USE OF YR4DS GENE OF AEGILOPS TAUSCHII IN STRIPE RUST RESISTANCE BREEDING OF TRITICEAE PLANTS
20210403936 · 2021-12-30
Assignee
- SHANDONG AGRICULTURAL UNIVERSITY (Taian, Shandong, CN)
- SICHUAN AGRICULTURAL UNIVERSITY (Chengdu, Sichuan, CN)
Inventors
- Daolin Fu (Taian, CN)
- Chaozhong Zhang (Taian, CN)
- Dengcai Liu (Chengdu, CN)
- Lin Huang (Chengdu, CN)
- Jiajie Wu (Taian, CN)
- Huifei Zhang (Taian, CN)
- Fei Ni (Taian, CN)
- Lianquan Zhang (Chengdu, CN)
- Ge Gao (Taian, CN)
Cpc classification
C12N15/8218
CHEMISTRY; METALLURGY
Y02A40/146
GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
International classification
Abstract
A Yr4DS gene of Aegilops tauschii and its use thereof in stripe rust resistance breeding of Triticeae plants. Said gene has a sequence as shown in SEQ ID NO. 1, SEQ ID NO. 3, SEQ ID NO. 5, SEQ ID NO. 7, SEQ ID NO. 9, or SEQ ID NO.10.
Claims
1. A stripe rust resistance gene, wherein, the gene is a nucleic acid described in any of the following a) to j): a) a nucleic acid, consisting of a base sequence shown in SEQ ID NO.1; b) a nucleic acid, consisting of a base sequence shown in SEQ ID NO.3; c) a nucleic acid, consisting of a base sequence shown in SEQ ID NO.5; d) a nucleic acid, consisting of a base sequence shown in SEQ ID NO.7; e) a nucleic acid, consisting of a base sequence shown in SEQ ID NO.9; f) a nucleic acid, consisting of a base sequence shown in SEQ ID NO.10; g) a nucleic acid, consisting of a base sequence encoding a protein shown in SEQ ID NO. 2; h) a nucleic acid, consisting of a base sequence encoding a protein shown in SEQ ID NO. 4; i) a nucleic acid, consisting of a base sequence encoding a protein shown in SEQ ID NO. 6; j) a nucleic acid, consisting of a base sequence encoding a protein shown in SEQ ID NO. 8.
2. A protein encoded by the stripe rust resistance gene of claim 1, wherein an amino acid sequence of the protein is shown in SEQ ID NO.2, SEQ ID NO.4, SEQ ID NO.6 or SEQ ID NO.8.
3. Recombinant expression vectors, transgenic cell lines or genetically engineered bacteria carrying the stripe rust resistance gene of claim 1.
4. An application of DNA fragments described in any of the following a)-f) as resistance genes to stripe rust in plant breeding or the control of wheat stripe rust: a) cDNA fragments shown in SEQ ID NO.1, SEQ ID NO.3, SEQ ID NO.5 or SEQ ID NO.7; b) cDNA fragments of the amino acid sequence shown in encoded SEQ ID NO.2, SEQ ID NO.4, SEQ ID NO.6 or SEQ ID NO.8; c) DNA fragments shown in SEQ ID NO.9 or SEQ ID NO.10; d) DNA fragments of the amino acid sequence shown in encoded SEQ ID NO.2, SEQ ID NO.4, SEQ ID NO.6 or SEQ ID NO.8; e) cDNA fragments or DNA fragments, the encoded protein is functionally equivalent to the protein shown in SEQ ID NO. 2, SEQ ID NO. 4, SEQ ID NO. 6 or SEQ ID NO. 8, however, there are substitution, deletion or insertion of one, several or dozens of amino acids in the amino acid sequence; f) cDNA fragments or DNA fragments, which are hybridized with the DNA fragments of a) or c) under strict conditions and encode the protein shown in SEQ ID NO.2, SEQ ID NO.4, SEQ ID NO.6 or SEQ ID NO.8.
5. An application of the DNA fragments described in any of the following 1)-4) in the control of stripe rust of Triticeae plants or plant breeding by regulating the expression of stripe rust resistance genes: 1) DNA fragments, whose transcripts up-regulate the expression of the stripe rust resistance gene shown in at least one of SEQ ID NO. 1, SEQ ID NO.3, SEQ ID NO.5, SEQ ID NO.7, SEQ ID NO.9 or SEQ ID NO.10 in plant cells; 2) DNA fragments, whose translation products up-regulate the expression of the stripe rust resistance gene shown in at least one of SEQ ID NO. 1, SEQ ID NO.3, SEQ ID NO.5, SEQ ID NO.7, SEQ ID NO.9 or SEQ ID NO.10 in plant cells; 3) DNA fragments, whose transcripts up-regulate the transcribed RNA of the stripe rust resistance gene shown in at least one of SEQ ID NO. 1, SEQ ID NO.3, SEQ ID NO.5, SEQ ID NO.7, SEQ ID NO.9 or SEQ ID NO.10 in plant cells; 4) DNA fragments, whose translation products up-regulate the encoded protein by the stripe rust resistance gene shown in at least one of SEQ ID NO. 1, SEQ ID NO.3, SEQ ID NO.5, SEQ ID NO.7, SEQ ID NO.9 or SEQ ID NO.10 in plant cells.
6. An application of recombinant expression vectors, transgenic cell lines or genetically engineered bacteria carrying the stripe rust resistance genes or the protein according to claim 2 in breeding Triticeae plants with improved or reduced stripe rust resistance, wherein the stripe rust resistance genes are shown in at least one of SEQ ID NO.1, SEQ ID NO.3, SEQ ID NO.5, SEQ ID NO.7, SEQ ID NO.9 or SEQ ID NO. 10.
7. A method for breeding stripe rust resistant wheat, wherein the method comprising: transferring stripe rust resistant genes shown in at least one of SEQ ID NO.1, SEQ ID NO.3, SEQ ID NO.5, SEQ ID NO.7, SEQ ID NO.9 or SEQ ID NO.10 into wheat or barley to obtain stripe rust resistant wheat or barley; or up-regulating the expression of the stripe rust resistance gene shown in at least one of SEQ ID NO.1, SEQ ID NO.3, SEQ ID NO.5, SEQ ID NO.7, SEQ ID NO.9 or SEQ ID NO.10 in wheat or barley genome, and screening to obtain wheat or barley plants with improved stripe rust resistance; the method of transferring the stripe rust resistance gene into wheat or barley comprising: polyethylene glycol method, agrobacterium-mediated method or biolistics bombardment; the method of up-regulating the expression of stripe rust resistance gene in wheat or barley genome comprising: introducing DNA fragments which are able to activate or improve the transcription level or translation level or protein activity of wheat stripe rust resistance gene; or controlling the synthesis of specific small RNA molecules and up-regulating the accumulation of wheat stripe rust resistance gene mRNA.
8. A method for breeding wheat or barley with reduced stripe rust resistance, wherein the method comprising: suppressing the expression of the stripe rust resistance gene shown in at least one of SEQ ID NO.1, SEQ ID NO.3, SEQ ID NO.5, SEQ ID NO.7, SEQ ID NO.9 or SEQ ID NO.10 in wheat or barley genome, and screening to obtain wheat or barley plants with reduced stripe rust resistance; the method for suppressing the expression of stripe rust resistance genes in wheat or barley genome comprising: mutating or knocking out all or part of the sequences of the gene shown in at least one of SEQ ID NO.1, SEQ ID NO.3, SEQ ID NO.5, SEQ ID NO.7, SEQ ID NO.9 or SEQ ID NO.10 in wheat or barley; or interfering with the expression of the gene shown in at least one of SEQ ID NO.1, SEQ ID NO.3, SEQ ID NO.5, SEQ ID NO.7, SEQ ID NO.9 or SEQ ID NO.10 by using interfering RNA; or using a gene silencing system to silence the gene shown in at least one of SEQ ID NO.1, SEQ ID NO.3, SEQ ID NO.5, SEQ ID NO.7, SEQ ID NO.9 or SEQ ID NO.10.
