OLIGONUCLEOTIDE THERAPY FOR WOLMAN DISEASE AND CHOLESTERYL ESTER STORAGE DISEASE

Abstract

The present disclosure provides antisense oligonucleotides, compositions, and methods that target a LIPA intron flanking exon 8, thereby modulating splicing of LIPA pre-mRNA to increase the level of LIPA mRNA molecules having exon 8, e.g., to provide a therapy for Wolman Disease or Cholesteryl Ester Storage Disease. The present disclosure provides an antisense oligonucleotide including a nucleobase sequence at least 70% complementary to a LIPA pre-mRNA target sequence in a 5′-flanking intron, a 3′-flanking intron, or a combination of exon 8 and the 5′-flanking or 3′-flanking intron.

Claims

1. An antisense oligonucleotide comprising a targeting moiety covalently linked to a nucleobase sequence at least 70% complementary to a LIPA pre-mRNA target sequence in a 5′-flanking intron, a 3′-flanking intron, or a combination of an exon and the 5′-flanking or 3′-flanking intron.

2. The antisense oligonucleotide of claim 1, wherein the antisense oligonucleotide comprises at least 12 nucleosides.

3. The antisense oligonucleotide of claim 2, wherein the antisense oligonucleotide comprises at least 16 nucleosides.

4. The antisense oligonucleotide of any one of claims 1 to 3, wherein the antisense oligonucleotide comprises a total of 50 nucleosides or fewer.

5. The antisense oligonucleotide of any one of claims 1 to 3, wherein the antisense oligonucleotide comprises a total of 30 nucleosides or fewer.

6. The antisense oligonucleotide of any one of claims 1 to 3, wherein the antisense oligonucleotide comprises a total of 20 nucleosides or fewer.

7. The antisense oligonucleotide of any one of claims 1 to 3, wherein the antisense oligonucleotide comprises a total of 16 to 20 nucleosides.

8. An antisense oligonucleotide comprising a total of 20 to 30 nucleosides in a nucleobase sequence at least 70% complementary to a LIPA pre-mRNA target sequence in a 5′-flanking intron, a 3′-flanking intron, or a combination of an exon and the 5′-flanking or 3′-flanking intron.

9. The antisense oligonucleotide of any one of claims 1 to 8, wherein the LIPA target sequence is in a 5′-flanking intron adjacent to exon 8, 3′-flanking intron adjacent to exon 8, or a combination of exon 8 and the adjacent 5′-flanking or 3′-flanking intron.

10. The antisense oligonucleotide of any one of claims 1 to 8, wherein the LIPA target sequence reduces the binding of a splicing factor to an intronic splicing silencer in the 5′-flanking or 3′-flanking intron.

11. The antisense oligonucleotide of any one of claims 1 to 8, wherein the LIPA target sequence comprises at least one nucleotide located among positions 34222-34321 in SEQ ID NO: 1.

12. The antisense oligonucleotide of any one of claims 1 to 8, wherein the LIPA target sequence comprises at least one nucleotide located among positions 34394-34493 in SEQ ID NO: 1.

13. The antisense oligonucleotide of any one of claims 1 to 8, wherein the LIPA target sequence comprises at least one nucleotide located among positions 34398-34480 in SEQ ID NO: 1.

14. The antisense oligonucleotide of any one of claims 1 to 8, wherein the LIPA target sequence comprises at least one nucleotide located among positions 34401-34422 in SEQ ID NO: 1.

15. The antisense oligonucleotide of any one of claims 1 to 8, wherein the LIPA target sequence comprises at least one nucleotide located among positions 34456-34473 in SEQ ID NO: 1.

16. The antisense oligonucleotide of any one of claims 1 to 8, wherein the nucleobase sequence is complementary to a sequence within the 5′-flanking intron of the pre-mRNA.

17. The antisense oligonucleotide of any one of claims 1 to 8, wherein the LIPA target sequence is located within the 5′-flanking intron among positions up to 34321 in SEQ ID NO: 1.

18. The antisense oligonucleotide of any one of claims 1 to 7, wherein the nucleobase sequence has at least 70% sequence identity to SEQ ID NO: 68, 81, or 98.

19. The antisense oligonucleotide of any one of claims 1 to 8, wherein the LIPA target sequence is located within the 3′-flanking intron of the pre-mRNA.

20. The antisense oligonucleotide of any one of claims 1 to 8, wherein the LIPA target sequence is located within the 3′-flanking intron among positions up to 34500 in SEQ ID NO: 1.

21. The antisense oligonucleotide of any one of claims 1 to 7, wherein the nucleobase sequence has at least 70% sequence identity to any one of SEQ ID NOs: 7, 9-15, 22-26, 29, 32, 34-41, 45-49, 51, 54, 56-60, 62-64, 67, 70-72, 74-80, 83-86, 88 and 89.

22. The antisense oligonucleotide of any one of claims 1 to 8, wherein the LIPA target sequence is located among positions 34394 to 34498 in SEQ ID NO: 1.

23. The antisense oligonucleotide of any one of claims 1 to 7, wherein the nucleobase sequence has at least 70% sequence identity to SEQ ID NO: 7, 9, 12, 13, 15, 22, 23, 24, 25, 26, 32, 34, 35, 36, 38, 39, 40, 41, 45, 47, 48, 49, 51, 54, 56, 57, 58, 59, 62, 63, 64, 70, 71, 74, 75, 76, 77, 78, 79, 80, 83, 84, 85, 86, 88, or 89.

24. The antisense oligonucleotide of any one of claims 1 to 7, wherein the nucleobase sequence has at least 70% sequence identity to SEQ ID NO: 84.

25. The antisense oligonucleotide of any one of claims 1 to 7, wherein the nucleobase sequence has at least 70% sequence identity to SEQ ID NO: 26.

26. The antisense oligonucleotide of any one of claims 1 to 7, wherein the nucleobase sequence has at least 70% sequence identity to SEQ ID NO: 22.

27. The antisense oligonucleotide of any one of claims 1 to 7, wherein the nucleobase sequence has at least 70% sequence identity to SEQ ID NO: 85.

28. The antisense oligonucleotide of any one of claims 1 to 7, wherein the nucleobase sequence has at least 70% sequence identity to SEQ ID NO: 76.

29. The antisense oligonucleotide of any one of claims 1 to 7, wherein the nucleobase sequence has at least 70% sequence identity to SEQ ID NO: 41.

30. The antisense oligonucleotide of any one of claims 1 to 7, wherein the nucleobase sequence has at least 70% sequence identity to SEQ ID NO: 56.

31. The antisense oligonucleotide of any one of claims 1 to 7, wherein the nucleobase sequence has at least 70% sequence identity to SEQ ID NO: 23.

32. The antisense oligonucleotide of any one of claims 1 to 7, wherein the nucleobase sequence has at least 70% sequence identity to SEQ ID NO: 79.

33. The antisense oligonucleotide of any one of claims 1 to 7, wherein the nucleobase sequence has at least 70% sequence identity to SEQ ID NO: 59.

34. The antisense oligonucleotide of any one of claims 1 to 7, wherein the nucleobase sequence has at least 70% sequence identity to SEQ ID NO: 58.

35. The antisense oligonucleotide of any one of claims 1 to 7, wherein the nucleobase sequence has at least 70% sequence identity to SEQ ID NO: 34.

36. The antisense oligonucleotide of any one of claims 1 to 7, wherein the nucleobase sequence has at least 70% sequence identity to SEQ ID NO: 54.

37. The antisense oligonucleotide of claim 12, 19, 20, 21, or 22, wherein the 5′-terminal nucleotide of the oligonucleotide is complementary to the LIPA pre-mRNA at any one position selected from the group consisting of 34394-34398 in SEQ ID NO: 1.

38. The antisense oligonucleotide of any one of claims 1 to 7, wherein the nucleobase sequence has at least 70% sequence identity to any one of SEQ ID NOs: 7, 22, 23, 24, 26, 32, 34, 38, 41, 49, 56, 58, 59, 63, 70, 71, 75, 76, 79, 80, 84, 85, 86, and 88.

39. The antisense oligonucleotide of any one of claims 1 to 38, wherein the sequence identity is at least 90%.

40. The antisense oligonucleotide of claim 39, wherein the sequence identity is 100%.

41. The antisense oligonucleotide of any one of claims 1 to 40, wherein the antisense oligonucleotide comprises at least one modified nucleobase.

42. The antisense oligonucleotide of any one of claims 1 to 41, wherein the antisense oligonucleotide comprises at least one modified internucleoside linkage.

43. The antisense oligonucleotide of claim 42, wherein the modified internucleoside linkage is a phosphorothioate linkage.

44. The antisense oligonucleotide of claim 42, wherein the phosphorothioate linkage is a stereochemically enriched phosphorothioate linkage.

45. The antisense oligonucleotide of any one of claims 42 to 44, wherein at least 50% of internucleoside linkages in the antisense oligonucleotide are independently the modified internucleoside linkage.

46. The antisense oligonucleotide of claim 45, wherein at least 70% of internucleoside linkages in the antisense oligonucleotide are independently the modified internucleoside linkage.

47. The antisense oligonucleotide of claim 46, wherein all internucleoside linkages in the antisense oligonucleotide are independently the modified internucleoside linkage.

48. The antisense oligonucleotide of any one of claims 1 to 47, wherein the antisense oligonucleotide comprises at least one modified sugar nucleoside.

49. The antisense oligonucleotide of claim 48, wherein at least one modified sugar nucleoside is a 2′-modified sugar nucleoside.

50. The antisense oligonucleotide of claim 49, wherein at least one 2′-modified sugar nucleoside comprises a 2′-modification selected from the group consisting of 2′-fluoro, 2′-methoxy, and 2′-methoxyethoxy.

51. The antisense oligonucleotide of claim 50, wherein the 2′-modified sugar nucleoside comprises the 2′-methoxyethoxy modification.

52. The antisense oligonucleotide of any one of claims 48 to 51, wherein at least one modified sugar nucleoside is a bridged nucleic acid.

53. The antisense oligonucleotide of claim 52, wherein the bridged nucleic acid is a locked nucleic acid (LNA), ethylene-bridged nucleic acid (ENA), or cEt nucleic acid.

54. The antisense oligonucleotide of any one of claims 48 to 53, wherein all nucleosides in the antisense oligonucleotide are independently the modified sugar nucleosides.

55. The antisense oligonucleotide of any one of claims 1 to 41, wherein the antisense oligonucleotide is a morpholino oligomer.

56. The antisense oligonucleotide of any one of claims 1 to 55, wherein the targeting moiety is covalently conjugated at the 5′-terminus of the antisense oligonucleotide.

57. The antisense oligonucleotide of any one of claims 1 to 55, wherein the targeting moiety is covalently conjugated at the 3′-terminus of the antisense oligonucleotide.

58. The antisense oligonucleotide of any one of claims 1 to 55, wherein the targeting moiety is covalently conjugated at an internucleoside linkage of the antisense oligonucleotide.

59. The antisense oligonucleotide of any one of claims 1 to 58, wherein the targeting moiety is covalently conjugated through a linker.

60. The antisense oligonucleotide of claim 59, wherein the linker is a cleavable linker.

61. The antisense oligonucleotide of any one of claims 1 to 60, wherein the targeting moiety comprises N-acetylgalactosamine.

62. The antisense oligonucleotide of claim 61, wherein the targeting moiety is an N-acetylgalactosamine cluster.

63. The antisense oligonucleotide of claim 62, wherein the N-acetylgalactosamine cluster is of the following structure: ##STR00029## wherein each L is independently CO or CH.sub.2, each Z is independently CO or CH.sub.2, each n is independently 1 to 9, each m is independently 1 to 5, each o is independently 0 to 1, each p is independently 1 to 10, and each q is independently 1 to 10.

64. The antisense oligonucleotide of claim 63, wherein each L is CH.sub.2.

65. The antisense oligonucleotide of claim 63 or 64, wherein each Z is CO.

66. The antisense oligonucleotide of any one of claims 63 to 65, wherein each n is 5.

67. The antisense oligonucleotide of any one of claims 63 to 66, wherein each m is 2.

68. The antisense oligonucleotide of any one of claims 63 to 67, wherein each o is 1.

69. The antisense oligonucleotide of any one of claims 63 to 68, wherein each p is 2.

70. The antisense oligonucleotide of any one of claims 63 to 68, wherein each p is 3.

71. The antisense oligonucleotide of any one of claims 63 to 65, wherein each q is 4.

72. The antisense oligonucleotide of claim 63, wherein the N-acetylgalactosamine cluster is of the following structure: ##STR00030##

73. A pharmaceutical composition comprising the antisense oligonucleotide of any one of claims 1 to 72 and a pharmaceutically acceptable excipient.

74. A method of increasing the level of exon-containing LIPA mRNA molecules in a cell expressing an aberrant LIPA gene, the method comprising contacting the cell with the antisense oligonucleotide of any one of claims 1 to 72.

75. The method of claim 74, wherein the cell is in a subject.

76. The method of claim 75, wherein the cell is a hepatocyte.

77. The method of claim 75, wherein the cell is a Kupffer cell.

78. A method of treating Wolman Disease or Cholesteryl Ester Storage Disease in a subject having an aberrant LIPA gene, the method comprising administering a therapeutically effective amount of the antisense oligonucleotide of any one of claims 1 to 72 or the pharmaceutical composition of claim 73 to the subject in need thereof.

79. The method of claim 78, wherein the administering step is performed parenterally.

80. The method of claim 78 or 79, further comprising administering to the subject a therapeutically effective amount of a second therapy for Wolman Disease or Cholesteryl Ester Storage Disease.

81. The method of claim 80, wherein the second therapy is a recombinant lysosomal acid lipase or a statin or a salt thereof.

82. The method of claim 80, wherein the second therapy is a hematopoietic stem cell transplantation.

83. The method of any one of claims 76 to 82, wherein the therapeutically effective amount is 1 mg/kg to 10 mg/kg.

84. The method of any one of claims 76 to 83, wherein the antisense oligonucleotide or the pharmaceutical composition is administered from once monthly to once weekly.

85. The method of any one of claims 76 to 83, wherein the antisense oligonucleotide or the pharmaceutical composition is administered once weekly, biweekly, or monthly.

