CXCL8 Binding Nucleic Acids

Abstract

The present invention is related to an L-nucleic acid molecule capable of binding to human CXCL8, wherein the L-nucleic acid molecule comprises a central stretch of nucleotides, wherein the central stretch of nucleotides comprises a nucleotide sequence of 5′-GG A AGU ACGUGGA AAGCCRA(Xu)RAGUGUGUCCCG-3′ [SEQ. ID. NO: 27], wherein Xu is U or absent.

Claims

1.-103. (canceled)

104. An L-nucleic acid molecule that binds human CXCL8, or a homolog of said L-nucleic acid molecule, said homolog comprising one of SEQ ID NOs:14-24, or said homolog comprising at least 75% homology to the nucleotide sequence of one of SEQ ID NOs:14-26 and 39-44.

105. The L-nucleic acid molecule of claim 104, wherein said L-nucleic acid molecule consists of ribonucleotides.

106. The L-nucleic acid molecule of claim 104, wherein said L-nucleic acid molecule comprises a modification group.

107. The L-nucleic acid molecule of claim 106, wherein excretion rate of said L-nucleic acid molecule comprising the modification group from an organism is decreased compared to excretion rate of an L-nucleic acid not comprising the modification group.

108. The L-nucleic acid molecule of claim 106, wherein said L-nucleic acid molecule comprising the modification group has an increased retention time in an organism compared to retention time in an organism of an L-nucleic acid molecule not comprising the modification group.

109. The L-nucleic acid molecule of claim 106, wherein said modification group is biodegradable.

110. The L-nucleic acid molecule of claim 106, wherein the modification group is selected from the group consisting of polyethylene glycol, linear polyethylene glycol, branched polyethylene glycol, hydroxyethyl starch, a peptide, a protein, a polysaccharide, a sterol, polyoxypropylene, polyoxyamidate and poly (2-hydroxyethyl)-L-glutamine.

111. The L-nucleic acid molecule of claim 106, wherein said modification group immobilizes said L-nucleic acid molecule.

112. The L-nucleic acid molecule of claim 106, wherein said modification group is detectable.

113. The L-nucleic acid molecule of claim 104 comprising the nucleotide sequence of SEQ ID NO:17.

114. The L-nucleic acid molecule of claim 113, wherein said L-nucleic acid molecule comprises a modification group selected from polyethylene glycol, linear polyethylene glycol, branched polyethylene glycol, hydroxyethyl starch, a peptide, a protein, a polysaccharide, a sterol, polyoxypropylene, polyoxyamidate or poly (2-hydroxyethyl)-L-glutamine.

115. The L-nucleic acid molecule of claim 104, comprising the nucleotide sequence of SEQ ID NO:20.

116. The L-nucleic acid molecule of claim 115, wherein said L-nucleic acid molecule comprises a modification group selected from polyethylene glycol, linear polyethylene glycol, branched polyethylene glycol, hydroxyethyl starch, a peptide, a protein, a polysaccharide, a sterol, polyoxypropylene, polyoxyamidate or poly (2-hydroxyethyl)-L-glutamine.

117. The L-nucleic acid molecule of claim 104, wherein said homolog comprises at least 85% homology to the nucleotide sequence of one of SEQ ID NOs:14-26 and 39-44.

118. A pharmaceutical composition comprising said L-nucleic acid molecule as defined in claim 104 and optionally a pharmaceutically acceptable excipient, a pharmaceutically acceptable carrier or a pharmaceutically active agent.

119. A complex comprising said L-nucleic acid molecule of claim 104 and CXCL8.

120. A kit for the detection of CXCL8, comprising the L-nucleic acid molecule of claim 104, and at least an instruction leaflet or a reaction vessel.

121. A method for the detection of CXCL8 comprising the steps of: a) providing a sample with unknown concentration of CXCL8; b) bringing the sample or a dilution thereof in contact with the L-nucleic acid as defined in claim 112; and c) measuring the detectable modification group; d) optionally, comparing signal from said detectable modification group with signal of a reference; or e) optionally, comparing signal from said detectable modification group with signal of a sample of known CXCL8 concentration.

122. The method of claim 121, comprising step e).

123. A method for the detection of the L-nucleic acid as defined in claim 104 in a sample, wherein the method comprises the steps of: a) providing a capture probe, wherein the capture probe is at least partially complementary to a first part of the L-nucleic acid molecule as defined in claim 104 and a detection probe, wherein the detection probe is at least partially complementary to a second part of the L-nucleic acid molecule as defined in claim 104, or, alternatively, the capture probe is at least partially complementary to a second part of the L-nucleic acid molecule as defined in any one of claim 104 and the detection probe is at least partially complementary to a first part of the L-nucleic acid molecule as defined in claim 104; b) adding the capture probe and the detection probe separately or combined to a sample containing the L-nucleic acid molecule as defined in claim 104 or presumed to contain the L-nucleic acid molecule as defined in claim 104; c) allowing the capture probe and the detection probe to react either simultaneously or in any order sequentially with the L-nucleic acid molecule as defined in claim 104 or part thereof; d) optionally detecting whether or not the capture probe is hybridized to the L-nucleic acid molecule as defined in claim 104 provided in step a); and e) detecting the complex formed in step c) consisting of the L-nucleic acid molecule as defined in claim 104 and the capture probe and the detection probe.

Description

[0380] The present invention is further illustrated by the figures, examples and the sequence listing from which further features, embodiments and advantages may be taken, wherein

[0381] FIG. 1 shows an alignment of sequences of nucleic acid molecules capable of binding human CXCL8 including the K.sub.D value determined by competition pull-down binding assay;

[0382] FIG. 2 shows truncated derivatives of nucleic acid molecule 315-F8-001 including the K.sub.D value and relative binding activity to human CXCL8 as determined by determined by competition pull-down binding assay and/or by surface plasmon resonance measurement;

[0383] FIG. 3 shows the kinetic evaluation by competition pull-down binding assay of D-nucleic acid molecules 315-F8-001 and 315-F8-002 to D-CXCL8;

[0384] FIG. 4 shows binding of nucleic acid molecule 315-F8-002 to CXCL8 at (A) 25° C. and (B) 37° C. as determined by surface plasmon resonance measurement. Association constant ka and dissociation constant kd are given;

[0385] FIG. 5 shows binding of nucleic acid molecule 315-F8-002-PEG to CXCL8 at (A) 25° C. and (B) 37° C. as determined by surface plasmon resonance measurement. Association constant ka and dissociation constant kd are given;

[0386] FIG. 6 shows the selectivity of 315-F8-002 binding for CXCL8 as determined by a by a competitive binding assays using surface plasmon resonance measurement;

[0387] FIG. 7 shows the inhibition of CXCL8-induced chemotaxis of CXCR2-expressing cells by nucleic acid molecule 315-F8-002-PEG;

[0388] FIG. 8 is a bar diagram showing quantification of CXCL8 by nucleic acid molecule 315-F8-002 (FIG. 8A) and quantification of CCL5 by nucleic acid molecule 315-F8-002 (FIG. 8B); and

[0389] FIG. 9 is a bar diagram showing binding of L-aptamer 315-F8-002 (FIG. 9A) and aptamer 8A-35 (FIG. 9B) to soluble CXCL8 and CXCL1 at different concenctions.