9. A PCR marker for identifying wheat stripe rust resistance genes according claim 1, wherein there are three markers named Yr4DS-PM, Yr4DS-GM and Yr4DS-TM, respectively, and the nucleotide sequences of which are shown in SEQ ID NO.61, SEQ ID NO.62 and SEQ ID NO.63.
10. A primer for amplifying the PCR marker of claim 8, wherein a sequence of the primer for amplifying Yr4DS-PM is shown in SEQ ID No.11 and SEQ ID No.12; a sequence of the primer for amplifying Yr4DS-GM is shown in SEQ ID No.13 and SEQ ID No.14; and a sequence of the primer for amplifying Yr4DS-TM is shown in SEQ ID No.15 and SEQ ID No.16.
11. An application of the PCR marker of claim 9 in any of the following: 1) identification of stripe rust resistance genes in wheat or barley; 2) plant breeding; 3) control of wheat or barley stripe rust.
12. A method for obtaining a plant cell carrying the stripe rust resistance gene of claim 1, wherein it is obtained by means of transgenic or genome editing.
13. A method for obtaining a plant carrying the stripe rust resistance gene of claim 1, wherein the plant cells obtained by means of transgenic or genome editing, regenerate into seedlings.
Description
DESCRIPTION OF FIGURE
[0053]
[0054]
[0055]
[0056] Synthetic wheat ‘Syn-SAU-93(AS2382/AS2388)’ shows a good level of resistance of adult plant to stripe rust, with infection type ranging from 3 to 4(Infection type or IT; Line and Qayoum. 1992. USDA Technical Bulletin 1788).
[0057]
[0058]
SPECIFIC EMBODIMENTS
[0059] Noted that the following detailed description is exemplary and is intended to provide further explanation for the application. Unless otherwise specified, all technical and scientific terms used herein have the same meanings as commonly understood by those of ordinary skill in the technical field to which this application belongs.
[0060] As described in the background technology section, due to the huge and complex wheat genome, the number of stripe rust resistance genes with known sequences is very limited, which greatly limits the effective use of stripe rust resistance genes in wheat breeding. Based on this, the purpose of the present invention is to provide a new stripe rust resistance gene and use it for the breeding of wheat, barley and other Triticeae plants.
[0061] In the present invention, RNA sequencing (RNA-seq) and Bulked Segregant Analysis (BSA) are used to compare the leaf transcriptome of stripe rust resistant BSA pool and stripe rust susceptible BSA pool in F.sub.6 generation of Aegilops tauschii segregation population at the adult stage, from which genes which are only expressed in stripe rust resistant parents (PI511383) and stripe rust resistant BSA pool are identified, and a gene which is specifically expressed on PI511383 and has NBS-LRR domain and is located on the 4DS chromosome of Aegilops tauschii is further screened out (thus named the Yr4DS gene). As a result, artificial manipulation of Yr4DS gene can improve the level of stripe rust resistance of wheat and barley. The present invention can be used for improving the stripe rust resistance level of wheat and other Triticeae plants and cultivating intermediate materials and production varieties with high stripe rust resistance.
[0062] The full-length cDNA sequence of Yr4DS gene is shown in SEQ ID NO.1, SEQ ID NO.3, SEQ ID NO.5 or SEQ ID NO.7; the amino acid sequence of the protein encoded by Yr4DS gene (i.e. Yr4DS protein) is shown in SEQ ID NO.2, SEQ ID NO.4, SEQ ID NO.6 or SEQ ID NO.8; Yr4DS genome full-length expression cassettes (including promoter, genome coding region and terminator), and its nucleotide sequence is shown in SEQ ID NO.10.
[0063] The present invention relates to the application of cDNA, synthetic DNA and genomic DNA encoding Yr4DS protein of Aegilops tauschii and its homologous protein. Those skilled in the art can obtain Yr4DS gene-related cDNA and genomic DNA using conventional techniques. The preparation of cDNA comprises the following steps: a) message RNA(mRNA) is extracted from Aegilops tauschii or other species; b) the mRNA used as template to synthesize cDNA; c) PCR primers are designed according to the full-length cDNA sequence SEQ ID NO.1, SEQ ID NO.3, SEQ ID NO.5 or SEQ ID NO.7 of Yr4DS gene of the present invention, and then Yr4DS gene or its homologous gene is amplified from cDNA template; d) cloning the PCR product into plasmid carrier, and isolating the cDNA of Yr4DS gene or its homologous gene; e) the cDNA sequence of Yr4DS gene used as template, commercial service is commissioned to synthesize DNA artificially. Likewise, those skilled in the art can also extract genomic DNA from Aegilops tauschii or other species to create genomic DNA libraries (such as BAC, cosmid, fosmid and other types of libraries), and then use the DNA probes or PCR primers based on the nucleotide sequence (such as SEQ ID NO. 10) of Yr4DS genome full-length expression cassettes to screen the DNA library, then the positive plasmid carrying Yr4DS gene was obtained. The long fragment PCR method can also be adopted to amplify the Yr4DS gene or its homologous gene from the plant genomic DNA or plasmid DNA by using the specific PCR primers of the nucleotide sequence (such as SEQ ID NO. 10) of the full-length expression cassettes of Yr4DS genome of the present invention, and then the PCR product is connected to the cloning vector.
[0064] The present invention includes homologous DNA fragments of Yr4DS, as long as their encoded protein is functionally equivalent to Yr4DS protein (such as SEQ ID NO.2, SEQ ID NO.4, SEQ ID NO.6 or SEQ ID NO.8). As used herein, “functionally equivalent to Yr4DS protein” means that the protein encoded by the target DNA fragment is close to the Yr4DS protein (such as SEQ ID NO. 2, SEQ ID NO.4, SEQ ID NO.6 or SEQ ID NO.8) of the present invention in terms of biological function and physiological and biochemical characteristics. The typical biological function of Yr4DS protein is to provide resistance to stripe rust. In order to verify whether Yr4DS gene is resistant to wheat stripe rust, ethylmethylsulfone (EMS) can be used to create a mutant population of ‘synthetic wheat carrying Yr4DS gene’ (Embodiment 4 and 5), and the mutant individuals with high susceptibility to wheat stripe rust can be identified by inoculation, and then the mutation situation of Yr4DS gene is analyzed, and the correlation between mutation frequency of Yr4DS gene and susceptible phenotype is analyzed. Genetic complementation can also be used to verify in order to clarify the function of Yr4DS gene. In the present invention, the Yr4DS genome full-length expression cassettes carrier (such as SEQ ID NO. 10) is introduced into the wheat ‘CB037’ and barley ‘Golden Promise’ (Embodiment 6) that are highly susceptible to stripe rust by using the biolistics bombardment technology; with the obtained transgenic plants, the contribution of Yr4DS transgenic expression to wheat and barley resistance to stripe rust was analyzed.
[0065] If the protein function encoded by DNA fragments is equivalent to Yr4DS protein (such as SEQ ID NO.2, SEQ ID NO.4, SEQ ID NO.6 or SEQ ID NO.8), the preferred source of these DNA fragments is monocotyledon, more preferably Gramineae, and most preferably Triticeae. These DNA fragments include alleles, homologous genes, mutant genes and derived genes corresponding to nucleotide sequences of the present invention (such as SEQ ID NO.1, SEQ ID NO.3, SEQ ID NO.5 or SEQ ID NO.7); the encoded protein is similar to the amino acid sequence of Yr4DS protein of the present invention (such as SEQ ID NO.2, SEQ ID NO.4, SEQ ID NO.6 or SEQ ID NO.8), or there is substitution, deletion or insertion of one, several or dozens of amino acids, which belong to the content of the present invention.