86. The method of any one of claims 74 to 85, wherein the aberrant LIPA gene is LIPA having a g.34393G>A mutation in SEQ ID NO: 1.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

[0140] FIGS. 1A and 1B show that the chr10:90982268:C:T [hg19/b37] variant reduces exon 8 inclusion in GM03111 fibroblasts. FIG. 1A is a schematic of the effect of the target variant on splicing of LIPA exon 8. FIG. 1B shows RT-PCR analysis in apparently healthy (GM00288 and GM09503) and LIPA-variant (GM03111 and GM00863) fibroblasts. Exon inclusion (165 bp) and exclusion (92 bp) products are indicated by arrows. 100 bp DNA ladder is shown for size reference.

[0141] FIG. 2 shows that LIPA enzyme activity is decreased in fibroblasts containing the LIPA variant c.894G>A (GM03111), measured by its ability to cleave of the fluorogenic substrate, 4-methylumberlliferyl oleate. Mean enzyme activity is presented in arbitrary units, error bars represent standard deviation in 2 technical replicates.

[0142] FIG. 3 shows representative capillary electrophoresis of RT-PCR products of GM03111 fibroblasts transfected with antisense oligonucleotides having the sequences set forth in SEQ ID Nos: 7, 3-14, 31-58, and 75-91. In FIG. 3, DG-FAM (Eurofins Genomics, Louisville, Ky.) refers to a conjugate of an M13 primer sequence and an FAM moiety used as an antisense oligonucleotide. The exon 8 inclusion band is at 165 bp and the exclusion band at 92 bp.

[0143] FIG. 4 shows viability of HepG2 cells transfected with antisense oligonucleotide compared to PSI in LIPA c.894G>A fibroblasts. In FIG. 4, each dot represents an antisense oligonucleotide identified by its SEQ ID NO.

[0144] FIG. 5 shows the rescue of LIPA enzyme activity in LIPA mutant fibroblasts by antisense oligonucleotide SEQ ID NO. 84. Error bars represent standard deviation in 4 replicates.

DETAILED DESCRIPTION

[0145] In general, the present invention provides antisense oligonucleotides, compositions, and methods that target a LIPA exon (e.g., exon 8) or a flanking intron. Surprisingly, the inventors have found that altering LIPA gene splicing to promote inclusion of an otherwise skipped exon (e.g., exon 8) in the transcript of splice variants (FIG. 1A) may be used to treat Wolman Disease or Cholesteryl Ester Storage Disease, and antisense oligonucleotides may be used to alter splicing of the LIPA gene to include the otherwise skipped exon (e.g., exon 8). The antisense oligonucleotides of the invention may modulate splicing of LIPA pre-mRNA to increase the level of LIPA mRNA molecules having the otherwise skipped exon (e.g., exon 8). Accordingly, the antisense oligonucleotides may be used to treat Wolman Disease or Cholesteryl Ester Storage Disease in a subject in need of a treatment therefor. Typically, an antisense oligonucleotide includes a nucleobase sequence at least 70% (e.g., at least 80%, at least 90%, at least 95%, or 100%) complementary to a LIPA pre-mRNA sequence in a 5′-flanking intron, a 3′-flanking intron, or a combination of an exon (e.g., exon 8) and a 5′-flanking or 3′-flanking intron (e.g., a 5′-flanking or 3′-flanking intron adjacent to exon 8).

[0146] Genetic variants may correspond to changes or modifications in transcription and/or splicing. RNA is initially transcribed from DNA as pre-mRNA, with protein-coding and 5′UTR/3′UTR exons separated by introns. Splicing generally refers to the molecular process, carried out by the spliceosome complexes that may remove introns and adjoins exons, producing a mature mRNA sequence, which is then scanned and translated to protein by the ribosome. The molecular reaction catalyzed by the spliceosome may comprise (i) nucleophilic attack of the branch site adenosine 2′0H onto the outmost base of the intronic donor dinucleotide, with consequent release of the outmost exonic donor base 3′OH; and (ii) nucleophilic attack of the exonic donor 3′OH onto the outmost exonic acceptor base, with consequent release of the intron lariat and the spliced exons.

[0147] Advantageously, the antisense oligonucleotides described herein may exhibit reduced or no toxicity. A combination of the targeting moiety, nucleobase sequence, nucleoside modifications, and/or internucleoside linkage modification may provide the reduced or no toxicity effect and/or enhance pharmacokinetics without sacrificing antisense activity. Without wishing to be bound by theory, favorable toxicity and pharmacokinetic properties of the antisense oligonucleotides described herein may be due to their efficient targeting to hepatocytes and/or Kupffer cells. The hepatocyte and/or Kupffer cell targeting efficiency may be measured using techniques and methods known in the art, e.g., an RNA in situ hybridization.

[0148] Splicing sequence changes can include the following categories: (a) alteration of a splice site (denominated canonical splice site) or exon recognition sequence required for the proper composition of a gene product, and (b) activation and utilization of an incorrect splice site (denominated cryptic splice site), or incorrect recognition of intronic sequence as an exon (denominated pseudo exon). Both (a) and (b) may result in the improper composition of a gene product. The splice site recognition signal may be required for spliceosome assembly and can comprise the following structures: (i) highly conserved intronic dinucleotide (AG, GT) immediately adjacent to the exon-intron boundary, and (ii) consensus sequence surrounding the intronic dinucleotide (often delimited to 3 exonic and 6 intronic nucleotides for the donor site, 3 exonic and 20 intronic nucleotides for the acceptor site) and branch site (variable position on the intronic acceptor side), both with lower conservation and more sequence variety.

[0149] In addition to splice site recognition, the exon recognition signal may comprise a plethora of motifs recognized by splicing factors and other RNA binding proteins, some of which may be ubiquitously expressed and some of which may be tissue specific. These motifs may be distributed over the exon body and in the proximal intronic sequence. The term “splicing enhancer” refers to motifs with positive effects (e.g., causing an increase) on exon inclusion, and the term “splicing silencer” refers to motifs with negative effects (e.g., causing a decrease) on exon inclusion. The exon recognition signal may be particularly important for correct splicing in the presence of weak consensus sequence. When a variant weakens the splice site recognition, the exon can be skipped and/or a nearby cryptic splice site which is already fairly strong can be used. In the presence of short introns, full intron retention is also a possible outcome. In particular, alteration of the intronic dinucleotide often results in splicing alteration, whereas consensus sequence alteration may be, on average, less impactful and more context-dependent. When the exon recognition signal is weakened, exon skipping may be a more likely outcome, but cryptic splice site use is also possible, especially in the presence of a very weak consensus sequence. Variants can also strengthen a weak cryptic splice site in proximity of the canonical splice site, and significantly increase its usage resulting in improper splicing and incorrect gene product (with effects including amino acid insertion/deletion, frameshift, and stop-gain).

[0150] Antisense oligonucleotides can be used to modulate gene splicing (e.g., by targeting splicing regulatory elements of the gene).

[0151] Antisense oligonucleotides may comprise splice-switching oligonucleotides (SSOs), which may modulate splicing by steric blockage preventing the spliceosome assembly or the binding of splicing factors and RNA binding proteins. Blocking binding of specific splicing factors or RNA binding proteins that have an inhibitory effect may be used to produce increased exon inclusion (e.g., exon 8 inclusion). Specific steric blocker antisense oligonucleotide chemistries may include the modified RNA chemistry with phosphorothioate backbone (PS) with a sugar modification (e.g., 2′-modification) and phosphorodiamidate morpholino (PMO). Exemplary PS backbone sugar modifications may include 2′-O-methyl (2′OMe) and 2′-O-methoxyethyl (2′-MOE), which is also known as 2′-methoxyethoxy. Other nucleotide modifications may be used, for example, for the full length of the oligonucleotide or for specific bases. The oligonucleotides can be covalently conjugated to a targeting moiety (e.g., a GaINAc cluster), or to a peptide (e.g., a cell penetrating peptide), or to another molecular or multimolecular group (e.g., a hydrophobic moiety or neutral polymer) different from the rest of the oligonucleotide. Antisense oligonucleotides may be used as a single stereoisomer or a combination of stereoisomers.

[0152] The LIPA gene (lipase A, lysosomal acid type, Entrez Gene ID 3988) may play an important role in the pathogenicity of Wolman Disease and Cholesteryl Ester Storage Disease. LIPA is a gene encoding a lysosomal enzyme required for the hydrolysis of cholesteryl esters and triglycerides, which are derived from the internalization of plasma lipoprotein particles (chylomicron remnants, LDL, IDL) by endocytosis. The gene may be expressed in liver hepatocytes. Defective hydrolysis of cholesteryl esters and triglycerides can lead to toxic effects in the liver. LIPA homozygous or compound heterozygous loss-of-function may result in the autosomal recessive Wolman Disease, partial loss-of-function may result in Cholesteryl Ester Storage Disease.

[0153] Recognizing a need for effective splicing modulation therapies for diseases such as Wolman Disease or Cholesteryl Ester Storage Disease, the present disclosure provides LIPA splice-modulating antisense oligonucleotides comprising sequences targeted to an intron adjacent to an abnormally spliced exon (e.g., exon 8) of LIPA. In some embodiments, the antisense oligonucleotide has a sequence targeted to one or more splicing regulatory elements which may be located in an intron adjacent to an abnormally spliced exon (e.g., exon 8) of LIPA. The present disclosure also provides methods for modulating splicing of LIPA RNA in a cell, tissue, or organ of a subject by bringing the cell, tissue, or organ in contact with an antisense oligonucleotide of the invention. A LIPA splice-modulating antisense oligonucleotide may comprise a nucleobase sequence targeted to a splicing regulatory element of an intron adjacent to an abnormally spliced exon (e.g., exon 8) of LIPA. In addition, the present disclosure provides a method for treating Wolman Disease or Cholesteryl Ester Storage Disease in a subject by administering to the subject a therapeutically effective amount of an oligonucleotide of the invention. A LIPA splice-modulating antisense oligonucleotide may comprise a sequence targeted to a splicing regulatory element of or an intron adjacent to an abnormally spliced exon (e.g., exon 8) of LIPA.

[0154] Splicing regulatory elements may include, for example, exonic splicing silencer elements or intronic splicing silencer elements. The antisense oligonucleotides may comprise sequences targeted to an intron adjacent to the exon (e.g., exon 8) of LIPA which modulates variant splicing of LIPA RNA. The modulation of splicing may result in an increase in exon inclusion (e.g., exon 8 inclusion). Antisense oligonucleotides may comprise a total of 8 to 50 nucleotides (e.g., 8 to 16 nucleotides, 8 to 20 nucleotides, 12 to 20 nucleotides, 12 to 30 nucleotides, or 12 to 50 nucleotides).

[0155] Genetic aberrations of the LIPA gene may play an important role in pathogenicity. In particular, a LIPA chr10:90982268:C:T [hg19/b37] genetic aberration (g.34393G>A mutant of SEQ ID NO: 1), may result in NM_000235.3(LIPA) cDNA change c.894G>A and no change in the protein sequence at amino acid position 298 (GIn) in exon 8. Genome coordinates may be expressed, for example, with respect to human genome reference hg19/b37. For example, this variant has been reported as pathogenic in patients with Wolman Disease or Cholesteryl Ester Storage Disease.

[0156] These exemplary genetic aberrations may be targeted with antisense oligonucleotides to increase levels of exon inclusion (e.g., exon 8 inclusion).

[0157] Different antisense oligonucleotides can be combined for increasing an exon inclusion (e.g., exon 8 inclusion) of LIPA. A combination of two antisense oligonucleotides may be used in a method of the invention, such as two antisense oligonucleotides, three antisense oligonucleotides, four different antisense oligonucleotides, or five different antisense oligonucleotides targeting the same or different regions or “hotspots.”

[0158] An antisense oligonucleotide according to the invention may be indirectly administered using suitable techniques and methods known in the art. It may for example be provided to an individual or a cell, tissue or organ of the individual in the form of an expression vector wherein the expression vector encodes a transcript comprising said oligonucleotide. The expression vector is preferably introduced into a cell, tissue, organ or individual via a gene delivery vehicle. In an embodiment, there is provided a viral based expression vector comprising an expression cassette or a transcription cassette that drives expression or transcription of an antisense oligonucleotide as identified herein. Accordingly, the present invention provides a viral vector expressing an antisense oligonucleotide according to the invention.

[0159] An antisense oligonucleotide according to the invention may be directly administered using suitable techniques and methods known in the art, e.g., using conjugates described herein.

Conjugates

[0160] Oligonucleotides of the invention may include an auxiliary moiety, e.g., a targeting moiety, hydrophobic moiety, cell penetrating peptide, or a polymer. An auxiliary moiety may be present as a 5′ terminal modification (e.g., covalently bonded to a 5′-terminal nucleoside), a 3′ terminal modification (e.g., covalently bonded to a 3′-terminal nucleoside), or an internucleoside linkage (e.g., covalently bonded to phosphate or phosphorothioate in an internucleoside linkage).

Targeting Moieties

[0161] An oligonucleotide of the invention may include a targeting moiety.

[0162] A targeting moiety is selected based on its ability to target oligonucleotides of the invention to a desired or selected cell population that expresses the corresponding binding partner (e.g., either the corresponding receptor or ligand) for the selected targeting moiety. For example, an oligonucleotide of the invention could be targeted to hepatocytes expressing asialoglycoprotein receptor (ASGP-R) by selecting a targeting moiety containing N-acetylgalactosamine (GaINAc).

[0163] A targeting moiety may include one or more ligands (e.g., 1 to 9 ligands, 1 to 6 ligands, 1 to 3 ligands, 3 ligands, or 1 ligand). The ligand may target a cell expressing asialoglycoprotein receptor (ASGP-R), IgA receptor, HDL receptor, LDL receptor, or transferrin receptor. Non-limiting examples of the ligands include N-acetylgalactosamine, glycyrrhetinic acid, glycyrrhizin, lactobionic acid, lactoferrin, IgA, or a bile acid (e.g., lithocholyltaurine or taurocholic acid).

[0164] The ligand may be a small molecule, e.g., a small molecules targeting a cell expressing asialoglycoprotein receptor (ASGP-R). A non-limiting example of a small molecule targeting an asialoglycoprotein receptor is N-acetylgalactosamine. Alternatively, the ligand can be an antibody or an antigen-binding fragment or an engineered derivative thereof (e.g., Fcab or a fusion protein (e.g., scFv)).