EXAMPLE 1: NUCLEIC ACIDS CAPABLE OF BINDING HUMAN CXCL8

[0390] Several CXCL8-binding nucleic acids and derivatives thereof were identified, the nucleotide sequences of which are depicted in FIGS. 1 to 2. CXCL8 binding nucleic acids were tested as D-aptamers (D-nucleic acids) and L-aptamers (L-nucleic acids), whereby the D-nucleic acids and the L-nuclei acids were synthesized as described in Example 2.

[0391] CXCL8-binding nucleic acids were characterized [0392] a) as D-aptamers by pull-down binding assays to biotinylated D-CXCL8 (SEQ ID NO: 1) as shown in Example 3; and [0393] b) as L-aptamers by surface plasmon resonance (SPR) measurement (Example 4), and by an in vitro assay with cells expressing the human CXCR2 receptor, whereby for both methods L-CXCL8 (SEQ ID NO: 2) was used (Example 5).

[0394] The nucleic acids thus generated exhibit slightly different sequences, whereby the sequences can be summarized or grouped as a sequence family.

[0395] For definition of nucleotide sequence motifs, the IUPAC abbreviations for ambiguous nucleotides are used:

TABLE-US-00006 S strong G or C; W weak A or U (T); R purine G or A; Y pyrimidine C or U (T); K keto G or U (T); M imino A or C; B not A C or U (T) or G; D not C A or G or U (T); H not G A or C or U (T); V not U A or C or G; N all A or G or C or U (T)

[0396] If not indicated to the contrary, any nucleic acid sequence or sequence of stretches, respectively, is indicated in the 5′.fwdarw.3′ direction.

[0397] As depicted in FIGS. 1 to 2 CXCL8 binding nucleic acids comprise one central stretch of nucleotides defining a potential CXCL8 binding motif, whereby FIG. 1 shows the different sequences of the sequence family and FIG. 2 show truncated derivatives of the CXCL8 nucleic acid 315-F8-001 including CXCL8 nucleic acid 315-F8-002-PEG.

[0398] In general, CXCL8 binding nucleic acid molecules comprise at the 5′-end and the 3′-end terminal stretches of nucleotides: the first terminal stretch of nucleotides and the second terminal stretch of nucleotides. The first terminal stretch of nucleotides and the second terminal stretch of nucleotides can hybridize to each other, whereby upon hybridization a double-stranded structure is formed. However, such hybridization is not necessarily given in the molecule in vivo and in vitro.

[0399] The three stretches of nucleotides of CXCL8 binding nucleic acid molecules—the first terminal stretch of nucleotides, the central stretch of nucleotides and the second terminal stretch of nucleotides—are arranged to each other in 5′.fwdarw.3′-direction: the first terminal stretch of nucleotides—the central stretch of nucleotides—the second terminal stretch of nucleotides. However, alternatively, the first terminal stretch of nucleotides, the central stretch of nucleotides and the second terminal stretch of nucleotides are arranged to each other in 5′.fwdarw.3′-direction: the second terminal stretch of nucleotides—the central stretch of nucleotides—the first terminal stretch of nucleotides.

[0400] The sequences of the defined stretches may be different between the CXCL8 binding nucleic acid molecules which influences the binding affinity to CXCL8. Based on binding analysis of the different CXCL8 binding nucleic acid molecules the central stretch of nucleotides and their nucleotide sequences as described in the following are individually and more preferably in their entirety essential for binding to CXCL8.

[0401] The CXCL8 binding nucleic acids consist of ribonucleotides (as shown in FIGS. 1 to 2).

[0402] As shown in FIG. 1 the sequence of the central stretch of nucleotides of the CXCL8 binding nucleic acids 315-H9-001, 315-F11-001 and 315-F8-001 are slightly different:

TABLE-US-00007 (315-H9-001) 5′ GGAAGUACGUGGAAAGCCAAUGAGUGUGUCCCG 3′, (315-F11-001) 5′ GGAAGUACGUGGAAAGCCGAUGAGUGUGUCCCG 3′, (315-F8-001) 5′ GGAAGUACGUGGAAAGCCGAAAGUGUGUCCCG 3′.

[0403] The central stretch of nucleotides of the CXCL8 binding nucleic acids according to the present invention comprises 32-33 nt and can be summarized in the consensus sequence: 5′ GGAAGUACGUGGAAAGCCRA(X.sub.U)RAGUGUGUCCCG 3′, wherein X.sub.U is U or absent.

[0404] The CXCL8 binding nucleic acids with the best binding affinity to CXCL8, that means the CXCL8 binding nucleic acids with the highest binding affinity to CXCL8 or the lowest dissociation constant Kd for CXCL8, comprise a central stretch of nucleotides with a sequence of 5′ GGAAGUACGUGGAAAGCCGAAAGUGUGUCCCG 3′ (315-F8-001) and 5′ GGAAGUACGUGGAAAGCCAAUGAGUGUGUCCCG 3′ (315-H9-001), whereby a central stretch of nucleotides with a sequence of 5′ GGAAGUACGUGGAAAGCCGAAAGUGUGUCCCG 3′ (315-F8-001) leads to the best binding affinity of a CXCL8 nucleic acid for CXCL8.

[0405] As shown in FIGS. 1 and 2 the first terminal stretch of nucleotides and second terminal stretch of nucleotides of CXCL8 binding nucleic acids comprise six nucleotides, five nucleotides, four nucleotides or three nucleotides whereby the stretches optionally hybridize with each other, whereby upon hybridization a double-stranded structure is formed. This double-stranded structure can consist of six, five, four, or three base pairs. However, such hybridization is not necessarily given in the molecule.