[0066] Genome editing technology, which can direct and knock out target genes, and be applied to animals and plants (Cheng and Alper. 2014. Current Opinion in Biotechnology 30:87-94). Partial genome editing technology, such as clustered, regularly interspaced, short palindromic repeats (CRISPR), has been successfully applied in wheat and other crops (Shan et al. 2014. Nature Protocols 9:2395-2410; Wang et al. 2014. Nature Biotechnology 32:947-951; Zhang et al. 2016. Nature Communications 7: 12617). Genome editing technology will cause deletion or insertion of one, several or dozens of bases in specific regions of target genes, which will lead to gene mutation, while DNA variation in transcription regions may cause variation or truncation of coding proteins (Wang et al. 2014. Nature Biotechnology 32:947-951). The base mutation of DNA in the transcription region will also cause the amino acid change of the encoded protein. Compared with Yr4DS protein (such as SEQ ID NO.2, SEQ ID NO.4, SEQ ID NO.6 or SEQ ID NO.8), the protein encoded by DNA fragment created by genome editing or base mutation may be replaced, deleted or inserted by one, several or dozens of amino acids, but as long as the protein encoded by DNA fragment is functionally equivalent to Yr4DS protein (such as SEQ ID NO.2, SEQ ID NO.4, SEQ ID NO.6 or SEQ ID NO.8), the DNA fragment belongs to the application content of the present invention. The DNA fragments defined by the present invention also include those mutations that have undergone base mutations but do not change the coding protein sequence, that is, conservative mutations.
[0067] For those skilled in the art, genome editing technology can be used to change the Yr4DS gene (such as SEQ ID NO.1, SEQ ID NO.3, SEQ ID NO.5 or SEQ ID NO.7) and its homologous gene sequence in the present invention. In addition, the variation of the target gene can be induced by mutation or identified by germplasm screening. For example, Slade et al. (2005) created EMS mutation population of wheat, and then identified the point mutation of target gene by Targeting Induced Local Lesions IN Genomes (TILLING)(Slade et al. 2005. Nature Biotechnology 23:75-81). Long-term evolution of natural germplasm has accumulated a large number of variations, and eco-tilling can also be used to identify the variations of target genes from natural germplasm or bred varieties (Till et al. 2006. Nature Protocols 1:2465-2477). For those skilled in the art, a mutant population of related plant materials can be created, and then individuals whose DNA fragments (such as SEQ ID NO.1, SEQ ID NO.3, SEQ ID NO.5, SEQ ID NO.7, SEQ ID NO.9 or SEQ ID NO.10) in the content of the present invention are mutated can be screened from thereof. Those skilled in the art can also identify the natural variation of the DNA fragment of the present invention (such as SEQ ID NO.1, SEQ ID NO.3, SEQ ID NO.5, SEQ ID NO.7, SEQ ID NO.9 or SEQ ID NO.10) from the natural germplasm or bred varieties of related plants. Therefore, the present invention also covers: a) all plant cells which are mutated by DNA fragments (such as SEQ ID NO.1, SEQ ID NO.3, SEQ ID NO.5, SEQ ID NO.7, SEQ ID NO.9 or SEQ ID NO.10) carrying the content of the present invention obtained by genome editing, mutagenesis or natural mutation screening; b) plants carrying plant cells of item a); c) asexual clones or plant progeny from plants of item b), as long as they still carry plant cells of item a); d) plant seeds, plant tissues or plant organs from items b) and c), as long as they still carry the plant cells of item a).
[0068] For those skilled in the art, there are many methods to obtain DNA fragments, so that their encoded protein is functionally equivalent to Yr4DS protein (such as SEQ ID NO.2, SEQ ID NO.4, SEQ ID NO.6 or SEQ ID NO.8), such as PCR method (Saiki et al. 1985. Science 230:1350-1354; Hemsley et al. 1989. Nucleic Acids Research 17:6545-6551; Landt et al. 1990. Gene 96:125-128), DNA recombination technology and DNA artificial synthesis technology (Kosuri and Church. 2014. Nature Methods 11:499-507). It can be said that for those skilled in the art, it is a conventional technique to obtain DNA fragments highly homologous to Yr4DS gene from wheat or other plants, and the corresponding DNA fragments can be obtained by screening genomic DNA or cDNA library by using PCR primers corresponding to the nucleotide sequence of the present invention (such as SEQ ID NO.1, SEQ ID NO.3, SEQ ID NO.5, SEQ ID NO.7, SEQ ID NO.9 or SEQ ID NO.10) or DNA probes corresponding to the nucleic acid sequence of the present invention (such as SEQ ID NO.1, SEQ ID NO.3, SEQ ID NO.5, SEQ ID NO.7, SEQ ID NO.9 or SEQ ID NO.10). With regard to the acquisition of DNA fragments, whether by PCR, DNA recombination, DNA synthesis or other similar technologies, as long as the protein encoded by these DNA fragments is functionally equivalent to Yr4DS protein (such as SEQ ID NO.2, SEQ ID NO.4, SEQ ID NO.6 or SEQ ID NO.8), these DNA fragments belong to the content of the present invention. The amino acid sequence encoded by these DNA fragments should be highly homologous to the amino acid sequence of the Yr4DS protein of the present invention (such as SEQ ID NO.2, SEQ ID NO.4, SEQ ID NO.6 or SEQ ID NO.8); as used herein, high homology means that the sequence identity of amino acid sequences between the two is at least 50% or higher, preferably 70% or higher, more preferably 90% or higher (such as 95%, 96%, 97%, 98% and 99% or higher) on regions that can be matched. The sequence identity of amino acid or nucleotide sequence can be determined by BLAST algorithm (Altschul et al. 1990. Journal of Molecular Biology 215:403-410; Karlin and Altschul. 1993. Proceedings of the National Academy of Sciences 90:5873-5877).
[0069] Molecular marker-assisted selective breeding makes use of effective molecular markers to accelerate the breeding process and improve the breeding effect. At present, the markers used effectively include Single nucleotide polymorphism, Cleaved amplified polymorphic sequence, Derived cleaved amplified polymorphic sequence, kompetitive allele specific PCR and the like. Those skilled in the art can use similar marker creation methods to design molecular markers (such as the Yr4DS-PM marker designed in the present invention; Embodiment 3,
[0070] In view of application, when a plant highly susceptible to stripe rust is introduced, the DNA fragments of the Yr4DS gene (such as SEQ ID NO. 1, SEQ ID NO.3, SEQ ID NO.5, SEQ ID NO.7, SEQ ID NO.9 or SEQ ID NO.10) of the present invention or its homologous gene are likely to create a phenotype with high resistance to stripe rust. In other words, for the DNA fragments of Yr4DS gene (such as SEQ ID NO. 1, SEQ ID NO.3, SEQ ID NO.5, SEQ ID NO.7, SEQ ID NO.9 or SEQ ID NO.10) or its homologous gene or the recombinant vectors of the DNA fragments, after they are introduced into the plant with high susceptibility to stripe rust, the transgenic cells are differentiated and regenerated to form a transgenic plant with high resistance to stripe rust, thereby transforming the susceptible plant into a disease-resistant plant. On the contrary, transgenic plants that regulate the expression of Yr4DS gene (such as SEQ ID NO.1, SEQ ID NO.3, SEQ ID NO.5, SEQ ID NO.7, SEQ ID NO.9 or SEQ ID NO.10) or its homologous gene can also be created. The “regulated expression” here includes three levels: DNA transcription level, cDNA translation level and protein product activity, including up-regulation and down-regulation. For example, DNA fragments excavated from the Yr4DS gene (such as SEQ ID NO.1, SEQ ID NO.3, SEQ ID NO.5, SEQ ID NO.7, SEQ ID NO.9 or SEQ ID NO.10) or its homologous gene according to the present invention can activate or improve the transcription level or translation level or protein activity of the gene, or insert them into a suitable plasmid carrier, and introduce the above DNA fragments or its carrying plasmid into plant cells carrying Yr4DS gene (such as SEQ ID NO.1, SEQ ID NO.3, SEQ ID NO.5, SEQ ID NO.7, SEQ ID NO.9 or SEQ ID NO.10) or its homologous gene, and the transgenic cells are differentiated to form transgenic plants with high resistance to stripe rust. For another example, for Yr4DS gene or its homologous gene, or the existence of microRNA(miRNA), small interfering RNA(siRNA) or artificial microRNA(amiRNA) interacting with it; by reasonably controlling the expression of specific small RNA molecules (amiRNA, miRNA or siRNA), the accumulation of Yr4DS gene or its homologous gene mRNA can be regulated, and the level of resistance to stripe rust of plants can be improved.
