCGCCCAGCTGGAGAACTAC 3′ 17 9 5′ GTAGTTCTCCAGCTGGGCGAGGGAGCAGATGCTG 3′ 18 Analog 5′ CAGCATCTGCTCCCTCGACCAGCTGGAGAACTAC 3′ 19 10 5′ GTAGTTCTCCAGCTGGTCGAGGGAGCAGATGCTG 3′ 20 Analog 5′ CTGGTGGAAGCTCTCGACCTAGTGTGCGGGGAAC 3′ 21 11 5′ GTTCCCCGCACACTAGGTCGAGAGCTTCCACCAG 3′ 22 Analog 5′ GGGGAACGAGGCTTCGACTACACACCCAAGACC 3′ 23 12 5′ GGTCTTGGGTGTGTAGTCGAAGCCTCGTTCCCC 3′ 24 Analog 5′ GGGGAACGAGGCTTCGAGTACACACCCAAGACC 3′ 25 13 5′ GGTCTTGGGTGTGTACTCGAAGCCTCGTTCCCC 3′ 26
(149) A PCR reaction for insulin analog amplification was performed under the conditions of 95° C. for 30 seconds, 55° C. for 30 seconds, and 68° C. for 6 minutes, for 18 repeated cycles. The insulin analog fragments obtained under the conditions were inserted into pET22b vector to be expressed as intracellular inclusion bodies, and the thus-obtained expression vectors were named as pET22b-insulin analogs 1 to 13. The expression vectors contained nucleic acids encoding amino acid sequences of insulin analogs 1 to 13 under the control of T7 promoter, and insulin analog proteins were expressed as inclusion bodies in host cells including the expression vectors.
(150) DNA sequences and protein sequences of insulin analogs 1 to 13 are given in Table 3 below.
(151) Each sequence modification was examined by DNA sequence analysis, and as a result, each of the insulin analogs was confirmed to have been modified in their sequences according to the intended purpose.
(152) TABLE-US-00006 TABLE 3 SEQ ID Analog Sequence NO Analog 1 DNA TTC GTT AAC CAA CAC TTG TGT GGC TCA 27 CAC CTG GTG GAA GCT CTC TAC CTA GTG TGC GGG GAA CGA GGC TTC TTC TAC ACA CCC AAG ACC CGC CGG GAG GCA GAG GAC CTG CAG GTG GGG CAG GTG GAG CTG GGC GGG GGC CCT GGT GCA GGC AGC CTG CAG CCC TTG GCC CTG GAG GGG TCC CTG CAG AAG CGT GGC ATT GTG GAA CAA TGC TGT ACC AGC ATC TGC TCC CTC CAT CAG CTG GAG AAC TAC TGC AAC Protein Phe Val Asn Gln His Leu Cys Gly Ser His Leu Val 28 Glu Ala Leu Tyr Leu Val Cys Gly Glu Arg Gly Phe Phe Tyr Thr Pro Lys Thr Arg Arg Glu Ala Glu Asp Leu Gln Val Gly Gln Val Glu Leu Gly Gly Gly Pro Gly Ala Gly Ser Leu Gln Pro Leu Ala Leu Glu Gly Ser Leu Gln Lys Arg Gly Ile Val Glu Gln Cys Cys Thr Ser Ile Cys Ser Leu His Gln Leu Glu Asn Tyr Cys Asn Analog 2 DNA TTC GTT AAC CAA CAC TTG TGT GGC TCA 29 CAC CTG GTG GAA GCT CTC TAC CTA GTG TGC GGG GAA CGA GGC TTC TTC TAC ACA CCC