[0165] A targeting moiety may be -LinkA(-T).sub.p, where LinkA is a multivalent linker, each T is a ligand (e.g., asialoglycoprotein receptor-targeting ligand (e.g., N-acetylgalactosamine)), and p is an integer from 1 to 9. When each T is N-acetylgalactosamine, the targeting moiety is referred to as a galactosamine cluster. Galactosamine clusters that may be used in oligonucleotides of the invention are known in the art. Non-limiting examples of the galactosamine clusters that may be included in the oligonucleotides of the invention are provided in U.S. Pat. Nos. 5,994,517; 7,491,805; 9,714,421; 9,867,882; 9,127,276; US 2018/0326070; US 2016/0257961; WO 2017/100461; and in Sliedregt et al., J. Med. Chem., 42:609-618, 1999. Ligands other than GaINAc may also be used in clusters, as described herein for galactosamine clusters.

[0166] Targeting moiety -LinkA(-T)p may be a group of formula (I):

[00001]$\begin{array}{cc}\text{-}{Q}^1\text{-}{Q^2\left({\left[\text{-}{Q}^3\text{-}{Q}^4\text{-}{Q}^5\right]}_s\text{-}{Q}^6\text{-}T\right)}_p,& \left(I\right)\end{array}$

[0167] where

[0168] each s is independently an integer from 0 to 20 (e.g., from 0 to 10), where the repeating units are the same or different;

[0169] Q.sup.1 is a conjugation linker (e.g., [-Q.sup.3-Q.sup.4-Q.sup.5].sub.s-Q.sup.c-, where Q.sup.C is optionally substituted C.sub.2-12 heteroalkylene (e.g., a heteroalkylene containing —C(O)—N(H)—, —N(H)—C(O)—, —S(O).sub.2—N(H)—, —N(H)—S(O).sub.2—, or —S—S—), optionally substituted C.sub.1-12 thioheterocyclylene

##STR00007##

optionally substituted C.sub.1-12 heterocyclylene (e.g., 1,2,3-triazole-1,4-diyl or

##STR00008##

cyclobut-3-ene-1,2-dione-3,4-diyl, pyrid-2-yl hydrazone, optionally substituted C.sub.6-16 triazoloheterocyclylene

##STR00009##

optionally substituted C.sub.8-16 triazolocycloalkenylene

##STR00010##

or a dihydropyridazine group

##STR00011##

[0170] Q.sup.2 is a linear group (e.g., [-Q.sup.3-Q.sup.4-Q.sup.5].sub.s-), if p is 1, or a branched group (e.g., [-Q.sup.3-Q.sup.4-Q.sup.5].sub.s-Q.sup.7([-Q.sup.3-Q.sup.4-Q.sup.5].sub.s-(Q.sup.7).sub.p1).sub.p2, where p1 is 0, 1, or 2, and p2 is 0, 1, 2, or 3), if p is an integer from 2 to 9;

[0171] each Q.sup.3 and each Q.sup.6 is independently absent, —CO—, —NH—, —O—, —S—, —SO.sub.2—, —OC(O)—, —C(O)O—, —NHC(O)—, —C(O)NH—, —CH.sub.2—, —CH.sub.2NH—, —NHCH.sub.2—, —CH.sub.2O—, or —OCH.sub.2—;

[0172] each Q.sup.4 is independently absent, optionally substituted C.sub.1-12 alkylene, optionally substituted C.sub.2-12 alkenylene, optionally substituted C.sub.2-12 alkynylene, optionally substituted C.sub.2-12 heteroalkylene, optionally substituted C.sub.6-10 arylene, optionally substituted C.sub.1-9 heteroarylene, or optionally substituted C.sub.1-9 heterocyclylene;

[0173] each Q.sup.5 is independently absent, —CO—, —NH—, —O—, —S—, —SO.sub.2—, —CH.sub.2—, —C(O)O—, —OC(O)—, —C(O)NH—, —NH—C(O)—, —NH—CH(R.sup.a)—C(O)—, —C(O)—CH(R.sup.a)—NH—, —OP(O)(OH)O—, or —OP(S)(OH)O—;

[0174] each Q.sup.7 is independently optionally substituted hydrocarbon or optionally substituted heteroorganic (e.g., C.sub.1-6 alkane-triyl, optionally substituted C.sub.1-6 alkane-tetrayl, optionally substituted C.sub.2-6 heteroalkane-triyl, or optionally substituted C.sub.2-6 heteroalkane-tetrayl); and

[0175] each R.sup.a is independently H or an amino acid side chain; provided that at least one of Q.sup.3, Q.sup.4, and Q.sup.5 is present.

[0176] In some instances, for each occurrence of [-Q.sup.3-Q.sup.4-Q.sup.5].sub.s-, at least one of Q.sup.3, Q.sup.4, and Q.sup.5 is present.

[0177] In some instances, Q.sup.7 may be a structure selected from the group consisting of:

##STR00012##

[0178] where RA is H or oligonucleotide, X is O or S, Y is O or NH, and the remaining variables are as described for formula (I).

[0179] Group -LinkA- may include a poly(alkylene oxide) (e.g., polyethylene oxide, polypropylene oxide, poly(trimethylene oxide), polybutylene oxide, poly(tetramethylene oxide), and diblock or triblock co-polymers thereof). In some embodiments, -LinkA- includes polyethylene oxide (e.g., poly(ethylene oxide) having a molecular weight of less than 1 kDa).

[0180] In some instances, -LinkA(-T).sub.p is of the following structure:

##STR00013##

where each L is independently CO or CH.sub.2, each Z is independently CO or CH.sub.2, each n is independently 1 to 9, each m is independently 1 to 5, each o is independently 0 to 1, each p is independently 1 to 10, and each q is independently 1 to 10.

[0181] In some instances, each L is CH.sub.2. In some instances, each Z is CO. In some instances, each n is 5. In some instances, each m is 2. In some instances, each o is 1. In some instances, each p is 2. In some instances, each p is 3. In some instances, each q is 4.

[0182] In some instances, -LinkA(-T).sub.p is of the following structure:

##STR00014##

[0183] In some instances, -LinkA(-T).sub.p is covalently bonded to a phosphate that is bonded to a 5′-terminal nucleoside. In some instances, -LinkA(-T).sub.p is covalently bonded to phosphate that is bonded to a 3′-terminal nucleoside.

[0184] In some instances, -Q.sup.2([-Q.sup.3-Q.sup.4-Q.sub.5].sub.s-Q.sup.6-T).sub.p is a group of the following structure:

##STR00015##

where n is 1 to 20 (e.g., 6).

[0185] In some instances, -Q.sup.2([-Q.sup.3-Q.sup.4-Q.sup.5].sub.s-Q.sup.6-T).sub.p is a group of the following structure:

##STR00016##

where n is 1 to 20 (e.g., 6).

[0186] In some instances, -LinkA(-T).sub.p is a group of the following structure:

##STR00017##

where n is 1 to 20.

[0187] In some instances, -LinkA(-T).sub.p is a group of the following structure:

##STR00018##

where n is 1 to 20.

[0188] In some instances, -LinkA(-T).sub.p is a group of the following structure:

##STR00019##

[0189] In some instances, -LinkA(-T).sub.p is a group of the following structure:

##STR00020##

Hydrophobic Moieties

[0190] Advantageously, an oligonucleotide including a hydrophobic moiety may exhibit superior cellular uptake, as compared to an oligonucleotide lacking the hydrophobic moiety. Oligonucleotides including a hydrophobic moiety may therefore be used in compositions that are substantially free of transfecting agents. A hydrophobic moiety is a monovalent group (e.g., a bile acid (e.g., cholic acid, taurocholic acid, deoxycholic acid, oleyl lithocholic acid, or oleoyl cholenic acid), glycolipid, phospholipid, sphingolipid, isoprenoid, vitamin, saturated fatty acid, unsaturated fatty acid, fatty acid ester, triglyceride, pyrene, porphyrine, texaphyrine, adamantine, acridine, biotin, coumarin, fluorescein, rhodamine, Texas-Red, digoxygenin, dimethoxytrityl, t-butydimethylsilyl, t-butyldiphenylsilyl, cyanine dye (e.g., Cy3 or Cy5), Hoechst 33258 dye, psoralen, or ibuprofen) covalently linked to the oligonucleotide backbone (e.g., 5′-terminus). Non-limiting examples of the monovalent group include ergosterol, stigmasterol, β-sitosterol, campesterol, fucosterol, saringosterol, avenasterol, coprostanol, cholesterol, vitamin A, vitamin D, vitamin E, cardiolipin, and carotenoids. The linker connecting the monovalent group to the oligonucleotide may be an optionally substituted C.sub.1-60 hydrocarbon (e.g., optionally substituted C.sub.1-60 alkylene) or an optionally substituted C.sub.2-60 heteroorganic (e.g., optionally substituted C.sub.2-60 heteroalkylene), where the linker may be optionally interrupted with one, two, or three instances independently selected from the group consisting of an optionally substituted arylene, optionally substituted heterocyclylene, and optionally substituted cycloalkylene. The linker may be bonded to an oligonucleotide through, e.g., an oxygen atom attached to a 5′-terminal carbon atom, a 3′-terminal carbon atom, a 5′-terminal phosphate or phosphorothioate, a 3′-terminal phosphate or phosphorothioate, or an internucleoside linkage.

Cell Penetrating Peptides

[0191] One or more cell penetrating peptides (e.g., from 1 to 6 or from 1 to 3) can be attached to an oligonucleotide disclosed herein as an auxiliary moiety. The CPP can be linked to the oligonucleotide through a disulfide linkage, as disclosed herein. Thus, upon delivery to a cell, the CPP can be cleaved intracellularly, e.g., by an intracellular enzyme (e.g., protein disulfide isomerase, thioredoxin, or a thioesterase) and thereby release the polynucleotide.

[0192] CPPs are known in the art (e.g., TAT or Arg.sub.8) (Snyder and Dowdy, 2005, Expert Opin. Drug Deliv. 2, 43-51). Specific examples of CPPs including moieties suitable for conjugation to the oligonucleotides disclosed herein are provided, e.g., in WO 2015/188197; the disclosure of these CPPs is incorporated by reference herein.

[0193] CPPs are positively charged peptides that are capable of facilitating the delivery of biological cargo to a cell. It is believed that the cationic charge of the CPPs is essential for their function. Moreover, the transduction of these proteins does not appear to be affected by cell type, and these proteins can efficiently transduce nearly all cells in culture with no apparent toxicity. In addition to full-length proteins, CPPs have also been used successfully to induce the intracellular uptake of DNA, antisense polynucleotides, small molecules, and even inorganic 40 nm iron particles suggesting that there is considerable flexibility in particle size in this process.

[0194] In one embodiment, a CPP useful in the methods and compositions of the invention includes a peptide featuring substantial alpha-helicity. It has been discovered that transfection is optimized when the CPP exhibits significant alpha-helicity. In another embodiment, the CPP includes a sequence containing basic amino acid residues that are substantially aligned along at least one face of the peptide. A CPP useful in the invention may be a naturally occurring peptide or a synthetic peptide.

Polymers

[0195] An oligonucleotide of the invention may include covalently attached neutral polymer-based auxiliary moieties. Neutral polymers include poly(C.sub.1-6 alkylene oxide), e.g., poly(ethylene glycol) and poly(propylene glycol) and copolymers thereof, e.g., di- and triblock copolymers. Other examples of polymers include esterified poly(acrylic acid), esterified poly(glutamic acid), esterified poly(aspartic acid), poly(vinyl alcohol), poly(ethylene-co-vinyl alcohol), poly(N-vinyl pyrrolidone), poly(ethyloxazoline), poly(alkylacrylates), poly(acrylamide), poly(N-alkylacrylamides), poly(N-acryloylmorpholine), poly(lactic acid), poly(glycolic acid), poly(dioxanone), poly(caprolactone), styrene-maleic acid anhydride copolymer, poly(L-lactide-co-glycolide) copolymer, divinyl ether-maleic anhydride copolymer, N-(2-hydroxypropyl)methacrylamide copolymer (HMPA), polyurethane, N-isopropylacrylamide polymers, and poly(N,N-dialkylacrylamides). Exemplary polymer auxiliary moieties may have molecular weights of less than 100, 300, 500, 1000, or 5000 Da (e.g., greater than 100 Da). Other polymers are known in the art.

Nucleobase Modifications

[0196] Oligonucleotides of the invention may include one or more modified nucleobases. Unmodified nucleobases include the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C), and uracil (U). Modified nucleobases include 5-substituted pyrimidines, 6-azapyrimidines, alkyl or alkynyl substituted pyrimidines, alkyl substituted purines, and N-2, N-6 and 0-6 substituted purines, as well as synthetic and natural nucleobases, e.g., 5-methylcytosine, 5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-alkyl (e.g., 6-methyl) adenine and guanine, 2-alkyl (e.g., 2-propyl) adenine and guanine, 2-thiouracil, 2-thiothymine, 2-thiocytosine, 5-halouracil, 5-halocytosine, 5-propynyl uracil, 5-propynyl cytosine, 5-trifluoromethyl uracil, 5-trifluoromethyl cytosine, 7-methyl guanine, 7-methyl adenine, 8-azaguanine, 8-azaadenine, 7-deazaguanine, 7-deazaadenine, 3-deazaguanine, 3-deazaadenine. Certain nucleobases are particularly useful for increasing the binding affinity of nucleic acids, e g., 5-substituted pyrimidines; 6-azapyrimidines; N2-, N6-, and/or 06-substituted purines. Nucleic acid duplex stability can be enhanced using, e.g., 5-methylcytosine. Non-limiting examples of nucleobases include: 2-aminopropyladenine, 5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-N-methylguanine, 6-N-methyladenine, 2-propyladenine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-propynyl (—C═C—CH3) uracil, 5-propynylcytosine, 6-azouracil, 6-azocytosine, 6-azothymine, 5-ribosyluracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl, 8-aza and other 8-substituted purines, 5-halo, particularly 5-bromo, 5-trifluoromethyl, 5-halouracil, and 5-halocytosine, 7-methylguanine, 7-methyladenine, 2-F-adenine, 2-aminoadenine, 7-deazaguanine, 7-deazaadenine, 3-deazaguanine, 3-deazaadenine, 6-N-benzoyladenine, 2-N-isobutyrylguanine, 4-N-benzoylcytosine, 4-N-benzoyluracil, 5-methyl 4-N-benzoylcytosine, 5-methyl 4-N-benzoyluracil, universal bases, hydrophobic bases, promiscuous bases, size-expanded bases, and fluorinated bases. Further modified nucleobases include tricyclic pyrimidines, such as 1,3-diazaphenoxazine-2-one, 1,3-diazaphenothiazine-2-one and 9-(2-aminoethoxy)-1,3-diazaphenoxazine-2-one (G-clamp). Modified nucleobases may also include those in which the purine or pyrimidine base is replaced with other heterocycles, for example 7-deazaadenine, 7-deazaguanine, 2-aminopyridine and 2-pyridone. Further nucleobases include those disclosed in Merigan et al., U.S. Pat. No. 3,687,808, those disclosed in The Concise Encyclopedia Of Polymer Science And Engineering, Kroschwitz, J. I., Ed., John Wiley & Sons, 1990, 858-859; Englisch et al., Angewandte Chemie, International Edition, 1991, 30, 613; Sanghvi, Y. S., Chapter 15, Antisense Research and Applications, Crooke, S. T. and Lebleu, B., Eds., CRC Press, 1993, 273-288; and those disclosed in Chapters 6 and 15, Antisense Drug Technology, Crooke S. T., Ed., CRC Press, 2008, 163-166 and 442-443.