[0406] As shown in FIG. 1 the first and the second stretch of nucleotides of the CXCL8 binding nucleic acids 315-H9-001, 315-F11-001 and 315-F8-001 comprise six nucleotides, respectively:

[0407] a) CXCL8 binding nucleic acids 315-H9-001 and 315-F8-001—the first terminal stretch of nucleotides comprises a nucleotide sequence of 5′ GCUGAC 3′ and the second terminal stretch of nucleotides comprises a nucleotide sequence of 5′ GUCAGC 3′;

[0408] b) CXCL8 binding nucleic acid 315-F11-001—the first terminal stretch of nucleotides comprises a nucleotide sequence of 5′ GCUGAC 3′ and the second terminal stretch of nucleotides comprises a nucleotide sequence of 5′ GUGAGC 3′.

[0409] As shown in FIG. 2 the first and the second stretch of nucleotides of the CXCL8 binding nucleic acids comprise five, four or three nucleotides, respectively: [0410] a) CXCL8 binding nucleic acid 315-F8-002—the first terminal stretch of nucleotides comprises a nucleotide sequence of 5′ CUGAC 3′ and the second terminal stretch of nucleotides comprises a nucleotide sequence of 5′ GUCAG 3′; [0411] b) CXCL8 binding nucleic acid 315-F8-005—the first terminal stretch of nucleotides comprises a nucleotide sequence of 5′ GUGAC 3′ and the second terminal stretch of nucleotides comprises a nucleotide sequence of 5′ GUCAC 3′; [0412] c) CXCL8 binding nucleic acid 315-F8-003—the first terminal stretch of nucleotides comprises a nucleotide sequence of 5′ UGAC 3′ and the second terminal stretch of nucleotides comprises a nucleotide sequence of 5′ GUCA 3′; [0413] d) CXCL8 binding nucleic acid 315-F8-006—the first terminal stretch of nucleotides comprises a nucleotide sequence of 5′ GGAC 3′ and the second terminal stretch of nucleotides comprises a nucleotide sequence of 5′ GUCC 3′; [0414] e) CXCL8 binding nucleic acid 315-F8-007—the first terminal stretch of nucleotides comprises a nucleotide sequence of 5′ GCAC 3′ and the second terminal stretch of nucleotides comprises a nucleotide sequence of 5′ GUGC 3′; [0415] f) CXCL8 binding nucleic acid 315-F8-008—the first terminal stretch of nucleotides comprises a nucleotide sequence of 5′ GGUC 3′ and the second terminal stretch of nucleotides comprises a nucleotide sequence of 5′ GACC 3′; [0416] g) CXCL8 binding nucleic acid 315-F8-009—the first terminal stretch of nucleotides comprises a nucleotide sequence of 5′ UGGC 3′ and the second terminal stretch of nucleotides comprises a nucleotide sequence of 5′ GCCA 3′; [0417] h) CXCL8 binding nucleic acid 315-F8-004—the first terminal stretch of nucleotides comprises a nucleotide sequence of 5′ GAC 3′ and the second terminal stretch of nucleotides comprises a nucleotide sequence of 5′ GUC 3′.

[0418] The first terminal stretch of nucleotides and the second terminal stretch of nucleotides of all tested CXCL8 binding nucleic acid molecules can be summarized in the following generic formula for the first terminal stretch of nucleotides and the second terminal stretch of nucleotides:

[0419] the generic formula for the first terminal stretch of nucleotides is 5′ Z.sub.1Z.sub.2Z.sub.3Z.sub.4Z.sub.5C 3′ and the generic formula for the second terminal stretch of nucleotides is 5′ GZ.sub.6Z.sub.7Z.sub.8Z.sub.9 Z.sub.10 3′, wherein Z.sub.1 is G or absent, Z.sub.2 is S or absent, Z.sub.3 is K or absent, Z.sub.4 is S, Z.sub.5 is D, Z.sub.6 is H, Z.sub.7 is S, Z.sub.8 is M or absent, Z.sub.9 is S or absent, and Z.sub.10 is C or absent,

[0420] whereby in a first preferred embodiment [0421] q) Z.sub.1 is G, Z.sub.2 is S, Z.sub.3 is K, Z.sub.4 is S, Z.sub.5 is D, Z.sub.6 is H, Z.sub.7 is S, Z.sub.8 1 S M, Z.sub.9 is S, and Z.sub.10 is C; or [0422] r) Z.sub.1 is absent, Z.sub.2 is S, Z.sub.3 is K, Z.sub.4 is S, Z.sub.5 is D, Z.sub.6 is H, Z.sub.7 is S, Z.sub.8 is M, Z.sub.9 is 5, and Z.sub.10 is absent; or [0423] s) Z.sub.1 is absent, Z.sub.2 is absent, Z.sub.3 is K, Z.sub.4 is S, Z.sub.5 is D, Z.sub.6 is H, Z.sub.7 is S, Z.sub.8 is M, Z.sub.9 is absent, and Z.sub.10 is absent; or [0424] t) Z.sub.1 is absent, Z.sub.2 is absent, Z.sub.3 is absent, Lt is S, Z.sub.5 is D, Z.sub.6 is H, Z.sub.7 is S, Z.sub.8 is absent, Z.sub.9 is absent, and Z.sub.10 is absent; or [0425] u) Z.sub.1 is absent, Z.sub.2 is S, Z.sub.3 is K, Z.sub.4 is S, Z.sub.5 is D, Z.sub.6 is H, Z.sub.7 is S, Z.sub.8 is M, Z.sub.9 is S, and Z.sub.10 is C; or [0426] v) Z.sub.1 is absent, Z.sub.2 is absent, Z.sub.3 is K, Z.sub.4 is S, Z.sub.5 is D, Z.sub.6 is H, Z′7 is S, Z.sub.8 is M, Z.sub.9 is 5, and Z.sub.10 is C; or [0427] w) Z.sub.1 is absent, Z.sub.2 is absent, Z.sub.3 is absent, Z.sub.4 is S, Z.sub.5 is D, Z.sub.6 is H, Z.sub.7 is S, Z.sub.8 is M, Z.sub.9 is S, and Z.sub.10 is C; or [0428] x) Z.sub.1 is G, Z.sub.2 is S, Z.sub.3 is K, Z.sub.4 is S, Z.sub.5 is D, Z.sub.6 is H, Z.sub.7 is S, Z.sub.8 is M, Z.sub.9 is S, and Z.sub.10 is absent; or [0429] y) Z.sub.1 is G, Z.sub.2 is S, Z.sub.3 is K, Z.sub.4 is S, Z.sub.5 is D, Z.sub.6 is H, Z.sub.7 is S, Z.sub.8 is M, Z.sub.9 is absent, and Z.sub.10 is absent; or [0430] z) Z.sub.1 is G, Z.sub.2 is S, Z.sub.3 is K, Z.sub.4 is S, Z.sub.5 is D, Z.sub.6 is H, Z.sub.7 is S, Z.sub.8 is absent, Z.sub.9 is absent, and Z.sub.10 is absent; or [0431] aa) Z.sub.1 is absent, Z.sub.2 is S, Z.sub.3 is K, Z.sub.4 is S, Z.sub.5 is D, Z.sub.6 is H, Z.sub.7 is S, Z.sub.8 is M, Z.sub.9 is absent, and Z.sub.10 is absent; or [0432] bb) Z.sub.1 is absent, Z.sub.2 is S, Z.sub.3 is K, Z.sub.4 is S, Z.sub.5 is D, Z.sub.6 is H, Z.sub.7 is S, Z.sub.8 is absent, Z.sub.9 is absent, and Z.sub.10 is absent; or [0433] cc) Z.sub.1 is absent, Z.sub.2 is absent, Z.sub.3 is K, Z.sub.4 is S, Z.sub.5 is D, Z.sub.6 is H, Z.sub.7 is S, Z.sub.8 is M, Z.sub.9 is S, and Z.sub.10 is absent; or [0434] dd) Z.sub.1 is absent, Z.sub.2 is absent, Z.sub.3 is absent, Z.sub.4 is S, Z.sub.5 is D, Z.sub.6 is H, Z.sub.7 is S, Z.sub.8 is M, Z.sub.9 is S, and Z.sub.10 is absent; or [0435] ee) Z.sub.1 is absent, Z.sub.2 is absent, Z.sub.3 is K, Z.sub.4 is S, Z.sub.5 is D, Z.sub.6 is H, Z.sub.7 is S, Z.sub.8 is absent, Z.sub.9 is absent, and Z.sub.10 is absent; or [0436] ff) Z.sub.1 is absent, Z.sub.2 is absent, Z.sub.3 is absent, Z.sub.4 is S, Z.sub.5 is D, Z.sub.6 is H, Z.sub.7 is S, Z.sub.8 is M, Z.sub.9 is absent, and Z.sub.10 is absent.