AAG ACC CGC CGG GAG GCA GAG GAC CTG CAG GTG GGG CAG GTG GAG CTG GGC GGG GGC CCT GGT GCA GGC AGC CTG CAG CCC TTG GCC CTG GAG GGG TCC CTG CAG AAG CGT GGC ATT GTG GAA CAA TGC TGT ACC AGC ATC TGC TCC CTC AAG CAG CTG GAG AAC TAC TGC AAC Protein Phe Val Asn Gln His Leu Cys Gly Ser His Leu Val 30 Glu Ala Leu Tyr Leu Val Cys Gly Glu Arg Gly Phe Phe Tyr Thr Pro Lys Thr Arg Arg Glu Ala Glu Asp Leu Gln Val Gly Gln Val Glu Leu Gly Gly Gly Pro Gly Ala Gly Ser Leu Gln Pro Leu Ala Leu Glu Gly Ser Leu Gln Lys Arg Gly Ile Val Glu Gln Cys Cys Thr Ser Ile Cys Ser Leu Lys Gln Leu Glu Asn Tyr Cys Asn Analog 3 DNA TTC GTT AAC CAA CAC TTG TGT GGC TCA 31 CAC CTG GTG GAA GCT CTC TAC CTA GTG TGC GGG GAA CGA GGC TTC TTC TAC ACA CCC AAG ACC CGC CGG GAG GCA GAG GAC CTG CAG GTG GGG CAG GTG GAG CTG GGC GGG GGC CCT GGT GCA GGC AGC CTG CAG CCC TTG GCC CTG GAG GGG TCC CTG CAG AAG CGT GGC ATT GTG GAA CAA TGC TGT ACC AGC ATC TGC TCC CTC TAC CAG CTG GAG AAC GAG TGC AAC Protein Phe Val Asn Gln His Leu Cys Gly Ser His Leu Val 32 Glu Ala Leu Tyr Leu Val Cys Gly Glu Arg Gly Phe Phe Tyr Thr Pro Lys Thr Arg Arg Glu Ala Glu Asp Leu Gln Val Gly Gln Val Glu Leu Gly Gly Gly Pro Gly Ala Gly Ser Leu Gln Pro Leu Ala Leu Glu Gly Ser Leu Gln Lys Arg Gly Ile Val Glu Gln Cys Cys Thr Ser Ile Cys Ser Leu Tyr Gln Leu Glu Asn Glu Cys Asn TTC GTT AAC CAA CAC TTG TGT GGC TCA Analog 4 DNA CAC CTG GTG GAA GCT CTC TAC CTA GTG 33 TGC GGG GAA CGA GGC TTC TTC TAC ACA CCC AAG ACC CGC CGG GAG GCA GAG GAC CTG CAG GTG GGG CAG GTG GAG CTG GGC GGG GGC CCT GGT GCA GGC AGC CTG CAG CCC TTG GCC CTG GAG GGG TCC CTG CAG AAG CGT GGC ATT GTG GAA CAA TGC TGT ACC AGC ATC TGC TCC CTC TAC CAG CTG GAG AAC TCC TGC AAC Protein Phe Val Asn Gln His Leu Cys Gly Ser His Leu Val 34 Glu Ala Leu Tyr Leu Val Cys Gly Glu Arg Gly Phe Phe Tyr Thr Pro Lys Thr Arg Arg Glu Ala Glu Asp Leu Gln Val Gly Gln Val Glu Leu Gly Gly Gly Pro Gly Ala Gly Ser Leu Gln Pro Leu Ala Leu Glu Gly Ser Leu Gln Lys Arg Gly Ile Val Glu Gln Cys Cys Thr Ser Ile Cys Ser Leu Tyr Gln Leu Glu Asn Ser Cys Asn Analog 5 DNA TTC GTT AAC CAA CAC TTG TGT GGC TCA 35 CAC CTG GTG GAA GCT CTC TAC CTA GTG TGC GGG GAA CGA GGC TTC TTC TAC ACA CCC AAG ACC CGC CGG GAG GCA GAG GAC CTG CAG GTG GGG CAG GTG GAG CTG GGC GGG GGC CCT GGT GCA GGC AGC CTG CAG CCC TTG GCC CTG GAG GGG TCC CTG CAG AAG CGT GGC ATT GTG GAA CAA TGC TGT ACC AGC