[0071] The present invention is not limited to plasmid carriers used for carrying out plant cell transformation, as long as they can express carrier genes in plant cells. For example, use carriers that carry constitutive promoters (such as corn Ubi promoter, Christensen et al. 1992. Plant Molecular Biology 18:675-689) or leaf-specific promoters. The “plant cell” referred to in the present invention has various forms, including various single cells, multi-cells, plant tissues or organs with life omnipotence, which can be suspension culture cells, protoplast cells, plant slice tissues and plant callus, and their unified characteristics are that plants or part of plants can be formed through differentiation regeneration or asexual reproduction. The “plant cell” referred to in the present invention also covers cells from various plants, such as wheat, barley and other triticeae plants, whose unified characteristic is that plants or parts of plants can be formed through differentiation and regeneration or asexual reproduction.
[0072] For those skilled in the art, various methods can be used to introduce plasmid carriers into plant cells, such as polyethylene glycol (PEG), electroporation method, agrobacterium-mediated method, biolistics bombardment, etc., and the transformed cells can be developed into transgenic plants. In the field of plants, various transgenic technologies tend to mature and are widely used. The above methods and other similar methods are applicable to the field of the present invention.
[0073] Transgenic plants carrying the DNA fragments of the present invention can be propagated in large quantities by obtaining their sexual offspring (such as seeds), asexual clones (such as adventitious branches, callus, protoplasts, etc.) and meristems (such as bud points, stem tips, root tips, etc.) in a sexual or asexual manner. Therefore, the present invention covers: a) all transgenic plant cells carrying DNA fragments of the present invention; b) plants carrying plant cells of item a); c) asexual clones or plant progeny from plants of item b), as long as they still carry plant cells of item a); d) plant seeds, plant tissues or plant organs from items b) and c), as long as they still carry the plant cells of item a). The resistance to stripe rust of transgenic plants or plants carrying transgenic cells obtained by the above methods will be different from that of wild-type control plants in theory. For example, Yr4DS gene of Aegilops tauschii (such as SEQ ID NO.1, SEQ ID NO.3, SEQ ID NO.5, SEQ ID NO.7, SEQ ID NO.9 or SEQ ID NO.10) or its homologous gene was introduced into the plants susceptible to stripe rust, and the plants with high resistance to stripe rust were created.
[0074] In summary, the present invention focuses on the application of Yr4DS gene (such as SEQ ID NO.1, SEQ ID NO.3, SEQ ID NO.5, SEQ ID NO.7, SEQ ID NO.9 or SEQ ID NO.10) in the field of triticeae plants resistance to stripe rust. The expression of Yr4DS gene or its homologous gene in leaves and other tissues by using the plants susceptible to stripe rust as receptors may transform stripe rust-sensitive plants into plants with high resistance to stripe rust. Therefore, it is speculated that Yr4DS and its homologous genes will play an important role in breeding wheat plants for resistance to stripe rust.
[0075] In order to enable those skilled in the art to understand the technical scheme of this application more clearly, the technical scheme of this application will be described in detail with specific embodiments below.
[0076] The test materials used in the embodiments and comparative examples of the present invention are all conventional test materials in the field and can be purchased through commercial channels. Test methods without detailed conditions are carried out according to conventional test methods or operating instructions recommended by suppliers.
[0077] In the present invention, Aegilops tauschii PI511383 and PI486274 were used as parents to create a recombinant inbred line (F.sub.6) of high generation hybridization. In order to test their resistance to stripe rust, the invention uses wheat stripe rust (Pst races including CYR29, CYR30, CYR31, CYR32, CYR33, CYR34, Gui 22-1, SY11-4, or HY46-8, etc.) for inoculation and identification. Aegilops tauschii is planted in greenhouse with long sunshine (16 h, 105 molm.sup.−2s.sup.−1), with daytime temperature of 25-30° C. and nighttime temperature of 15-20° C. Aegilops tauschii is inoculated by injection or shaking powder, then kept at 10° C., dark and high humidity (100%) for 24 h, and then transferred to artificial climate room: 8 h night, 12° C.; 16 h light, 18° C. In the present invention, water, conventional drugs and plant hormones for molecular biology experiments are purchased from Fisher Scientific, Pittsburgh, Pa., USA and Sigma-Aldrich, St. Louis, Mo., USA, the plant tissue culture medium is purchased from PhytoTechnology Laboratories, Overland Park, Kans., USA, the microbial culture medium is purchased from Becton, Dickinson and Company, Franklin Lakes, N.J., USA, and antibiotics and bialaphos are purchased from Gold Biotechnology, St. Louis, Mo., USA. The PCR primers and sequences involved in the present invention are shown in Table 1.
TABLE-US-00001 TABLE 1 PCR primers used in the present invention Name of the Sequences of the primers Number of the primers (5′ to 3′ end) sequences YR4DS-FP1 TGTGTCATGTTTGGTCGATAGG SEQ ID NO. 11 YR4DS-RP1 TCCTCCCTTGTAGCTTCACG SEQ ID NO. 12 YR4DS-FP2 GCTTCCTTGACTTAAATTTCACCG SEQ ID NO. 13 YR4DS-RP2 CCACATATCATCATTCAAGACG SEQ ID NO. 14 YR4DS-FP3 AGATGAGAAGAAATGGCACGTG SEQ ID NO. 15 YR4DS-RP3 CCAGTATACATCACTCTGATTCG SEQ ID NO. 16 YR4DS-FP4 ATATTCACCCTTCCCGTCTG SEQ ID NO. 17 YR4DS-RP4 CTTGCCAATCACGTCGTGTT SEQ ID NO. 18 YR4DS-FP5 GCACCGTCCTTCATCTCAGT SEQ ID NO. 19 YR4DS-RP5 TGCTTTTCCCCGTATCCCTT SEQ ID NO. 20 YR4DS-FP6 TAGTTCAAGCGTGAGCAAACC SEQ ID NO. 21 YR4DS-RP6 CCATGTTTCTTCACCAGCTG SEQ ID NO. 22 YR4DS-FP7 CTGTAGTTGAACTCGAATTGGG SEQ ID NO. 23 YR4DS-RP7 ATGGCTGATGCTTTTCCCCG SEQ ID NO. 24 YR4DS-FP8 ACTACTTGCGAGACAGCACG SEQ ID NO. 25 YR4DS-FP9 GAAGCATGAAAGCCTTTCATCC SEQ ID NO. 26 YR4DS-RP9 TCCATTAGTTGCTTGCACTGC SEQ ID NO. 27 YR4DS-RP10 TGAGAGACGGATCTTGTTGC SEQ ID NO. 28 YR4DS-RP11 AGTAGTTGCAGGGTCCAGTG SEQ ID NO. 29 YR4DS-FP10 AAAGCTCGAGATGCTGCAGG SEQ ID NO. 30 YR4DS-FP11 TCCGAGTGGGACAAGTTCAG SEQ ID NO. 31 YR4DS-FP12 CACAGGAGAGGAAAATGAACCA SEQ ID NO. 32 YR4DS-FP13 CAAGAAGGAGAAAACACGACG SEQ ID NO. 33 YR4DS-FP14 TGTGGCTAGGGATGAAACAC SEQ ID NO. 34 YR4DS-RP14 CATCATATGGTCCTTCCTCG SEQ ID NO. 35 YR4DS-FP15 GCAAAATGTGATGGCTTACCAC SEQ ID NO. 36 YR4DS-RP15 ACTAGTGTTTCATCCCTAGC SEQ ID NO. 37 YR4DS-FP16 TGTGCACTGTCTTTGCAAGC SEQ ID NO. 38 YR4DS-RP16 GTGTAGTCCCAAACGACGTG SEQ ID NO. 39 YR4DS-FP17 GCATGATGTACGGCTTCTCA SEQ ID NO. 40 YR4DS-RP17 GAGTGGAGACATTGGACGCT SEQ ID NO. 41 RLK1-FP1 GATGAAGATAGGGATGCCGG SEQ ID NO. 42 RLK1-RP1 AGAACTTCTGTCTCAGCGCC SEQ ID NO. 43 RLK1-RP2 TAGAACAACATAGTTGGGTGC SEQ ID NO. 44 RLK1-FP3 GTGTCGGAGACTTTCAAGTC SEQ ID NO. 45 RLK1-RP3 GATGTCGGCCCTGTGAGAA SEQ ID NO. 46 RLK1-FP4 TTTCTGCTTCGGGGACTGTG SEQ ID NO. 47 RLK1-RP4 AACAGAAACAATTCACCATGGC SEQ ID NO. 48 RLK1-FP5 AGCGAGTGATATAGATGCGC SEQ ID NO. 49 RLK1-RP5 TGCAAATGGCCAGAGTTCAC SEQ ID NO. 50 RLK2-FP1 CTTCACATGTGCACATGTCC SEQ ID NO. 51 RLK2-RP1 TATTCATACAATAGCACACGCTC SEQ ID NO. 52 RLK2-FP2 TCTGCAAGAGCACCCATAGC SEQ ID NO. 53 RLK2-RP2 AAAATCACTTCCGGGCAAGC SEQ ID NO. 54 RLK2-FP3 GTCAAATAATACAGTCGGGGC SEQ ID NO. 55 RLK2-RP3 TGAAGGTATGCAAGAGCTTTGCA SEQ ID NO. 56 RLK2-FP4 ACACAGGTATGACACGCACC SEQ ID NO. 57 RLK2-RP4 CAAGCCTGCGAGCTTGATTG SEQ ID NO. 58 Actin-FP.sup.1 TATGCCAGCGGTCGAACAAC SEQ ID NO. 59 Actin-RP GGAACAGCACCTCAGGGCAC SEQ ID NO. 60 Note: The internal reference primers Actin-FP and Actin-RP in RT-PCR work on wheat, barley and Aegilops tauschii.