[0197] The replacement of cytidine with 5-methylcytidine can reduce immunogenicity of oligonucleotides, e.g., those oligonucleotides having CpG units.

[0198] The replacement of one or more guanosines with, e.g., 7-deazaguanosine or 6-thioguanosine, may inhibit the antisense activity reducing G tetraplex formation within antisense oligonucleotides.

Sugar Modifications

[0199] Oligonucleotides of the invention may include one or more sugar modifications in nucleosides. Nucleosides having an unmodified sugar include a sugar moiety that is a furanose ring as found in ribonucleosides and 2′-deoxyribonucleosides.

[0200] Sugars included in the nucleosides of the invention may be non-furanose (or 4′-substituted furanose) rings or ring systems or open systems. Such structures include simple changes relative to the natural furanose ring (e.g., a six-membered ring). Alternative sugars may also include sugar surrogates wherein the furanose ring has been replaced with another ring system such as, e.g., a morpholino or hexitol ring system. Non-limiting examples of sugar moieties useful that may be included in the oligonucleotides of the invention include β-D-ribose, β-D-2′-deoxyribose, substituted sugars (e.g., 2′, 5′, and bis substituted sugars), 4′-S-sugars (e.g., 4′-S-ribose, 4′-S-2′-deoxyribose, and 4′-5-2′-substituted ribose), bridged sugars (e.g., the 2′-O—CH.sub.2-4′ or 2′-O—(CH.sub.2).sub.2-4′ bridged ribose derived bicyclic sugars) and sugar surrogates (when the ribose ring has been replaced with a morpholino or a hexitol ring system).

[0201] Typically, a sugar modification may be, e.g., a 2′-substitution, locking, carbocyclization, or unlocking. A 2′-substitution is a replacement of 2′-hydroxyl in ribofuranose with 2′-fluoro, 2′-methoxy, or 2′-(2-methoxy)ethoxy. A locking modification is an incorporation of a bridge between 4′-carbon atom and 2′-carbon atom of ribofuranose. Nucleosides having a sugar with a locking modification are known in the art as bridged nucleic acids, e.g., locked nucleic acids (LNA), ethylene-bridged nucleic acids (ENA), and cEt nucleic acids. The bridged nucleic acids are typically used as affinity enhancing nucleosides.

Internucleoside Linkage Modifications

[0202] Oligonucleotides of the invention may include one or more internucleoside linkage modifications. The two main classes of internucleoside linkages are defined by the presence or absence of a phosphorus atom. Non-limiting examples of phosphorus-containing internucleoside linkages include phosphodiester linkages, phosphotriester linkages, phosphorothioate diester linkages, phosphorothioate triester linkages, morpholino internucleoside linkages, methylphosphonates, and phosphoramidate. Non-limiting examples of non-phosphorus internucleoside linkages include methylenemethylimino (—CH.sub.2—N(CH.sub.3)—O—CH.sub.2—), thiodiester (—O—C(O)—S—), thionocarbamate (—O—C(O)(NH)—S—), siloxane (—O—Si(H).sub.2—O—), and N,N′-dimethylhydrazine (—CH.sub.2—N(CH.sub.3)—N(CH.sub.3)—). Modified linkages, compared to natural phosphodiester linkages, can be used to alter, typically increase, nuclease resistance of the oligonucleotide. Methods of preparation of phosphorous-containing and non-phosphorous-containing internucleoside linkages are known in the art.

[0203] Internucleoside linkages may be stereochemically enriched. For example, phosphorothioate-based internucleoside linkages (e.g., phosphorothioate diester or phosphorothioate triester) may be stereochemically enriched. The stereochemically enriched internucleoside linkages including a stereogenic phosphorus are typically designated S.sub.P or R.sub.P to identify the absolute stereochemistry of the phosphorus atom. Within an oligonucleotide, S.sub.P phosphorothioate indicates the following structure:

##STR00021##

[0204] Within an oligonucleotide, R.sub.P phosphorothioate indicates the following structure:

##STR00022##

[0205] The oligonucleotides of the invention may include one or more neutral internucleoside linkages. Non-limiting examples of neutral internucleoside linkages include phosphotriesters, phosphorothioate triesters, methylphosphonates, methylenemethylimino (5′-CH.sub.2—N(CH.sub.3)—O-3′), amide-3 (5′-CH.sub.2—C(═O)—N(H)-3′), amide-4 (5′-CH.sub.2—N(H)—C(═O)-3′), formacetal (5′-O—CH.sub.2—O-3′), and thioformacetal (5′-S—CH.sub.2—O-3′). Further neutral internucleoside linkages include nonionic linkages including siloxane (dialkylsiloxane), carboxylate ester, carboxamide, sulfide, sulfonate ester, and amides (See for example: Carbohydrate Modifications in Antisense Research; Y. S. Sanghvi and P. D. Cook, Eds., ACS Symposium Series 580; Chapters 3 and 4, 40-65).

Terminal Modifications

[0206] Oligonucleotides of the invention may include a terminal modification, e.g., a 5′-terminal modification or a 3′-terminal modification.

[0207] The 5′ end of an oligonucleotide may be, e.g., hydroxyl, a hydrophobic moiety, a targeting moiety, 5′ cap, phosphate, diphosphate, triphosphate, phosphorothioate, diphosphorothioate, triphosphorothioate, phosphorodithioate, diphosphrodithioate, triphosphorodithioate, phosphonate, phosphoramidate, a cell penetrating peptide, an endosomal escape moiety, or a neutral organic polymer. An unmodified 5′-terminus is hydroxyl or phosphate. An oligonucleotide having a 5′ terminus other than 5′-hydroxyl or 5′-phosphate has a modified 5′ terminus.

[0208] The 3′ end of an oligonucleotide may be, e.g., hydroxyl, a targeting moiety, a hydrophobic moiety, phosphate, diphosphate, triphosphate, phosphorothioate, diphosphorothioate, triphosphorothioate, phosphorodithioate, disphorodithioate, triphosphorodithioate, phosphonate, phosphoramidate, a cell penetrating peptide, an endosomal escape moiety, or a neutral organic polymer (e.g., polyethylene glycol). An unmodified 3′-terminus is hydroxyl or phosphate. An oligonucleotide having a 3′ terminus other than 3′-hydroxyl or 3′-phosphate has a modified 3′ terminus.

[0209] The terminal modification (e.g., 5′-terminal modification) may be, e.g., a targeting moiety as described herein.

[0210] The terminal modification (e.g., 5′-terminal modification) may be, e.g., a hydrophobic moiety as described herein.

Complementarity

[0211] In some embodiments, oligonucleotides of the invention are complementary to a LIPA target sequence over the entire length of the oligonucleotide. In other embodiments, oligonucleotides are at least 99%, 95%, 90%, 85%, 80%, or 70% complementary to the LIPA target sequence. In further embodiments, oligonucleotides are at least 80% (e.g., at least 90% or at least 95%) complementary to the LIPA target sequence over the entire length of the oligonucleotide and include a nucleobase sequence that is fully complementary to a LIPA target sequence. The nucleobase sequence that is fully complementary may be, e.g., 6 to 20, 10 to 18, or 18 to 20 contiguous nucleobases in length.

[0212] An oligonucleotide of the invention may include one or more (e.g., 1, 2, 3, or 4) mismatched nucleobases relative to the target nucleic acid. In certain embodiments, a splice-switching activity against the target is reduced by such mismatch, but activity against a non-target is reduced by a greater amount. Thus, the off-target selectivity of the oligonucleotides may be improved.

Methods for Preparing Compositions

[0213] The present disclosure provides methods for preparing or generating compositions provided herein. A nucleic acid molecule, such as an oligonucleotide, comprising a targeted sequence may be generated, for example, by various nucleic acid synthesis approaches. For example, a nucleic acid molecule comprising a sequence targeted to a splice site may be generated by oligomerization of modified and/or unmodified nucleosides, thereby producing DNA or RNA oligonucleotides. Antisense oligonucleotides can be prepared, for example, by solid phase synthesis. Such solid phase synthesis can be performed, for example, in multi-well plates using equipment available from vendors such as Applied Biosystems (Foster City, CA). It is well known to use similar techniques to prepare oligonucleotides such as the phosphorothioates and alkylated derivatives. Oligonucleotides may be subjected to purification and/or analysis using methods known to those skilled in the art. For example, analysis methods may include capillary electrophoresis (CE) and electrospray-mass spectroscopy.

Pharmaceutical Compositions

[0214] An oligonucleotide of the invention may be included in a pharmaceutical composition. A pharmaceutical composition typically includes a pharmaceutically acceptable diluent or carrier. A pharmaceutical composition may include (e.g., consist of), e.g., a sterile saline solution and an oligonucleotide of the invention. The sterile saline is typically a pharmaceutical grade saline. A pharmaceutical composition may include (e.g., consist of), e.g., sterile water and an oligonucleotide of the invention. The sterile water is typically a pharmaceutical grade water. A pharmaceutical composition may include (e.g., consist of), e.g., phosphate-buffered saline (PBS) and an oligonucleotide of the invention. The sterile PBS is typically a pharmaceutical grade PBS.

[0215] Pharmaceutical compositions may include one or more oligonucleotides and one or more excipients. Excipients may be selected from water, salt solutions, alcohol, polyethylene glycols, gelatin, lactose, amylase, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose and polyvinylpyrrolidone.

[0216] Pharmaceutical compositions including an oligonucleotide encompass any pharmaceutically acceptable salts of the oligonucleotide. Pharmaceutical compositions including an oligonucleotide, upon administration to a subject (e.g., a human), are capable of providing (directly or indirectly) the biologically active metabolite or residue thereof. Accordingly, for example, the disclosure is also drawn to pharmaceutically acceptable salts of oligonucleotides. Suitable pharmaceutically acceptable salts include, but are not limited to, sodium and potassium salts. In certain embodiments, prodrugs include one or more conjugate group(s) attached to an oligonucleotide, wherein the one or more conjugate group(s) is cleaved by endogenous enzymes within the body.

[0217] Lipid moieties have been used in nucleic acid therapies in a variety of methods. In certain such methods, the nucleic acid, such as an oligonucleotide, is introduced into preformed liposomes or lipoplexes made of mixtures of cationic lipids and neutral lipids. DNA complexes with mono- or poly-cationic lipids may form, e.g., without the presence of a neutral lipid. A lipid moiety may be, e.g., selected to increase distribution of a pharmaceutical agent to a particular cell or tissue. A lipid moiety may be, e.g., selected to increase distribution of a pharmaceutical agent to fat tissue. A lipid moiety may be, e.g., selected to increase distribution of a pharmaceutical agent to muscle tissue.

[0218] Pharmaceutical compositions may include a delivery system. Examples of delivery systems include, but are not limited to, liposomes and emulsions. Certain delivery systems are useful for preparing certain pharmaceutical compositions including those including hydrophobic compounds. Certain organic solvents such as dimethylsulfoxide may be used.

[0219] Pharmaceutical compositions may include one or more tissue-specific delivery molecules designed to deliver the one or more pharmaceutical agents of the present invention to specific tissues or cell types. For example, pharmaceutical compositions may include liposomes coated with a targeting moiety as described herein.

[0220] Pharmaceutical compositions may include a co-solvent system. Certain co-solvent systems include, e.g., benzyl alcohol, a nonpolar surfactant, a water-miscible organic polymer, and an aqueous phase. Such co-solvent systems may be used, e.g., for hydrophobic compounds. A non-limiting example of a co-solvent system is the VPD co-solvent system, which is a solution of absolute ethanol including 3% w/v benzyl alcohol, 8% w/v of the nonpolar surfactant Polysorbate 80™ and 65% w/v polyethylene glycol 300. The proportions of such co-solvent systems may be varied considerably without significantly altering their solubility and toxicity characteristics. Furthermore, the identity of co-solvent components may be varied: for example, other surfactants may be used instead of Polysorbate 80™; the fraction size of polyethylene glycol may be varied; other biocompatible polymers may replace polyethylene glycol, e.g., polyvinyl pyrrolidone; and other sugars or polysaccharides may substitute for dextrose.

[0221] Pharmaceutical compositions may be prepared for administration by injection or infusion (e.g., intravenous, subcutaneous, intramuscular, intrathecal, intracerebroventricular, etc.). A pharmaceutical composition may include, e.g., a carrier and may be formulated, e.g., in aqueous solution, e.g., water or physiologically compatible buffers, e.g., Hanks's solution, Ringer's solution, or physiological saline buffer. Other ingredients may also be included (e.g., ingredients that aid in solubility or serve as preservatives). Injectable suspensions may be prepared, e.g., using appropriate liquid carriers, suspending agents and the like. Certain pharmaceutical compositions for injection are presented in unit dosage form, e.g., in ampoules or in multi-dose containers. Certain pharmaceutical compositions for injection may be, e.g., suspensions, solutions, or emulsions in oily or aqueous vehicles, and may contain excipients (e.g., suspending, stabilizing and/or dispersing agents). Certain solvents suitable for use in pharmaceutical compositions for injection include, but are not limited to, lipophilic solvents and fatty oils, e.g., sesame oil, synthetic fatty acid esters (e.g., ethyl oleate or triglycerides), and liposomes.

