EXTRACELLULAR VESICLE COMPOSITIONS AND METHODS OF USE THEREOF

20220226384 · 2022-07-21

    Inventors

    Cpc classification

    International classification

    Abstract

    Compositions and methods for promoting generation or regeneration of the lymphatic system in a subject are provided. Compositions and methods for the treatment of lymphedema are also provided. The composition can include extracellular vesicles and a pharmaceutically acceptable carrier, and is typically cell-free. In some embodiments, the extracellular vesicles are formed by a method including culturing MSCs to produce media conditioned with the extracellular vesicles, and optionally, but preferably separating the extracellular vesicles from the media conditioned by the MSCs. In some embodiments, the extracellular vesicles include or consist of exosomes, microvesicles or a combination thereof, and they may have a size of between about 20 nm and about 500 nm. In some embodiments, extracellular vesicles include CD9, CD63, or a combination thereof and/or one or more of miR-199a-3p, miR-145-5p, miR-143-3p, miR-377-3p, miR-100-3p, miR-29a-3p, miR-495-3p, miR-29c-3p, miR-658, miR-493-3p, miR-184, and miR-27a-3p.

    Claims

    1. A method of promoting generation or regeneration of the lymphatic system in a subject comprising administering the subject a composition comprising an effective amount of extracellular vesicles formed by mesenchymal stem cells (MSCs) to increase generation of the lymphatic system.

    2. The method of claim 1, wherein the composition is cell-free.

    3. The method of claim 1, wherein the extracellular vesicles are formed by a method comprising culturing MSCs to produce media conditioned with the extracellular vesicles.

    4. The method of claim 3, wherein the method further comprises separating extracellular vesicles from the media conditioned by the MSCs.

    5. The method of claim 4, wherein the composition does not comprise the media conditioned by the MSCs.

    6. The method of claim 1, wherein the MSCs are primary cells or a cell line.

    7. The method claim 6, wherein the MSCs are from bone barrow, placenta, umbilical cord blood, adipose tissue, adult muscle, corneal stroma, or the dental pulp of deciduous teeth.

    8. The method of claim 7, wherein the MSCs are adipose-derived stem cells.

    9. The method of claim 1, wherein the extracellular vesicles comprise or consist of ectosomes, microvesicles (MV), microparticles, exosomes, oncosomes, apoptotic bodies (AB), tunneling nanotubes (TNT), or a combination thereof.

    10. The method of claim 9, wherein the extracellular vesicles comprise or consist of exosomes, microvesicles or a combination thereof.

    11. The method of claim 10, wherein the extracellular vesicles comprise or consist of a vesicles having a size of between about 20 nm and about 500 nm, or between about 20 nm and about 250 nm, or between about 20 nm and about 200 nm, or between about 20 nm and about 150 nm, or between about 20 nm and about 100 nm.

    12. The method of claim 11, wherein the extracellular vesicles comprise CD9, CD36, or a combination thereof

    13. The method of claim 11, wherein the extracellular vesicles comprise one or more of miR-199a-3p, miR-145-5p, miR-143-3p, miR-377-3p, miR-100-3p, miR-29a-3p, miR-495-3p, miR-29c-3p, miR-658, miR-493-3p, miR-184, and miR-27a-3p.

    14. The method of claim 1 comprising increasing the proliferation, migration, and/or tube formation of lymphatic endothelial cells, increasing expression of one or more lymphatic markers (e.g., hyaluronan receptor-1(LYVE-1), vascular endothelial growth factor receptor-3 (VEGFR-3), prospero homeobox 1 (Prox1), and/or podoplanin) in lymphatic endothelial cells, increasing angiogenesis, increasing lymphangiogeneisis, reducing inflammatory response, decreasing fibrosis formation, enlarging circumference and/or inducing formation of capillary vessels and/or lymphatic vessels, inducing formation of vessels that express both vascular and lymphatic markers, increasing drainage routes (e.g., for accumulated fluids), increasing HIF1-alpha expression and/or activity, reducing Prohibitin (PHB) expression and/or activity, or a combination thereof in the subject.

    15. The method of claim 1, wherein the subject has a blockage in the lymphatic system, optionally wherein the blockage prevents lymph fluid from draining well, and wherein the fluid buildup leads to swelling.

    16. The method of claim 1, wherein the subject has one or more symptoms selected from swelling of part or all of the arm(s) and/or leg(s), a feeling of heaviness or tightness, restricted range of motion, aching or discomfort, recurring infections, and fibrosis in one or both arms and/or legs.

    17. The method of claim 1, wherein the subject has been diagnosed with lymphedema.

    18. The method of claim 1, wherein the composition is administered by local injection or infusion at or adjacent to a site of interest.

    19. The method of claim 18, wherein the site of interest is in one or both arms and/or legs.

    20. The method of claim 18, wherein the site of interest is a site of lymphatic blockage and/or lymphedema.

    Description

    BRIEF DESCRIPTION OF THE DRAWINGS

    [0014] FIG. 1 is a plot showing nanotracking analysis of the size distribution of extracellular vesicles (EV) isolated from conditioned media of adipose-derived stem cells.

    [0015] FIGS. 2A-2C are bar graphs showing proliferation (2A, WST-8 assay), migration (2B, Boyden chamber assay), and tube length (2C, pixel length per field (×40 magnification, 5 random fields)) of lymphatic endothelial cells (LECs) treated with PBS, HEK 293-EVs, VEGF-C, or adipose-derived stem cells (ADSC)-EVs. For FIGS. 2A and 2B, values are means (SD) (n=6, triplicate) (*P<0.05). For FIG. 2C, values are means (SD) (n=6, duplicate) (*P<0.05).

    [0016] FIGS. 3A-3H are bar graphs showing mRNA expression levels of LYVE-1 (3A, 3E), VEGFR-3 (3B, 3F), Prox1 (3C, 3G) and podoplanin (3D, 3H) in LECs 12 hrs. (3A-3D) or 24 hrs (3E-3H) after treatment with PBS, VEGF-C, or ADSC-EVs. The samples were analyzed by qRT-PCR to evaluate the expression of genes. The data were normalized based on GAPDH expression and shown as changes relative to PBS group. Values are means (SD) (n=3, triplicate) (*P<0.05 vs PBS). GAPDH indicates glyceraldehyde-3-phosphate dehydrogenase.

    [0017] FIG. 4A is a schematic illustrating a splinted lymphedema model. After x-ray irradiation in the bilateral inguinal region at 10 Gy in a single dose twice prior to the surgery, mice were subjected to circumferential incision in the inguinal region. After the resection of inguinal lymph nodes, a 3-mm-wide silicone splint was placed in the inguinal wound and then fixed to the skin and underlying muscle to prevent wound contraction and desiccation. As a therapeutic intervention, injection of PBS or ADSC-EVs (˜40 μg) or HEK293-EVs (˜40 μg) as a thin layer to the whole leg area was performed in postoperative day 7 and 14. FIG. 4B is a line graph showing the ratio of hindlimb circumference change over 4 weeks after injections of PBS or ADSC-EVs. FIG. 4C is a bar graph showing quantitation of computed tomographic images of indocyanine green (ICG) lymphography used to assess lymphatic function of the hindlimb, after indocyanine green injection of both feet.

    [0018] FIGS. 5A-5C are bar graphs showing histological analysis of LYVE-1(+) area (%) (5A), CD31(+) area (%) (5B), CD31(+)/LYVE-1(+) overlap area (%) (5C) per 0.25 mm2 area (four random areas per limb) following treatment with PBS, HEK 293-EVs, or ADSC-EVs. All data represent mean±s.d. with P<0.05 considered as significant.

    [0019] FIGS. 6A-6B are bar graphs showing collagen 1(+) area (%) (6A) and pSMAD3(+) area (%) (6B) per 0.25 mm2 area (four random areas per limb) after treatments of PBS, HEK293-EVs, or ADSC-EVs. All data represent mean±s.d. with P<0.05 considered as significant.

    [0020] FIG. 7 is a gene interaction network map illustrating the results of an Ingenuity Pathway Analysis (IPA) evaluating the implications of miRNA expression found to be altered by ADSC-EVs treatment. This map provides the top ranked network found associated with the role of ADSC-EVs in lymphatic endothelial cells.

    DETAILED DESCRIPTION OF THE INVENTION

    I. Definitions

    [0021] As used herein, the term “carrier” or “excipient” refers to an organic or inorganic ingredient, natural or synthetic inactive ingredient in a formulation, with which one or more active ingredients are combined.

    [0022] As used herein, the term “pharmaceutically acceptable” means a non-toxic material that does not interfere with the effectiveness of the biological activity of the active ingredients.

    [0023] As used herein, the term “pharmaceutically acceptable carrier” encompasses any of the standard pharmaceutical carriers, such as a phosphate buffered saline solution, water and emulsions such as an oil/water or water/oil emulsion, and various types of wetting agents. As used herein, the terms “effective amount” or “therapeutically effective amount” means a dosage sufficient to alleviate one or more symptoms of a disorder, disease, or condition being treated, or to otherwise provide a desired pharmacologic and/or physiologic effect. The precise dosage will vary according to a variety of factors such as subject-dependent variables (e.g., age, immune system health, etc.), the disease or disorder being treated, as well as the route of administration and the pharmacokinetics of the agent being administered.

    [0024] As used herein, the term “prevention” or “preventing” means to administer a composition to a subject or a system at risk for or having a predisposition for one or more symptom caused by a disease or disorder to cause cessation of a particular symptom of the disease or disorder, a reduction or prevention of one or more symptoms of the disease or disorder, a reduction in the severity of the disease or disorder, the complete ablation of the disease or disorder, stabilization or delay of the development or progression of the disease or disorder.

    [0025] As used herein, the terms “subject,” “individual,” and “patient” refer to any individual who is the target of treatment using the disclosed compositions. The subject can be a vertebrate, for example, a mammal. Thus, the subject can be a human. The subjects can be symptomatic or asymptomatic. The term does not denote a particular age or sex. Thus, adult and newborn subjects, whether male or female, are intended to be covered. A subject can include a control subject or a test subject. As used herein, “substantially changed” means a change of at least e.g. 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 75%, 100%, or more relative to a control.

    [0026] As used herein, the term “purified,” “isolated,” and like terms relate to the isolation of a molecule or compound in a form that is substantially free (at least 60% free, preferably 75% free, and most preferably 90% free) from other components normally associated with the molecule or compound in a native environment.

    [0027] As used herein, the term “antibody” refers to natural or synthetic antibodies that bind a target antigen. The term includes polyclonal and monoclonal antibodies. In addition to intact immunoglobulin molecules, also included in the term “antibodies” are fragments or polymers of those immunoglobulin molecules, and human or humanized versions of immunoglobulin molecules that bind the target antigen.