TABLE-US-00002 TABLE 2 Mutations of candidate genes in synthetic wheat mutants with high susceptibility to stripe rust.sup.1 Yr4DS Yr4DS Mutant Plant RLK1 RLK2 Yr4DS base Amino acid strain generation (RLK1-FP1/RP1) (RLK2-FP1/RP1) (YR4DS-FP5RP5) substitution.sup.2 substitution.sup.3 L30 M.sub.3 + + + G350A G117D L59 M.sub.3 + + + G350A G117D L68 M.sub.3 + + + G350A G117D L75 M.sub.3 + + + G350A G117D L19 M.sub.3 + + + G805A V267I L64 M.sub.3 + + + G805A V267I L70 M.sub.3 + + + G805A V267I L91 M.sub.3 + + + G805A V267I L80 M.sub.3 + + + C1560T L421F L38 M.sub.3 + + + C1968T Q557* G4 M.sub.3 + + + C603T A201A L10 M.sub.3 + + + C843T F281F G1 M.sub.4 + + + No No G2 M.sub.4 + + + No No G3 M.sub.4 + + + No No G6 M.sub.4 + + + No No G7 M.sub.4 + + + No No G8 M.sub.4 + + + No No G9 M.sub.4 + + + No No L22 M.sub.3 + + + No No L27 M.sub.3 + + + No No L31 M.sub.3 + + + No No L40 M.sub.3 + + + No No L43 M.sub.3 + + + No No L44 M.sub.3 + + + No No L52 M.sub.3 + + + No No L53 M.sub.3 + + + No No L56 M.sub.3 + + + No No L62 M.sub.3 + + + No No L66 M.sub.3 + + + No No L71 M.sub.3 + + + No No L73 M.sub.3 + + + No No S2 M.sub.3 + + + No No S5 M.sub.3 + + + No No S10 M.sub.3 + + + No No S14 M.sub.3 + + + No No S19 M.sub.3 + + + No No S20 M.sub.3 + + + No No S3 M.sub.3 + + − No No L14 M.sub.3 + − − No No L42 M.sub.3 + − − No No L54 M.sub.3 + − − No No L55 M.sub.3 + − − No No L58 M.sub.3 + − − No No L72 M.sub.3 + − − No No L85 M.sub.3 + − − No No L86 M.sub.3 + − − No No S11 M.sub.3 + − − No No S13 M.sub.3 + − − No No S17 M.sub.3 + − − No No S22 M.sub.3 + − − No No G5 M.sub.4 − − − No No L32 M.sub.3 − − − No No L63 M.sub.3 − − − No No L69 M.sub.3 − − − No No L89 M.sub.3 − − − No No S6 M.sub.3 − − − No No S7 M.sub.3 − − − No No S9 M.sub.3 − − − No No S25 M.sub.3 − − − No No .sup.1The table describes the deletion and point mutation of three genes in Yr4DS region. ACTIN gene is used as an internal reference to evaluate the quality of DNA samples. The amplified primers include RLK1(RLK1-FP1 and RLK1-RP1), RLK2(RLK2-FP1 and RLK2-RP1), Yr4DS(YR4DS-FP5 and YR4DS-RP5) and ACTIN(Actin-FP and Actin-RP). “+” means positive PCR amplification; “−” means negative PCR amplification, reflecting the deletion of the whole or part of the target gene. The RLK2 and Yr4DS genes carried by the plants with positive target gene amplification were sequenced, there is no base mutation in the coding sequence of RLK2 gene of all individuals, but there is a base mutation in the coding sequence of Yr4DS gene. .sup.2The left letter is the base of disease-resistant Yr4DS gene, the middle number represents the base position of cDNA level relative to the start codon ATG, and the right letter is the base after mutation. .sup.3The left letter is the corresponding amino acid in the disease-resistant Yr4DS protein, the middle number represents the position relative to the first amino acid, and the right letter is the mutated amino acid.
TABLE-US-00003 TABLE 3 effect of different target gene expression on stripe rust resistance level of transgenic plants Carrier (enzyme Independent digestion transgenic Stripe rust Classification treatment) .sup.1 line.sup.2 RLK1 RLK2 Yr4DS reaction G1 PC1104 (I) 2 + 3 + + + Disease- resistant G2 PC1104 (X1) 1 + + − susceptible G3 PC1104 (I) 1 − + + Disease- resistant G4 PC1104 (X1, XK1) 2 + − − susceptible G5 PC1104 (B1, N1, XK1) 5 − + − susceptible G6 PC1104 (B1, N1, X1) 7 + 2 − − − susceptible .sup.1Firstly, the plasmid PC1104 was digested with restriction enzymes, and then used for the transformation of wheat and barley. The restriction enzyme digestion treatment of the plasmid includes: non-restriction digestion (Intact = I), BsrGI digestion (B1), NotI digestion (1), XbaI digestion (X1), and XbaI + KpnI double digestion (XK1). The role of each gene in resistance to stripe rust is determined by detecting the expression of three genes in the Yr4DS region and the resistance to stripe rust of transgenic plants. The amplified primers include RLK1 (first round primers RPK1-FP1 and RLK1-RP2, second round primers RPK1-FP3 and RLK1-RP3), RLK2 (first round primers RPK2-FP2 and RLK2-RP2, second round primers RPK2-FP3 and RLK2-RP3), Yr4DS (TV1 first round primers YR4DS-FP6 and YR4DS-RP6, TV1 second round primers YR4DS-FP7 and YR4DS-RP7; TV4 first round primers YR4DS-FP8 and YR4DS-RP3, TV4 second round primers YR4DS-FP9 and YR4DS-RP9) and ACTIN (single round primers Actin-FP and Actin-RP). “+” represents expression; represents non expression. .sup.2For double numbers, the number before plus sign represents the number of independent transgenic lines of wheat, and the number behind plus sign represents the number of independent transgenic lines of barley. For a single number, it only represents the number of independent transgenic lines of wheat.