Methods of the Invention

[0222] The invention provides methods of using oligonucleotides of the invention.

[0223] A method of the invention may be a method of increasing the level of an exon-containing (e.g., exon 8-containing) LIPA mRNA molecules in a cell expressing an aberrant LIPA gene by contacting the cell with an antisense oligonucleotide of the invention.

[0224] A method of the invention may be a method of treating Wolman Disease or Cholesteryl Ester Storage Disease in a subject having an aberrant LIPA gene by administering a therapeutically effective amount of an antisense oligonucleotide of the invention or a pharmaceutical composition of the invention to the subject in need thereof.

[0225] The oligonucleotide of the invention or the pharmaceutical composition of the invention may be administered to the subject using methods known in the art. For example, the oligonucleotide of the invention or the pharmaceutical composition of the invention may be administered parenterally (e.g., intravenously, intramuscularly, subcutaneously, transdermally, intranasally, or intrapulmonarily) to the subject.

[0226] Dosing is typically dependent on a variety of factors including, e.g., severity and responsiveness of the disease state to be treated. The treatment course may last, e.g., from several days to several years, or until a cure is effected or a diminution of the disease state is achieved. Optimal dosing schedules can be calculated from measurements of drug accumulation in the body of the patient. Thus, optimum dosages, dosing methodologies and repetition rates can be established as needed. Optimum dosages may vary depending on the relative potency of individual oligonucleotides, and can generally be estimated based on EC.sub.50s found to be effective in in vitro and in vivo animal models. In general, dosage may be from 0.01 μg to 1 g per kg of body weight, and may be given once or more daily, weekly, monthly, bimonthly, trimonthly, every six months, annually, or biannually. Frequency of dosage may vary. Repetition rates for dosing may be established, for example, based on measured residence times and concentrations of the drug in bodily fluids or tissues. Following successful treatment, it may be desirable to have the patient undergo maintenance therapy to prevent the recurrence of the disease state, wherein the oligonucleotide is administered in maintenance doses, ranging from 0.01 μg to 1 g per kg of body weight, e.g., once daily, twice daily, three times daily, every other day, weekly, biweekly, monthly, bimonthly, trimonthly, every six months, annually or biannually.

[0227] Methods of treating Wolman Disease or Cholesteryl Ester Storage Disease in a subject in need thereof may also include administering to the subject a second therapeutic (e.g., a cholesterol lowering statin or a recombinant lysosomal acid lipase (e.g., sebelipase alfa)). Non-limiting examples of statins include HMG CoA reductase inhibitors, e.g., pravastatin, lovastatin, simvastatin, atorvastatin, fluvastatin, and other statins, e.g., fluindostatin. In some embodiments, the method includes administering to the subject a pharmaceutically acceptable salt of a statin or niacin combination (e.g., pravastatin sodium salt, atorvastatin calcium salt, or lovastatin/niacin). In one example, an oligonucleotide of the invention and a statin or a pharmaceutically acceptable salt thereof are administered together in the same pharmaceutical composition. In another example, an oligonucleotide of the invention and a statin or a pharmaceutically acceptable salt thereof are administered separately at about the same time (e.g., one minute apart or less, or five minutes apart or less). In some embodiments, an oligonucleotide of the invention and a statin or a pharmaceutically acceptable salt thereof are administered separately via the same route of administration (e.g., intravenous injection). In some embodiments, an oligonucleotide of the invention and a statin or a pharmaceutically acceptable salt thereof are administered separately via different routes of administration (e.g., intravenous injection of an oligonucleotide of the invention and oral administration of a statin or a pharmaceutically acceptable salt thereof). In some embodiments, the second therapy is a recombinant lysosomal acid lipase (e.g., sebelipase alfa). Details on administration of the recombinant lysosomal acid lipase (e.g., sebelipase alfa) are described, e.g., in U.S. Pat. No. 10,166,274.

[0228] The pharmaceutical composition of the invention may contain a statin, e.g., pravastatin, lovastatin, simvastatin, atorvastatin, or fluvastatin in an amount as normally employed for such statin as exemplified in the 71st edition of the Physician's Desk Reference (PDR). Thus, depending upon the particular statin, it may be employed in amounts within the range from about 0.1 mg to 2000 mg per day in single or divided doses, and preferably from about 0.2 to about 200 mg per day. Most preferably for pravastatin, a daily dosage of 10 to 80 mg may be employed; for lovastatin, a daily dosage of 10 to 80 mg may be employed, for simvastatin a daily dosage of 5 to 80 mg may be employed; for atorvastatin, a daily dosage of 10 to 80 mg may be employed; and for fluvastatin, a daily dosage of 20 to 80 mg may be employed.

[0229] In some embodiments, an oligonucleotide of the invention is administered prior to a statin. In further embodiments, an oligonucleotide of the invention is administered within 1 hour of the statin administration (e.g., before, e.g., 15 min, 30 min, or 1 hour before). In some embodiments, an oligonucleotide of the invention is administered within 12 hours of the statin (e.g., before, e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 hours before). In certain embodiments, an oligonucleotide of the invention is administered within 24 hours of the statin (e.g., before, e.g., 12 or 24 hours before). In particular embodiments, an oligonucleotide of the invention is administered within 1 week of the statin administration (e.g., before, e.g., 1, 2, 3, 4, 5, or 6 days before). In some embodiments, an oligonucleotide of the invention is administered within 1 month of the statin administration (e.g., before, e.g., 1, 2, 3, or 4 weeks before).

[0230] In some embodiments, an oligonucleotide of the invention is administered after a statin. In further embodiments, an oligonucleotide of the invention is administered within 1 hour of the statin administration (e.g., after, e.g., 15 min, 30 min, or 1 hour after). In some embodiments, an oligonucleotide of the invention is administered within 12 hours of the statin administration (e.g., after, e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 hours after). In certain embodiments, an oligonucleotide of the invention is administered within 24 hours of the statin administration (e.g., after, e.g., 12 or 24 hours after). In particular embodiments, an oligonucleotide of the invention is administered within 1 week of the statin administration (e.g., after, e.g., 1, 2, 3, 4, 5, or 6 days after). In some embodiments, an oligonucleotide of the invention is administered within 1 month of the statin administration (e.g., after, e.g., 1, 2, 3, or 4 weeks after).

EXAMPLES

[0231] The following materials, methods, and examples are illustrative only and not intended to be limiting.

Materials and Methods

[0232] In general, the practice of the present invention employs, unless otherwise indicated, conventional techniques of chemistry, molecular biology, and recombinant DNA technology. See, e.g., Sambrook, Fritsch and Maniatis, Molecular Cloning: Cold Spring Harbor Laboratory Press (1989) and Current Protocols in Molecular Biology, eds. Ausubel et al., John Wiley & Sons (1992).

[0233] Oligonucleotides. All antisense oligonucleotides used were obtained from Integrated DNA Technologies Inc. (USA). All bases in the antisense oligonucleotides were 2′-O-methoxyethyl-modified (MOE) with a full phosphorothioate backbone.

[0234] Cell lines. Fibroblast cell lines GM00288, GM00863, GM03111, GM06122, and GM09503 were obtained from the Coriell Institute for Medical Research. Lines GM00288 and GM09503 are from ostensibly healthy individuals. The GM06122 is from a clinically unaffected individual who is heterozygous for the LIPA gene mutation (c.796G>T(p.G266X)). The GM00863 line is from a Wolman Disease patient and is heterozygous for LIPA gene mutations c.290C>G (p.T97R) and c.353G>A (p.G118D). The GM03111 line is from a CESD patient and is heterozygous for LIPA gene mutations c.894G>A and c.967_968delAG (p.S323Lfs*44).

[0235] Cell culture. Fibroblast cells were grown in Eagle's Minimal Essential Medium (Gibco) supplemented with 15% Fetal Bovine Serum (Gibco) and 1× Non-Essential Amino Acids Solution (Gibco) in a humidified incubator at 37° C. with 5% CO.sub.2. Upon reaching confluency the cells were passaged by washing with Hanks Buffered Saline Solution followed by dissociation with 0.05% Trypsin-EDTA (Gibco) and plated in 4-fold dilution. HepG2 cells were grown in Dulbecco's Modified Eagle's Medium (Gibco) supplemented with 10% Fetal Bovine Serum (Gibco) in a humidified incubator at 37° C. with 5% CO.sub.2. Upon reaching confluency the cells were passaged by washing with Phosphate-Buffered Saline followed by TrypLE (Gibco) dissociation and plated in a culture flask in 2 to 4-fold dilution.

[0236] Transfection of fibroblasts with antisense oligonucleotides. Antisense oligonucleotides were transfected at absolute amounts of 300 pmol of an antisense oligonucleotide per well of a 12-well plate containing approximately 125,000 GM03111 fibroblast cells. For this, 200 μL of Opti-MEM media (Gibco) containing 3 μL of Lipofectamine 2000 (Invitrogen) was transferred to each well of a 12-well tissue culture plate containing 300 pmol antisense oligonucleotides. Antisense oligonucleotide-lipid complexes in the mixture were formed by tilting of the plate followed by incubation for 20 minutes at room temperature. Next, approximately 125,000 fibroblast cells in 800 μL fibroblast media solution were added to the antisense oligonucleotide-lipid complexes and incubated for 48 hours at 37° C. and 5% CO.sub.2.

[0237] RNA preparation. RNA was isolated using the RNeasy Mini kit (Qiagen), according to manufacturer's instructions.

[0238] RT-PCR analysis. First-strand cDNA synthesis was performed using the High-Capacity cDNA Reverse Transcription Kit (Thermo Fisher), according to manufacturer's instructions. Target-specific fragments were amplified by PCR using the primers SEQ ID NO: 115 (TTCTTCTGTGTGGATTTAATGAGAG) and SEQ ID NO: 116 (AATTCTTGGCACTGCTTCCC). PCR reactions contained 5 μl first-strand cDNA product, 0.4 μM forward primer, 0.4 μM reverse primer, 300 μM of each dNTP, 25 mM Tricine, 7.0% Glycerol (m/v), 1.6% DMSO (m/v), 2 mM MgCl.sub.2, 85 mM NH.sub.4-acetate (pH 8.7), and 1 unit Taq DNA polymerase (FroggaBio) in a total volume of 25 μL. Fragments were amplified by a touchdown PCR program (95° C. for 120 sec; 10 cycles of 95° C. for 20 sec, 68° C. for 30 sec with a decrement of 1° C. per cycle, and 72° C. for 60 sec; followed by 20 cycles of 95° C. for 20 sec, 58° C. for 30 sec, and 72° C. for 60 sec; 72° C. for 180 sec).

[0239] Capillary electrophoresis. Samples were analyzed using a LabChip GX Touch Nucleic Acid Analyzer using a DNA 1K Hi Sensitivity LabChip and associated reagents according to manufacturer's recommendations (GE).

[0240] LIPA enzyme activity assay. Fibroblasts cultured in 12-well plates with approximately 125,000 cells/well were lysed using 200 μL 1% Triton-X with 1× HALT protease inhibitor (Thermo Fisher). Lysates were passed through a 23-gauge needle 5 times and centrifuged at 14,000 rpm for 10 min at 4° C. Supernatant containing the cell lysates were quantified using the Pierce BCA assay (Thermo Fisher) and samples normalized. 4 μg cell lysate was added to each well of a 96-well plate in quadruplicate. 10 μL of 50 μM Lalistat 2 (Cayman Chemicals) or 10% DMSO was added to each well and the plate was incubated at 37° C. for 10 min. The reaction was started by adding 50 μL of 1 mM 4-methylumbelliferyl oleate (4-MUO; Sigma) to each well and plates were incubated at 37° C. for 1 h. Fluorescence was measured at 340 nm(ex)/450 nm(em) in a BioTEK Synergy Neo 2 plate reader. Enzyme activity was determined by subtracting Lalistat 2-treated samples from DMSO-treated samples.

[0241] Viability assay. HepG2 cells were reverse-transfected by adding 50 pmol antisense oligonucleotide into each well of a 96-well plate along with 10 μL Lipofectamine RNAiMAX (Gibco) in Opti-MEM (Gibco) and incubated for 20 min at room temperature. Aproximatly 20,000 HepG2 cells were added to each well. Plates were incubated for 48 h at 37° C. and 5% CO2. Viability determination was performed using the Promega CellTiter Fluor kit, following manufacturer's instructions. The plates were incubated at 37° C. for 1.5 h. Fluorescence (ex: 400 nm, em: 505 nm) was measured using the BioTEK Synergy Neo 2 plate reader.

Example 1. The Splicing and Enzymatic Activity of LIPA is Disrupted in the c.894G>A Variant and can be Partially Rescued Through the Use of Antisense Oligonucleotides

[0242] To confirm exon 8 skipping in the c.894G>A variant, RT-PCR was conducted on GM00288, GM03111, GM09503, and GM00863 cells (FIG. 1B). RT-PCR analysis shows that exon 8 is skipped more frequently in cells with the c.894G>A mutation (GM0311). LIPA enzyme activity (FIG. 2) demonstrates reduced LIPA activity in those cell lines where the donor is known to have Wolman Disease or CESD (GM03111 and GM00863).

[0243] To examine the ability of antisense oligonucleotides to promote exon 8 inclusion in the c.894G>A variant the GM03111 cells were transfected with antisense oligonucleotides having sequences set forth in SEQ ID NOs: 3-91 (see Table 1). FIG. 3 shows representative RT-PCR samples measured by capillary electrophoresis. A 100 bp DNA ladder is shown for size reference with the exon 8 inclusion band at 165 bp and exclusion band at 92 bp. From both FIG. 3 and Table 1 it is clear that targeting the intronic regions surrounding exon 8 induces exon 8 inclusion. Percent spliced in (PSI) for exon 8 was then calculated as well as the change in percent spliced in compared to an inactive control antisense oligonucleotide (dPSI) (Table 1). These observations suggest antisense oligonucleotides targeting the surrounding introns of exon 8 may be useful in the treatment of Wolman Disease or Cholesteryl Ester Storage Disease associated with exon 8 skipping (e.g., Wolman Disease or Cholesteryl Ester Storage Disease caused by the c.894G>A mutation).