    [0028] As used herein, “treatment” refers to the medical management of a patient with the intent to cure, ameliorate, stabilize, or prevent a disease, pathological condition, or disorder. This term includes active treatment, that is, treatment directed specifically toward the improvement of a disease, pathological condition, or disorder, and also includes causal treatment, that is, treatment directed toward removal of the cause of the associated disease, pathological condition, or disorder. In addition, this term includes palliative treatment, that is, treatment designed for the relief of symptoms rather than the curing of the disease, pathological condition, or disorder; preventative treatment, that is, treatment directed to minimizing or partially or completely inhibiting the development of the associated disease, pathological condition, or disorder; and supportive treatment, that is, treatment employed to supplement another specific therapy directed toward the improvement of the associated disease, pathological condition, or disorder.

    [0029] As used herein, the terms “inhibit” or “reduce” means to decrease, hinder or restrain a particular characteristic such as an activity, response, condition, disease, or other biological parameter. It is understood that this is typically in relation to some standard or expected value, i.e., it is relative, but that it is not always necessary for the standard or relative value to be referred to. “Inhibits” or “reduce” can also mean to hinder or restrain the synthesis, expression or function of a protein relative to a standard or control. This can include, but is not limited to, the complete ablation of the activity, response, condition, or disease. Inhibition may also include, for example, a 10% reduction in the activity, response, condition, disease, or other biological parameter as compared to the native or control level. Thus, the reduction can be about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64,65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100%, or any amount of reduction in between as compared to native or control levels.

    [0030] Recitation of ranges of values herein are merely intended to serve as a shorthand method of referring individually to each separate value falling within the range, unless otherwise indicated herein, and each separate value is incorporated into the specification as if it were individually recited herein. Use of the term “about” is intended to describe values either above or below the stated value in a range of approx. +/−10%; in other forms the values may range in value either above or below the stated value in a range of approx. +/−5%; in other forms the values may range in value either above or below the stated value in a range of approx. +/−2%; in other forms the values may range in value either above or below the stated value in a range of approx. +/−1%. The preceding ranges are intended to be made clear by context, and no further limitation is implied.

    II. Compositions

    [0031] In general, cell-based therapies have limitations such as uncontrolled differentiation, side effects, tumor formation, and incompatibility of allogenic use. On the contrary, regenerative therapy using extracellular vesicles (EVs) from MSCs have the possibility to overcome such disadvantages cell-based therapies have.

    [0032] The conditioned medium which contains cultured MSCs secretion have also been reported to have lymphangiogenic effects and therapeutic potential (Takeda et al., Ann Plast Surg., June;74(6):728-36 (2015)). MSCs can secrete cytokines, chemokines, growth factors, and EVs (Katsuda et al., Proteomics, May;13(10-11) (2013)). These EVs are produced by a variety of cell types and may pay a role as intercellular transmitters of mRNA, microRNA, and proteins (Valadi et al., Nature Cell Biology volume 9, pages 654-659 (2007)). There is some evidence indicating that some of the regenerative properties previously credited to MSCs may be related to the secreted EVs (Lai et al., Stem Cell Res., May;4(3):214-22 (2010), Bruno et al., J Am Soc Nephrol., May;20(5):1053-67 (2009)). However, the experiments discussed in the Examples below investigate the therapeutic ability of EVs secreted from ADSCs using in vitro and in vivo experimental systems and demonstrate that ADSC-EVs can modulate the phenotype of lymphatic endothelial cells (LECs), which may contribute to several lymphatic pathophysiological processes. Results further demonstrate the therapeutic potential of ADSC-EVs in relief of lymphedema using a mouse hindlimb lymphedema model. Cell-free compositions including EVs and methods of use thereof are provided. The EVs can be part of a heterogeneous mixture of factors such as conditioned media, or a fraction isolated therefrom. In other embodiments, EVs, or one or more subtypes thereof, are isolated or otherwise collected from conditioned media. The EVs, or one or more subtypes thereof, can be suspended in a pharmaceutically acceptable composition, such as a carrier or matrix or depot, prior to administration to the subject.

    [0033] A. Extracellular Vesicles

    [0034] The disclosed compositions typically are or include extracellular vesicles derived from mesenchymal cells, or an isolated or fractionated subtype or subtypes thereof. Extracellular vesicles are lipid bilayer-delimited particles that are naturally released from a cell and, unlike a cell, cannot replicate. EVs range in diameter from near the size of the smallest physically possible unilamellar liposome (around 20-30 nanometers) to as large as 10 microns or more, although the vast majority of EVs are smaller than 200 nm. EVs secreted from MSCs play a role in MSC-mediated paracrine effects via transfer of miRNAs (Spees et al., Stem Cell Res Ther., 7:125 (2016)), and may have effects on wound healing (Zhang et al., J Transl Med., February 1;13:49 (2015)), skin rejuvenation (Kim et al., Biochem Biophys Res Commun., November 18;493(2):1102-1108 (2017)), angiogenesis (Gong et al., Oncotarget, July 11;8(28):45200-45212 (2017)), adjusting immunologic function (Zhao et al., Diabetes, February;67(2):235-247 (2018)), regeneration of damaged tissue (Lai et al., Stem Cell Res., May;4(3):214-22 (2010)) as well as relief neurological disorders (Katsuda et al., Proteomics, May;13(10-11) (2013)). Diverse EV subtypes have been proposed including ectosomes, microvesicles (MV), microparticles, exosomes, oncosomes, apoptotic bodies (AB), tunneling nanotubes (TNT), and more (Yáñez-Mó, et al., J Extracell Vesicles. 4: 27066 (2015) doi:10.3402/jev.v4.27066. PMC 4433489). These EV subtypes have been defined by various, often overlapping, definitions, based mostly on biogenesis (cell pathway, cell or tissue identity, condition of origin) (Théry, et al., J Extracell Vesicles. 7 (1): 1535750 (2018). doi:10.1080/20013078.2018.1535750). However, EV subtypes may also be defined by size, constituent molecules, function, or method of separation. According to minimal information from studies of extracellular vesicles 2018 (MISEV2018)12, EV is a collective term covering various subtypes of cell-released, membranous structures, called exosomes, microvesicles, microparticles, ectosomes, oncosomes, apoptotic bodies, and many other names (Clotilde, et al., J Extracell Vesicles, 7(1):1535750 (2018)). As discussed in Théry, et al., subtypes of EVs may be defined by: [0035] a) physical characteristics of EVs, such as size (“small EVs” (sEVs) and “medium/large EVs” (m/lEVs), with ranges defined, for instance, respectively, <100 nm or <200 nm [small], or >200 nm [large and/or medium]) or density (low, middle, high, with each range defined); [0036] b) biochemical composition (CD63+/CD81+−EVs, Annexin A5-stained EVs, etc.); or [0037] c) descriptions of conditions or cell of origin (podocyte EVs, hypoxic EVs, large oncosomes, apoptotic bodies).

    [0038] Thus, in some embodiments, the composition is or includes one or more EV subtypes defined according (a), (b), or (c) as discussed above.

    [0039] In some embodiments, the vesicles are or include exosomes. Exosomes possess the surface proteins that promote endocytosis and they have the potential to deliver macromolecules. Also, if the exosomes are obtained from the same individual as they are delivered to, the exosomes will be immunotolerant. Due to the technical limitations, previous studies are not sufficient to conclude that exosomes have specific functions compared with other EVs (Clotilde, et al., J Extracell Vesicles, 7(1):1535750 (2018)).

    [0040] Exosomes are vesicles with the size of 30-150 nm, often 40-100 nm, and are observed in most cell types. Exosomes are often similar to MVs with an important difference: instead of originating directly from the plasma membrane, they are generated by inward budding into multivesicular bodies (MVBs). The formation of exosomes includes three different stages: (1) the formation of endocytic vesicles from plasma membrane, (2) the inward budding of the endosomal vesicle membrane resulting in MVBs that consist of intraluminal vesicles (ILVs), and (3) the fusion of these MVBs with the plasma membrane, which releases the vesicular contents, known as exosomes.

    [0041] Exosomes have a lipid bilayer with an average thickness of ˜5 nm (see e.g., Li, Theranostics, 7(3):789-804 (2017) doi: 10.7150/thno.18133).

    [0042] The lipid components of exosomes include ceramide (sometimes used to differentiate exosomes from lysosomes), cholesterol, sphingolipids, and phosphoglycerides with long and saturated fatty-acyl chains. The outer surface of exosomes is typically rich in saccharide chains, such as mannose, polylactosamine, alpha-2,6 sialic acid, and N-linked glycans.

    [0043] Many exosomes contain proteins such as platelet derived growth factor receptor, lactadherin, transmembrane proteins and lysosome associated membrane protein-2B, membrane transport and fusion proteins like annexins, flotillins, GTPases, heat shock proteins, tetraspanins, proteins involved in multivesicular body biogenesis, as well as lipid-related proteins and phospholipases. These characteristic proteins therefore serve as good biomarkers for the isolation and quantification of exosomes. Another key cargo that exosomes carry is nucleic acids including deoxynucleic acids (DNA), coding and non-coding ribonucleic acid (RNA) like messenger RNA (mRNA) and microRNA (miRNA).

    [0044] In some embodiments, the vesicles include or are one or more alternative extracellular vesicles, such as ABs, MVs, TNTs, or others discussed herein or elsewhere.

    [0045] ABs are heterogenous in size and originate from the plasma membrane. They can be released from all cell types and are about 1-5 μm in size.

    [0046] MVs with the size of 20 nm-1 μm are formed due to blebbing with incorporation of cytosolic proteins. In contrast to ABs, the shape of MVs is homogenous. They originate from the plasma membrane and are observed in most cell types.

    [0047] TNTs are thin (e.g., 50-700 nm) and up to 100 μm long actin containing tubes formed from the plasma membrane.

    [0048] The Examples below show that EVs isolated from ADSC were physically homogeneous with a peak of 100 nm (FIG. 1). Thus, in some embodiments, the EVs are between about 20 nm and about 500 nm. In some embodiments, the EVs are between about 20 nm and about 250 nm or 200 nm or 150 nm or 100 nm.

    [0049] The Examples below show that EVs isolated from ADSC include CD9 and CD63. Thus, in some embodiments, the EVs include CD9, CD63, or both.

    [0050] The Examples below show that EVs isolated from ADSC include a number of miRNAs. In some embodiments, the EVs include one or more of the miRNA of Table 1. In some embodiments, the EVs include on or more of miR-199a-3p, miR-145-5p, miR-143-3p, miR-377-3p, miR-100-3p, miR-29a-3p, miR-495-3p, miR-29c-3p, miR-658, miR-493-3p, miR-184, and miR-27a-3p.

