PEPTIDE PROBE FOR RECOGNITION OF G-QUADRUPLEX AND USE THEREOF IN DETECTION OF G-QUADRUPLEX IN CELL

20210403507 · 2021-12-30

    Inventors

    Cpc classification

    International classification

    Abstract

    A polypeptide probe, including: from two to four G4-binding domains, and one or more linkers disposed between every two G4-binding domains. Each G4-binding domain includes a specific motif including a sequence of amino acids

    TABLE-US-00001 (SEQ ID NO: 1) PGHLKGREIGMWY.

    Claims

    1. A polypeptide probe, comprising: from two to four G4-binding domains, and one or more linkers disposed between every two G4-binding domains; each G4-binding domain comprising a specific motif comprising a sequence of amino acids PGHLKGREIGMWY (SEQ ID NO: 1).

    2. The probe of claim 1, wherein each G4-binding domain comprises 23 amino acids.

    3. The probe of claim 2, wherein each G4-binding domain comprises a sequence of amino acids HPGHLKGREIGMWYAKKQGQKNK (SEQ ID NO: 2).

    4. The probe of claim 2, wherein the G4-binding domains are 2 in number.

    5. The probe of claim 3, wherein the G4-binding domains are 2 in number.

    6. The probe of claim 1, wherein the one or more linkers comprise from two to four hexapeptides each comprising a sequence of amino acids GTGSGA (SEQ ID NO: 71).

    7. The probe of claim 6, wherein a number of the hexapeptides is 3.

    8. The probe of claim 1, wherein the polypeptide probe further comprises a protein tag located on a C-terminal of the polypeptide probe.

    9. A method for detecting G-quadruplexes (G4s) of a cell, the method comprising applying the polypeptide probe of claim 1.

    10. The method of claim 9, wherein the G4s in the cell are detected by using chromatin immunoprecipitation-next-generation sequencing (ChIP-seq).

    11. The method of claim 10, wherein the cell is derived from a living human, mouse or chicken.

    Description

    BRIEF DESCRIPTION OF THE DRAWINGS

    [0018] FIG. 1 is a graph of binding affinities of G4P to G4s of different types of conformations;

    [0019] FIG. 2 shows a schematic drawing of clamping-binding of a G4 by a G4P;

    [0020] FIG. 3 is a comparison of G4 binding affinity between G4P and the monomeric RHAU23;

    [0021] FIG. 4 shows the profiles of G4 reads across RefSeq genes in A549, 293T, HeLa-S3, NCI-H1975, mouse 3T3, and chicken DF-1 cells;

    [0022] FIG. 5 is an example of G4 formation in human cells depicted by G4-ChIP;

    [0023] FIG. 6 is an example of G4 formation in mouse 3T3 cells depicted by G4-ChIP;

    [0024] FIG. 7 is an example of G4 formation in chicken DF-1 cells depicted by G4-ChIP;

    [0025] FIG. 8 is a graph of G4P reads at 4G PQSs as percent of total reads mapped to the genome;

    [0026] FIG. 9A shows G4P enrichment by ChIP-qPCR, where qPCR regions are indicated by arrowheads;

    [0027] FIG. 9B is a verification of G4P enrichment by ChIP-qPCR. Enrichment of G4P at indicated qPCR regions expressed as means of duplicate with range; and

    [0028] FIG. 10 shows the electrophoresis of the G4s binding to proteins monomer, G4P, triplex, and tetrad, respectively.

    DETAILED DESCRIPTION

    [0029] To further illustrate the disclosure, embodiments detailing a polypeptide probe are described below. It should be noted that the following embodiments are intended to describe and not to limit the disclosure.

    [0030] The disclosure provides a polypeptide probe for detecting the G4s, comprising from two to four G4-binding domains, and one or more linkers disposed between every two the G4-binding domains. Each G4-binding domain comprises a specific motif comprising a sequence of amino acids PGHLKGREIGMWY (SEQ ID NO: 1). The specific motif functions as a major determinant for the affinity and specificity toward G4s in RHAU (RNA Helicase associated with AU-rich element). The polypeptide probe possesses a simple structure thus minimizing the non-specific interaction with other proteins. The synergy of the G4-binding domains improves the affinity and selectivity thereof towards G4s. Therefore, the polypeptide probe has high specificity for detecting G4s, is compatible with the reducing environment in the living cells and is suitable for probing G4s.