ATC TGC TCC CTC TAC CAG CTG GAG AAC ACC TGC AAC Protein Phe Val Asn Gln His Leu Cys Gly Ser His Leu Val 36 Glu Ala Leu Tyr Leu Val Cys Gly Glu Arg Gly Phe Phe Tyr Thr Pro Lys Thr Arg Arg Glu Ala Glu Asp Leu Gln Val Gly Gln Val Glu Leu Gly Gly Gly Pro Gly Ala Gly Ser Leu Gln Pro Leu Ala Leu Glu Gly Ser Leu Gln Lys Arg Gly Ile Val Glu Gln Cys Cys Thr Ser Ile Cys Ser Leu Tyr Gln Leu Glu Asn Thr Cys Asn Analog 6 DNA TTC GTT AAC CAA CAC TTG TGT GGC TCA 37 CAC CTG GTG GAA GCT CTC GAG CTA GTG TGC GGG GAA CGA GGC TTC TTC TAC ACA CCC AAG ACC CGC CGG GAG GCA GAG GAC CTG CAG GTG GGG CAG GTG GAG CTG GGC GGG GGC CCT GGT GCA GGC AGC CTG CAG CCC TTG GCC CTG GAG GGG TCC CTG CAG AAG CGT GGC ATT GTG GAA CAA TGC TGT ACC AGC ATC TGC TCC CTC TAC CAG CTG GAG AAC TAC TGC AAC Protein Phe Val Asn Gln His Leu Cys Gly Ser His Leu Val 38 Glu Ala Leu Glu Leu Val Cys Gly Glu Arg Gly Phe Phe Tyr Thr Pro Lys Thr Arg Arg Glu Ala Glu Asp Leu Gln Val Gly Gln Val Glu Leu Gly Gly Gly Pro Gly Ala Gly Ser Leu Gln Pro Leu Ala Leu Glu Gly Ser Leu Gln Lys Arg Gly Ile Val Glu Gln Cys Cys Thr Ser Ile Cys Ser Leu Tyr Gln Leu Glu Asn Tyr Cys Asn Analog 7 DNA TTC GTT AAC CAA CAC TTG TGT GGC TCA 39 CAC CTG GTG GAA GCT CTC TCC CTA GTG TGC GGG GAA CGA GGC TTC TTC TAC ACA CCC AAG ACC CGC CGG GAG GCA GAG GAC CTG CAG GTG GGG CAG GTG GAG CTG GGC GGG GGC CCT GGT GCA GGC AGC CTG CAG CCC TTG GCC CTG GAG GGG TCC CTG CAG AAG CGT GGC ATT GTG GAA CAA TGC TGT ACC AGC ATC TGC TCC CTC TAC CAG CTG GAG AAC TAC TGC AAC Protein Phe Val Asn Gln His Leu Cys Gly Ser His Leu Val 40 Glu Ala Leu Ser Leu Val Cys Gly Glu Arg Gly Phe Phe Tyr Thr Pro Lys Thr Arg Arg Glu Ala Glu Asp Leu Gln Val Gly Gln Val Glu Leu Gly Gly Gly Pro Gly Ala Gly Ser Leu Gln Pro Leu Ala Leu Glu Gly Ser Leu Gln Lys Arg Gly Ile Val Glu Gln Cys Cys Thr Ser Ile Cys Ser Leu Tyr Gln Leu Glu Asn Tyr Cys Asn Analog 8 DNA TTC GTT AAC CAA CAC TTG TGT GGC TCA 41 CAC CTG GTG GAA GCT CTC ACC CTA GTG TGC GGG GAA CGA GGC TTC TTC TAC ACA CCC AAG ACC CGC CGG GAG GCA GAG GAC CTG CAG GTG GGG CAG GTG GAG CTG GGC GGG GGC CCT GGT GCA GGC AGC CTG CAG CCC TTG GCC CTG GAG GGG TCC CTG CAG AAG CGT GGC ATT GTG GAA CAA TGC TGT ACC AGC ATC TGC TCC CTC TAC CAG CTG GAG AAC TAC TGC AAC Protein Phe Val Asn Gln His Leu Cys Gly Ser His Leu Val 42 Glu Ala Leu Thr Leu Val Cys Gly Glu Arg Gly Phe Phe Tyr Thr Pro Lys Thr Arg