    [0051] B. Methods of Making Extracellular Vesicles

    [0052] 1. Sources of Cells for Making Extracellular Vesicles

    [0053] As used herein, EVs, including AB, MV, exosomes, and TNT typically refer to lipid vesicles formed by cells or tissue. They can be isolated from tissue, cells, and fluid directly from a subject, including cultured and uncultured tissue, cells, or fluids, and fluid derived or conditioned by cultured cells (e.g., conditioned media). For example, exosomes are present in physiological fluids such as plasma, lymph liquid, malignant pleural effusion, amniotic liquid, breast milk, semen, saliva and urine, and are secreted into the media of cultured cells.

    [0054] The EVs of the disclosed compositions are typically formed from mesenchymal cells, preferably mesenchymal stem cells. Mesenchymal stem cells (MSCs) are multipotent adult stem cells that are present in multiple tissues, including umbilical cord, bone marrow and fat tissue. Mesenchymal stem cells can self-renew by dividing and can differentiate into multiple tissues including bone, cartilage, muscle and fat cells, and connective tissue. Thus, mesenchymal cells include, for example, adipocytes, chondrocytes, osteoblasts, myocytes and tendon, and MSCs are multipotent stem cells that can differentiate in one or more of these cell types.

    [0055] In some embodiments, the EVs are formed by MSCs. MSCs can be derived from bone barrow or other non-marrow tissues, such as placenta, umbilical cord blood, adipose tissue, adult muscle, corneal stroma or the dental pulp of deciduous (baby) teeth.

    [0056] In some embodiments, the MSCs are derived from adipose tissue. Adipose tissue-derived MSCs (AdMSCs or ADSC), in addition to being easier and safer to isolate than bone marrow-derived MSCs, can be obtained in larger quantities.

    [0057] Methods of isolating extracellular vesicles from tissue, cells, and fluid directly from a subject, including cultured and uncultured tissue, cells, or fluids, and fluid derived or conditioned by cultured cells (e.g., conditioned media) are known in the art.

    [0058] See, for example, Li, Themaostics, 7(3):789-804 (2017) doi: 10.7150/thno.18133, Ha, et al., Acta Pharmaceutica Sinica B, 6(4):287-296 (2016) doi: 10.1016/j.apsb.2016.02.001, Skotland, et al., Progress in Lipid Research, 66:30-41 (2017) doi: 10.1016/j.plipres.2017.03.001, Phinney and Pittenger, Stem Cells, 35:851-858 (2017) doi: 10.1002/stem.2575, each of which is specifically incorporated by reference, and describes isolating extracellular vesicles, particularly exosomes.

    [0059] The EVs can be collected from primary cells or tissue or fluid. In some embodiments, the vesicles are isolated from cells, tissue, or fluid of the subject to be treated. An advantage of utilizing EVs that are isolated from natural sources includes avoidance of immunogenicity that can be associated with artificially produced lipid vesicles.

    [0060] The EVs can also be collected from cell lines or tissue. Exemplary cells lines are commercially available and include those various sources including human bone-marrow, human umbilical cord, human embryonic tissue, and human adipose including those derived from lipoaspirate or dedifferentiated from mature adipocytes.

    [0061] 2. Methods of Collecting Extracellular Vesicles

    [0062] Extracellular vesicles, including exosomes, can be isolated using differential centrifugation, flotation density gradient centrifugation, filtration, high performance liquid chromatography, and immunoaffinity-capture.

    [0063] For example, one of the most common isolation techniques for isolating exosomes from cell culture is differential centrifugation, whereby large particles and cell debris in the culture medium are separated using centrifugal force between 200-100,000×g and the exosomes are separated from supernatant by the sedimenting exosomes at about 100,000×g. Purity can be improved, however, by centrifuging the samples using flotation density gradient centrifugation with sucrose or Optiprep. Tangential flow filtration combined with deuterium/sucrose-based density gradient ultracentrifugation was employed to isolate therapeutic exosomes for clinical trials.

    [0064] In the experiments provided below, EVs were isolated from ADSCs. After incubation for two days, the medium was collected and centrifuged at 2,000 g for 15 min at room temperature. To thoroughly remove cellular debris, the supernatant was filtered with a 0.22-mm filter unit. Then, the cultured media (CM) was ultracentrifuged at 110,000 g (35,000 rpm) for 70 min at 4° C.

    [0065] Ultrafiltration and high-performance liquid chromatography (HPLC) are additional methods of isolating EVs based on their size differences. EVs prepared by HPLC are highly purified.

    [0066] Hydrostatic filtration dialysis has been used for isolating extracellular vesicles from urine.

    [0067] Other common techniques for EV collection involve positive and/or negative selection using affinity-based methodology. Antibodies can be immobilized in different media conditions and combined with magnetic beads, chromatographic matrix, plates, and microfluidic devices for separation. For example, antibodies against exosome-associated antigens—such as cluster of differentiation (CD) molecules CD63, CD81, CD82, CD9, epithelial cell adhesion molecule (EpCAM), and Ras-related protein (Rab5)—can be used for affinity-based separation of exosomes. Non-exosomes vesicles that carry these or different antigens can also be isolated in a similar way.

    [0068] Microfluidics-based devices have also been used to rapidly and efficiently isolate EVs such as exosomes, tapping on both the physical and biochemical properties of exosomes at microscales. In addition to size, density, and immunoaffinity, sorting mechanisms such as acoustic, electrophoretic and electromagnetic manipulations can be implemented.

    [0069] Methods of characterizing EVs including exosomes are also known in the art. Exosomes can be characterized based on their size, protein content, and lipid content. Exosomes are sphere-shaped structures with sizes between 40-100 nm and are much smaller compared to other systems, such as a microvesicle, which has a size range from 100-500 nm. Several methods can be used to characterize EVs, including flow cytometry, nanoparticle tracking analysis, dynamic light scattering, western blot, mass spectrometry, and microscopy techniques. EVs can also be characterized and marked based on their protein compositions. For example, integrins and tetraspanins are two of the most abundant proteins found in exosomes. Other protein markers include TSG101, ALG-2 interacting protein X (ALIX), flotillin 1, and cell adhesion molecules. Similar to proteins, lipids are major components of EVs and can be utilized to characterize them.

    [0070] C. Pharmaceutical Compositions

    [0071] Pharmaceutical compositions including EVs are also provided. Pharmaceutical compositions can be administered parenterally (intramuscular (IM), intraperitoneal (IP), intravenous (IV), subcutaneous injection (SubQ), subdermal), transdermally (either passively or using iontophoresis or electroporation), or by any other suitable means, and can be formulated in dosage forms appropriate for each route of administration.

    [0072] In some embodiments, the compositions are administered systemically, for example, by intravenous or intraperitoneal administration, in an amount effective for delivery of the compositions to targeted cells.

    [0073] In preferred embodiments, the compositions are administered locally, for example, by injection directly into, or adjacent to, a site to be treated. For example, in some embodiments such as for the treatment of lymphedema, the compositions are injected or otherwise administered directly to the lymphedemic area or the area adjacent thereto (e.g., in the arms or legs).

    [0074] Typically, local injection causes an increased localized concentration of the compositions which is greater than that which can be achieved by systemic administration.

    [0075] In some embodiments, the compositions are delivered locally to the appropriate cells by using a catheter or syringe. Other means of delivering such compositions locally to cells include using infusion pumps (for example, from Alza Corporation, Palo Alto, Calif.) or incorporating the compositions into polymeric implants (see, for example, P. Johnson and J. G. Lloyd-Jones, eds., Drug Delivery Systems: Fundamentals and Techniques (Chichester, England: Ellis Horwood Ltd., 1988 ISBN-10: 0895735806), which can effect a sustained release of the material to the immediate area of the implant.

    [0076] The EV compositions can be provided to the cell either directly, such as by contacting it with the cell, or indirectly, such as through the action of any biological process. For example, the vesicles can be formulated in a physiologically acceptable carrier, and injected into a tissue or fluid surrounding the cell.

    [0077] Exemplary dosage for in vivo methods are discussed in the experiments below. As further studies are conducted, information will emerge regarding appropriate dosage levels for treatment of various conditions in various patients, and the ordinary skilled worker, considering the therapeutic context, age, and general health of the recipient, will be able to ascertain proper dosing. The selected dosage depends upon the desired therapeutic effect, on the route of administration, and on the duration of the treatment desired.

    [0078] Generally, for local injection or infusion, dosage may be lower. Generally, the total amount of the active agent administered to an individual using the disclosed vesicles can be less than the amount of unassociated active agent that must be administered for the same desired or intended effect and/or may exhibit reduced toxicity.

    [0079] In a preferred embodiment the compositions are administered in an aqueous solution, by parenteral injection such as intramuscular, intraperitoneal, intravenous, subcutaneous, subdermal, etc.

    [0080] The formulation can be in the form of a suspension or emulsion. In general, pharmaceutical compositions are provided including effective amounts of one or more active agents optionally include pharmaceutically acceptable diluents, preservatives, solubilizers, emulsifiers, adjuvants and/or carriers. Such compositions can include diluents, sterile water, buffered saline of various buffer content (e.g., Tris-HCl, acetate, phosphate) at various pHs and ionic strengths; and optionally, additives such as detergents and solubilizing agents (e.g., TWEEN® 20, TWEEN® 80 also referred to as polysorbate 20 or 80), anti-oxidants (e.g., ascorbic acid, sodium metabisulfite), and preservatives (e.g., Thimersol, benzyl alcohol) and bulking substances (e.g., lactose, mannitol). Examples of non-aqueous solvents or vehicles are propylene glycol, polyethylene glycol, vegetable oils, such as olive oil and corn oil, gelatin, and injectable organic esters such as ethyl oleate. The formulations may be lyophilized and redissolved/resuspended immediately before use. The formulation may be sterilized by, for example, filtration through a bacterium retaining filter, by incorporating sterilizing agents into the compositions, by irradiating the compositions, or by heating the compositions.

    [0081] Transdermal formulations may also be prepared. These will typically be ointments, lotions, sprays, or patches, all of which can be prepared using standard technology. Transdermal formulations can include penetration enhancers. Chemical enhancers and physical methods including electroporation and microneedles can work in conjunction with this method.

    III. Methods of Use

    [0082] Methods of using the disclosed compositions are also provided. The experiments below illustrate that EVs from ADSCs promoted proliferation, migration, and tube formation activities, and upregulated gene expression of lymphatic markers in lymphatic endothelial cells. ADSC-EVs increased both LYVE-1 positive lymphatic endothelial cells and CD-31 positive vascular endothelial cells of injected limbs in vivo, and suppressed immunologic activities. These alterations induced by ADSC-EVs resulted in relief the condition of lymphedema.