    [0031] In certain embodiments, each G4-binding domain comprises 23 amino acids.

    [0032] In certain embodiments, each G4-binding domain comprises a sequence of amino acids HPGHLKGREIGMWYAKKQGQKNK (SEQ ID NO: 2).

    [0033] In certain embodiments, the number of the G4-binding domains is 2. Therefore, the G4-binding domains in the polypeptide probe can clamp onto the two terminal G-quartets of a G4, resulting in a tighter binding because of synergy between two binding activities.

    [0034] In certain embodiments, the one or more linkers contains from two to four hexapeptides each comprising a sequence GTGSGA. The one or more linkers are a short peptide of flexible amino acids.

    [0035] In certain embodiments, the number of the hexapeptides is 3.

    [0036] In certain embodiments, the polypeptide probe further comprises a protein tag located on the C-terminal of the polypeptide probe. The protein tag is 3×FLAG for binding to the corresponding antibody.

    [0037] The disclosure also provides a method for detecting G-quadruplexes of a cell, the method comprising applying the polypeptide probe.

    [0038] In certain embodiments, the G4s in the cell are detected by using chromatin immunoprecipitation-next-generation sequencing (ChIP-seq).

    [0039] In certain embodiments, the cell is derived from a living human, mouse or chicken.

    [0040] The polypeptide probe can detect G4 formation in living cells, which enables evaluation of G4 formation on both genome-wide scale and locus of interest, making a contribution toward research on G4s biology.

    [0041] A polypeptide probe was taken as an example of the disclosure to explain in detail about how G4s were detected in living cells. The polypeptide probe comprised two G4-binding domains, a linker comprising three hexapeptides (GTGSGA), and a protein tag located on the C-terminal of the polypeptide probe. To facilitate the extraction and purification of the polypeptide probe, a protein tag HIS is located on the N-terminal of the polypeptide probe. The polypeptide probe of the disclosure comprises two G4-binding domains RHAU23. The gene sequence of G4P was shown in SEQ ID NO: 3, and the amino acid sequence of G4P was shown in SEQ ID NO: 4.

    Example 1

    [0042] Preparation of G4P

    [0043] The gene sequence of G4P was inserted between the Nde I and EcoRI sites of pet28b vector, and introduced into a BL21-DE3 expression strain by plasmid transformation. The cells were incubated until the optical density (OD) reached 0.5, and 0.8 mM isopropylthio-galactoside (IPTG) was added and kept for 4 h at 37° C., followed by protein extraction and purification. The protein extraction was performed by using Capturem™ His-Tagged Purification Miniprep Kit (TAKARA). The purified protein was stored in a solution containing 20 mM Tris-HCl (pH 7.4), 150 mM NaCl, 0.1 mM EDTA, and 50% glycerol, and kept at −20° C.

    Example 2

    [0044] G4P Recognizes G4s with Specificity

    [0045] In Example 2, enzyme-linked immunosorbent assay (ELISA) was used to detect the G4P binding ability of the probe to 21 canonical G4s with different sequences and several non-canonical G4s as reference sequences. 21 biotinylated nucleotides (Sequences in Table 1) were annealed in a buffer containing 10 mM Tris-HCl (pH 7.4), 150 mM KCl by heating to 95° C. and slowly cooling down to 20° C. The annealed oligonucleotides were immobilized on a streptavidin-coated plate (Sigma-Aldrich), followed by incubating with G4P or RHAU23 at the indicated concentrations. Detection of bound proteins used an anti-FLAG Mouse Monoclonal Antibody (Transgen Biotech, China), an HRP Conjugated Goat Anti-Mouse IgG (H+L) secondary antibody (Transgen Biotech, China), and a TMB ELISA Substrate (Transgen Biotech, China) according to the manufacturer's instructions. Absorbance was measured at 450 nm on a Multi-Plate Reader (Biotek, USA). Dissociation constants (K.sub.d) were obtained from the binding curves. The standard error of mean values was calculated from three replicates.