Arg Glu Ala Glu Asp Leu Gln Val Gly Gln Val Glu Leu Gly Gly Gly Pro Gly Ala Gly Ser Leu Gln Pro Leu Ala Leu Glu Gly Ser Leu Gln Lys Arg Gly Ile Val Glu Gln Cys Cys Thr Ser Ile Cys Ser Leu Tyr Gln Leu Glu Asn Tyr Cys Asn Analog 9 DNA TTC GTT AAC CAA CAC TTG TGT GGC TCA 43 CAC CTG GTG GAA GCT CTC TAC CTA GTG TGC GGG GAA CGA GGC TTC TTC TAC ACA CCC AAG ACC CGC CGG GAG GCA GAG GAC CTG CAG GTG GGG CAG GTG GAG CTG GGC GGG GGC CCT GGT GCA GGC AGC CTG CAG CCC TTG GCC CTG GAG GGG TCC CTG CAG AAG CGT GGC ATT GTG GAA CAA TGC TGT ACC AGC ATC TGC TCC CTC GCC CAG CTG GAG AAC TAC TGC AAC Protein Phe Val Asn Gln His Leu Cys Gly Ser His Leu Val 44 Glu Ala Leu Tyr Leu Val Cys Gly Glu Arg Gly Phe Phe Tyr Thr Pro Lys Thr Arg Arg Glu Ala Glu Asp Leu Gln Val Gly Gln Val Glu Leu Gly Gly Gly Pro Gly Ala Gly Ser Leu Gln Pro Leu Ala Leu Glu Gly Ser Leu Gln Lys Arg Gly Ile Val Glu Gln Cys Cys Thr Ser Ile Cys Ser Leu Ala Gln Leu Glu Asn Tyr Cys Asn Analog 10 DNA TTC GTT AAC CAA CAC TTG TGT GGC TCA 45 CAC CTG GTG GAA GCT CTC TAC CTA GTG TGC GGG GAA CGA GGC TTC TTC TAC ACA CCC AAG ACC CGC CGG GAG GCA GAG GAC CTG CAG GTG GGG CAG GTG GAG CTG GGC GGG GGC CCT GGT GCA GGC AGC CTG CAG CCC TTG GCC CTG GAG GGG TCC CTG CAG AAG CGT GGC ATT GTG GAA CAA TGC TGT ACC AGC ATC TGC TCC CTC GAC CAG CTG GAG AAC TAC TGC AAC Protein Phe Val Asn Gln His Leu Cys Gly Ser His Leu Val 46 Glu Ala Leu Tyr Leu Val Cys Gly Glu Arg Gly Phe Phe Tyr Thr Pro Lys Thr Arg Arg Glu Ala Glu Asp Leu Gln Val Gly Gln Val Glu Leu Gly Gly Gly Pro Gly Ala Gly Ser Leu Gln Pro Leu Ala Leu Glu Gly Ser Leu Gln Lys Arg Gly Ile Val Glu Gln Cys Cys Thr Ser Be Cys Ser Leu Asp Gln Leu Glu Asn Tyr Cys Asn Analog 11 DNA TTC GTT AAC CAA CAC TTG TGT GGC TCA 47 CAC CTG GTG GAA GCT CTC GAC CTA GTG TGC GGG GAA CGA GGC TTC TTC TAC ACA CCC AAG ACC CGC CGG GAG GCA GAG GAC CTG CAG GTG GGG CAG GTG GAG CTG GGC GGG GGC CCT GGT GCA GGC AGC CTG CAG CCC TTG GCC CTG GAG GGG TCC CTG CAG AAG CGT GGC ATT GTG GAA CAA TGC TGT ACC AGC ATC TGC TCC CTC TAC CAG CTG GAG AAC TAC TGC AAC Protein Phe Val Asn Gln His Leu Cys Gly Ser His Leu Val 48 Glu Ala Leu Asp Leu Val Cys Gly Glu Arg Gly Phe Phe Tyr Thr Pro Lys Thr Arg Arg Glu Ala Glu Asp Leu Gln Val Gly Gln Val Glu Leu Gly Gly Gly Pro Gly Ala Gly Ser Leu Gln Pro Leu Ala Leu Glu Gly Ser Leu Gln Lys Arg Gly Ile Val Glu Gln Cys Cys Thr Ser Ile Cys