    [0083] Thus, in some embodiments, the disclosed compositions are administered to a subject in need thereof in an effective amount. In some embodiments, the amount is effective to increase the proliferation, migration, and/or tube formation of lymphatic endothelial cells, increase expression of one or more lymphatic makers (e.g., hyaluronan receptor-1 (LYVE-1), vascular endothelial growth factor receptor-3 (VEGFR-3), prospero homeobox 1 (Prox1), and/or podoplanin) in lymphatic endothelial cells, increase angiogenesis, increase lymphangiogeneisis, reduce inflammatory response, decrease fibrosis formation, enlarging circumference and/or inducing formation of capillary vessels and/or lymphatic vessels, induce formation of vessels that express both vascular and lymphatic markers, increase drainage routes (e.g., for accumulated fluids), increase HIF1-alpha expression and/or activity (e.g., in lymphatic endothelial cells), reduce Prohibitin (PHB) expression and/or activity (e.g., in lymphatic endothelial cells), or a combination thereof in a subject.

    [0084] The disclosed compositions and methods are particularly useful for treating a subject having lymphedema, and/or symptoms associated therewith. Thus, in some embodiments, EVs or a subtype or subtypes thereof or a composition thereof, are administered to a subject in need thereof in an effective amount to treat lymphedema, or one or more symptoms associated therewith.

    [0085] Lymphedema refers to swelling that generally occurs in one or both arms or legs. Lymphedema is generally caused by blockage the lymphatic system. The blockage prevents lymph fluid from draining well, and the fluid buildup leads to swelling.

    [0086] Lymphedema signs and symptoms, which typically occur in the affected arm(s) and/or leg(s), include: swelling of part or all of the arm(s) and/or leg(s), including fingers or toes, a feeling of heaviness or tightness, restricted range of motion, aching or discomfort, recurring infections, hardening and thickening of the skin (fibrosis).

    [0087] Draining excess lymphatic fluid is one of the main purposes of lymphedema treatment. To promote remaining drainage function, traditional compression care or microsurgical lymphatic system reconstruction has been performed for lymphedema management (Tashiro, et al., J Plast Reconstr Aesthet Surg., 69(3):368-75 (2016)). Recent advancement of surgical approach to lymphedema has been attempted to create lympho-venous shunts or healthy lymph nodes transplantation from other sites. Thus, in some embodiments, the disclosed methods are combined with one or more of these or other conventional methods of treating lymphedema.

    [0088] In the studies below, the effects of ADSC-EVs treatment were investigated both in vitro and in vivo situations, and results indicate that inducing both angiogenesis and lymphangiogenesis may lead to the establishment of new connection between capillary vessels and lymphatic vessels. The existence of the route between capillary system and lymphatic system may work lifelong as drainage route of excess lymphatic fluid in affected tissues as a treatment option.

    [0089] Lymphedema can be caused by the removal of, or damage to, lymph nodes as a part of cancer treatment. Thus, in some embodiments, the subject also has cancer. In some embodiments, the subject does not have cancer.

    [0090] In some embodiments, the EVs are administered as part of a heterogeneous mixture of factors (e.g., conditioned media, or a fraction isolated therefrom). In some embodiments, EVs or more of more subtypes thereof are isolated or otherwise collected from conditioned media. The EVs or one or more subtypes thereof can be suspended in pharmaceutically acceptable composition, such as a carrier or matrix or depot, prior to administration to the subject.

    [0091] EVs may possess the versatility and capacity to interact with multiple cell types immediately and remote areas to regulate cellular responses (Zhang et al., Cell Prolif., 49:3-13 (2016)). Thus, although regional or local administration to the site of interest (e.g., the site of lymphedema) or a site adjacent thereto is preferred, systemic administration is also contemplated. Furthermore, although lymphatic endothelial cells are a preferred target, the EVs may also affect other cells in the region of administration that effect the treatment outcome.

    [0092] The frequency of administration of a method of treatment can be, for example, one, two, three, four or more times daily, weekly, every two weeks, or monthly. In some embodiments, the composition is administered to a subject once every 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, or 31 days. In some embodiments, the frequency of administration is once, twice or three times weekly, or is once, twice or three times every two weeks, or is once, twice or three times every four weeks. In some embodiments, the composition is administered to a subject 1-3 times, preferably 2 times, a week.

    [0093] In some embodiments, the effect of the disclosed compositions and methods on a subject is compared to a control. For example, the effect of the composition on a particular symptom, pharmacologic, or physiologic indicator (including those mentioned above and elsewhere herein) can be compared to an untreated subject, or the condition of the subject prior to treatment. In some embodiments, the symptom, pharmacologic, or physiologic indicator is measured in a subject prior to treatment, and again one or more times after treatment is initiated. In some embodiments, the control is a reference level, or average determined based on measuring the symptom, pharmacologic, or physiologic indicator in one or more subjects that do not have the disease or condition to be treated (e.g., healthy subjects).

    [0094] In some embodiments, the effect of the treatment is compared to a conventional treatment that is known in the art, such as one of those discussed herein.

    IV. Kits

    [0095] Dosage units including the disclosed compositions, for example, in a pharmaceutically acceptable carrier for shipping and storage and/or administration are also disclosed. Components of the kit may be packaged individually and can be sterile. In some embodiments, a pharmaceutically acceptable carrier containing an effective amount of the composition is shipped and stored in a sterile vial. The sterile vial may contain enough composition for one or more doses. The composition may be shipped and stored in a volume suitable for administration, or may be provided in a concentration that is diluted prior to administration. In another embodiment, a pharmaceutically acceptable carrier containing drug can be shipped and stored in a syringe.

    [0096] Kits containing syringes of various capacities or vessels with deformable sides (e.g., plastic vessels or plastic-sided vessels) that can be squeezed to force a liquid composition out of an orifice are provided. The size and design of the syringe will depend on the route of administration. Any of the kits can include instructions for use.

    [0097] The disclosed compositions and methods can be further understood through the following numbered paragraphs.

    [0098] 1. A method of promoting generation or regeneration of the lymphatic system in a subject comprising administering the subject a composition comprising an effective amount of extracellular vesicles formed by mesenchymal stem cells (MSCs) to increase generation of the lymphatic system. 2. A method of treating a subject for lymphedema comprising administering the subject an effective amount of a composition comprising extracellular vesicles formed by mesenchymal stem cells to increase generation of the lymphatic system.

    [0099] 3. The method of paragraphs 1 or 2, wherein the composition comprises a pharmaceutically acceptable carrier.

    [0100] 4. The method of any one of paragraphs 1-3, wherein the composition is cell-free.

    [0101] 5. The method of any one of paragraphs 1-4, wherein the extracellular vesicles are formed by a method comprising culturing MSCs to produce media conditioned with the extracellular vesicles.

    [0102] 6. The method of paragraph 5, wherein the method further comprises separating extracellular vesicles from the media conditioned by the MSCs.

    [0103] 7. The method of paragraph 6, wherein the composition does not comprise the media conditioned by the MSCs.

    [0104] 8. The method of any one of paragraphs 1-7, wherein the MSCs are primary cells or a cell line.

    [0105] 9. The method of any one of paragraphs 1-8, wherein the MSCs are from bone barrow, placenta, umbilical cord blood, adipose tissue, adult muscle, conical stroma, or the dental pulp of deciduous teeth.

    [0106] 10. The method of any one of paragraphs 1-9, wherein the MSCs are adipose-derived stem cells.

    [0107] 11. The method of any one of paragraphs 1-10, wherein the extracellular vesicles comprise or consist of ectosomes, microvesicles (MV), microparticles, exosomes, oncosomes, apoptotic bodies (AB), tunneling nanotubes (TNT), or a combination thereof.

    [0108] 12. The method of paragraph 11, wherein the extracellular vesicles comprise or consist of exosomes, microvesicles or a combination thereof.

    [0109] 13. The method of any one of paragraphs 1-12, wherein the extracellular vesicles comprise or consist of a vesicles having a size of between about 20 nm and about 500 nm, or between about 20 nm and about 250 nm, or between about 20 nm and about 200 nm, or between about 20 nm and about 150 nm, or between about 20 nm and about 100 nm.

    [0110] 14. The method of any one of paragraphs 1-13, wherein the extracellular vesicles comprise CD9, CD63, or a combination thereof 15. The method of any one of paragraphs 1-14, wherein the extracellular vesicles comprise one or more of miR-199a-3p, miR-145-5p, miR-143-3p, miR-377-3p, miR-100-3p, miR-29a-3p, miR-495-3p, miR-29c-3p, miR-658, miR-493-3p, miR-184, and miR-27a-3p.

    [0111] 16. The method of any one of paragraphs 1-15 comprising increasing the proliferation, migration, and/or tube formation of lymphatic endothelial cells, increasing expression of one or more lymphatic markers (e.g., hyaluronan receptor-1(LYVE-1), vascular endothelial growth factor receptor-3 (VEGFR-3), prospero homeobox 1 (Prox1), and/or podoplanin) in lymphatic endothelial cells, increasing angiogenesis, increasing lymphangiogeneisis, reducing inflammatory response, decreasing fibrosis formation, enlarging circumference and/or inducing formation of capillary vessels and/or lymphatic vessels, inducing formation of vessels that express both vascular and lymphatic markers, increasing drainage routes (e.g., for accumulated fluids), increasing HIF1-alpha expression and/or activity, reducing Prohibitin (PHB) expression and/or activity, or a combination thereof in the subject.

    [0112] 17. The method of any one of paragraphs 1-16, wherein the subject has a blockage in the lymphatic system, optionally wherein the blockage prevents lymph fluid from draining well, and wherein the fluid buildup leads to swelling.

    [0113] 18. The method of any one of paragraphs 1-17, wherein the subject has one or more symptoms selected from swelling of part or all of the arm(s) and/or leg(s), a feeling of heaviness or tightness, restricted range of motion, aching or discomfort, recurring infections, and fibrosis in one or both arms and/or legs.

    [0114] 19. The method of any one of paragraphs 1-18, wherein the subject has been diagnosed with lymphedema.

    [0115] 20. The method of any one of paragraphs 1-19, wherein the composition is administered by local injection or infusion at or adjacent to a site of interest.

    [0116] 21. The method of paragraph 20, wherein the site of interest is in one or both arms and/or legs.

    [0117] 22. The method of paragraphs 20 or 21, wherein the site of interest is a site of lymphatic blockage and/or lymphedema.

    [0118] 23. The method of any one of paragraphs 1-22, wherein the composition is administered by intramuscular, intraperitoneal, intravenous, subcutaneous, or subdermal injection.