    TABLE-US-00002 TABLE 1 Kd of G4P to different G4 structures Name Sequence (5′ to 3′) Structure Topology Kd (nM) ± SD DRD3 GGGCTGGGCTGGGCTTG G4 Antiparallel  0.31 ± 0.03 GCCGGG (SEQ ID NO: 8) T2B-1 TATTGTTGGTGGGTGGGT G4, Bulge Parallel  0.34 ± 0.02 GGGTTAT (SEQ ID NO: 9) C20orf24 GGGCCGGGCCTGGGGCG G4 Mixed  0.35 ± 0.03 CGCGGG (SEQ ID NO: 10) parallel and antiparallel CSTB GGGGCGGGGCGCGGGGC G4 Parallel  0.37 ± 0.03 GGGG (SEQ ID NO: 11) hTel GG(TTAGGG)4TTAG (SEQ G4 Mixed  0.37 ± 0.03 ID NO: 12) parallel and antiparallel 2G DNA + See rows at bottom 2/2 Parallel  0.42 ± 0.06 2G DNA/RNA RNA Hybrid G4 NRAS AGGGAGGGGCGGGUCU G4 ND  0.48 ± 0.03 RNA GGG (SEQ ID NO: 13) ABTB2 TGGGCGGAGGGAAGTGG G4, GVBQ ND  0.59 ± 0.04 GA (SEQ ID NO: 14) 3G DNA + See rows at bottom 3/1 Parallel  0.59 ± 0.10 1G DNA/RNA RNA Hybrid G4 hTel-3G TTAGGGTTAGGGTTAGG intermolecular Mixed  0.71 ± 0.05 G (SEQ ID NO: 15) G4 parallel and antiparallel TB-1 TATTGTGGTGGGTGGGT G4, Bulge ND  0.74 ± 0.05 GGGTTAT (SEQ ID NO: 16) HT TTGGGTTAGGGTTAGGG G4 Mixed  0.79 ± 0.05 TTAGGGA (SEQ ID NO: parallel and 17) antiparallel MYOG AGGGTGGGCTGGGAGGT G4, GVBQ ND  0.82 ± 0.05 (SEQ ID NO: 18) TERRA3 UUAGGGUUAGGGUUAG intermolecular Parallel  0.83 ± 0.05 G GGUUA (SEQ ID NO: 19 G4 Bcl2 GGGCGCGGGAGGAAGG G4 Mixed   0.9 ± 0.08 GGGCGGG (SEQ ID NO: parallel and 20) antiparallel c-MYC AGGGTGGGGAGGGTGGG G4 Parallel  0.99 ± 0.1 GA (SEQ ID NO: 21) TERRA UUAGGGUUAGGGUUAG G4 Parallel 1.437 ± 0.11 GGUUAGGG (SEQ ID NO: 22) TBA GGTTGGTGTGGTTGG G4 Antiparallel  1.71 ± 0.1 (SEQ ID NO: 23) C9orf72 GGGGCCGGGGCCGGGGC G4 Antiparallel  1.89 ± 0.21 CGGGGCC (SEQ ID NO: 24) SPB1 GGCGAGGAGGGGCGTGG G4 Antiparallel  2.83 ± 0.15 CCGGC (SEQ ID NO: 25) HRAS1 TCGGGTTGCGGGCGCAG G4 Antiparallel  3.11 ± 0.25 GGCACGGGCG (SEQ ID NO: 26) DNA TCGCGGCGGCGCGCGGC DNA stem NA (not UD (hard to Hairpin GATTGCGTTTCGCCGCGC loop applicable) detect) GCCGCGCCGA (SEQ ID NO: 27) Bcl2-C- CCCGCCCCCTTCCTCCCG i-motif NA UD rich CGCCC (SEQ ID NO: 28) c-MYC- AGCGTGGGGAGCGTGGG ssDNA NA UD M GA (SEQ ID NO: 29) hTel- A(CCCTAA)4T5(TTAGGG) dsDNA NA UD Duplaex 4 (SEQ ID NO: 30) ssDNA TTCACGCGGGCTCGGAG ssDNA NA UD TGGTT (SEQ ID NO: 31) hTel-C- CCCTAACCCTAACCCTA i-motif NA UD rich ACCCT (SEQ ID NO: 32) RNA CAGUACAGAUCUGUACU RNA stem NA UD Hairpin G (SEQ ID NO: 33) loop TERRA- UUACCGUUACCGUUACC ssRNA NA UD mut GUUACCG (SEQ ID NO: 34) 1G DNA AAGCAGACAGCTAGTGA ssDNA NA UD ATTCAGATAGATGGGTT GCTCTACAAGCGTATAA CTGT (SEQ ID NO: 35) 1G DNA + See below DNA: RNA NA UD 1G hybrid RNA duplex 1G DNA AAGCAGACAGCTAGTGA ND (not ATTCAGATAGATGGGTT determined) GCTCTACAAGCGTATAA CTGT (SEQ ID NO: 36) 1G RNA UACGCUUGUAGAGCUUG ND GGUU (SEQ ID NO: 37) 2G DNA AAGCAGACAGCTAGTGA ND ATTCAGATGGGTGGGTT GCTCTACAAGCGTATAA CTGT (SEQ ID NO: 38) 2G RNA UACGCUUGUAGAGCUUG ND GGUGGGUU (SEQ ID NO: 39) 3G DNA AAGCAGACAGCTAGTGA ND ATTCGGGTGGGTGGGTT GCTCTACAAGCGTATAA CTGT (SEQ ID NO: 40)