[0437] The CXCL8 binding nucleic acids with the best binding affinity to CXCL8, that means the CXCL8 binding nucleic acids with the highest binding affinity to CXCL8 or the lowest dissociation constant Kd for CXCL8, comprise the following first and second terminal stretches of nucleotides: [0438] a) CXCL8 binding nucleic acids 315-H9-001 and 315-F8-001—the first terminal stretch of nucleotides comprises a nucleotide sequence of 5′ GCUGAC 3′ and the second terminal stretch of nucleotides comprises a nucleotide sequence of 5′ GUCAGC 3′; [0439] b) CXCL8 binding nucleic acid 315-F8-002—the first terminal stretch of nucleotides comprises a nucleotide sequence of 5′ CUGAC 3′ and the second terminal stretch of nucleotides comprises a nucleotide sequence of 5′ GUCAG 3′; [0440] c) CXCL8 binding nucleic acid 315-F8-005—the first terminal stretch of nucleotides comprises a nucleotide sequence of 5′ GUGAC 3′ and the second terminal stretch of nucleotides comprises a nucleotide sequence of 5′ GUCAC 3′.

[0441] The Kd values of CXCL8-binding nucleic acids 315-F8-001, 315-H9-001 and 315-F11-001 (comprising terminal stretches with six nucleotides) were measured in the range of 1.5-12.5 nM as determined in a competition pull-down binding assay (FIGS. 1 to 3). In a direct pull-down assay format CXCL8-binding nucleic acid 315-F8-001 showed a Kd value of 0.8 nM. Using surface plasmon resonance measurement, a more sensitive method for determining Kd values, the Kd for CXCL8 binding nucleic acid 315-F8-001, was 0.22 nM at 25° C. and 0.68 nM at 37° C. (FIG. 2).

[0442] It was surprisingly found that truncation of the first terminal stretch from six to five nucleotides and the truncation of the second terminal stretch from six to five nucleotides had no negative effect on the binding affinity to CXCL8. The binding affinity of CXCL8 binding nucleic acid 315-F8-002 as measured by the competition pull-down assay (Kd of 1.1 nM; FIGS. 2 and 3) and by surface plasmon resonance measurement (Kd of 0.22 nM at 25° C. and of 0.75 nM at 37° C.; FIGS. 2 and 4) is in the range of the binding affinity as determined for CXCL8-binding nucleic acid 315-F8-001 (see Kd values for 315-F8-001 supra).

[0443] Attempts to further truncate and/or mutate the terminal stretches of CXCL8-binding nucleic acid 315-F8-002 resulted in CXCL8-binding nucleic acids 315-F8-003, 315-F8-004, 315-F8-005, 315-F8-006, 315-F8-007, 315-F8-008 and 315-F8-009 with lower (315-F8-003, 315-F8-004, 315-F8-006, 315-F8-007, 315-F8-008, and 315-F8-009) or similar (315-F8-005) binding affinities for CXCL8 (FIG. 2).

[0444] For the 5′-40 kDa-PEGylated variant of CXCL8-binding nucleic acid 315-F8-002, the CXCL8-binding nucleic acid 315-F8-002-PEG (also referred to as AON-S08) a Kd of 0.2 nM at 25° C. and 0.8 nM at 37° C. was determined by surface plasmon resonance measurement (FIGS. 2 and 5).

[0445] CXCL8 is one of several ELR-positive human CXC chemokines. Beside CXCL8, the ELR-positive human CXC chemokines CXCL1, CXCL2, CXCL3, CXCL5, CXCL6, CXCL7 bind to the CXCL8 receptor CXCR2, wherein the ELR-positive human CXC chemokines CXCL6 and CXCL7 also bind to the CXCL8 receptor CXCR1. To show the specificity and selectivity of the binding characteristics of CXCL8 binding nucleic acid 315-F8-002, the binding affinity of CXCL8 binding nucleic acid 315-F8-002 to the ELR-positive human CXC chemokines CXCL1, CXCL2, CXCL3, CXCL5, CXCL6, CXCL7 was tested by SPR in a competitive binding assay (Example 4). CXCL8 binding nucleic acid 315-F8-002 showed no binding to any other ELR-positive human CXC chemokine CXCL1, CXCL2, CXCL3, CXCL5, CXCL6, CXCL7 (FIG. 6).