Ser Leu Tyr Gln Leu Glu Asn Tyr Cys Asn Analog 12 DNA TTC GTT AAC CAA CAC TTG TGT GGC TCA 49 CAC CTG GTG GAA GCT CTC TAC CTA GTG TGC GGG GAA CGA GGC TTC GAC TAC ACA CCC AAG ACC CGC CGG GAG GCA GAG GAC CTG CAG GTG GGG CAG GTG GAG CTG GGC GGG GGC CCT GGT GCA GGC AGC CTG CAG CCC TTG GCC CTG GAG GGG TCC CTG CAG AAG CGT GGC ATT GTG GAA CAA TGC TGT ACC AGC ATC TGC TCC CTC TAC CAG CTG GAG AAC TAC TGC AAC Protein Phe Val Asn Gln His Leu Cys Gly Ser His Leu Val 50 Glu Ala Leu Tyr Leu Val Cys Gly Glu Arg Gly Phe Asp Tyr Thr Pro Lys Thr Arg Arg Glu Ala Glu Asp Leu Gln Val Gly Gln Val Glu Leu Gly Gly Gly Pro Gly Ala Gly Ser Leu Gln Pro Leu Ala Leu Glu Gly Ser Leu Gln Lys Arg Gly Ile Val Glu Gln Cys Cys Thr Ser Ile Cys Ser Leu Tyr Gln Leu Glu Asn Tyr Cys Asn Analog 13 DNA TTC GTT AAC CAA CAC TTG TGT GGC TCA 51 CAC CTG GTG GAA GCT CTC TAC CTA GTG TGC GGG GAA CGA GGC TTC GAG TAC ACA CCC AAG ACC CGC CGG GAG GCA GAG GAC CTG CAG GTG GGG CAG GTG GAG CTG GGC GGG GGC CCT GGT GCA GGC AGC CTG CAG CCC TTG GCC CTG GAG GGG TCC CTG CAG AAG CGT GGC ATT GTG GAA CAA TGC TGT ACC AGC ATC TGC TCC CTC TAC CAG CTG GAG AAC TAC TGC AAC Protein Phe Val Asn Gln His Leu Cys Gly Ser His Leu Val 52 Glu Ala Leu Tyr Leu Val Cys Gly Glu Arg Gly Phe Glu Tyr Thr Pro Lys Thr Arg Arg Glu Ala Glu Asp Leu Gln Val Gly Gln Val Glu Leu Gly Gly Gly Pro Gly Ala Gly Ser Leu Gln Pro Leu Ala Leu Glu Gly Ser Leu Gln Lys Arg Gly Ile Val Glu Gln Cys Cys Thr Ser Ile Cys Ser Leu Tyr Gln Leu Glu Asn Tyr Cys Asn
Example 2: Expression of Recombinant Insulin Analog Fusion Peptides
(153) Expressions of recombinant insulin analogs were performed under the control of T7 promoter. E. coli BL21-DE3 (E. coli B F-dcm ompT hsdS(rB-mB-) gal λDE3; Novagen) was transformed with each of the recombinant insulin analog-expressing vectors. Transformation was performed in accordance with the recommended protocol (Novagen). Single colonies transformed with each recombinant expression vector were collected, inoculated in 2× Luria Broth (LB) containing ampicillin (50 μg/mL), and cultured at 37° C. for 15 hours. The recombinant strain culture broth and 2× LB medium containing 30% glycerol were mixed in a ratio of 1:1 (v/v), 1 mL each of the mixture was dispensed to a cryotube and stored at −140° C., which was used as a cell stock for producing the recombinant fusion protein.