    [0046] FIG. 1 is a graph of binding affinity of G4P to G4s of different types or configurations, where abscissa represents the probe concentration and ordinate represents the absorbance.

    [0047] Referring to FIG. 1 and Table 1, in the 21 G4s that included canonical DNA and RNA G4s, intermolecular DNA G4s, DNA: RNA hybrid G4s, G-vacancy-bearing G4s (GVBQs) and bulge G4s, the G4P showed a K.sub.d of sub-nM to 16 G4s and of 1-3 nM to 5 G4s. The K.sub.d values for these G4s ranged from 0.31-3.11 nM within one order of magnitude. The polypeptide probe G4P had a high affinity for the canonical G4P, and other forms of G4s were also captured. Therefore, the following were searched for PQSs of the three well-characterized non-canonical G4s, i.e. G4s with one loop of 8-15 nucleotides (4GL15), G-vacancy-bearing G4s (GVBQ), G4 with a bulge (Bulge), respectively. The G4P had no binding to the non-G4 DNAs or RNAs, including single-stranded DNA (ssDNA), RNA hairpin, DNA: RNA heteroduplex, and i-motif. Analysis of the result indicated that the polypeptide probe G4P of the disclosure can bind canonical and non-canonical G4s with high affinity and specificity.

    [0048] FIG. 2 showed a clamping-binding of a G4 by a G4P. Each of the two terminal guanine quartets (G-quartet) of a G4 can bind the RHAU23. Therefore, the two RHAU23s in the G4P can clamp onto the two terminal G-quartets of the G4, resulting in a tighter binding because of synergy between two binding activities.

    [0049] A comparison of G4 binding affinity between G4P and a monomeric RHAU23 was further performed. A G4P comprising only one G4-binding domain was termed monomeric RHAU23. FIG. 3 showed a comparison of G4 binding affinity between G4P and the monomeric RHAU23; where abscissa represents the probe concentration and ordinate represents the absorbance. As shown in FIG. 3, unlike the RHAU23 which only binds parallel, but not nonparallel G4s, the G4P showed almost no discrimination between the parallel and nonparallel G4. And the K.sub.d of the G4P to the parallel G4s increased by 10 folds or much more in comparison with the monomeric RHAU23.

    Example 3

    [0050] G4P Recognizes G4s in Living Cells

    [0051] To capture G4s in living cells, the G4P were expressed in the cultured human A549 cells by transfection with a plasmid and performed G4-ChIP. The G4-ChIP libraries were sequenced and reads were mapped to the corresponding genomes.