[0446] CXCL8 binding nucleic acid 315-F8-002-PEG inhibited CXCL8-induced chemotaxis of CXCR2-expressing BA/F3 cells with a mean inhibitory constant IC.sub.50 of 0.26 nM (FIG. 7, Example 5).

[0447] A biosensor with immobilized CXCL8 binding nucleic acid 315-F8-002 was used to detect and quantify CXCL8. The limit of detection (mean baseline value+3× standard deviation of baseline values) was <98 pM CXCL8 and the lower limit of quantification (mean baseline value+10× standard deviation of baseline values) was also <98 pM CXCL8 (FIG. 8A, Example 6). In order to show the specificity of the immobilised CXCL8 binding nucleic acid 315-F8-002, a different chemokine (CCL5) was used as an analyte. No binding of CCL5 was measured at concentrations up to 12.5 nM (FIG. 8B, Example 6).

EXAMPLE 2: SYNTHESIS OF D- AND L-APTAMERS

Small Scale Solid-Phase Synthesis

[0448] D-aptamers (D-nucleic acids) and L-aptamers (L-nucleic acids) were produced by solid-phase synthesis with an ABI 394 synthesizer (Applied Biosystems, Foster City, Calif., USA) using 2′TBDMS RNA phosphoramidite chemistry (Damha and Ogilvie, 1993). L-rA(N-Bz)-, L-rC(Ac)-, L-rG(N-ibu)-, L-rU-, D-rA(N-Bz)-, D-rC(Ac)-, D-rG(N-ibu)-, D-rU-phosphoramidites were purchased from ChemGenes, Wilmington, Mass. D- and L-aptamers were purified by gel electrophoresis.

Large Scale Solid-Phase Synthesis

[0449] L-aptamers were produced by solid-phase synthesis with an ÄktaPilot100 synthesizer (Amersham Biosciences; General Electric Healthcare, Freiburg) using 2′TBDMS RNA and DNA phosphoramidite chemistry (Damha and Ogilvie, 1993). L-rA(N-Bz)-, L-rC(Ac)-, L-rG(N-ibu)-, and L-rU- were purchased from ChemGenes, Wilmington, Mass. The 5′-amino-modifier was purchased from American International Chemicals Inc. (Framingham, Mass., USA). Synthesis of the unmodified or 5′-amino-modified L-aptamer was started on L-riboA, L-riboC, L-riboG, or L-riboU, modified CPG pore size 1000 A (Link Technology, Glasgow, UK. For coupling of the RNA phosphoramidites (15 min per cycle), 0.3 M benzylthiotetrazole (CMS-Chemicals, Abingdon, UK) in acetonitrile, and 2 equivalents of the respective 0.2 M phosphoramidite solution in acetonitrile was used. An oxidation-capping cycle was used: Further standard solvents and reagents for oligonucleotide synthesis were purchased from Biosolve (Valkenswaard, NL). The L-aptamer was synthesized DMT-ON; after deprotection, it was purified via preparative RP-HPLC (Wincott et al., 1995) using Source15RPC medium (Amersham). The 5′DMT-group was removed with 80% acetic acid (30 min at RT). In case of 5′aminomodified L-aptamers the 5′MMT-group was removed with 80% acetic acid (90 min at RT). Subsequently, aqueous 2 M NaOAc solution was added and the L-aptamer was desalted by tangential-flow filtration using a 5 K regenerated cellulose membrane (Millipore, Bedford, Mass.).

PEGylation of L-Aptamers

[0450] To prolong the L-aptamer's plasma residence time in vivo, the L-aptamer was covalently coupled to a 40 kDa polyethylene glycol (PEG) moiety at 5′-end. For PEGylation (for technical details of the method for PEGylation see European patent application EP 1 306 382), the purified 5′ amino modified L-aptamer was dissolved in a mixture of H.sub.2O (2.5 ml), DMF (5 ml), and buffer A (5 ml; prepared by mixing citric acid.H.sub.2O [7 g], boric acid [3.54 g], phosphoric acid [2.26 ml], and 1 M NaOH [343 ml] and adding water to a final volume of 1 l; pH=8.4 was adjusted with 1 M HCl).

[0451] The pH of the L-aptamer solution was brought to 8.4 with 1 M NaOH. Then, 40 kDa PEG-NHS ester (Jenkem Technology, Allen, Tex., USA) was added at 37° C. every 30 min in six portions of 0.25 equivalents until a maximal yield of 75 to 85% was reached. The pH of the reaction mixture was kept at 8-8.5 with 1 M NaOH during addition of the PEG-NHS ester.

[0452] The reaction mixture was blended with 4 ml urea solution (8 M), and 4 ml buffer B (0.1 M triethylammonium acetate in H.sub.2O) and heated to 95° C. for 15 min. The PEGylated L-aptamer was then purified by RP-HPLC with Source 15RPC medium (Amersham), using an acetonitrile gradient (buffer B; buffer C: 0.1 M triethylammonium acetate in acetonitrile). Excess PEG eluted at 5% buffer C, PEGylated L-aptamer at 10-15% buffer C. Product fractions with a purity of >95% (as assessed by HPLC) were combined and mixed with 40 ml 3 M NaOAc. The PEGylated L-aptamer was desalted by tangential-flow filtration (5 K regenerated cellulose membrane, Millipore, Bedford Mass.).

EXAMPLE 3: PULL-DOWN BINDING ASSAYS

Direct Pull-Down Assay for Determination of Binding Constants of D-Aptamers

[0453] Direct pull-down assays are used to determine the affinity of D-aptamers to D-CXCL8(C-bio) (SEQ ID NO: 1). For this purpose, D-aptamers are radioactively labeled by T4 polynucleotide kinase (Invitrogen, Karlsruhe, Germany) using [γ-.sup.32P]-ATP (Hartmann Analytic, Braunschweig, Germany). The specific radioactivity of labeled D-aptamers was 110,000-300,000 cpm/pmol. Labeled D-aptamers are incubated at 0.2 nM concentration in selection buffer (20 mM Tris, pH 7.4, 150 mM NaCl, 5 mM KCl, 1 mM MgCl.sub.2, 1 mM CaCl.sub.2, 0.1% Tween 20, 100 μg/ml essential fatty acid free bovine serum albumin, 200 μg/ml yeast RNA) together with varying amounts of D-CXCL8(C-bio) ranging from 0.0192 to 300 nM for 1.5-2 hours at 37° C. D-CXCL8(C-bio)/D-aptamer complexes are immobilized on NAag+ beads (Neutravidin agarose plus from Pierce Biotechnology, Rockford, USA) preequilibrated in selection buffer. After detaching the supernatant and appropriate washing, bead-bound radioactivity is measured in a scintillation counter (LS6500; Beckman Coulter, Fullerton, USA). The amount of immobilized, labeled D-aptamer (% of input) is plotted against the concentration of D-CXCL8(C-bio) and dissociation constants Kd are obtained by using software algorithms (GRAFIT; Erithacus Software; Surrey U.K.) assuming a 1:1 stoichiometry.