(154) To express the recombinant insulin analogs, one vial of each cell stock was thawed and inoculated into 500 mL of 2× Luria broth, and cultured with shaking at 37° C. for 14 hours to 16 hours. The cultivation was terminated when OD600 reached 5.0 or higher and the culture broth was used as a seed culture broth. The seed culture broth was inoculated to 17 L of fermentation medium using a 50 L fermentor (MSJ-U2, B.E.MARUBISHI, Japan), and initial bath fermentation was started. The culture conditions were maintained at a temperature of 37° C., an air flow rate of 20 L/min (1 vvm), an agitation speed of 500 rpm, and at pH 6.70 using a 30% ammonia solution. Fermentation was performed in fed-batch mode by adding a feeding solution, when nutrients were depleted in the culture broth. Growth of the strain was monitored by OD value. IPTG was introduced to a final concentration of 500 μM, when OD value reached 100 or higher. After introduction, the cultivation was progressed further for about 23 hours to 25 hours. Upon termination of the cultivation, the recombinant strains were harvested by centrifugation and stored at −80° C. until use.
Example 3: Recovery and Refolding of Recombinant Insulin Analogs
(155) In order to change the recombinant insulin analogs expressed in Example 2 into soluble forms, cells were disrupted followed by refolding. The cell pellet (100 g; wet weight) was resuspended in 1 L lysis buffer (50 mM Tris-HCl (pH 9.0), 1 mM EDTA (pH 8.0), 0.2 M NaCl, and 0.5% Triton X-100). The cells were disrupted using a microfluidizer (Microfluidic Corp. Model M-110EH-30) at an operating pressure of 15,000 psi. The thus-disrupted cell lysate was centrifuged at 7,000 rpm at a temperature of 4° C. to 8° C. for 20 minutes. The supernatant was discarded and the pellet was resuspended in 3 L washing buffer (0.5% Triton X-100 and 50 mM Tris-HCl (pH 8.0), 0.2 M NaCl, and 1 mM EDTA). After centrifugation at 7,000 rpm at a temperature of 4° C. to 8° C. for 20 minutes, the cell pellet was resuspended in distilled water, followed by centrifugation in the same manner. The thus-obtained pellet was resuspended in buffer (1 M L-Glycine, 3.78 g L-Cysteine-HCl, pH 10.6) and stirred at room temperature for 1 hour. To recover the recombinant insulin analog thus resuspended, 8 M urea was added thereto and stirred for 3 hours to 5 hours. For refolding of the solubilized recombinant proinsulin analogs, centrifugation was carried out at 7,000 rpm at a temperature of 4° C. to 8° C. for 30 minutes, the supernatant was collected, and treated with 15 mM L-Cysteine-HCl, i.e., a reducing agent, for one hour. A predetermined volume of distilled water was added thereto using a peristaltic pump and stirred at a temperature of 4° C. to 8° C. for at least 12 hours.
Example 4: Cation Exchange Chromatography Purification
(156) The sample, upon completion of refolding, was loaded onto an equilibrated SP FF (GE healthcare) column equilibrated with 20 mM sodium citrate (pH 2.0) buffer containing 45% ethanol, and then the insulin analog proteins were eluted in 10 column volumes with a linear gradient from 0% to 100% using a 20 mM sodium citrate (pH 2.0) buffer containing 0.5 M potassium chloride and 45% ethanol.