    [0052] The detailed description is as follows:

    [0053] Plasmid construction for G4P-ChIP:

    [0054] The DNA encoding G4P was synthesized by Generay Biotechnology (Shanghai, China), and inserted between the Nde I and EcoRI sites of pIRES2-EGFP vector to obtain pG4P-IRES2-EGFP. The DNA fragment containing nuclear localization signal (NLS: PKKKRKV) of the SV40 large antigen was synthesized by Sangon (Shanghai, China), and inserted into the Nde I site of the pG4P-IRES2-EGFP to obtain a plasmid pNLS-G4P-IRES2-EGFP.

    [0055] The DNA fragment expressing NLS-G4P and eGFP was amplified from the pNLS-G4P-IRES2-EGFP and inserted into the AAVS1 donor plasmid between the Spe I and Sal I sites. The AAVS1 loci specific guide RNA sequence (5′-GTCACCAATCCTGTCCCTAG-3′) was designed by the online CRISPR tool (crispr.mit.edu.) and inserted into the PX330 plasmid between two Bbs I sites.

    [0056] Cell lines: A549, NCI-H1975, 293T, HeLa-S3, 3T3, and DF-1 cells were kindly provided by Stem Cell Bank, Chinese Academy of Sciences.

    [0057] Cell culture conditions: the cells were grown in DMEM comprising 10% Fetal Bovine Serum (FBS), 100 U/mL penicillin, and 0.1 mg/mL Streptomycin.

    [0058] Transient transfection and gene knock-in:

    [0059] For transient transfection, the cells were cultured in 15 cm dishes to 70-80% confluence and transfected with 30 μg of pNLS-G4P-IRES2-EGFP using lipofectamine 3000 (Thermo Scientific) according to the manufacturer's instructions. The cells were cultured for an additional 24 hours before harvesting.

    [0060] For gene knock-in, AAVS1 donor and PX330 plasmid containing G4P and AAVS1 gRNA were co-transfected into 293T cells using lipofectamine 2000 (Thermo Scientific). After 24 hours, GFP positive single cell was sorted by a flow cytometer (MoFlo XDP, Beckman) into a 96-well plate. The cells were cultured for two weeks and the cell lines with a stable expression of G4P were verified by PCR.

    [0061] G4-ChIP and DNA library construction:

    [0062] Approximately 0.5-1×10.sup.7 transiently or stably transfected cells expressing G4P were crosslinked with 1% formaldehyde for 20 min at room temperature. Fixation was quenched by 0.125 M glycine for 15 min. The fixed cells were washed twice with PBS, suspended in NP-40 buffer (10 mM Tris-HCl pH 7.4, 150 mM NaCl, 0.5% NP-40 and 2 mM AEBSF) and incubated on ice for 10 min. After centrifugation at 800×g for 5 min, the cell pellet was resuspended in a CHAPS buffer (20 mM Tris-HCl pH 7.4, 0.5 mM EGTA, 50 mM NaCl, 0.5% CHAPS, 10% glycerol and 2 mM AEBSF). The suspension was incubated on ice for 30 min, and centrifuged at 800×g for 5 min. The pellet was resuspended in 1 ml of 1×dsDNase digestion buffer supplied with 50 μl of dsDNase (Invitrogen, EN0771) and incubated at 37° C. for 20 min with constant agitation. A final concentration of 20 mM EDTA was added to terminate the reaction. The nuclei were pelleted by centrifugation at 15,000×g at 4° C. and the supernatant was incubated on ice. The nuclei pellet was resuspended in 500 μl of 1 wash buffer (150 mM NaCl, 10 mM Tris-HCl, pH 7.4, 0.1 mM EDTA, 0.5% Triton X-100) and sonicated for 30-60 seconds in an ice-cold water bath. After centrifugation at 15000×g for 5 min, the supernatant was collected and combined with the supernatant from the previous step.