Embodiment 1: Transcriptomics is Used to Identify the Genes Specifically Expressed in Stripe Rust Resistant Parents and BSA Pool
[0078] In the present invention, RNA sequencing (RNA-seq) and Bulked Segregant Analysis (BSA) are used to compare the leaf transcriptome of the stripe rust resistant BSA pool and the stripe rust susceptible BSA pool of the F.sub.6 generation of the Aegilops tauschii isolated population at the adult stage. RNA sequencing uses high-throughput sequencing technology to directly determine the sample cDNA molecules. In the present invention, RNA sequencing is used to compare the transcriptome of leaves in adult stage of BSA disease-resistant pool (Rpool) and BSA susceptible pool (Spool), wherein the Rpool is composed of stripe rust resistant Aegilops tauschii parent PI511383, stripe rust susceptible Aegilops tauschii parent PI486274 and 12 stripe rust-resistant strains in F.sub.6 generation homozygous strains derived from stripe rust resistant Aegilops tauschii parent PI511383 and stripe rust susceptible Aegilops tauschii parent PI486274, the Spool is composed of 11 stripe rust susceptible strains. A biological repeat is determined separately for different samples. Total RNA is extracted by TRIzol reagent and related methods (Life Technologies, Grand Island, N.Y., USA). The library construction (preferably about 500 bp mRNA fragments) and high-throughput double-ended sequencing (HiSeq 2500, Illumina, San Diego, Calif., USA; paired-end, PE125) involved in RNA sequencing are undertaken by Berry Genomics Company, Beijing, China.
[0079] For the original data of RNA-seq, firstly, the adapter information, low-quality bases (bases with Q value ≤3, accounting for more than 50% of the whole read) and undetected bases (the ratio of N is more than 3%) are eliminated to obtain valid data; using Trinity software (Haas et al. 2013. Nature Protocols 8:1494-1512) to assemble effective data from scratch. By comparing the leaf transcriptome data of PI511383, PI486274, Rpool and Spool, it is found that individual genes are only expressed in stripe rust resistant parents PI511383 and Rpool. According to the present invention, an unknown gene is identified, the sequence of which is shown as SEQ ID NO.1, SEQ ID NO.3, SEQ ID NO.5, SEQ ID NO.7, SEQ ID NO.9 or SEQ ID NO.10; with primer combination Yr4DS-FP4/Yr4DS-RP4, it is detected that the gene is expressed in resistant parents PI511383 and resistant pool, but not expressed in susceptible parent PI486274 and susceptible pool (Figure. 2). Inventors predict that the gene (such as SEQ ID NO.1, SEQ ID NO.3, SEQ ID NO.5, SEQ ID NO.7, SEQ ID NO.9 or SEQ ID NO.10) may affect the resistance level of Aegilops tauschii to wheat stripe rust. By comparing the genome sequences of Aegilops tauschii, it is found that the gene is located on chromosome 4DS (http://aegilops.wheat.ucdavis.edu/ATGSP/blast.php). The present invention temporarily named the gene as Yellow rust resistance gene 4DS(Yr4DS), and carried out functional research around the gene.
Embodiment 2: Verification of Full-Length cDNA of Yr4DS Gene of Aegilops tauschii
[0080] In order to verify the full-length cDNA of Yr4DS gene, TRIzol reagent was used to extract the total RNA of leaf of Aegilops tauschii PI511383 after 10 days of inoculation with stripe rust, and then the cDNA template was prepared by the RevertAid Frist Strand cDNA Synthesis kit (Thermo Scientific, Waltham, Mass., USA). The 5′ and 3′ ends of the full-length cDNA of Yr4DS gene (SEQ ID NO.1 and 3) were isolated by rapid amplification of cDNA ends (RACE) and the SMARTer RACE cDNA Amplification kit (Clontech Laboratories, Mountain View, Calif., USA) was used, and the operation method was according to the kit instructions. The nested primers of 5′-end RACE PCR were Yr4DS-RP10 and Yr4DS-RP11, in which Yr4DS-RP11 was the nested primer of Yr4DS-RP10. The gene had two 3′ ends, and the nested primers of the first 3′ end RACE PCR were Yr4DS-FP10 and Yr4DS-FP11, in which Yr4DS-FP11 was the nested primer of Yr4DS-FP10. The nested primers of the second 3′ end RACE PCR were Yr4DS-FP12 and Yr4DS-FP13, in which Yr4DS-FP13 was the nested primer of Yr4DS-FP12. Sequencing the RACE PCR products confirmed the integrity of both ends of the full-length cDNA sequence (such as SEQ ID NO.1, SEQ ID NO.3, SEQ ID NO.5 or SEQ ID NO.7) of Yr4DS gene, which indicated that RNA sequencing and sequence assembly were highly reliable. The full-length cDNA TV1 (SEQ ID NO.1) of Yr4DS gene was 4,266 bp in total, including an open reading frame (ORF) of 3,207 bp; there was one in-frame stop codon at the position 30 bp upstream of the start codon, indicating the current prediction ORF was reliable and representing an isoform of Yr4DS protein. The full-length cDNA TV2a (SEQ ID NO.3) of the Yr4DS gene was 3,477 bp in total and contains an ORF of 1,277 bp, representing another isoform of the Yr4DS protein. The full-length cDNA TV3 (SEQ ID NO.5) of the Yr4DS gene was 2,853 bp in total and contains an ORF of 1,488 bp, representing the third isoform of the Yr4DS protein. The full-length cDNA TV4 (SEQ ID NO.7) of Yr4DS gene was 2,609 bp in total and contains an ORF of 1,416 bp, representing the fourth isoform of Yr4DS protein.
Embodiment 3: Construction and Screening of Fosmid Library of ‘PI511383’ Genome
[0081] The Fosmid library of PI511383 genomic DNA is created for the convenience of cloning genomic DNA, and the construction method referred to published literature (Jetty. 2005. Theor Appl Genet111: 1596-1607). Firstly, genomic DNA with high-molecular weight (HMW) was extracted from leaves of PI511383, and the genomic DNA with high-molecular weight was randomly “cut” into fragments with different sizes by repeated freezing and thawing (liquid nitrogen/45° C., 20-30 times). 1% agarose gel and pulsed-field gel electrophoresis (PFGE) free DNA fragment products were used to purify DNA fragments between 36-60 kb. Complement the DNA fragment with terminal repair enzyme, repeat pulsed-field gel electrophoresis and fragment purification steps, and clone the DNA fragment obtained by twice purification into Fosmid carrier pCC1FOS; after packed with phage extract, the host bacteria EPI300-T1R strain cells were infected. The host bacteria infected with phage was coated on LB plate containing 12.5 ug ml.sup.−1 chloramphenicol, cultured overnight at 37° C., and Fosmid clones on the plate were collected.