[0244] Targeting the regions within 100 bp of exon 8 in either of the surrounding introns can lead to a positive dPSI. Targeting these regions (positions 34222-34321 and 34394-34493 in SEQ ID NO: 1; which correspond to chr10:90982339-90982439 and chr10:90982168-90982268, respectively), e.g. using those sequences targeted to be complementary to the pre-mRNA in that region in SEQ ID NOs: 16, 20, 21, 27, 31, 55, 68, 81, 90, and 91 for region 1 and SEQ ID NOs: 3-15, 17-19, 22-26, 28-30, 32-54, 56-67, 69-80, and 82-89 for region 2, may be useful in the treatment of Wolman Disease or Cholesteryl Ester Storage Disease associated with exon 8 skipping (e.g., Wolman Disease or Cholesteryl Ester Storage Disease caused by the c.894G>A mutation). Targeting a “hotspot” corresponding to positions 34398-34480 within region 2, which shows particularly high dPSls, e.g. by using an oligonucleotide having a sequence of SEQ ID NO: 7, 22-26, 32, 34-36, 38-39, 41, 47, 49, 54, 56-59, 63-64, 70-71, 75-77, 79-80, 84-86, 88, or 89, may be particularly useful in the treatment of Wolman Disease or Cholesteryl Ester Storage Disease associated with exon 8 skipping (e.g., Wolman Disease or Cholesteryl Ester Storage Disease caused by the c.894G>A mutation).

TABLE-US-00001 TABLE 1 Start on Stop on Start Chr10 End Chr10 SEQ ID SEQ ID SEQ ID NO: PSI Sequence [hg19/b37] [hg19/b37] NO: 1 NO: 1 length dPSI 84 0.7852 CCCAAATGCACTCCTGG 90982242 90982258 34403 34419 17 0.5099 70 0.7145 ATGCACTCCTGGAATG 90982247 90982262 34399 34414 16 0.4391 71 0.6913 CAAATGCACTCCTGGAATG 90982244 90982262 34399 34417 19 0.4160 75 0.6730 TCTATTTGGAAAGGGTTT 90982186 90982203 34458 34475 18 0.3977 22 0.6562 ACCCCAAATGCACTCCTGG 90982240 90982258 34403 34421 19 0.3809 56 0.6546 AACCCCAAATGCACTCCTGG 90982239 90982258 34403 34422 20 0.3792 80 0.6459 AAATGCACTCCTGGAA 90982245 90982260 34401 34416 16 0.3706 79 0.6416 CCAAATGCACTCCTGGA 90982243 90982259 34402 34418 17 0.3662 26 0.6392 CCAAATGCACTCCTGG 90982243 90982258 34403 34418 16 0.3638 85 0.6381 ACCCCAAATGCACTCCTGGA 90982240 90982259 34402 34421 20 0.3628 63 0.6267 CCAAATGCACTCCTGGAATG 90982243 90982262 34399 34418 20 0.3514 88 0.6180 ATGTTGATTTTACATGAA 90982223 90982240 34421 34438 18 0.3426 23 0.6154 CCCAAATGCACTCCTGGA 90982242 90982259 34402 34419 18 0.3400 41 0.6127 CCCCAAATGCACTCCTGG 90982241 90982258 34403 34420 18 0.3374 24 0.6071 CAAATGCACTCCTGGAA 90982244 90982260 34401 34417 17 0.3318 86 0.5701 TCTATTTGGAAAGGGTTTGC 90982186 90982205 34456 34475 20 0.2948 59 0.5659 CCCAAATGCACTCCTGGAA 90982242 90982260 34401 34419 19 0.2906 76 0.5484 CCCCAAATGCACTCCTGGA 90982241 90982259 34402 34420 19 0.2730 38 0.5447 CCAAATGCACTCCTGGAA 90982243 90982260 34401 34418 18 0.2694 49 0.5282 AATGCACTCCTGGAATG 90982246 90982262 34399 34415 17 0.2529 58 0.5196 CAAATGCACTCCTGGA 90982244 90982259 34402 34417 16 0.2442 7 0.5122 CAAATGCACTCCTGGAAT 90982244 90982261 34400 34417 18 0.2369 32 0.5042 AAATGCACTCCTGGAATG 90982245 90982262 34399 34416 18 0.2288 34 0.4909 CCCCAAATGCACTCCTGGAA 90982241 90982260 34401 34420 20 0.2155 54 0.4570 TATTTGGAAAGGGTTTGC 90982188 90982205 34456 34473 18 0.1817 39 0.4417 TTCTATTTGGAAAGGG 90982185 90982200 34461 34476 16 0.1664 25 0.4074 AATGCACTCCTGGAAT 90982246 90982261 34400 34415 16 0.1321 57 0.4062 ACCCCAAATGCACTCCTG 90982240 90982257 34404 34421 18 0.1308 35 0.4044 CCCAAATGCACTCCTGGAAT 90982242 90982261 34400 34419 20 0.1290 89 0.4024 CCAAATGCACTCCTGGAAT 90982243 90982261 34400 34418 19 0.1271 36 0.3998 GTCTTTCTATTTGGAAAGG 90982181 90982199 34462 34480 19 0.1245 77 0.3893 CCCCAAATGCACTCCTG 90982241 90982257 34404 34420 17 0.1140 64 0.3840 AAATGCACTCCTGGAATGC 90982245 90982263 34398 34416 19 0.1086 51 0.3600 CCCAAATGCACTCCTG 90982242 90982257 34404 34419 16 0.0847 47 0.3547 AAATGCACTCCTGGAAT 90982245 90982261 34400 34416 17 0.0794 12 0.3501 TCTGATGTTGATTTTACA 90982219 90982236 34425 34442 18 0.0748 48 0.3464 GCAGGTTGTCTTTCTAT 90982174 90982190 34471 34487 17 0.0711 40 0.3393 GTAAGCAGGTTGTCTTTCTA 90982170 90982189 34472 34491 20 0.0640 78 0.3353 TCTGATGTTGATTTTA 90982219 90982234 34427 34442 16 0.0600 45 0.3272 AACCCCAAATGCACTCCTG 90982239 90982257 34404 34422 19 0.0519 83 0.3185 AATGCACTCCTGGAATGC 90982246 90982263 34398 34415 18 0.0432 62 0.3071 TTCTGATGTTGATTTTA 90982218 90982234 34427 34443 17 0.0318 74 0.3064 TGTTGATTTTACATGAACC 90982224 90982242 34419 34437 19 0.0311 13 0.3058 ACCTTTCTGATGTTGATT 90982214 90982231 34430 34447 18 0.0305 9 0.3054 ACATGAACCCCAAATGCA 90982234 90982251 34410 34427 18 0.0301 15 0.3033 CAGATTTGTAAGCAGG 90982163 90982178 34483 34498 16 0.0280 67 0.2930 ACCCCAAATGCACTCC 90982240 90982255 34406 34421 16 0.0176 29 0.2911 ATGCACTCCTGGAATGC 90982247 90982263 34398 34414 17 0.0157 68 0.2895 ATAATAAACATTGTAT 90982394 90982409 34252 34267 16 0.0142 46 0.2891 TTTGTAAGCAGGTTGTCTTT 90982167 90982186 34475 34494 20 0.0137 37 0.2889 TTGTAAGCAGGTTGTCTT 90982168 90982185 34476 34493 18 0.0135 60 0.2884 GTTGATTTTACATGAACCC 90982225 90982243 34418 34436 19 0.0131 11 0.2872 TGTTGATTTTACATGAAC 90982224 90982241 34420 34437 18 0.0119 72 0.2813 TGCACTCCTGGAATGCC 90982248 90982264 34397 34413 17 0.0060 98 0.2809 AATACATTGAAATGAAGA 90982350 90982367 34294 34311 18 0.0055 14 0.2781 CCCAGACCTTTCTGATGT 90982209 90982226 34435 34452 18 0.0027 10 0.2778 ATTTTACATGAACCCCAA 90982229 90982246 34415 34432 18 0.0024 81 0.2755 ATAATAAACATTGTATTT 90982394 90982411 34250 34267 18 0.0002 65 0.2739 ATGCACTCCTGGAATGCC 90982247 90982264 34397 34414 18 −0.0014 18 0.2729 GCACTCCTGGAATGCC 90982249 90982264 34397 34412 16 −0.0025 33 0.2716 ACCCCAAATGCACTCCT 90982240 90982256 34405 34421 17 −0.0037 90 0.2711 TAATAAACATTGTATTTT 90982395 90982412 34249 34266 18 −0.0042 42 0.2707 CAAATGCACTCCTGGAATGC 90982244 90982263 34398 34417 20 −0.0046 21 0.2694 TTCAAAGCACTAAAAACT 90982417 90982434 34227 34244 18 −0.0059 55 0.2694 AGCACTAAAAACTAGA 90982422 90982437 34224 34239 16 −0.0059 50 0.2686 TGCACTCCTGGAATGC 90982248 90982263 34398 34413 16 −0.0067 96 0.2685 AATGAAGAATGAAAACAG 90982360 90982377 34284 34301 18 −0.0068 27 0.2677 TGATAATAAACATTGTA 90982392 90982408 34253 34269 17 −0.0076 94 0.2675 GAAAACAGCATTAAGGTG 90982370 90982387 34274 34291 18 −0.0078 95 0.2665 AGAATGAAAACAGCATTA 90982365 90982382 34279 34296 18 −0.0088 93 0.2636 CAGCATTAAGGTGGCATT 90982375 90982392 34269 34286 18 −0.0117 20 0.2616 GCCCTTCAAAGCACTAAA 90982413 90982430 34231 34248 18 −0.0137 16 0.2615 TCAAAGCACTAAAAAC 90982418 90982433 34228 34243 16 −0.0139 31 0.2605 TGCCCTTCAAAGCACT 90982412 90982427 34234 34249 16 −0.0149 30 0.2594 AAATGCACTCCTGGAATGCC 90982245 90982264 34397 34416 20 −0.0160 8 0.2593 AACCCCAAATGCACTCCT 90982239 90982256 34405 34422 18 −0.0160 43 0.2557 AATGCACTCCTGGAATGCC 90982246 90982264 34397 34415 19 −0.0196 53 0.2525 CCCCAAATGCACTCCT 90982241 90982256 34405 34420 16 −0.0228 66 0.2462 GCACTCCTGGAATGCCT 90982249 90982265 34396 34412 17 −0.0292 52 0.2460 AACCCCAAATGCACTCC 90982239 90982255 34406 34422 17 −0.0294 44 0.2396 TGCACTCCTGGAATGCCT 90982248 90982265 34396 34413 18 −0.0357 19 0.2387 ATGCACTCCTGGAATGCCT 90982247 90982265 34396 34414 19 −0.0367 17 0.2357 AACCCCAAATGCACTC 90982239 90982254 34407 34422 16 −0.0396 97 0.2347 ATTGAAATGAAGAATGAA 90982355 90982372 34289 34306 18 −0.0407 73 0.2325 AATGCACTCCTGGAATGCCT 90982246 90982265 34396 34415 20 −0.0429 99 0.2197 AAATAAATACATTGAAAT 90982345 90982362 34299 34316 18 −0.0556 92 0.1946 TAAGGTGGCATTGATAAT 90982381 90982398 34263 34280 18 −0.0807 87 0.1649 ATGCACTCCTGGAATGCCTA 90982247 90982266 34395 34414 20 −0.1104 69 0.1344 TGCACTCCTGGAATGCCTA 90982248 90982266 34395 34413 19 −0.1409 100 0.1325 CTGCAAAATAAATACATT 90982340 90982357 34304 34321 18 −0.1429 6 0.0909 GCACTCCTGGAATGCCTA 90982249 90982266 34395 34412 18 −0.1845 4 0.0827 AATGCCTACTTGGCTCCA 90982259 90982276 34385 34402 18 −0.1926 28 0.0753 CACTCCTGGAATGCCT 90982250 90982265 34396 34411 16 −0.2000 113 0.0682 CCAGTGTAACATGTTTTG 90982274 90982291 34370 34387 18 −0.2071 5 0.0469 CCTGGAATGCCTACTTGG 90982254 90982271 34390 34407 18 −0.2284 101 0.0457 CTAGACTGCAAAATAAAT 90982335 90982352 34309 34326 18 −0.2296 3 0.0422 CTACTTGGCTCCAGTGTA 90982264 90982281 34380 34397 18 −0.2331 91 0.0418 TTGATAATAAACATTGTA 90982391 90982408 34253 34270 18 −0.2336 112 0.0247 GTAACATGTTTTGCACAG 90982279 90982296 34365 34382 18 −0.2506 61 0.0224 ACTCCTGGAATGCCTA 90982251 90982266 34395 34410 16 −0.2530 111 0.0215 ATGTTTTGCACAGAAGTT 90982284 90982301 34360 34377 18 −0.2538 104 0.0189 GTATATACATCCACTCTA 90982320 90982337 34324 34341 18 −0.2564 105 0.0183 GTGTTGTATATACATCCA 90982315 90982332 34329 34346 18 −0.2570 82 0.0158 CACTCCTGGAATGCCTA 90982250 90982266 34395 34411 17 −0.2595 110 0.0117 TTGCACAGAAGTTCCAGC 90982289 90982306 34355 34372 18 −0.2636 106 0.0073 AGAATGTGTTGTATATAC 90982310 90982327 34334 34351 18 −0.2680 109 0.0067 AGAAGTTCCAGCAGGAGA 90982295 90982312 34349 34366 18 −0.2686 102 0.0051 CCACTCTAGACTGCAAAA 90982330 90982347 34314 34331 18 −0.2703 103 0.0032 TACATCCACTCTAGACTG 90982325 90982342 34319 34336 18 −0.2721 107 0.0015 GCAGGAGAATGTGTTGTA 90982305 90982322 34339 34356 18 −0.2738 108 0.0000 TTCCAGCAGGAGAATGTG 90982300 90982317 34344 34361 18 −0.2753 114 0.0000 TGGCTCCAGTGTAACATG 90982269 90982286 34375 34392 18 −0.2753

Example 2 Characterization of Target Regions (Hot Spots) for Increasing Inclusion of LIPA Exon 8

[0245] To determine the potential patient tolerability of the screened antisense oligonucleotides, HepG2 (human liver cancer) cells were transfected with antisense oligonucleotides having the sequences set forth in Table 2. Viability of the cells was measured with values normalized to a negative control. A low viability score translates to some observed toxicity in vitro. These values were plotted against their respective PSI in FIG. 4.