    [0063] For library preparation, 50 μl of anti-FLAG M2 magnetic beads (Sigma-Aldrich) were washed with washing buffer (10 mM Tris-HCl, pH 8.0, 150 mM NaCl, and 0.5% Triton X-100) and blocked in the same buffer containing 75 μg/ml single-stranded sperm DNA and 1 mg/ml BSA. 1% chromatin fragment was saved as input and the remaining was incubated with blocked anti-FLAG magnetic beads in rotation at 4° C. for 3 hrs. Beads were sequentially washed ten times with washing buffer and transferred to new tubes three times. The chromatin was eluted with 300 μg/ml 3×FLAG peptide (Sigma-Aldrich) and incubated at 4° C. for 1 hour. The eluted chromatin and the input samples were incubated with proteinase K at 65° C. overnight. After sequential RNase A and proteinase K digestion, DNA fragment was cleaned by extraction with phenol: chloroform: isoamyl alcohol, followed by ethanol precipitation. Libraries were constructed from the recovered DNA fragment using the NEBNext Ultra II DNA LibraryPrep Kit from Illumina (NEB) according to the manufacturer's instructions. The next-generation sequencing was performed with Illumina HiSeq X Ten by Genewiz (Suzhou, China).

    [0064] ChIP-qPCR:

    TABLE-US-00003 TABLE 2 ChIP-qPCR primers Gene Sequence: 5′ to 3′ ADAR TGTCCTTCTCGGCTACACCTG (SEQ ID NO: 41) CACGCTTCCTCTAACATCAACG (SEQ ID NO: 42) CBFA2T2 GCTCGGCGATGGTAGGCGT (SEQ ID NO: 43) CCCGCATTCACGCCCCAC (SEQ ID NO: 44) CD47 TCACCGCAGCACGCCGAG (SEQ ID NO: 45) CGGAGATGTGGCCCCTGGTA (SEQ ID NO: 46) EGFR GAGGTGGGGACCCGAATAAA (SEQ ID NO: 47) TGGCCGAGCCTTAGAGCC (SEQ ID NO: 48) CGCCAACGCCACAACCA (SEQ ID NO: 49) CGGAGGGTCGCATCGCT (SEQ ID NO: 50) KRAS CCCGCCATTTCGGACTG (SEQ ID NO: 51) GGAGCCGCTGAGCCTCTG (SEQ ID NO: 52) MET GATGCGGGGCGACAGCT (SEQ ID NO: 53) AGCGGCGCAAGGACCAC (SEQ ID NO: 54) PIK3CA TCCGCCTTCGGGATGGTAT (SEQ ID NO: 55) GCGTTGCTGTGCGTTCTTC (SEQ ID NO: 56) CTTCCTTTGCTTCTACTCCCAGTT (SEQ ID NO: 57) GCGCACTTCCTCAACCTCC (SEQ ID NO: 58) PLAA CGGTCTCGGGACACGGACAC (SEQ ID NO: 59) GGACGTACGGGGCCTGGTG (SEQ ID NO: 60) PSMD3 CCCCAGGATGTGGAGATGAA (SEQ ID NO: 61) CCGTCTTGCCGTCTGCC (SEQ ID NO: 62) CTCAACCTTTGGCCTAAACTCC (SEQ ID NO: 63) TTGGAGGAACAAGAGGACTACAGAC (SEQ ID NO: 64) TERF1 CTCTTTGCCGAGCTTTCCG (SEQ ID NO: 65) CACCCTCTGCGCTGTTGC (SEQ ID NO: 66) TUSC1 TCGTCCCGCGCACGGATG (SEQ ID NO: 67) CCCGACAGCAGCTGGAGGAGC (SEQ ID NO: 68) WDR43 GTATGGGAGACGGCCAACAA (SEQ ID NO: 69) AGGCCAGACAGGTGCAGGTA (SEQ ID NO: 70)

    [0065] qPCR reaction was performed using the GoTaq qPCR Master Mix (Promega) and qTOWER 2.2. The cycling condition was 95° C. for 20 s followed by 45 cycles of 30 s at 95° C. and 30 s at 60° C. The enrichment of the genomic locus in the chip sample relative to the input was calculated using double delta Ct analysis with a PQS negative region as references.