    [0119] 24. The composition of any one of paragraphs 1-23.

    [0120] 25. A composition comprising an effective amount of extracellular vesicles formed by mesenchymal stem cells (MSCs) suitable for use in the method of any one of paragraphs 1-23.

    [0121] 26. Use of the composition of paragraph 24 or 25 for promoting generation or regeneration of the lymphatic system.

    [0122] 27. Use of the composition of paragraph 24 or 25 for the manufacture of a medicament for promoting generation or regeneration of the lymphatic system.

    [0123] 28. Use of the composition of paragraph 24 or 25 for treating lymphedema.

    [0124] 29. Use of the composition of paragraph 24 or 25 for the manufacture of a medicament for treating lymphedema.

    [0125] 30. A composition, use, or method according to any of the disclosure herein including, but not limited to, the description, the experimental examples, and/or the figures and their descriptions.

    EXAMPLES

    Example 1

    Characteristics of ADSC-Derived EVs Materials and Methods

    [0126] Cell Culture and Preparation of EVs

    [0127] Human adipose derived stem cells were purchased from Lonza (Basel, Switzerland) and cultured in Dulbecco's Modified Eagle Medium (DMEM; Nissui Pharmaceutical Co, Tokyo, Japan) supplemented with 10% fetal bovine serum. Primary cells were cultured for 7 days (passage 0), replacing the medium three times weekly. Cell passage was done each week in 0.25% trypsin/2 mM EDTA (37° C., 5 min). All ADSCs were used within the sixth passage.

    [0128] At approximate 80% confluence, ADSCs were washed with PBS thrice and the culture media were replaced with DMEM containing 0.1% fetal bovine serum. After incubation for two days, the medium was collected and centrifuged at 2,000 g for 15 mM at room temperature. To thoroughly remove cellular debris, the supernatant was filtered with a 0.22-mm filter unit (Millipore). Then, the conditioned media (CM) was ultracentrifuged at 110,000 g (35,000 rpm) for 70 mM at 4° C. using an SW41 rotor (Beckman) (Clotilde, et al., J Extracell Vesicles, 7(1):1535750 (2018)). The pellets were washed with 11 ml PBS, and after ultracentrifugation, they were resuspended in PBS. The protein concentration of the putative EV fraction was determined using a Quant-iT Protein Assay with a Qubit 2.0 Fluorometer (Invitrogen). To determine the size distribution of the EVs, nanoparticle tracking analysis was carried out using the Nanosight system (NanoSight) on samples diluted 500- to 1,000-fold with PBS for analysis. The system focuses a laser beam through a suspension of the particles of interest. These are visualized by light scattering using a conventional optical microscope perpendicularly aligned to the beam axis, which collects light scattered from every particle in the field of view. A 60 s video recorded all events for further analysis by the nanoparticle tracking analysis software. The Brownian motion of each particle was tracked between frames to calculate its size using the Stokes-Einstein equation. Using same procedures and culture media, EVs derived from Human Embryonic Kidney 293 (HEK293) cells (KAC co ltd, Japan) were obtained.

    [0129] PKH67-Labelled EVs Transfer

    [0130] Purified EVs derived from ADSCs were labelled with a PKH67 green fluorescence labelling kit (Sigma-Aldrich, Mo., USA). EVs were incubated with 2 mM of PKH67 for 5 min and washed five times using a 100 kDa filter (Microcon YM-100, Millipore) to remove excess dye. PKH67-labelled EVs were used to assess EV uptake in vitro.

    Results

    [0131] Recently, it has been shown that EVs secreted by ADSCs contribute to their paracrine effects. To identify the angiogenic and lymphangiogenic capacity of ADSC-EVs, putative EV fractions were isolated from conditioned media of ADSCs. ADSC-EVs exhibited the characteristic round morphology with bilayer structure under a transmission electron microscope. Nano tracking analysis showed that the size distribution of the isolated EVs was physically homogeneous with a peak diameter of 82 nm (FIG. 1).

    [0132] Immunoblot analyses showed that tetraspanin CD9 and CD63, reliable exosomal markers, were present in the EV fraction. Fluorescence microscopy analysis demonstrated that the PKH67-labelled EVs had been taken up and was transferred to perinuclear compartments, presumably representative of late endocytic compartments.

    Example 2

    ADSC-Derived EVs have Lymphangiogenic Effects

    Materials and Methods

    [0133] LEC Culture

    [0134] Human dermal lymphatic microvascular endothelial cells (HMVEC-dLy Ad) were purchased from Lonza (Basel, Switzerland) and cultured in endothelial growth medium-2-MV(EGM-2-MV; Lonza) that consisted of endothelial basal medium-2 (EBM-2; Lonza) supplemented with 5% fetal bovine serum (FBS), human basic fibroblast growth factor (bFGF), human

    [0135] VEGF, human insulin like growth factor-1 (IGF-1), human epidermal growth factor, hydrocortisone, ascorbic acid, and gentamicin and amphotericin (SingleQuots; Lonza), according to the manufacturer's instructions. Lymphatic endothelial cells between passages 3 and 6 were used for all experiments in this study.

    [0136] Proliferation Assay

    [0137] LEC proliferation assays were performed as previously described (Takeda, et al., Ann Plast Surg., 74(6):728-36 (2015)) LECs were treated with 100 μL of EBM-2 containing PBS, 10 ng/ml recombinant human VEGF-C (rVEGF-C) (R&D Systems, Minneapolis, Minn.), HEK293-EVs, or ADSC-EVs (10 μg/ml) for 48 hours at 37° C. in 5% CO.sub.2. Cell proliferation activity was measured using Cell Counting Kit-8 (Dojindo, Kumamoto, Japan), in which 10 μL of the WST-8 assay solution was added to each well and incubated for 4 hours. The absorbance was measured using a microplate reader (Bio-Rad, Hercules, Calif.) at a wavelength of 450 nm.

    [0138] Migration Assay

    [0139] LEC migration assays were performed using Transwell chambers with inserts with 8-μm pores (Corning Costar) as previously described (Takeda, et al., Ann Plast Surg., 74(6):728-36 (2015)). The lower chambers were filled with 700 μL of EBM-2 containing PBS, 10 ng/ml rVEGF-C, HEK293-EVs, or ADSC-EVs (10 μg/ml). After incubation for 16 hours at 37° C. in 5% CO2, the cells on the lower surface of the filter were stained using Diff-Quik (Sysmex, Hyogo, Japan).LECs were photographed through the pores at 100x magnification in 10 random fields, and the migrated cells were counted.

    [0140] Tube Formation Assay

    [0141] Matrigel tube formation assays were carried out as previously described (Takeda, et al., Ann Plast Surg., 74(6):728-36 (2015)). LECs were seeded onto the coated wells and cultured in 500 μL of EBM-2 containing PBS, 10 ng/ml rVEGF-C, HEK293-EVs, or ADSC-EVs (10 μg/ml). After incubation for 8 hours at 37° C. in 5% CO.sub.2, tube formation images were captured at 40× magnification in 5 random fields. For quantification, the tube length was measured using NIH ImageJ software.

    [0142] Statistical Analysis

    [0143] All statistical analyses were performed using GraphPad Prism 8 (GraphPad Software, Inc., La Jolla, Calif.). All data were expressed as mean±SEM, with the results in the three groups compared by one-way analysis of variance for more than three groups and t test for two groups, with a value of p<0.05 considered significant.

    Results

    [0144] To investigate the ability of ADSC-EVs to enhance lymphangiogenesis in vitro, the proliferation, migration, and tube formation was investigated in LECs, after addition of ADSC-EVs. Proliferation assay showed that ADSC-EVs markedly increased proliferation (absorbance: 1.51+−0.21, P<0.05) by up to one and one-half times compared with PBS treated group (absorbance: 1.095+−0.11). Similar tendency was observed in VEGF-C treated group (absorbance: 1.62+−0.19, P<0.05), although HEK293-EVs treated group showed no significant changes (absorbance: 1.15+−0.20, P>0.05) (FIG. 2A). Migration assay showed that ADSC-EVs significantly promoted LECs migration (120.1+−12.2, cells/field, P<0.05) compared with PBS treated group (90.2 +−11.2, cells/field), as well as VEGF-C treated group (125.3+−11.7, cells/field, P<0.05). HEK293-EVs did not show a significant difference (102.1+−13.3, cells/field, P>0.05) (FIG. 2B). The role of ADSC-EVs was further assessed in the regulation of LECs tube formation. Morphological analysis showed ADSC-EVs promote tube formation (2620.5+−321.3, pixel/field, P<0.05) of LECs compared with PBS treated group (1317.8+−500.8 pixel/field) (FIG. 2C). VEGF-C treated group showed a significant difference (2593.4+−156.2, pixel/field, P<0.05), however, HEK293-EVs showed no significant difference (1702.1+−280.3, pixel/field, P>0.05) (FIG. 2C) These results indicate that ADSC-EVs have lymphangiogenic molecules such as cytokines or miRNAs that stimulated proliferation, migration, and tube formation of LECs.

    Example 3

    qRT-PCR Analysis Shows Increased Expression of Lymphatic Marker mRNA after ADS C-Derived EVs Treatment

    Materials and Methods

    [0145] qRT-PCR

    [0146] To assess the effect of ADSC-EVs on LECs, confluent LECs in 24-well plates were treated with 500 μl of EBM-2 containing PBS, rVEGF-C(10 ng/ml), or ADSC-EVs(10 μg/ml) for 12 or 24 hours. Total RNA was extracted from LECs cultured in each condition using a QIAzol and the miRNeasy Mini Kit (Qiagen, Holden, Germany) according to the manufacturer's protocols. For qRT-PCR analysis, complementary DNA was generated from 1 μg of total RNA using a High Capacity cDNA Reverse Transcription Kit (Applied Biosystems). Real-Time PCR system was subsequently performed in triplicate with a 1:15 dilution of cDNA using TaqMan Gene Expression Assays (Applied Biosystems) on a StepOne Real-Time PCR System (Applied Biosystems). Each Assay ID (Thermo Fisher Scientific) is LYVE-1 (Hs00272659_m1), VEFF-R3 (Hs01047677_m1), Prox1 (Hs00896293_m1), and podoplanin (Hs00366766_m1). All mRNA quantification data from cultured cells were normalized to the expression of glyceraldehydes 3-phosphate dehydrogenase (GAPDH).