[0246] These observations suggest antisense oligonucleotides targeting the surrounding introns of exon 8 may be effective in the treatment of Wolman Disease or Cholesteryl Ester Storage Disease associated with exon 8 skipping (e.g., Wolman Disease or Cholesteryl Ester Storage Disease caused by the c.894G>A mutation).

[0247] These observations also suggest certain antisense oligonucleotides targeting the surrounding introns of exon 8, namely SEQ ID NOs: 84, 26, 22, 85, 76, 41, 56, 23, 79, 59, 58, 34, and 54 (corresponding to positions 34401-34422 and 34456-34473 in SEQ ID NO: 1; which correspond to chr10: 90982239-90982260 and chr10: 90982188-90982205, respectively) may be particularly effective for use in the treatment of Wolman Disease or Cholesteryl Ester Storage Disease associated with exon 8 skipping (e.g., Wolman Disease or Cholesteryl Ester Storage Disease caused by the c.894G>A mutation).

TABLE-US-00002 TABLE 2 SEQ ID NO PSI Viability 84 0.7852 1.056 70 0.7145 0.7418 71 0.6913 0.6839 75 0.6730 0.7306 22 0.6562 0.9804 56 0.6546 0.9275 80 0.6459 0.7425 79 0.6416 0.9131 26 0.6392 1.0282 85 0.6381 0.9497 63 0.6267 0.627 88 0.6180 0.9578 23 0.6154 0.9459 41 0.6127 0.9594 24 0.6071 0.8187 86 0.5701 0.7442 59 0.5659 0.938 76 0.5484 1.0274 38 0.5447 0.8577 49 0.5282 0.5794 58 0.5196 0.932 7 0.5122 0.5005 32 0.5042 0.5288 34 0.4909 0.9153 54 0.4570 0.9255 39 0.4417 0.6035 25 0.4074 0.6308 57 0.4062 0.9989 35 0.4044 0.8695 89 0.4024 0.781 36 0.3998 1.0084 77 0.3893 0.9956 64 0.3840 0.7294 51 0.3600 1.0239 47 0.3547 0.5962 12 0.3501 0.6463 48 0.3464 0.8973 40 0.3393 0.8518 78 0.3353 0.9404 45 0.3272 0.9834 83 0.3185 0.8834 62 0.3071 0.9463 74 0.3064 1.0092 13 0.3058 0.8395 9 0.3054 1.0039 67 0.2930 1.022 29 0.2911 0.8432 68 0.2895 1.0396 46 0.2891 0.9373 37 0.2889 0.9647 60 0.2884 1.029 11 0.2872 0.8863 72 0.2813 0.8834 14 0.2781 0.7326 10 0.2778 1.0056 81 0.2755 0.9486 65 0.2739 0.7999 33 0.2716 0.9769 90 0.2711 1.0058 42 0.2707 0.8742 21 0.2694 1.0196 55 0.2694 0.943 50 0.2686 0.7207 27 0.2677 1.0507 20 0.2616 1.0403 31 0.2605 0.9703 30 0.2594 0.7667 8 0.2593 0.9885 43 0.2557 0.9165 53 0.2525 0.9968 66 0.2462 0.913 52 0.2460 1.0471 44 0.2396 0.9439 73 0.2325 0.7117 87 0.1649 0.7232 69 0.1344 0.8563 6 0.0909 0.538 4 0.0827 0.9837 28 0.0753 0.9876 5 0.0469 0.4829 3 0.0422 0.7602 91 0.0418 1.019 61 0.0224 0.8386 82 0.0158 0.8816

Example 3 Treatment of Cholesteryl Ester Storage Disease Patient Derived Cells Containing the c.894G>A Variant with a Splice Modulating Antisense Oligonucleotide Increases LIPA Activity

[0248] To test whether the rescue of the splice aberration by antisense oligonucleotide treatment would result in a corresponding rescue of function, a LIPA enzyme assay was conducted using GM03111 (LIPA c.894G>A compound heterozygous) fibroblasts transfected with an antisense oligonucleotide shown to increase exon 8 inclusion (FIG. 5), SEQ ID NO:84. Comparing LIPA enzyme activity in GM03111 fibroblasts, with and without antisense oligonucleotide treatment, to samples from an apparently healthy donor's fibroblasts (GM09503, GM00288) or fibroblasts from a clinically unaffected donor with a LIPA heterozygous mutation (GM06122), showed that treated cell activity was rescued to the level of a clinically unaffected individual and 50% of wild-type activity (GM00288). This corresponded to a 10-fold increase in activity versus untreated fibroblasts, indicating that antisense treatment with splice switching oligonucleotides may be effective in the treatment of Wolman Disease or Cholesteryl Ester Storage Disease by partially restoring LIPA activity associated with exon 8 inclusion (e.g., Wolman Disease or Cholesteryl Ester Storage Disease caused by the c.894G>A mutation).

Example 4. Toxicology Study of Antisense Oligonucleotides Including a Targeting Moiety

[0249] The objective of the study was to determine the toxicity of 7 different GaINAc-conjugated oligonucleotides when given as a single subcutaneous injection to CD-1 mice and to assess the persistence, delayed onset or reversibility of any changes during a 7-day postdose period. The test items each contained an oligonucleotide sequence conjugated to an N-acetylgalactosamine (GaINAc) cluster show below:

##STR00023##

[0250] The test and control/vehicle items were administered on one occasion by subcutaneous injection as shown in Table 3.

TABLE-US-00003 TABLE 3 Dose Dose Dose No. of Group Level concentration Volume Animals No. Treatment.sup.a (mg/kg).sup.b (mg/mL).sup.b (mL/kg) Males Females 1 Vehicle.sup.c 0 0 5 3 3 2 22 30 6 5 3 3 3 22 100 20 5 3 3 4 22 300 60 5 3 3 5 23 30 6 5 3 3 6 23 100 20 5 3 3 7 23 300 60 5 3 3 8 26 30 6 5 3 3 9 26 100 20 5 3 3 10 26 300 60 5 3 3 11 41 30 6 5 3 3 12 41 100 20 5 3 3 13 41 300 60 5 3 3 14 56 30 6 5 3 3 15 56 100 20 5 3 3 16 56 300 60 5 3 3 17 84 30 6 5 3 3 18 84 100 20 5 3 3 19 84 300 60 5 3 3 20 85 30 6 5 3 3 21 85 100 20 5 3 3 22 85 300 60 5 3 3 .sup.aThe treatment column lists either Vehicle or a SEQ ID NO of the administered antisense oligonucleotide conjugated to the GalNAc cluster shown above. .sup.bDose levels and concentrations were expressed as the full weight of the oligonucleotide/GalNAc conjugate. .sup.cThe control animals were administered phosphate-buffered saline (PBS) alone.

[0251] Protocol. The test oligonucleotides were prepared fresh on the day of dosing. The vials of preweighed test oligonucleotides were removed from the freezer (−20±10° C.) and allowed to equilibrate for 30 minutes at room temperature. Once equilibrated, 2 mL of Phosphate Buffered Saline (PBS) were added to each vial and the formulation was mixed by gentle inversion and filtered through a 0.22 pm PVDF filter into a sterile container. The formulations were kept at room temperature pending transfer to the animal rooms for dosing.

[0252] Sixty-six male and female CD-1 mice were received from Charles River Laboratories Inc. (Raleigh, NC). On the first treatment day (Day 1) mice weighed 19.6 g to 37.9 g. Animals were assigned to their dose levels by block randomization based on body weights.

[0253] All animals were cared for, fed, watered and housed in accordance with ITR SOPs and codes of practice for animal welfare.

[0254] The test oligonucleotides and control/vehicle items were administered by subcutaneous injection on Day 1 at a dose level of 5 mL/kg per animal. The actual volume administered to each mouse was calculated and adjusted based on the most recent practical body weight of each animal. The difference between the weight of the test and control items containers before and after dosing, and the theoretical volume of dose formulations to be administered to the animals revealed that all animals received 101% to 104% of their nominal dose.

[0255] During the in-life period, mortality and clinical signs were monitored daily; the detailed clinical examinations and bodyweight were performed on Day 1 and prior to necropsy on Day 8. Food consumption was recorded on Day 1 and Day 7.

[0256] The maximum amount of blood was collected from each mouse via the abdominal aorta or cardiac puncture under isoflurane anesthesia and was transferred to the Clinical Pathology department where various clinical chemistry parameters were measured.

[0257] All animals were subjected to a gross pathology which consisted of an external examination, including identification of all clinically-recorded lesions, as well as a detailed internal examination. On completion of the gross examination, select organs were weighed, and all livers, kidneys and gross lesions were examined for microscopic findings.

[0258] Results. There were no clinical signs that could be attributed to the single subcutaneous administration of GaINAc conjugates of SEQ ID NOS: 22, 23, 26, 41, 56, 84, or 85 at dose levels up to 300 mg/kg. The clinical signs that were noted (including eating like behaviour, eye opacity, closed eyes, swelling anus, kinked tail, and crusts on the pinna) were considered to be incidental and/or procedurally related as they were observed at low incidence and/or were also noted during the pre-treatment period.

[0259] Similar to the absence of clinical signs there were no changes in body weights that could be attributed to the single subcutaneous administration of GaINAc conjugates of SEQ ID NOS: 22, 23, 26, 41, 56, 84, or 85 at a concentration of up to 300 mg/kg. The body weight fluctuations that were noted during the study were considered to be within the normal variation range for this species.

[0260] As with body weights, no changes in food consumption that could be attributed to the single subcutaneous administration of GaINAc conjugates of SEQ ID NOS: 22, 23, 26, 41, 56, 84, or 85 at dose levels up to 300 mg/kg. The food consumption fluctuations that were noted during the study were considered to be within the normal variation range for this species.

[0261] There were no changes in clinical chemistry parameters that could be attributed to the single subcutaneous administration of GaINAc conjugates of SEQ ID NOS: 22, 23, 26, 41, 56, 84, or 85 at dose levels up to 300 mg/kg. The observed values are comparable to the Control/Vehicle group and all fluctuations that were noted during the study were considered to be within the normal variation range for this species.

[0262] There were no changes in organ weights that could be attributed to the single subcutaneous administration of GaINAc conjugates of SEQ ID NOS: 22, 23, 26, 41, 56, 84, or 85 at dose levels of up to 300 mg/kg. For some animals the organ weights of some organs were higher or lower when compared to the Control/Vehicle animals; however, the weights were uncorrelated with the other animals in the group and were therefore considered to be aberrant. It must be noted that in females exhibiting estrus, the uterus weight was excluded from the group calculations.

[0263] There were no macroscopic findings in male and female mice related to the treatment of any of the seven test items: GaINAc conjugates of SEQ ID NOS: 22, 23, 26, 41, 56, 84, or 85 at doses of 30, 100, and 300 mg/kg. Findings noted infrequently at the dosing site of some treatment groups were considered procedure-related.

[0264] There were no microscopic findings in the liver and kidney of male mice related to treatment with any of the seven test items: GaINAc conjugates of SEQ ID NOS: 22, 23, 26, 41, 56, 84, or 85 at doses of 30, 100, and 300 mg/kg.

[0265] There were no microscopic findings in the liver and kidney of female mice related to treatment with two of the test items: GaINAc conjugates of SEQ ID NOS: 23 or 84 at doses of 30, 100, and 300 mg/kg.

[0266] Minimal tubular basophilic granulation was noted occasionally in the kidney of female mice treated with five of the test items: GaINAc conjugates of SEQ ID NOS: 22, 26, 41, 56, or 85 at doses of 100 and/or 300 mg/kg. There were no microscopic findings in the liver and kidney of female mice related to treatment with these five test items at a dose of 30 mg/kg.

[0267] SEQ ID NO: 22: Minimal tubular basophilic granulation was noted in the kidney of one female mouse (⅓) dosed with 300 mg/kg of the SEQ ID NO: 22 conjugated to the GaINAc cluster (Group 4).

[0268] SEQ ID NO: 26: Minimal tubular basophilic granulation was noted in the kidney of one female mouse (⅓) dosed with 300 mg/kg of the SEQ ID NO: 26 conjugated to the GaINAc cluster (Group 10).

[0269] SEQ ID NO: 41: Minimal tubular basophilic granulation was noted in the kidney of one female mouse (⅓) dosed with 100 mg/kg of DG2455 (Group 12) and one female mouse (⅓) dosed with 300 mg/kg of the SEQ ID NO: 41 conjugated to the GaINAc cluster (Group 13).

[0270] SEQ ID NO: 56: Minimal tubular basophilic granulation was noted in the kidney of one female mouse (⅓) dosed with 300 mg/kg of the SEQ ID NO: 56 conjugated to the GaINAc cluster (Group 16).

[0271] SEQ ID NO: 85: Minimal tubular basophilic granulation was noted in the kidney of one female mouse (⅓) dosed with 100 mg/kg of DG2499 (Group 21) and two female mice (⅔) dosed with 300 mg/kg of the SEQ ID NO: 85 conjugated to the GaINAc cluster (Group 22).

[0272] Findings noted infrequently at the dosing site of some treatment groups were considered procedure-related. Increased hepatocyte rarefaction was noted rarely and sporadically in the liver of female mice from some treatment groups and was considered to be within the range of expected background change.

[0273] All other microscopic findings were considered to be incidental as they were not dose-related, of low incidence or severity, and/or considered to be within the expected range of spontaneous background findings.

Example 5. Preparation of an Exemplary Targeting Moiety

[0274] Some targeting moieties may be prepared using techniques and methods known in the art and those described herein. For example, a targeting moiety may be prepared according to the procedure illustrated in Schemes 1, 2, and 3 and described herein.