Example 5: Treatment with Trypsin and Carboxypeptidase B
(157) Salts were removed from the eluted samples using an ultrafiltration membrane, followed by replacement of a buffer solution (10 mM Tris-HCl, pH 8.0). The thus-obtained sample protein was treated with trypsin corresponding to a molar ratio of about 30,000 relative to the protein amount of the sample and carboxypeptidase B corresponding to a molar ratio of about 3,000 molar ratio relative to the protein amount of the sample and stirred at a temperature of 4° C. to 8° C. for at least 16 hours.
Example 6: Cation Exchange Chromatography Purification
(158) The sample, upon completion of the reaction, was reloaded onto an equilibrated SP HP (GE healthcare) column equilibrated with 20 mM sodium citrate (pH 2.0) buffer containing 45% ethanol, and the insulin analog proteins were eluted in 10 column volumes with a linear gradient from 0% to 100% using a 20 mM sodium citrate (pH 2.0) buffer containing 0.5 M potassium chloride and 45% ethanol.
Example 7: Reversed Phase Chromatography Purification
(159) For the pure separation of the pure insulin analog obtained in Example 6, it was loaded onto the reversed phase chromatography Source30RPC (GE healthcare, USA), which was equilibrated with sodium phosphate and isopropanol, and the insulin analog proteins were eluted with a linear gradient using a buffer containing sodium phosphate and isopropanol.
(160) The thus-purified insulin analogs were analyzed by protein electrophoresis (SDS-PAGE,
Example 8: Comparison of Binding Affinity of Insulin Analogs for Insulin Receptors
(161) For the measurement of binding affinity of insulin analogs to insulin receptors, the analysis was performed by Scintillation proximity assay (SPA). The cell membrane of a CHO cell line, in which insulin receptors were expressed, and PVT SPA beads were added together into a 96-well pico-plate. In order to confirm the binding affinity to the insulin receptors, human insulin and each of the insulin analogs diluted in more than 10 different concentrations, and radioisotope I.sup.125-tagged insulin, as a competitor, were added together and allowed to react competitively at room temperature for 4 hours. Four hours thereafter, the binding affinity to insulin receptors was measured using a beta counter. The binding affinity of each material was calculated in IC.sub.50 using the GraphPad Prism 6 software, and digitized as the relative binding affinity against the human insulin to the insulin receptors.
(162) As a result, compared to the human insulin, the binding affinity to the insulin receptors was shown to be 90% for insulin analog (no. 1); 95% for insulin analog (no. 2); 1.0% for insulin analog (no. 3); <0.1% for insulin analog (no. 4); 20% for insulin analog (no. 6); 8.5% for insulin analog (no. 7); 79% for insulin analog (no. 9), 79% for insulin analog (no. 10); 24% for insulin analog (no. 11); <0.1% for insulin analog (no. 12); and <0.1% for insulin analog (no. 13) (Table 4). Accordingly, the insulin analogs of the present invention were observed to have reduced binding affinity to insulin receptors compared to the native insulin.
(163) TABLE-US-00007 TABLE 4 Binding Affinity to Insulin Receptors Material Name (vs. Human Insulin) Insulin analog insulin analog (No. 1) 90% insulin analog (No. 2) 95% insulin analog (No. 3) 1.0% insulin analog (No. 4) <0.1% insulin analog (No. 6) 20% insulin analog (No. 7) 8.5% insulin analog (No. 9) 79% insulin analog (No. 10) 79% insulin analog (No. 11) 24% insulin analog (No. 12) <0.1% insulin analog (No. 13) <0.1%
Example 9: Comparison of In-Vitro Efficacy of Insulin Analog 10