[0082] The Fosmid library of PI511383 genome contains about 1 million clones and is stored in 622 super pools. According to the randomly selected 120 Fosmid clones, the library quality is tested, and the empty rate of the library is 0, the monoclonal average insert fragment is 35 kb, covering about 8.2 times of the whole genome of Aegilops tauschii (calculated by 4.3 Gb). To obtain Fosmid clone carrying Yr4DS gene, several sets of PCR primers are designed according to The full-length cDNA TV1 (SEQ ID NO.1) of Yr4DS gene and reference sequence of Aegilops tauschii genome, the amplification effect of different primer combinations on Aegilops tauschii genome DNA is tested, and two pairs of primer combinations for library screening are determined: Yr4DS-FP1/Yr4DS-RP1 and Yr4DS-FP14/Yr4DS-RP14. A 727 bp band is amplified by Yr4DS-FP1/Yr4DS-RP1 from the Aegilops tauschii Clae9 and PI511383 resistant to stripe rust (
[0083] With Yr4DS-PM labeling, 622 super pools of PI511383 Fosmid library are screened by bacterial liquid PCR. Firstly, the super pool where the positive Fosmid monoclonal is located is confirmed, and then the positive Fosmid monoclonal is obtained by dilution screening step by step, and a total of 10 independent monoclonal antibodies are screened. Then, the primer Yr4DS-FP15/YR4DS-RP15 of YR4DS gene is used for further screening to obtain 8 independent monoclonal antibodies. Clone F2-1 (i.e., plasmid PC1104) carries an insert fragment of 39,535 bp (SEQ ID NO.10;
Embodiment 4: Creation of EMS Mutant Group of ‘Synthetic Wheat’
[0084] In order to confirm the function of the disease-resistant Yr4DS gene, the synthetic wheat Syn-SAU-93(AS2382/AS2388) was treated with the chemical mutagen ethyl methane sulfonate (EMS) aqueous solution (Zhang et al. 2010. Euphytica 172: 285-294). The previous results showed that AS2388 and PI511383 carry the same disease resistance gene (Liu et al. 2013. Crop Science 53: 2014-2020); actually, their Yr4DS gene sequences (such as SEQ ID NO.1, SEQ ID NO.3, SEQ ID NO.5, SEQ ID NO.7, SEQ ID NO.9 or SEQ ID NO.10) were identical. The mutant population was created as follows: a total of 1,850 seeds are treated, 200 seeds per 100 ml of EMS water solution (78 mM) were treated, placed on a horizontal shaker for 12 hours (150 rpm, 25° C.), and then washed with water for 12 hours at room temperature; the washed seeds were simply dried by airing and then sown to the experimental field of the Wheat Research Institute of Sichuan Agricultural University, and a total of 613 M.sub.2 strains were obtained.
Embodiment 5: Screening the Mutant Population of Synthetic Wheat and Confirming the Mutation and Function of Yr4DS and Other Genes
[0085] M.sub.3 or M.sub.3 seeds derived from all M.sub.2 strains were mixed and planted in the experimental field of Wheat Research Institute of Sichuan Agricultural University, and the current popular stripe rust mixed physiological races, including CYR30, CYR31, CYR32, CYR33, CYR34, Gui 22-1, SY11-4 and HY46-8, were used for inoculation at seedling stage; and identification of synthetic wheat mutants susceptible to stripe rust was carried out after the full incidence of the susceptible control. The genomic DNA of susceptible plants was extracted with Sodium lauroylsarcosinate (Sarkosyl) method (Yuan et al. 2012. Journal of Genetics and Genomics 39: 587-592), and the DNA concentration was determined by NanoDrop™ One ultramicro spectrophotometer (Thermo Fisher Scientific, Madison, Wis., USA), and adjusted uniformly to 100 ng ul.sup.−1. By using PCR amplification technology, Yr4DS gene was cloned by using mutant DNA with high susceptibility to stripe rust as template. The 3,956 bp region in the Yr4DS gene is divided into three amplifications: the first segment uses PCR primers Yr4DS-FP16 and Yr4DS-RP16, the second segment uses PCR primers Yr4DS-FP17 and Yr4DS-RP17, and the third segment uses PCR primers Yr4DS-FP5 and Yr4DS-RP5; the PCR reaction conditions are as follows: initial denaturation 94° C., 3 min, 10 cycles (denaturation 94° C., 30 sec; annealing at 65° C. each cycle drops 0.5° C., 30 sec; and the extension is 72° C., 105 sec); 28 cycles (denaturation 94° C., 30 sec; annealing 60° C., 30 sec; extension 72° C., 105 sec), and the final extension is 72° C., 6 min. In addition, the variations of RLK1 and RLK2 genes close to Yr4DS in mutants with high susceptibility to stripe rust were detected, and PCR primers RLK1-FP1 and RLK1-RP1, RLK1-FP4 and RLK1-RP4, RLK2-FP4 and RLK2-RP1 were used (Table 1). PCR amplification products were commissioned to Sangon Biotech (Shanghai)(Sangon Biotech, Chengdu, China) for sequencing.
[0086] In M.sub.3 or M.sub.4 mixed generation, 60 synthetic wheat plants with high susceptibility to wheat stripe rust were detected (Table 2,
[0087] For the 38 mutant plants with high susceptibility to stripe rust without deletion of Yr4DS gene, 10 of them had point mutation of Yr4DS gene, which caused single amino acid change or early termination of protein translation. According to other people's research, when 0.8% EMS (or 78 mM) is used to treat common wheat, the average step size of point mutation in each mutant is about 30 kb (Krasileva et al. 2017. PNAS 114: E913-921). Assuming that the Yr4DS gene has nothing to do with wheat resistance to stripe rust (H.sub.0 hypothesis), in the remaining 38 individuals highly susceptible to stripe rust, theoretically 5 (=38×3.956÷30; Yr4DS gene detection region is 3,956 bp) strains of Yr4DS gene mutation will be found, and the other 33 strains did not have mutations in the detected segment of the Yr4DS gene. In reality, among 38 individuals with high susceptibility to stripe rust, 28 plants did not find the effective point mutation of Yr4DS gene, but the other 10 plants had the effective point mutation of Yr4DS gene. Based on this, a chi-square goodness-of-fit test was carried out (ω.sup.2=5.8, df=1, P=0.016), and the H.sub.0 hypothesis was overturned at the significance level of α=0.05. Therefore, the Yr4DS gene affects the resistance level of Aegilops tauschii to stripe rust. In addition, the RLK2 gene in highly susceptible stripe rust mutants was also determined, which was located less than 3 kb away from the centromere of Yr4DS gene, but no effective point mutation was found. In contrast, the mutation frequency of Yr4DS gene was 26.3% in mutants with Yr4DS gene but high susceptibility to stripe rust. It can be seen that the Yr4DS gene affects the resistance level of Aegilops tauschii to stripe rust.
Embodiment 6: Acquisition, Phenotypic Analysis and Molecular Verification of Transgenic Wheat and Barley
[0088] In order to carry out the genetic complementary experiment of wheat, the genetic transformation of Fosmid F2-1 (or plasmid PC1104 with insertion sequence of SEQ ID No.10;
[0089] Wheat immature embryo culture and transformation by biolistics bombardment refer to the procedure of Lv et al (Lv et al. 2014. PLoS ONE 9:e94171). Wherein, the carrier PC1104 of Yr4DS gene and the co-transformation carrier PC174 are mixed in a molar ratio of 3:1. The present invention selects wheat ‘CB037’ and barley ‘Golden Promise’ which can be infected with stripe rust as the transformation recipients. For wheat transformation, the immature embryos about 7-14 d after flowering were sterilized on the surface of the immature embryos. Firstly, treated with 70% alcohol (containing 0.05% Tween-20) for 5 minutes, and then treated with 20% Clorox's bleaching solution (Clorox® Regular Bleach, Oakland, Calif., USA; additional 0.05% tween-20 was added) for 15 min, and finally rinsed with sterilized water for 3-5 times. Peel off immature embryos (the length of immature embryos is 1-1.5 mm) on an ultra-clean table, and placed the scutellum upward on the induction medium (MS basic medium 4.3gL.sup.−1, maltose 40gL.sup.−1, vitamin B.sub.1 0.5 mgL.sup.−1, aspartic acid 0.15gL.sup.−1, 2,4-D 2 mgL.sup.−1, copper sulfate 0.78 mgL.sup.−1, phytagel 2.5gL.sup.−1, pH 5.8), cultured in dark at 22-23° C. for 4-6 d. The immature embryos were transferred to hypertonic medium (i.e., induction medium+sucrose 171.15gL.sup.−1, pH 5.8) and treated for 4 h, followed by biolistics bombardment. After the bombardment treatment for 20 h, the immature embryos were transferred to a recovery medium (equivalent to an induction medium) and cultured in the dark at 22-23° C. for 2 wk. Transfer embryogenic callus derived from immature embryos to differentiation medium (ie, induction medium+6-benzylaminopurine 0.1 mgL.sup.−1+bialaphos 3 mgL.sup.−1, pH 5.8), cultured for 2 wk at 22-23° C. and 16 h light (25 μmolm.sup.−2s.sup.−1). Transfer the differentiated regenerated seedlings (height 2-3 cm) to rooting medium (MS basic medium 2.15gL.sup.−1, maltose 20gL.sup.−1, vitamin B.sub.1 0.25 mgL.sup.−1, aspartic acid 0.075gL.sup.−1, 2, 4-D 1 mgL.sup.−1, copper sulfate 0.39 mgL.sup.−1, phytagel 2.5gL.sup.−1, bialaphos 3 mgL.sup.−1, pH 5.8), and cultured under the same environmental conditions. After the roots of the regenerated seedlings are fully developed, converted to potted plants and planted under greenhouse conditions.