##STR00024##

[0275] Preparation of compound 3: compound 1 was dissolved in DCM with compound 2 (0.9 equiv.). TMSOTf (1.0 equiv.) was added dropwise at room temperature, and the resulting mixture was stirred for 16 hours. Then, the reaction mixture was washed with 5% aqueous NaHCO3, stirred for 30 minutes, and separated, and the organic phase was collected. The organic phase was then extracted with dichloromethane (DCM) and concentrated to dryness. The product was recrystallized from 2:1 EtOAc/hexane to yield a white solid (83% yield).

[0276] Preparation of compound 4: compound 3 was dissolved in 1:1 methanol:CH.sub.2Cl.sub.2. NaOMe (0.11 equiv.) was added, and the resulting mixture was stirred under nitrogen for one hour at room temperature. The reaction mixture was concentration in vacuo to produce a while solid, which was used in the next step without further purification.

[0277] Preparation of compound 5: under inert atmosphere, 3-bromopropionitrile (12.1 equiv.) was added dropwise at 0° C. to a DMF solution of compound 4 (1.0 equiv.), and KOH (8.1 equiv.). The resulting mixture was gradually warmed to room temperature and stirred overnight. The mixture was then concentrated to give a residue, which was dissolve in EtOAc and washed with brine. The organic layer was dried over Na.sub.2SO.sub.4, concentrated, and subjected to silica gel chromatography (3:2 EtOAc/hexanes) to give the product.

[0278] Preparation of compound 6: to a stirred suspension of compound 5 in anhydrous CH.sub.2Cl.sub.2 at −70° C., DIBAL-H (1.0M) in CH.sub.2Cl.sub.2 may be added dropwise. The resulting mixture may then be stirred under inert atmosphere for 2 hours. The reaction mixture may be worked up using Fieser procedure to remove aluminum byproducts. First, the reaction mixture may be diluted with ether and warmed to 0° C. The imine intermediate may be hydrolyzed by slow addition of water. Then, 15% aqueous NaOH may be added, followed by water. The resulting mixture may be warmed to room temperature and stirred for 15 minutes, at which time, anhydrous MgSO.sub.4 may be added. The resulting mixture may be stirred for 15 minutes and filtered through a Celite® pad. The product may be purified by silica gel chromatography (3:2 EtOAc/hexanes).

[0279] Preparation of compound 7: periodic acid may be added to MeCN and stirred vigorously for 15 minutes at room temperature. Compound 6 may then be added, followed by pyridinium chlorochromate (PCC) in MeCN in 2 parts. After 3 hours stirring, the reaction mixture may be diluted with EtOAc and washed with brine, NaHCO.sub.3, brine, and dried over Na.sub.2SO.sub.4. The separated organic layer may be concentrated in vacuo to give compound 7. A quantitative yield is expected for this reaction.

[0280] Preparation of compound 8: CBz-protected β-alanine (1 equiv.) and HBTU (1.1 equiv.) were dissolved in DMF. The resulting solution was cooled to 0-10° C., and N,N-diisopropyl-N-ethylamine (DIPEA, 1.5 equiv. was added dropwise. The resulting mixture was stirred for at least 30 minutes at 0-10° C. and then cooled to −25° C. 6-amino-1-hexanol (1 equiv.) in DMF was added dropwise. After 4 hours, the reaction was quenched with water, and the resulting mixture was stirred for 1 hour and filtered, and the filter cake was washed with water. A slurry of the cake and water was filtered twice. The filter cake was dried under vacuum at 40° C. until water content was 0.3% or less (76% yield).

[0281] Preparation of compound 9: compound 1 (1.1 equiv.) was dissolved in DCM, and the resulting solution was cooled to 5-15° C. TMSOTf (1.2 equiv.) was added, and the resulting mixture was stirred for 2 hours at 5-15° C. Compound 8 (1.0 equiv.) was added to the reaction mixture, and the resulting mixture was stirred for 16 hours as 30-40° C. The reaction mixture was then cooled to 15-25° C.

[0282] Water was added, and the mixture was stirred for 10 minutes. Layers were separated, and the organic phase was washed with water twice. The organic layer was concentrated to dryness. The product was recrystallized from 2:1 EtOAc/hexane and filtered, and the filter cake was dried in vacuo to product the white solid (65% yield).

[0283] Preparation of compound 10: compound 9 was dissolved in ethyl acetate (EtOAc) under nitrogen, and trifluoroacetic acid (1.5 equiv) and Pd/C (20% (w/w)) were added with stirring. Hydrogen gas (balloon) was added to the reaction at 2 atm, and the resulting mixture was stirred at room temperature for 2 hours. Solid Pd/C was filtered through a pad of Celite®, and the filtrate was concentrated in vacuo to give a crude product, which may be used without purification in the next step (coupling to the tri-perfluorophenyl ester of compound 7).

##STR00025##

[0284] Preparation of compound 11: compound 7 (1.0 equiv.) may be dissolved in CH2012 at 0-10° C. To this solution of compound 7, DIPEA (8 equiv.) and perfluorophenyl trifluoroacetate (4 equiv.) may be added. The resulting mixture may be stirred for 2 hours at 0-10° C. and may be washed with water at 0-10° C., and the separated organic phase may be dried over Na.sub.2SO.sub.4 (200% (w/w)). The organic phase may be cooled to 0-10° C., DIPEA (3 equiv.) may be added, compound 10 (3.4 equiv.) in CH.sub.2Cl.sub.2 may be added dropwise, and the resulting mixture may be stirred for 1 hour at 0-10° C. The reaction mixture may be washed with saturated aqueous NH.sub.4Cl at 0-10° C., phases may be separate, and the organic phase may be washed with water, dried over Na.sub.2SO.sub.4 (200% (w/w)), filtered, and concentrated. To the concentrated filtrate, MTBE may be added to precipitate the solid from the remaining CH.sub.2Cl.sub.2/MTBE.

[0285] Removal of the CBz protecting group in 11: this reaction may be performed under the same hydrogenation conditions as those described for the preparation of compound 10, with the exception that the crude product may be dissolved in CH2012. The resulting solution may be added dropwise to MTBE to precipitate solid product, which may be filtered. The filter cake may then be combined with 50% (w/w) Al.sub.2O.sub.3 in CH.sub.2Cl.sub.2 at 20-25° C. for 30 minutes. The resulting mixture may be filtered, and the filtrate may be dried to give the desired product as a solid.

[0286] Preparation of compound 12: the product of CBz removal from 11 may be dissolved in DMF and stirred at room temperature for 4 hours with glutaric anhydride. The reaction mixture may be washed with saturated aqueous NaHCO.sub.3, layers may be separated, and the organic phase may be washed with CH.sub.2Cl.sub.2. The resulting solution may be dried in vacuo to give the product.

##STR00026##

[0287] Preparation of compound 13: compound 12 (1 equiv.) may be dissolved in CH.sub.2Cl.sub.2 at 0-10° C. DIPEA (2.0 equiv.) and perfluorophenyl trifluoroacetate (1.5 equiv.) may be added. The reaction mixture may be stirred for 2 hours at 0-10° C. and washed with water at 0-10° C., and the separated organic phase may be dried over Na.sub.2SO.sub.4 (200% (w/w)) and filtered. The filtrate may be concentrated, and the product may be isolated as a solid from CH.sub.2Cl.sub.2/MTB.

[0288] Preparation of compound 14: compound 12 (1.0 equiv.) and HBTU (1.1 equiv.) may be dissolved in CH.sub.2Cl.sub.2. The resulting solution may be stirred and cooled to 0-10° C. DIPEA (1.5 equiv.) may be added, and the resulting mixture may be stirred at 0-10° C. for 15 minutes, at which time, 6-amino-1-hexanol (1.05 equiv.) in CH.sub.2Cl.sub.2 may be added dropwise, and the reaction mixture may be stirred for 1 hour at 0-10° C. CH.sub.2Cl.sub.2 may be added to the reaction mixture, followed by the addition of aqueous saturated NH.sub.4C.sub.1 at 0-10° C. Layers may be separated, and the organic phase may be washed with NH.sub.4Cl, dried over Na.sub.2SO.sub.4 (200% (w/w)), filtered, and concentrated. To the concentrated filtrate, MTBE may be added to precipitate the solid from CH.sub.2Cl.sub.2/MTBE. The resulting mixture may be filtered, and the filter cake may be dissolved in CH.sub.2Cl.sub.2. To the resulting solution, Al.sub.2O.sub.3 (100% (w/w)) may be added, and the resulting mixture may be stirred for an hour, at which time, the mixture may be filtered, and the filtrate may be dried in vacuo to give the product as a solid.

[0289] Preparation of compound 15: Compound 14 (1.0 equiv.), N-methylimidazole (0.2 equiv.), and tetrazole (0.8 equiv.) may be dissolved in DMF. The resulting solution may be stirred and cooled to 0-10° C. 2-Cyanoethyl-N,N,N′,N′-tetraisopropylphosphordiamidite (3.0 equiv.) may be added dropwise, and the resulting mixture may be stirred for 1 hour at room temperature. The reaction may be quenched by the dropwise addition of water at 0-10° C. Saturated aqueous NaCl and EtOAc may be added at 0-10° C. Layers may be separated, and the aqueous phase may be extracted with EtOAc twice. The organic phase may be dried over Na.sub.2SO.sub.4, filtered, and concentrated. The product may be isolated as a solid by precipitation from CH.sub.2Cl.sub.2/MTBE.

[0290] Compound 13 and compound 15 may be used in the preparation of compounds of the invention described herein.

Example 6. Preparation of an Exemplary Targeting Moiety

[0291] Compound 15 from Example 5 may be coupled to an oligonucleotide to produce compound 16.

##STR00027##

[0292] For example, reaction between compound 15 and oligo-O—P(O)(OH)—O—(CH.sub.2).sub.6—NH.sub.2, or a salt thereof, in buffered medium (e.g., sodium tetraborate buffer at pH 8.5) may produce compound 16.

Example 7. Preparation of an Exemplary Targeting Moiety

[0293] Additionally, a targeting moiety may be prepared as shown in Scheme 4 and described below, e.g., from compound 11 in Example 5.

##STR00028##

[0294] Removal of the CBz protecting group in 11: this reaction may be performed under the same hydrogenation conditions as those described for the preparation of compound 10, with the exception that the crude product may be dissolved in CH2012. The resulting solution may be added dropwise to MTBE to precipitate solid product, which may be filtered. The filter cake may then be combined with 50% (w/w) Al.sub.2O.sub.3 in CH.sub.2Cl.sub.2 at 20-25° C. for 30 minutes. The resulting mixture may be filtered, and the filtrate may be dried to give the desired product as a solid.

[0295] Preparation of compound 17: the product of CBz removal from 11 may be dissolved in DMF and stirred at room temperature for 4 hours with succinic anhydride. The reaction mixture may be washed with saturated aqueous NaHCO.sub.3, layers may be separated, and the organic phase may be washed with CH.sub.2Cl.sub.2. The resulting solution may be dried in vacuo to give the product.

[0296] Preparation of compound 18: compound 17 (1 equiv.) may be dissolved in CH.sub.2Cl.sub.2 at 0-10° C. DIPEA (2.0 equiv.) and perfluorophenyl trifluoroacetate (1.5 equiv.) may be added. The reaction mixture may be stirred for 2 hours at 0-10° C. and washed with water at 0-10° C., and the separated organic phase may be dried over Na.sub.2SO.sub.4 (200% (w/w)) and filtered. The filtrate may be concentrated, and the product may be isolated as a solid from CH.sub.2Cl.sub.2/MTBE.

[0297] Preparation of compound 19: compound 17 (1.0 equiv.) and HBTU (1.1 equiv.) may be dissolved in CH.sub.2Cl.sub.2. The resulting solution may be stirred and cooled to 0-10° C. DIPEA (1.5 equiv.) may be added, and the resulting mixture may be stirred at 0-10° C. for 15 minutes, at which time, 6-amino-1-hexanol (1.05 equiv.) in CH.sub.2Cl.sub.2 may be added dropwise, and the reaction mixture may be stirred for 1 hour at 0-10° C. CH.sub.2Cl.sub.2 may be added to the reaction mixture, followed by the addition of aqueous saturated NH.sub.4Cl at 0-10° C. Layers may be separated, and the organic phase may be washed with NH.sub.4Cl, dried over Na.sub.2SO.sub.4 (200% (w/w)), filtered, and concentrated. To the concentrated filtrate, MTBE may be added to precipitate the solid from CH.sub.2Cl.sub.2/MTBE. The resulting mixture may be filtered, and the filter cake may be dissolved in CH.sub.2Cl.sub.2. To the resulting solution, Al.sub.2O.sub.3 (100% (w/w)) may be added, and the resulting mixture may be stirred for an hour, at which time, the mixture may be filtered, and the filtrate may be dried in vacuo to give the product as a solid.

[0298] Preparation of compound 20: Compound 19 (1.0 equiv.), N-methylimidazole (0.2 equiv.), and tetrazole (0.8 equiv.) may be dissolved in DMF. The resulting solution may be stirred and cooled to 0-10° C. 2-Cyanoethyl-N,N,N′,N′-tetraisopropylphosphordiamidite (3.0 equiv.) may be added dropwise, and the resulting mixture may be stirred for 1 hour at room temperature. The reaction may be quenched by the dropwise addition of water at 0-10° C. Saturated aqueous NaCI and EtOAc may be added at 0-10° C. Layers may be separated, and the aqueous phase may be extracted with EtOAc twice. The organic phase may be dried over Na.sub.2SO.sub.4, filtered, and concentrated. The product may be isolated as a solid by precipitation from CH.sub.2Cl.sub.2/MTBE.

[0299] Compound 18 and compound 20 may be used in the preparation of compounds of the invention described herein.

OTHER EMBODIMENTS

[0300] Various modifications and variations of the described invention will be apparent to those skilled in the art without departing from the scope and spirit of the invention. Although the invention has been described in connection with specific embodiments, it should be understood that the invention as claimed should not be unduly limited to such specific embodiments. Indeed, various modifications of the described modes for carrying out the invention that are obvious to those skilled in the art are intended to be within the scope of the invention.