    [0066] ChIP-Seq Data Analysis:

    [0067] Clean paired-end sequencing data were mapped to the human genome using Bowtie2. Mapped reads were written to bam files after being filtered by samtools view to remove poor alignments with the parameter −q 20 and by samtools rmdup to remove duplicates. Reads bam files were processed by the deeptoolsbamCompare to produce bigwig coverage file in ratio or subtract mode. Profiles and heatmaps of reads were generated from the bigwig files using the deeptools computeMatrix followed by plotProfile and plotHeatmap, respectively, with region bed files derived from the NCBI RefSeq bed file downloaded from the UCSC website (http://genome.ucsc.edu/). Coordinate duplicates in the bed files were removed. Peaks of reads enrichment were identified with the macs2 using --qvalue 0.001, -keep-dup 1, and default values for the other parameters. ChIP-Seq data from public repositories were downloaded from the GEO (https://www.ncbi.nlm.nih.gov/geo/) or Encode (http://www.encodeproject.org/) database and processed as described above.

    [0068] The disclosure used the above methods to detect G4s in living cells derived from human A549, NCI-H1975, HeLa-S3, 293T, and mouse 3T3, and chicken DF-1. The results were shown in FIGS. 4-7.

    [0069] The ability of the G4P to recognize G4s in cells was first demonstrated by the enrichment of G4P reads mapped to the canonical PQS motifs. To distinguish this type of PQSs from the non-canonical ones, they were termed 4G PQSs. The enrichment disappeared when the coordinates of the 4G PQSs were shuffled and the reads at these fake motifs counted. This result indicated a specific recognition of G4s at the 4G PQSs. The recognition of G4s was next illustrated by a peak when the G4P reads were profiled around the center of the 4G PQSs. FIG. 8 was a graph of G4P reads at 4G PQSs as % of total reads mapped to the genome. The recognition of G4s by the G4P was further verified by ChIP-qPCR (FIGS. 9A and 9B). Collectively, these results revealed a specific binding of G4P to the G4s at the 4G PQSs in the living cells.

    [0070] The G4P of the disclosure had a much smaller size, higher affinities, and little discrimination to the different forms of G4s. With the removal of >90% of the amino acid residues from the original RHAU, the G4P was unlikely to interact with other proteins, therefore, ensuring direct target recognition and specificity. Most importantly, the G4P of the disclosure overcame the problem of disulfide bonds associated with antibodies such that the G4P is applicable in living cells.

    Example 4

    [0071] G4s binds the protein comprising 1-4 binding domains RHAU23, respectively.

    [0072] The protein comprising only one binding domain RHAU23 was termed monomer, with a sequence of amino acids as shown in SEQ ID NO: 5. The protein comprising three binding domains RHAU23s were termed triplex, with a sequence of amino acids as shown in SEQ ID NO: 6. The protein comprising four binding domains RHAU23s were termed tetrad, with a sequence of amino acids as shown in SEQ ID NO: 7.

    [0073] The gene sequences of monomer, G4P, triplex, and tetrad were respectively inserted between the Nde I and EcoRI sites of pet28b vector, and introduced into a BL21-DE3 expression strain by plasmid transformation. After the culture was incubated until OD reach 0.5, the culture was induced with 0.8 mM IPTG and kept for 4 h at 37° C., followed by protein extraction and purification to obtain the proteins monomer, G4P, triplex, and tetrad. The protein extraction was performed by using Capturem™ His-Tagged Purification Miniprep Kit (TAKARA).

    [0074] The obtained proteins were mixed with the DNA of G4 at a molar concentration ratio of 2:1 and 6:1, respectively, where the DNA of G4 comprises a sequence of (GGGT).sub.4, with a concentration of 100 nM. The G4 DNAs binding to the proteins were electrophoresed in a non-denaturing polyacrylamide gel containing 75 mM KCl. FIG. 10 shows the electrophoresis of the G4s binding to proteins monomer, G4P, triplex, and tetrad, respectively. The G4 DNAs moved slower after binding to the proteins, thereby yielding a new band. The result revealed a binding ability of proteins G4P, triplex, and tetrad to G4 DNAs, among which the G4P had the highest affinity with G4s.

    [0075] It will be obvious to those skilled in the art that changes and modifications may be made, and therefore, the aim in the appended claims is to cover all such changes and modifications.