[0090] PDS-1000/He tabletop gene gun (Bio-Rad Laboratories, Hercules, Calif., USA) was used for bombardment treatment. The preparation steps for bombarding the particle mixture are as follows: add 2 mg gold powder (diameter 0.6 μm) into a 1.5 ml silicified centrifuge tube, then add 35 μl absolute ethyl alcohol, shake and mix well, centrifuge and collect (12,000 rpm, 5 sec), and discard the supernatant; add 200 μl sterilized water precooled by ice, shake and mix well, centrifuge and collect (12,000 rpm, 5 sec), and discard the supernatant; adding 20 μg plasmid DNA (the concentration is about 1 μgμl.sup.−1), then add the sterilized water precooled by ice to 245 μl, shake and mix well; then add 250 μl calcium chloride precooled by ice (2.5M), shake and mix well; at last, add 50 μl spermidine (1.45%, v/v), shake at 4° C. for 15-20 min, centrifuge and collect (12,000 rpm, 10 sec), and discard the supernatant; and then add 36 μl absolute ethanol precooled by ice, shake and mix well. 10 μl gold powder and DNA suspension were sucked into the center of the carrier film, and after aseptic air drying, the carrier film (with gold powder side down) is placed into the microcarrier launch assembly, which is located 3 cm below the splittable film (1,100 psi). Place the bombarded callus on a hypertonic medium (area with a diameter of about 3.5 cm), and then place it 6 cm below the carrier membrane. The use of PDS-1000/He gene gun refers to the instrument manual, and the bombardment parameters are 1,300 psi (bombardment pressure) and 25 mm Hg (vacuum degree).
[0091] In the present invention, a total of 8,380 wheat immature embryos were bombarded (including 1,590 immature embryos which were not treated with enzyme-digested PC1104 plasmid and 6,790 immature embryos which were treated with enzyme-digested PC1104 plasmid), and 222 strains from 170 immature embryos were successfully obtained through tissue culture, screening and transplanting. PCR primers were used to detect the integration of RLK1(RLK1-FP5 and RLK1-RP5), RLK2(RLK2-FP3 and RLK2-RP4) and Yr4DS(YR4DS-FP1 and YR4DS-RP1, YR4DS-FP3 and YR4DS-RP3) in 222 strains. Furthermore, RT-PCR primers, RLK1 (first round primers RLK1-FP1 and RLK1-RP2; second round primers RLK1-FP3 and RLK1-RP3), RLK2(first round primers RLK2-FP2 and RLK2-RP2; second round primers RLK2-FP3 and RLK2-RP3) and Yr4DS (TV1 first round primers YR4DS-FP6 and YR4DS-RP6, second round primers YR4DS-FP7 and YR4DS-RP7; TV4 first round primers YR4DS-FP8 and YR4DS-RP3, second round primers YR4DS-FP9 and YR4DS-RP9) were used to confirm the expression of each target gene (see Table 3,
[0092] The PC1104 plasmid without enzyme digestion was co-transformed in barley, and the transformation steps were similar to those in wheat, but the methods of Hao et al. (Hao et al. 2018. Molecular Plant Pathology 19:1995-2010) were used for tissue culture, regeneration and screening. After biolistics bombardment, the treated immature embryos were transferred to the induction screening medium and cultured in the dark at 24° C. for 14 d; transferring the differentiated callus immature embryos to the induction screening medium, performing subculture screening culture, and culturing in the dark at 24° C. for 14 d; the bright yellow embryogenic callus were selected and transferred into the induction and screening medium for subculture and screening, and cultured in darkness at 24° C. for 14 d; the vigorous callus were transferred to the transition medium to induce callus differentiation and regeneration, after 5-10 d of culture, green buds could be regenerated, the culture conditions was 24° C., weak light, and light intensity was 2 μmol m.sup.−2 s.sup.−1; after 14 d, the callus was transferred to regeneration medium, and the culture conditions was 24° C., 16 h light/8 h dark, and the light intensity was 35 μmol m.sup.−2 s.sup.−1; after about 14 d, the strong regenerated seedlings were transferred to rooting medium, and the culture conditions are the same as the previous step; transplanting the regenerated seedlings to the greenhouse for planting after the roots of the regenerated seedlings develop well.
[0093] The various media used in barley tissue culture are as follows: a) the medium for induction includes MS salt 4.3 g L.sup.−1, maltose 30 g L.sup.−1, casein enzymatic hydrolysate 1 g L.sup.−1, solution A 10 mL L.sup.−1, phytagel 3.5 g L.sup.−1, pH=5.8, hygromycin 25 mg L.sup.−1 was added after autoclaving (121° C., 15 min); b) transition medium includes MS salt 2.7 g L.sup.−1, maltose 20 g L.sup.−1, glutamic acid 0.75 g L.sup.−1, solution B 5 mL L.sup.−1, phytagel 3.5 g L.sup.−1, pH=5.8, and hygromycin 25 mg L.sup.−1, 2,4-D 2.5 mg L.sup.−1 and 6BA 0.1 mg L.sup.−1 were added after autoclaving; c) the regeneration medium includes MS salt 2.7 g L.sup.−1, maltose 20 g L.sup.−1, glutamic acid 0.75 g L.sup.−1, solution B 5 mL L.sup.−1, phytagel 3.5 g L.sup.−1, pH=5.8, and hygromycin 25 mg L.sup.−1 was added after autoclaving; d) rooting medium includes MS salt 4.3 g L.sup.−1, maltose 30 g L.sup.−1, casein enzymatic hydrolysate 1 g L.sup.−1, solution A 10 mL L.sup.−1, phytagel 3.5 g L.sup.−1, pH=5.8, and hygromycin 25 mg L.sup.−1 was added after autoclaving. Solution A is inositol 35 g L.sup.−1, proline 69 g L.sup.−1, copper sulfate 0.12 g L.sup.−1, VB1 0.1 g L.sup.−1, pH=5.8. Solution B is ammonium nitrate 33 g L.sup.−1, inositol 20 g L.sup.−1, VB1 0.08 g L.sup.−1, pH=5.8.
[0094] In the present invention, 2,200 barley immature embryos were bombarded, and 540 strains from 300 immature embryos were successfully obtained through tissue culture, screening and transplanting. The integration and expression of RLK1, RLK2 and Yr4DS in 540 strains were detected by PCR primers introduced from wheat (see Table 3,
[0095] In summary, the expression of Yr4DS genome full-length expression framework (SEQ ID NO.10) provides high resistance to stripe rust in wheat and barley, and transforms susceptible wheat and barley into stripe rust resistant wheat and barley, respectively. Thus, introducing the full-length expression framework of Yr4DS genome (SEQ ID NO.10) into wheat and other triticeae plants can create plants with high resistance to stripe rust, which will play a role in breeding wheat and other triticeae plants with resistance to stripe rust.
[0096] The above are only preferred embodiments of the application, and are not used to limit the application, and for those skilled in the art, the application can be variously modified and varied. Any modification, equivalent substitution, improvement and the like made within the spirit and principle of the application shall be included in the protection scope of the application.