    Results

    [0147] Lymphatic vessel endothelial hyaluronan receptor-1 (LYVE-1), vascular endothelial growth factor receptor-3 (VEGFR-3), prospero homeobox 1 (Prox1), and podoplanin are well known lymphatic markers in LECs. Therefore, expression levels of mRNA of LYVE-1, VEGFR-3, Prox1, and podoplanin in LECs were examined under conditions of PBS, VEGF-C, or ADSC-EVs treatment. The mRNA expression of LYVE-1 was slightly higher in both 12 and 24 hours in the ADSC-EVs treatment group compared to the PBS group. The VEGF-C group showed a similar trend to the ADSC-EVs treatment group. As for VEGFR-3 mRNA expression, it was almost four times higher in 12 hours and twice higher in 24 hours in the ADSC-EVs treatment group than the PBS treatment group. The VEGF-C treated group showed five to six times higher expression than the PBS treated group in 12 hours. The mRNA expression of Prox1 showed no significant differences in 12 hours, however, it was almost 2.5 times higher in the ADSC-EVs treatment group than PBS treatment group, after 24 hours. VEGF-C treatment group showed little expression changes compared to the ADSC-EVs treatment group. The expression levels of Podoplanin were increased 1.5 times higher in ADSC-EVs treatment group than PBS treatment group in 12 hours; however, it showed no significant differences in 24 hours. VEGF-C group showed the same trend as the ADSC-EVs treatment group. See FIGS. 3A-3H.

    Example 4

    ADSC-Derived EV Improved Hindlimbs Appearance in a Lymphedema Mouse Model

    Materials and Methods

    [0148] Lymphedema Mouse Model, Treatment and Edema Assessment

    [0149] Lymphedema was established in the bilateral hindlimbs of 10-week-old female C57BL/6J mice (CLEA Japan, Inc., Tokyo, Japan) as previously described (Iwasaki, et al., Plast Reconstr Surg., 139(1):67e-78e (2017)). They were handled according to the guidelines established for animal care at the center and the protocol was approved by the Institutional Animal Care and Use Committee of Jichi Medical University. After gas anesthesia, the mice were subjected to x-ray irradiation in the bilateral inguinal region at 10 Gy in a single dose twice prior to the surgery. The radiation was emitted from an x-ray machine (MX-160Labo, mediXtec, Japan). One week later, mice were subjected to circumferential incision in the inguinal region to the muscle layer. The subiliac and popliteal lymph nodes and the lymphatic vessels entwined around the sciatic veins were removed. To block the superficial lymphatic system, a 3-mm-wide silicone splint was placed in the inguinal wound and then fixed to the skin and underlying muscle using interrupted 6-0 nylon sutures (Bear medic, Tokyo, Japan). This silicon splint placement prevented wound contraction and desiccation. As a therapeutic intervention, injection of PBS (25 μ1) or ADSC-EVs (˜40 μg) or HEK293-EVs (˜40 μg) as a thin layer to the whole leg area was performed in postoperative day 7 and 14. Hindlimb circumference measurements were performed by unblind reviewers at a point 6 mm proximal to the heel at various time points.

    [0150] Fluorescence lymphography was used to compare the lymphatic structures in swollen hindlimbs treated with PBS or ADSC-EVs every 2 weeks postoperatively using a near-infrared fluorescence camera system (FLUORO, Toa Kogaku, Japan). To examine the thickness of soft tissue postoperatively, we used computed tomography (CT) imaging over 4 weeks postoperatively.

    [0151] Edema Assessment

    [0152] To measure the extent of postsurgical edema, hindlimb circumference measurements were performed at a point 6 mm proximal to the heel. In addition, to evaluate the state of lymphedema and the effect of injection of ADSC-EVs, hindlimb circumferences were determined at various time points. Fluorescence lymphography was used to compare lymphatic structures in swollen hindlimbs treated PBS or ADSC-EVs every 2 weeks postoperatively. The animals were clipped and residual hair was removed with a depilatory cream before imaging. Anesthetized mice with isoflurane were placed on a warming pad. A 5-μl volume of a 1-mg/ml solution of indocyanine green (Sigma-Aldrich, St. Louis, Mo.) dissolved in distilled water was injected subcutaneously into the dorsal aspect of both paws using a 26-gauge needle. Fluorescence images were acquired 15 mintes after indocyanine green injection using a near-infrared fluorescence camera system (FLUORO, Toa Kogaku, Japan). Computed tomography (CT) imaging was used to examine the thickness of soft tissue postoperatively, over 4 weeks. Anesthesized mice with isoflurane were placed inside the CT. After the CT images were acquired, the thickness of the soft tissue (length from bone to skin) was measured.

    Results

    [0153] All limbs demonstrated consistent enlargement after radiation, surgical removal of lymph nodes and lymphatic vessels and silicone fixation (FIG. 4A). Although the limb volumes did not return to preoperative levels in these animals, treatment with ADSC-EVs was highly effective in decreasing gross leg swelling (65.1% +−4.5%) as compared with controls (79.4% +−5.1%) (FIG. 4B).

    [0154] To assess lymphatic function, indocyanine green lymphography of the hindlimb was performed. Using indocyanine green lymphography 4 weeks after the final treatment, clearance of accumulated lymphatic fluid and a clear linear sign of lymphatic channels in ADSC-EVs-treated legs. In contrast, control legs demonstrated pooling of ICG in the whole area and no transport across the zone of surgery (FIG. 4C). This finding was confirmed using computed tomographic (CT) images. The thickness of soft tissue area, which was defined between bone and skin, markedly decreased in the ADSC-EVs treated group compared with the controls, indicating that the excess amount of lymphatic fluid was drained into the venous system.

    Example 5

    ADSC-Derived EVs Promoted Angiogenesis and Lymphangiogenesis in the Affected Limb

    Materials and Methods

    [0155] Immunohistochemistry

    [0156] The mice were sacrificed 4 weeks after the final injection of PBS or ADSC-EVs. Skin sections (5 μm) were generated from 6 mm distal to the inguinal wound and 6 mm proximal to the ankle. The tissues were stained with Hoechst 33342 (Dojindo, Tokyo, Japan), lymphatic vessel endothelial receptor-1 (LYVE-1) polyclonal antibodies (bs-1311R-A555, Bioss Antibodies, USA), anti-CD31 polyclonal antibodies (bs-0468R-A647, Bioss Antibodies, USA), SMAD3 polyclonal antibodies (bs-2225R-A488, Bioss Antibodies, USA), and collagen 1 polyclonal antibodies (bs-10423R-A488, Bioss Antibodies, USA). Stained slides were examined under a fluorescence microscope (Keyence, Osaka, Japan). Fluorescence images were captured at 40×magnification in 5 random fields. For quantification, each positive area was measured using NIH ImageJ software by unblind reviewers.

    Results

    [0157] To determine the lymphangiogenic and angiogenic effects of ADSC-EVs in lymphedema leg models in which drainage of lymphatic fluid is obstructed surgically, histologic changes of affected limbs were evaluated. Immunohistochemical analysis of LYVE-1+ vessel counts in the hindlimb tissues of experimental and control legs demonstrated that injection of ADSC-EVs group modestly but significantly increased the total number of capillary lymphatic vessels (25.3%+−5.2%, P<0.05) compared to PBS group and HEK293-EVs group (16.1%+−2.8%, 16.9%+−3.2% respectively) (FIG. 5A). Similarly, analysis of cross-sections obtained from the hindlimb in the mouse models demonstrated increase in the number of CD31+ endothelial cells in the hindlimb tissues treated with ADSC-EVs (12.3%+−3.9%) as compared with PBS or HEK293-EVs (7.7%+−3.3%, 10.2%+−2.2%, respectively) (FIG. 5B). Consistent with the increased number of vascular and lymphatic endothelial cells, an increase of the number of vessels which expressed both CD31+ and LYVE-1+ in tissue samples harvested from the ADSC-EVs(5.2%+−1.1%, P<0.05) group was noted compared to controls (2.1%+−0.2%, 2.3%+−0.3%) (FIG. 5C). These overlapping regions may be the newly connected bypass between lymphatics to capillary vessels, indicating that interstitial transport capacity is greatly increased after ADSC-EVs treatment.

    Example 6

    ADSC-Derived EVs Decreased Fibrosis After Lymphatic Injury

    [0158] Because the degree of fibrosis in lymphedema patients correlates with the severity of disease, several markers of fibrosis were analyzed in hindlimbs to understand the effects of ADSC-EVs treatment. ADSC-EVs significantly decreased subdermal type I collagen deposition (32.5%+−4.4%, P<0.05) as compared with PBS group (45.8%+−5.1%) and HEK293-EVs group (42.2%+−4.5%) (FIG. 6A). ADSC-EVs treatment significantly decreased expression of phosphorylated SMAD3 (pSMAD-3) (17.1%+−9.2%, P<0.05), which is a downstream signaling molecule of pro-fibrotic growth factor, compared to PBS group(36.5%+−14.2%) and HEK293-EVs group (23.3%+−10.4%) (FIG. 6B). Taken together, these findings show that ADSC-EVs mitigate the formation of fibrotic response in the setting of lymphedema.

    Example 7

    ADSC-Derived EVs Contain Several miRNAs Targeting MDM2, HIF1a, and PHB

    Materials and Methods

    [0159] miRNA Expression Profiling by Real-Time PCR Arrays

    [0160] Total RNA, including miRNA, was extracted from ADSC-EVs and HEK293-EVs using Trizol reagent (Invitrogen Life Technologies, Carlsbad, CA, USA) according to the manufacturer's instruction. From each sample, 15 μl of miRNAs were reverse-transcribed using a miRCURY LNA RT Kit (Qiagen, Netherlands). The cDNA was mixed with 2× PCR master mix (Qiagen, Netherlands). All the real-time PCR-based experiments using a

    [0161] LightCycler 480 Instrument 2 according to the manufacturer's instructions. For normalization, miRNA expressions were compared between ADSC-EVs and HEK293-EVs. The cycle threshold (2-AACt) method was utilized to calculate the fold change.

    [0162] mRNA Expression Profiling in LECs by Microarray

    [0163] To perform a mRNA microarray, 5×10e4 LECs were seeded into 24-well plates and 12 h later EVs from ADSC or PBS as control were added to LECs. Total mRNAs were extracted from LECs 12 h after treatment with the EVs and PBS. For each hybridization, 0.60 μg of Cy3 labeled cRNA were fragmented, and hybridized at 65 degrees for 17 hours to an Agilent SurePrint G3 Human GE v3 8×60K Microarray (Design ID: 072363). After washing, microarrays were scanned using an Agilent DNA microarray scanner.

    [0164] Intensity values of each scanned feature were quantified using Agilent feature extraction software version 11.5.1.1, which performs background subtractions. Only features that were flagged as no errors (Detected flags) were used and features that were not positive, not significant, not uniform, not above background, saturated, and population outliers (Not Detected and Compromised flags) were excluded. Normalization was performed using Agilent GeneSpring software version 14.9.1 (per chip:normalization to Quantile).