[0454] For the CXCL8 binding aptamers 315-H9-001 and 315-F8-001 Kd values of 1.7 nM and 0.8 nM were determined by direct pull-down assay, respectively.

[0455] Competition pull-down assay for ranking and determination of binding constants of D-aptamers Competition pull-down assays are used to compare affinities of different D-CXCL8(C-bio) binding D-aptamers. For this purpose, a reference D-aptamer is radioactively labeled (as described above) and incubated at 37° C. with D-CXCL8(C-bio) in selection buffer at conditions that result in a non-saturated binding signal after immobilization on NAag+ and washing (e.g. 3 nM D-CXCL8(C-bio), 0.15 nM labeled D-aptamer). Addition of an excess amount of a non-labeled D-aptamer that competes with the labeled D-aptamer for binding to D-CXCL8(C-bio) results in a decreased in the amount of bead-bound, radioactivity after immobilization and washing. The degree of signal reduction depends on the amount and affinity of the non-labeled D-aptamer. Competition pull-down assays are used for ranking experiments and to determine dissociation constants (Kd) of selected D-aptamers. Dissociation constants Kd are determined by plotting the fraction (in %) of a labeled D-aptamer bound to D-CXCL8(C-bio) against the concentration of the non-labeled competitive D-aptamer. Data analyses were performed with GRAFIT.

[0456] The results of the pull-down binding assays are specified in Example 1 and shown in FIGS. 1, 2 and 3, wherein as labeled D-aptamer the CXCL8 nucleic acid 315-F8-001 was used.

EXAMPLE 4: SURFACE PLASMON RESONANCE (SPR) BINDING ASSAYS

[0457] Surface plasmon resonance measurements were performed on a Biacore 2000 instrument (GE Healthcare) set to a constant temperature of 25° C. or 37° C. Proteins was immobilized on CM4 sensor chips (GE Healthcare) by amine coupling. The sensor chip surface was activated by injection of a 1:1 mixture of 0.4 M EDC (1-ethyl-3-(3-dimethylaminopropyl) carbodiimide; GE) and 0.1 M NHS (N-hydroxysuccinimide; GE). The maximal observed response for covalently immobilized peptide or protein was about 500 RU. The flow cells were blocked with 1 M ethanolamine hydrochloride (GE, BR-1000-50). Non-covalently bound peptide or protein is also removed by this procedure. A flow cell with untreated dextran surface and a flow cell with ethanolamine-blocked surface served as controls. Prior to measurement, the sensor chip was primed twice with degassed physiological running buffer (20 mM Tris pH 7.4, 150 mM NaCl, 5 mM KCl, 1 mM MgCl.sub.2 and 1 mM CaCl.sub.2) and underwent at least three injection and regeneration (5 M NaCl) cycles.

[0458] Binding affinities of L-aptamers were measured by injection of a concentration series of 1000, 500, 250, 125, 62.5, 31.3, 15.6, 7.8, 3.9, 1.95, 0.98, 0.49, 0.24, 0.12, 0.06 nM and recording of the binding event's association and dissociation phase. The resulting binding curves were fitted to a Langmuir 1:1 stoichiometric binding model to determine the binding kinetic rate constants (association constants ka; dissociation constant kd) which are used to calculate the dissociation constant (Kd=kd/ka). Data analysis were done with the BIAevaluation 3.1.1 software (BIACORE AB, Uppsala, Sweden) with a constant refractive index (RI) value and an initial mass transport coefficient kt of 1×10e7 (RU.Math.M.sup.−1s.sup.−1).

[0459] Selectivity of L-aptamer binding was evaluated by a competitive binding assays. For this purpose, human chemokines CXCL1, CXCL2, CXCL3, CXCL5, CXCL6, CXCL7, and CXCL8 (purchased from RnD Systems, PeproTech, or ProSpecTech) were individually injected at 40 nM along with the L-aptamer of CXCL8-binding nucleic acid 315-F8-002 (0.25 nM) to compete for binding of the L-aptamer to immobilized CXCL8. As a control, chemokines were injected in the absence of the L-aptamer to monitor for binding to the sensor chip dextran matrix or/and immobilized CXCL8. Binding of 315-F8-002 to immobilized CXCL8 was recorded at a predefined report point 240 s after the end of injection. Selected chemokines were immobilized and binding affinities of the L-aptamer of CXCL8-binding nucleic acid 315-F8-002 were determined as described above.

[0460] The results of the SPR binding assays are specified in Example 1 and shown in FIGS. 2, 4, 5 and 6.

EXAMPLE 5: IN VITRO PHARMACOLOGY—CHEMOTAXIS ASSAY

[0461] The BA/F3 mouse pro-B cell line was stably transfected using a plasmid coding for the human CXCR2. For chemotaxis assays, recombinant CXCL8 (0.5 nM) was preincubated with the L-aptamer of CXCL8-binding nucleic acid 315-F8-002-PEG at indicated concentrations in HBH buffer (Hanks balanced salt solution (HBSS)+1 mg/ml BSA+20 mM HEPES) in the lower compartments of a 96-well Corning Transwell plate with 5 μm pores (Costar Corning, N.Y.) at 37° C. for 20-30 minutes. CXCR2.sup.+ cells in HBH buffer were added to the upper compartments and could migrate at 37° C. for 3 hours. After removal of the upper compartments 50 μM resazurin (Sigma-Aldrich) in PBS was added to the lower compartments and incubated at 37° C. for 2.5 hours. Fluorescence was measured at 590 nm (excitation wavelength 544 nm). Background-corrected and normalized fluorescence values were plotted against L-aptamer concentration. Inhibitory constant IC.sub.50 values (L-aptamer concentrations required for half-maximal inhibition) were determined with nonlinear regression (4 parameter fit) using Prism 5 software (GraphPad Software, San Diego, Calif.).

[0462] The results of the chemotaxis assays are specified in Example 1 and shown in FIG. 7.