(164) In order to evaluate in-vitro efficacy of the insulin analog 10, mouse-derived 3T3-L1 cell line differentiated into adipocytes were used to test glucose uptake ability or lipid synthesis. 3T3-L1 cells were subcultured in 10% newborn calf serum (NBCS)-containing Dulbeco's Modified Eagle's Medium (DMEM, Gibco, Cat. No, 12430) 2 or 3 times a week, and maintained. The 3T3-L1 cells were suspended in a differentiation medium (10% FBS-containing DMEM), and then inoculated at a concentration of 5×10.sup.4 cells per well in a 48-well dish, and cultured for 48 hours. For differentiation of the cells into adipocytes, 1 μg/mL human insulin (Sigma, Cat. No. 19278), 0.5 μM 3-isobutyl-1-methylxanthine (IBMX, Sigma, Cat. No. 15879), and 1 μM dexamethasone (Sigma, Cat. No. D4902) were mixed with the differentiation medium, and 250 μL of the mixture was added to each well, after removing the existing medium. After 48 hours, the medium was replaced with the differentiation medium supplemented with only 1 μg/mL of human insulin. Thereafter, the induction of differentiation into adipocytes was examined for 12 days while exchanging the medium with the differentiation medium supplemented with 1 μg/mL of human insulin every 48 hours. To test glucose uptake ability, the differentiated cells were washed with serum-free DMEM medium once, and then 250 μL each of serum-free DMEM medium was added to induce serum depletion for 4 hours. Serum-free DMEM medium was used to perform 10-fold serial dilutions for human insulin and insulin analog 10 from 10 μM to 0.001 nM. 250 μL each of the thus-prepared samples was added to cells, and cultured in a 5% CO.sub.2 incubator at 37° C. for 24 hours. In order to measure the remaining amount of glucose in the medium after incubation, 200 μL each of the medium was taken and diluted 5-fold with D-PBS, followed by GOPOD assay (GOPOD Assay Kit, Megazyme, Cat. No. K-GLUC). Based on the absorbance of glucose standard solution, the concentration of glucose remaining in the medium was converted, and EC.sub.50 values for glucose uptake ability of human insulin and insulin analog 10 were calculated, respectively.
(165) A total of 3 tests were repeated, and as a result, the EC.sub.50 values of human insulin and insulin analog 10 were calculated as 14.4±1.0 nM and 7.8±0.7 nM, respectively. That is, it was confirmed that insulin analog 10 had a glucose uptake ability of 185.5±25.7% in comparison with human insulin (
Example 10: Comparison of Cell Stability of Insulin Analog 10
(166) In order to confirm the cell stability of insulin analog 10, a test was performed using a human-derived HepG2 cell line. First, HepG2 cells were subcultured in DMEM medium containing 10% FBS 2 to 3 times a week. 300 μL each of poly-L-lysine (Trevigen, Cat. No. 3438-100-01) was added into a 24-well plate and coated at 37° C. for 2 hours. After washing twice with cold D-PBS, HepG2 cells were suspended in a culture medium (DMEM containing 10% FBS) and inoculated on a 24-well plate at a concentration of 1×10.sup.5 cells per well and cultured for 24 hours. After washing the cells with a test medium (DMEM containing 2% FBS), 500 μL of a test medium containing 500 nM of human insulin and insulin analog 10 was added to each well. After incubating the cells in a 5% CO.sub.2 incubator at 37° C. for 0, 2, 6, 9, 24, and 48 hours, the medium was recovered and stored frozen upon completion of incubation. For determining the amount of insulin remaining in the medium, a 100-fold dilution with PBS-T was performed and analyzed using the human insulin ELISA kit (Alpco, Cat. No. 80-INSHU-E10.1).
(167) A total of 3 tests were repeated, and as a result, the amount of insulin remaining in the culture medium was calculated as 20.9±11.4% and 72.7±5.7% for human insulin and insulin analog 10, respectively, after incubating for 48 hours compared to 0 hours. That is, it was confirmed that insulin analog 10 had higher cell stability compared to human insulin (
(168) From the foregoing, a skilled person in the art to which the present invention pertains will be able to understand that the present invention may be embodied in other specific forms without modifying the technical concepts or essential characteristics of the present invention. In this regard, the exemplary embodiments disclosed herein are only for illustrative purposes and should not be construed as limiting the scope of the present invention. On the contrary, the present invention is intended to cover not only the exemplary embodiments but also various alternatives, modifications, equivalents, and other embodiments that may be included within the spirit and scope of the present invention as defined by the appended claims.