    Results

    [0165] To determine how ADSC-EVs regulate miRNAs associated with various processes, using a real-time RT-PCR-based miRNA array, the expression patterns of 752 different miRNAs were next profiled in ADSC-EVs. The expression patterns of the same miRNAs in HEK293 cells derived EVs were also analyzed as controls. The miRNA PCR array revealed that 396 differentially expressed miRNAs in ADSC-EVs compared to HEK293-EVs. miRNAs expressed over double fold in log2 ratio are shown in Table 1.

    [0166] Bioinformatic analysis (Ingenuity Pathway Analysis, IPA), was performed to evaluate the implications of the altered miRNA expression. IPA revealed that the major networks which incorporate the predicted targets, include functions such as ‘Organismal injury and abnormalities’, ‘Reproductive system disease’, ‘Inflammatory disease’, and ‘Inflammatory response’.

    [0167] The cargo of EVs, which includes miRNAs, mRNAs, proteins and other biological components, is transferred from the donor to recipient cells and influences the cellular phenotypes. Therefore, which genes are altered in the LECs treated with the ADSC-EVs or PBS as control were investigated.

    [0168] Total RNA was extracted from treated LECs, and microarray analyses were performed. Results show that differentially expressed genes among treatments with ADSC-EVs and control PBS, there were clear differences in gene expression in the LECs.

    [0169] A bioinformatic analysis was conducted using IPA for the relation between highly expressed miRNAs in ADSC-EVs and genes which showed expression changes in LECs after addition of ADSC-EVs (FIG. 7, Table 2). As a result, eight miRNAs such as miR-199a-3p, miR-145-5p, miR-143-3p, miR-377-3p, miR-100-3p, miR-29a-3p, miR-495-3p, and miR-29c-3p were found to target and regulate the expression of mouse double minute 2 homolog (MDM2), which contributed to the stability of hypoxiainducible factor-1 alpha (HIF1a) and resulted in angiogenesis and lymphangiogenesis in LECs.. MDM2 is a cellular oncoprotein encoded by a gene located on chromosome 12q13-14. MDM2 can suppress p53, a cancer suppressor gene. Inhibition of MDM2 has anti-inflammatory effects and may lead to treatment of autoimmune diseases and cancer. Previous studies have shown that MDM2 negatively regulates the stability of hypoxia-inducible factor-1 alpha (HIF1a) in protein level. This investigation found that the expression level of HIF1a was elevated in LECs after addition of ADSC-EVs. HIF1a is a transcription factor that controls the cellular response to hypoxia. HIF1a promotes transcription of various proteins such as VEGF, Erythropoietin (EPO) and glucose transporters, and also plays a key role in lymphangiogenesis and angiogenesis. The result indicates that the reduced expression of MDM2 caused by miR-199a-3p, miR-145-5p, miR-143-3p, miR-377-3p, miR-100-3p, miR-29a-3p, miR-495-3p, and miR-29c-3p in ADSC-EVs lead to elevation of HIF1a in LECs, which leads to angiogenesis and lymphangiogenesis.

    [0170] Another target of four miRNAs such as miR-658, miR-493-3p, miR-184, and miR-27a-3p in ADSC-EVs was found to be Prohibitin (PHB). PHB is a membrane protein which regulates a variety of biological processes such as apoptosis, cell cycle, signal transduction and cellular senescence. The downregulation of PHB can lead to angiogenesis (Qian, et al., CNS Neurosci Ther., 19(10):804-12 (2013)).

    TABLE-US-00001 TABLE 1 miRNAs expressed over double fold in log2 ratio SEQ ID # miRname Log2 Ratio target sequence   1 hsa-miR-548c-3p 13.1573 CAAAAAUCUCAAUUACUUUUGC   2 hsa-miR-214-5p 12.4406 UGCCUGUCUACACUUGCUGUGC   3 hsa-miR-372-3p 12.4273 AAAGUGCUGCGACAUUUGAGCGU   4 hsa-miR-206 12.0473 UGGAAUGUAAGGAAGUGUGUGG   5 hsa-miR-337-5p 11.2373 GAACGGCUUCAUACAGGAGUU   6 hsa-miR-199a-5p 10.2440 CCCAGUGUUCAGACUACCUGUUC   7 hsa-miR-214-3p 9.2040 ACAGCAGGCACAGACAGGCAGU   8 hsa-miR-199a-3p 8.9240 ACAGUAGUCUGCACAUUGGUUA   9 hsa-miR-370-3p 8.4440 GCCUGCUGGGGUGGAACCUGGU  10 hsa-miR-100-5p 7.2940 AACCCGUAGAUCCGAACUUGUG  11 hsa-miR-145-5p 7.2440 GUCCAGUUUUCCCAGGAAUCCCU  12 hsa-miR-199b-5p 7.1940 CCCAGUGUUUAGACUAUCUGUUC  13 hsa-miR-143-3p 7.1640 UGAGAUGAAGCACUGUAGCUC  14 hsa-miR-888-5p 7.0240 UACUCAAAAAGCUGUCAGUCA  15 hsa-let-71-3p 6.8206 CUGCGCAAGCUACUGCCUUGCU  16 hsa-let-7 a-2-3p 6.7106 CUGUACAGCCUCCUAGCUUUCC  17 hsa-miR-137 6.6740 UUAUUGCUUAAGAAUACGCGUAG  18 hsa-miR-337-3p 6.4640 CUCCUAUAUGAUGCCUUUCUUC  19 hsa-miR-145-3p 6.3173 GGAUUCCUGGAAAUACUGUUCU  20 hsa-miR-133b 6.2640 UUUGGUCCCCUUCAACCAGCUA  21 hsa-miR-208b-3p 5.7706 AUAAGACGAACAAAAGGUUUGU  22 hsa-miR-493-5p 5.6873 UUGUACAUGGUAGGCUUUCAUU  23 hsa-let-7b-3p 5.6073 CUAUACAACCUACUGCCUUCCC  24 hsa-let-71-5p 5.6040 UGAGGUAGUAGUUUGUGCUGUU  25 hsa-miR-143-5p 5.5773 GGUGCAGUGCUGCAUCUCUGGU  26 hsa-miR-675-5p 5.4673 UGGUGCGGAGAGGGCCCACAGUG  27 hsa-miR-136-3p 5.4473 CAUCAUCGUCUCAAAUGAGUCU  28 hsa-miR-133a-3p 5.3740 UUUGGUCCCCUUCAACCAGCUG  29 hsa-miR-377-5p 5.2406 AGAGGUUGCCCUUGGUGAAUUC  30 hsa-let-7b-5p 5.2340 UGAGGUAGUAGGUUGUGUGGUU  31 hsa-miR-377-3p 5.1840 AUCACACAAAGGCAACUUUUGU  32 hsa-miR-136-5p 5.1840 ACUCCAUUUGUUUUGAUGAUGGA  33 hsa-miR-125b-1-3p 5.0673 ACGGGUUAGGCUCUUGGGAGCU  34 hsa-miR-100-3p 5.040584 CAAGCUUGUAUCUAUAGGUAUG  35 hsa-miR-125b-5p 4.9640 UCCCUGAGACCCUAACUUGUGA  36 hsa-miR-127-3p 4.8840 UCGGAUCCGUCUGAGCUUGGCU  37 hsa-miR-29a-5p 4.8673 ACUGAUUUCUUUUGGUGUUCAG  38 hsa-miR-135a-3p 4.8106 UAUAGGGAUUGGAGCCGUGGCG  39 hsa-miR-539-5p 4.7340 GGAGAAAUUAUCCUUGGUGUGU  40 hsa-miR-424-3p 4.5773 CAAAACGUGAGGCGCUGCUAU  41 hsa-miR-369-5p 4.5540 AGAUCGACCGUGUUAUAUUCGC  42 hsa-miR-376a-3p 4.2940 AUCAUAGAGGAAAAUCCACGU  43 hsa-miR-410-3p 4.2340 AAUAUAACACAGAUGGCCUGU  44 hsa-miR-376c-3p 4.1940 AACAUAGAGGAAAUUCCACGU  45 hsa-miR-154-5p 4.1840 UAGGUUAUCCGUGUUGCCUUCG  46 hsa-miR-409-3p 4.1740 GAAUGUUGCUCGGUGAACCCCU  47 hsa-miR-146a-5p 4.0940 UGAGAACUGAAUUCCAUGGGUU  48 hsa-miR-29a-3p 4.0640 UAGCACCAUCUGAAAUCGGUUA  49 hsa-miR-127-5p 3.9640 CUGAAGCUCAGAGGGCUCUGAU  50 hsa-miR-382-5p 3.9540 GAAGUUGUUCGUGGUGGAUUCG  51 hsa-miR-409-5p 3.9273 AGGUUACCCGAGCAACUUUGCAU  52 hsa-miR-424-5p 3.8540 CAGCAGCAAUUCAUGUUUUGAA  53 hsa-let-7f-1-3p 3.7873 CUAUACAAUCUAUUGCCUUCCC  54 hsa-miR-485-3p 3.7140 GUCAUACACGGCUCUCCUCUCU  55 hsa-miR-369-3p 3.6273 AAUAAUACAUGGUUGAUCUUU  56 hsa-miR-376a-5p 3.6173 GUAGAUUCUCCUUCUAUGAGUA  57 hsa-miR-1 3.5940 UGGAAUGUAAAGAAGUAUGUAU  58 hsa-let-7d-3p 3.5340 CUAUACGACCUGCUGCCUUUCU  59 hsa-miR-382-3p 3.4973 AAUCAUUCACGGACAACACUU  60 hsa-miR-668-3p 3.4840 UGUCACUCGGCUCGGCCCACUAC  61 hsa-miR-487b-3p 3.4340 AAUCGUACAGGGUCAUCCACUU  62 hsa-miR-411-5p 3.4240 UAGUAGACCGUAUAGCGUACG  63 hsa-miR-544a 3.4073 AUUCUGCAUUUUUAGCAAGUUC  64 hsa-miR-889-3p 3.4073 UUAAUAUCGGACAACCAUUGU  65 hsa-miR-329-3p 3.2840 AACACACCUGGUUAACCUCUUU  66 hsa-miR-503-5p 3.2540 UAGCAGCGGGAACAGUUCUGCAG  67 hsa-miR-30c-1-3p 3.2473 CUGGGAGAGGGUUGUUUACUCC  68 hsa-miR-22-5p 3.1840 AGUUCUUCAGUGGCAAGCUUUA  69 hsa-miR-658 3.1473 GGCGGAGGGAAGUAGGUCCGUUGGU  70 hsa-miR-1185-5p 3.1773 AGAGGAUACCCUUUGUAUGUU  71 hsa-miR-495-3p 3.1240 AAACAAACAUGGUGCACUUCUU  72 hsa-miR-432-5p 3.1040 UCUUGGAGUAGGUCAUUGGGUGG  73 hsa-miR-379-5p 3.1040 UGGUAGACUAUGGAACGUAGG  74 hsa-miR-22-3p 3.0640 AAGCUGCCAGUUGAAGAACUGU  75 hsa-miR-654-3p 3.0373 UAUGUCUGCUGACCAUCACCUU  76 hsa-miR-365b-5p 3.0273 AGGGACUUUCAGGGGCAGCUGU  77 hsa-miR-493-3p 2.9740 UGAAGGUCUACUGUGUGCCAGG  78 hsa-miR-134-5p 2.9340 UGUGACUGGUUGACCAGAGGGG  79 hsa-miR-154-3p 2.8740 AAUCAUACACGGUUGACCUAUU  80 hsa-miR-411-3p 2.8273 UAUGUAACACGGUCCACUAACC  81 hsa-miR-335-3p 2.7773 UUUUUCAUUAUUGCUCCUGACC  82 hsa-miR-543 2.7573 AAACAUUCGCGGUGCACUUCUU  83 hsa-miR-381-3p 2.6940 UAUACAAGGGCAAGCUCUCUGU  84 hsa-miR-574-3p 2.6640 CACGCUCAUGCACACACCCACA  85 hsa-miR-379-3p 2.6173 UAUGUAACAUGGUCCACUAACU  86 hsa-miR-21-5p 2.6040 UAGCUUAUCAGACUGAUGUUGA  87 hsa-miR-654-5p 2.6040 UGGUGGGCCGCAGAACAUGUGC  88 hsa-miR-605-5p 2.5573 UAAAUCCCAUGGUGCCUUCUCCU  89 hsa-miR-29c-3p 2.5440 UAGCACCAUUUGAAAUCGGUUA  90 hsa-miR-184 2.5040 UGGACGGAGAACUGAUAAGGGU  91 hsa-miR-193a-5p 2.4940 UGGGUCUUUGCGGGCGAGAUGA  92 hsa-miR-541-5p 2.4773 AAAGGAUUCUGCUGUCGGUCCCACU  93 hs a-miR-27 a-3p 2.4740 UUCACAGUGGCUAAGUUCCGC  94 hsa-miR-494-3p 2.4240 UGAAACAUACACGGGAAACCUC  95 hsa-miR-376b-3p 2.4140 AUCAUAGAGGAAAAUCCAUGUU  96 hsa-miR- 144-5p 2.3673 GGAUAUCAUCAUAUACUGUAAG  97 hsa-miR-1244 2.3473 AAGUAGUUGGUUUGUAUGAGAUGGUU  98 hsa-miR-323a-3p 2.3440 CACAUUACACGGUCGACCUCU  99 hsa-miR-335-5p 2.2940 UCAAGAGCAAUAACGAAAAAUGU 100 hsa-miR-21-3p 2.2640 CAACACCAGUCGAUGGGCUGU 101 hs a-let-7 d-5p 2.0940 AGAGGUAGUAGGUUGCAUAGUU 102 hsa-miR-487 a-3p 2.0773 AAUCAUACAGGGACAUCCAGUU