EXAMPLE 6: CXCL8 BIOSENSOR

[0463] SPR-sensor chips coated with azide-terminated carbo nanomembrane were prepared and the CXCL8-binding L-aptamer 315-F8-002-DBCO (a DBCO-modified variant of 315-F8-002-Amino) was immobilised out of a 20 μM solution in 2 M NaCl on a flow cell of a commercial Biacore system (to about 1000 RU). As a reference, the non-functional L-aptamer (DBCO-modified reverse 315-F8-002-Amino), was immobilised to a similar amount on another flow cell. The surfaces were passivated by immobilising DBCO-modified linear methoxy-terminated polyethylene glycol (MW: 5 kDa). Injection of a concentration series of the analyte CXCL8 that was spiked into a standard sample buffer (Universal Transport Medium from Copan) with the addition of 0.1% (w/v) Tween20 showed a dose-dependent increase of the signal. The temperature of the measurement was 25° C., the flow was 30 μL/min and the running buffer was measurement buffer (20 mM Tris pH 7.4, 150 mM NaCl, 5 mM KCl, 1 mM MgCl.sub.2, 1 mM CaCl.sub.2, 0.1% (w/v) Tween20). The analyte was allowed to associate for 10 min followed by a dissociation time in measurement buffer of 2.5 min. The signal at the end of the dissociation phase was referenced by subtraction of the signal on the reference flow cell.

[0464] The results of the CXCL8 biosensor are specified in Example 1 and shown in FIG. 8.

EXAMPLE 7: SPR BINDING ASSAY FOR COMPARISON OF BINDING TO SOLUBLE CHEMOKINES

[0465] The inhibitory activity of an aptamer depends on its ability to bind to its target in solution. Here, a competitive SPR binding assay was used to determine the binding of the L aptamer of CXCL8-binding nucleic acid 315 F8 002 according to the present invention and the previously published aptamer 8A-35 (Sung, Biomaterials 2014) to soluble CXCL8 and CXCL1. For this purpose, SPR measurements were performed as described in Example 4 with CXCL8 being immobilized on a C1 sensor chip (GE Healthcare) by amine coupling. Binding of 315 F8 002 (3 nM) or 8A-35 (1.6 nM) to immobilized CXCL8 resulted in a binding response of approximately 20 response units. In 8A-35 binding assays, sensor chips were regenerated using 1M CaCl.sub.2 solution. To evaluate the binding of both aptamers to their target in solution, soluble CXCL8 was concomitantly injected at equimolar concentration (1:1 ratio) or at 5-fold excess (1:5 ratio) to compete with aptamer binding to immobilized CXCL8. Binding of soluble CXCL1 was used as a control. All measurements were performed at 37° C. Binding responses to immobilized CXCL8 were recorded at 240 s after injection.

[0466] Binding of 315-F8-002 to immobilized CXCL8 was completely blocked (>90%) by an equimolar concentration of soluble CXCL8 (FIG. 9A). In contrast, binding of 8A 35 was only partially blocked by soluble CXCL8 at equimolar (ca. 30%) and at 5-fold excess concentration (ca. 45%) (FIG. 9B). This shows that 315-F8-002 has a higher binding affinity to soluble CXCL8 compared to 8A-35. A reduced binding affinity to soluble CXCL8 (compared surface immobilized CXCL8) may explain the poor inhibitory activity of 8A-358 observed in a CXCL8-induced neutrophil migration assay (Sung, Biomaterials 2014).

[0467] Soluble CXCL1 was used as a control as 315-F8-002 was shown to have no cross-reactivity to other ELR-positive chemokines (FIG. 6). In agreement, binding of 315-F8-002 was not blocked by soluble CXCL1 (FIG. 9A). Surprisingly, binding of 8A-358 was blocked by soluble CXCL1 with similar efficacy as by soluble CXCL8 (ca. 25% at equimolar and ca. 35% at 5-fold excess concentration) (FIG. 9B). This shows that 8A-35, in contrast to 315-F8-002, does not selectively bind to and prospectively inhibit CXCL8 in solution.

REFERENCES

[0468] The complete bibliographic data of the documents recited herein the disclosure of which is incorporated by reference is, if not indicated to the contrary, as follows. [0469] Altschul S F, Gish W, Miller W, Myers E W, Lipman D J (1990), Basic local alignment search tool. J Mol Biol. 215(3):403-10. [0470] Altschul S F, Madden T L, Schaffer A A, Zhang J, Zhang Z, Miller W, Lipman D J (1997). Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res. 25(17):3389-402. [0471] Bao, Z., et al. (2010), Humanized monoclonal antibody against the chemokine CXCL-8 (IL-8) effectively prevents acute lung injury. Int Immunopharmacol. 10(2): 259-63. [0472] Brand, H. K., et al. (2013), CD4+ T-cell counts and interleukin-8 and CCL-5 plasma concentrations discriminate disease severity in children with RSV infection. Pediatr Res. 73(2): 187-93. [0473] Brat, D. J., A. C. Bellail, and E. G. Van Meir (2005), The role of interleukin-8 and its receptors in gliomagenesis and tumoral angiogenesis. Neuro Oncol. 7(2): 122-33. [0474] Campbell, L. M., P. J. Maxwell, and D. J. Waugh (2013), Rationale and Means to Target Pro-Inflammatory Interleukin-8 (CXCL8) Signaling in Cancer. Pharmaceuticals (Basel). 6(8): 929-59. [0475] Chen, Y., et al. (2012), Interleukin-8, a promising predictor for prognosis of pancreatic cancer. World J Gastroenterol. 18(10): 1123-9. [0476] David, J. M., et al. (2016), The IL-8/IL-8R Axis: A Double Agent in Tumor Immune Resistance. Vaccines (Basel). 4(3): 22. [0477] Fang, Q. I., et al. (2017), Increased CXCL8 Expression Is Negatively Correlated with the Overall Survival of Patients with ER-Negative Breast Cancer. Anticancer Res. 37(9): 4845-4852. [0478] Feniger-Barish, R., et al. (1999), Differential modes of regulation of cxc chemokine-induced internalization and recycling of human CXCR1 and CXCR2. Cytokine. 11(12): 996-1009. [0479] Garau, A., et al. (2005), Neuroprotection with the CXCL8 inhibitor repertaxin in transient brain ischemia. Cytokine. 30(3): 125-31. [0480] Ginestier, C., et al. (2010), CXCR1 blockade selectively targets human breast cancer stem cells in vitro and in xenografts. J Clin Invest. 120(2): 485-97. [0481] Ha, H., B. Debnath, and N. Neamati (2017), Role of the CXCL8-CXCR1/2 Axis in Cancer and Inflammatory Diseases. Theranostics. 7(6): 1543-1588. [0482] Harada, A., et al. (1994), Essential involvement of interleukin-8 (IL-8) in acute inflammation. J Leukoc Biol. 56(5): 559-64. [0483] Highfill, S. L., et al. (2014), Disruption of CXCR2-mediated MDSC tumor trafficking enhances anti-PD1 efficacy. Sci Transl Med. 6(237): 237ra67. [0484] Jamal, R., et al. (2017), Peripheral and local predictive immune signatures identified in a phase II trial of ipilimumab with carboplatin/paclitaxel in unresectable stage III or stage IV melanoma. J Immunother Cancer. 5(1): 83. [0485] Klussmann S. (2006). “The Aptamer Handbook—Functional Oligonucleotides and their Applications.” Edited by S. Klussmann. WILEY-VCH, Weinheim, Germany, ISBN 3-527-31059-2 [0486] Koch, A. E., et al. (1992), Interleukin-8 as a macrophage-derived mediator of angiogenesis. Science. 258(5089): 1798-801. [0487] Kratschmer, C. and M. Levy, Effect of Chemical Modifications on Aptamer Stability in Serum. Nucleic Acid Ther, 2017. 27(6): p. 335-344. [0488] Kusser W (2000). J Biotechnol 74:27-38 [0489] Li, A., et al. (2005), Autocrine role of interleukin-8 in induction of endothelial cell proliferation, survival, migration and MMP-2 production and angiogenesis. Angiogenesis. 8(1): 63-71. [0490] Liu, Q., et al. (2016), The CXCL8-CXCR1/2 pathways in cancer. Cytokine Growth Factor Rev. 31: 61-71. [0491] Ludwig, H., et al. (2017), Olaptesed pegol, an anti-CXCL12/SDF-1 Spiegelmer, alone and with bortezomib-dexamethasone in relapsed/refractory multiple myeloma: a Phase IIa Study. Leukemia. 31(4): 997-1000. [0492] Maxwell, P. J., et al. (2013), Potentiation of inflammatory CXCL8 signalling sustains cell survival in PTEN-deficient prostate carcinoma. Eur Urol. 64(2): 177-88. [0493] Maxwell, P. J., et al. (2014), Tumor-derived CXCL8 signaling augments stroma-derived CCL2-promoted proliferation and CXCL12-mediated invasion of PTEN-deficient prostate cancer cells. Oncotarget. 5(13): 4895-4908. [0494] McGinnis S, Madden T L (2004) BLAST: at the core of a powerful and diverse set of sequence analysis tools. Nucleic Acids Res. 32 (Web Server issue): W20-5. [0495] Menne, J., et al. (2017), C—C motif-ligand 2 inhibition with emapticap pegol (NOX-E36) in type 2 diabetic patients with albuminuria. Nephrol Dial Transplant. 32(2): 307-315. [0496] Merritt, W. M., et al. (2008), Effect of interleukin-8 gene silencing with liposome-encapsulated small interfering RNA on ovarian cancer cell growth. J Natl Cancer Inst. 100(5): 359-72. [0497] Morris, A. C., et al. (2009), Diagnostic importance of pulmonary interleukin-10 and interleukin-8 in ventilator-associated pneumonia. Thorax. thx. 2009.122291. [0498] Needleman & Wunsch (1970) A general method applicable to the search for similarities in the amino acid sequence of two proteins. J Mol Biol. 48(3):443-53. [0499] Oberthur, D., et al. (2015), Crystal structure of a mirror-image L-RNA aptamer (Spiegelmer) in complex with the natural L-protein target CCL2. Nat Commun. 6: 6923. [0500] Pearson & Lipman (1988) Improved tools for biological sequence comparison. Proc. Nat'l. Acad. Sci. USA 85: 2444 [0501] Russo, R. C., et al. (2014), The CXCL8/IL-8 chemokine family and its receptors in inflammatory diseases. Expert Rev Clin Immunol. 10(5): 593-619. [0502] Sanmamed, M. F., et al. (2014), Serum interleukin-8 reflects tumor burden and treatment response across malignancies of multiple tissue origins. Clin Cancer Res. 20(22): 5697-707. [0503] Sawant, K. V., et al. (2016), Chemokine CXCL1 mediated neutrophil recruitment: Role of glycosaminoglycan interactions. Sci Rep. 6: 33123. [0504] Shahzad, A., et al. (2010), Interleukin 8 (IL-8)—a universal biomarker? Int Arch Med. 3: p. 11. [0505] Skov, L., et al. (2008), IL-8 as antibody therapeutic target in inflammatory diseases: reduction of clinical activity in palmoplantar pustulosis. J Immunol. 181(1): 669-79. [0506] Smith & Waterman (1981) Adv. Appl. Math. 2: 482 [0507] Steele, C. W., et al. (2016), CXCR2 Inhibition Profoundly Suppresses Metastases and Augments Immunotherapy in Pancreatic Ductal Adenocarcinoma. Cancer Cell. 29(6): 832-45. [0508] Sung, H. J., et al., Inhibition of human neutrophil activity by an RNA aptamer bound to interleukin-8. Biomaterials, 2014. 35(1): p. 578-89. [0509] Venkatesan N, Kim S J, Kim B H (2003) Novel phosphoramidite building blocks in synthesis and applications toward modified oligonucleotides. Curr Med Chem 10(19): 1973-1991 [0510] Visvader, J. E. and G. J. Lindeman (2008), Cancer stem cells in solid tumours: accumulating evidence and unresolved questions. Nat Rev Cancer. 8(10): 755-68. [0511] Wang, C., et al. (2016), CXCL13, CXCL10 and CXCL8 as Potential Biomarkers for the Diagnosis of Neurosyphilis Patients. Sci Rep. 6: 33569. [0512] Wincott F, DiRenzo A, Shaffer C, Grimm S, Tracz D, Workman C, Sweedler D, Gonzalez C, Scaringe S, and Usman N (1995). Synthesis, deprotection, analysis and purification of RNA and ribosomes. Nucleic Acids Res. 23:2677-2684. [0513] X.sub.U, L. and I. J. Fidler (2000), Interleukin 8: an autocrine growth factor for human ovarian cancer. Oncol Res. 12(2): 97-106. [0514] Yao, R., et al. (2015), Diagnostic performance of interleukin-6 and interleukin-8 for bacterial meningitis: a meta-analysis. Int J Clin Exp Med. 8(5): 7059-68. [0515] Zhou, M., et al. (2015), Interleukin-8 for diagnosis of neonatal sepsis: a meta-analysis. PLoS One. 10(5): e0127170.

[0516] The project leading to this application has received funding from the European Union's Horizon 2020 research and innovation programme under grant agreement No 634415.