    TABLE-US-00002 TABLE 2 Differentially expressed genes in LEC for treatment of EVs or PBS Fold Log fold Expression change change compared to (ADSC EV (ADSC EV GeneSymbol GeneName control vs PBS) vs PBS) FOXB1 forkhead box B1 up 19.85 4.31 WWC2-AS1 WWC2 antisense RNA 1 up 19.66 4.30 CFAP61 cilia and flagella associated up 14.71 3.88 protein 61 CHST10 carbohydrate sulfotransferase 10 up 13.57 3.76 HRK harakiri, BCL2 interacting up 12.81 3.68 protein KLK8 kallikrein-related peptidase 8 up 12.43 3.64 MYHAS myosin heavy chain gene cluster up 12.15 3.60 antisense RNA HTR4 5-hydroxytryptamine (serotonin) up 11.96 3.58 receptor 4, G protein-coupled ANAPC1 anaphase promoting complex up 10.64 3.41 subunit 1 LYPD6B LY6/PLAUR domain containing up 9.75 3.29 6B LIG3 ligase III, DNA, ATP-dependent up 9.75 3.29 TSPEAR thrombospondin-type laminin G up 9.41 3.23 domain and EAR repeats OR6A2 olfactory receptor, family 6, up 9.28 3.21 subfamily A, member 2 GRIN2C glutamate receptor, ionotropic, up 9.21 3.20 N-methyl D-aspartate 2C GPR141 G protein-coupled receptor 141 up 9.11 3.19 MUC7 mucin 7, secreted up 8.51 3.09 ATXN8OS ATXN8 opposite strand (non- up 8.14 3.03 protein coding) KLK13 kallikrein-related peptidase 13 up 8.05 3.01 ADAMTS8 ADAM metallopeptidase with up 8.01 3.00 thrombospondin type 1 motif, 8 ILF2 interleukin enhancer binding up 7.59 2.92 factor 2 RMDN2-AS1 RMDN2 antisense RNA 1 up 7.48 2.90 CD300C CD300c molecule up 7.44 2.90 LRP1 low density lipoprotein receptor- up 7.25 2.86 related protein 1 CCDC13 coiled-coil domain containing 13 up 6.77 2.76 POLM polymerase (DNA directed), mu up 6.40 2.68 GPER1 G protein-coupled estrogen up 6.37 2.67 receptor 1 SNORD77 small nucleolar RNA, C/D box up 6.14 2.62 77 SDC2 syndecan 2 up 5.78 2.53 KRTAP22-1 keratin associated protein 22-1 up 5.76 2.53 SLITRK2 SLIT and NTRK-like family, up 5.72 2.52 member 2 LRRC7 leucine rich repeat containing 7 up 5.51 2.46 CHRNA2 cholinergic receptor, nicotinic, up 5.40 2.43 alpha 2 (neuronal) SEPT3 septin 3 up 5.22 2.39 TSRM zinc finger domain-related up 5.14 2.36 protein TSRM TRAPPC2 trafficking protein particle up 5.03 2.33 complex 2 WDR5B WD repeat domain 5B up 4.97 2.31 PPP1R26-AS1 PPP1R26 antisense RNA 1 up 4.79 2.26 SAMD13 sterile alpha motif domain up 4.71 2.23 containing 13 RNF180 ring finger protein 180 up 4.69 2.23 ZNF888 zinc finger protein 888 up 4.39 2.14 PTCD2 pentatricopeptide repeat domain up 4.38 2.13 2 TM4SF5 transmembrane 4 L six family up 4.37 2.13 member 5 PHGR1 proline/histidine/glycine-rich 1 up 4.33 2.11 LRRC10 leucine rich repeat containing 10 up 4.27 2.09 COL27A1 collagen, type XXVII, alpha 1 up 4.26 2.09 XKR7 XK, Kell blood group complex up 4.16 2.06 subunit-related family, member 7 NOS1AP nitric oxide synthase 1 (neuronal) up 4.11 2.04 adaptor protein ITLN2 intelectin 2 up 4.11 2.04 PTCD2 pentatricopeptide repeat domain up 4.05 2.02 2 KRT8 keratin 8, type II up 3.92 1.97 FAM150B family with sequence similarity up 3.85 1.94 150, member B SNORD19B small nucleolar RNA, C/D box up 3.83 1.94 19B MEGF10 multiple EGF-like-domains 10 up 3.76 1.91 LRIG2 leucine-rich repeats and up 3.67 1.87 immunoglobulin-like domains 2 LRIT1 leucine-rich repeat, up 3.62 1.86 immunoglobulin-like and transmembrane domains 1 OR1L8 olfactory receptor, family 1, up 3.56 1.83 subfamily L, member 8 CBX3P2 chromobox homolog 3 up 3.54 1.83 pseudogene 2 RAB11FIP4 RAB11 family interacting up 3.50 1.81 protein 4 (class II) FSD1L fibronectin type III and SPRY up 3.48 1.80 domain containing 1-like ROR1 receptor tyrosine kinase-like up 3.45 1.79 orphan receptor 1 CCDC17 coiled-coil domain containing 17 up 3.42 1.78 SLC7A14 solute carrier family 7, member up 3.42 1.77 14 KCNS1 potassium voltage-gated channel, up 3.41 1.77 modifier subfamily S, member 1 PRY2 PTPN13-like, Y-linked 2 up 3.40 1.76 TLCD2 TLC domain containing 2 up 3.40 1.76 CEP85L centrosomal protein 85 kDa-like up 3.34 1.74 CDC42EP3 CDC42 effector protein (Rho up 3.29 1.72 GTPase binding) 3 PVRL3-AS1 PVRL3 antisense RNA 1 up 3.24 1.69 NT5DC4 5′-nucleotidase domain up 3.23 1.69 containing 4 CNOT4 CCR4-NOT transcription up 3.18 1.67 complex, subunit 4 POFUT1 protein O-fucosyltransferase 1 up 3.17 1.67 PTGER4P2- PTGER4P2-CDK2AP2P2 up 3.17 1.66 CDK2AP2P2 readthrough transcribed pseudogene NCOA2 nuclear receptor coactivator 2 up 3.13 1.65 L2HGDH L-2-hydroxyglutarate up 3.12 1.64 dehydrogenase SIRPG signal-regulatory protein gamma up 3.10 1.63 MID1 midline 1 up 3.10 1.63 WDR55 WD repeat domain 55 up 3.10 1.63 GATA6 GATA binding protein 6 up 3.09 1.63 RNF216 ring finger protein 216 up 3.06 1.61 CGN cingulin up 3.04 1.60 SERPINI1 serpin peptidase inhibitor, clade I up 3.01 1.59 (neuroserpin), member 1 LCP1 lymphocyte cytosolic protein 1 up 3.01 1.59 (L-plastin) NR2F2-AS1 NR2F2 antisense RNA 1 up 3.00 1.59 FLJ43315 asparagine synthetase up 2.99 1.58 pseudogene AADAC arylacetamide deacetylase up 2.99 1.58 NDUFA6-AS1 NDUFA6 antisense RNA 1 (head up 2.98 1.57 to head) PMFBP1 polyamine modulated factor 1 up 2.96 1.57 binding protein 1 RBM23 RNA binding motif protein 23 up 2.96 1.57 CALML3-AS1 CALML3 antisense RNA 1 up 2.96 1.56 CSRNP3 cysteine-serine-rich nuclear up 2.96 1.56 protein 3 PCDHGC3 protocadherin gamma subfamily up 2.95 1.56 C, 3 CCDC110 coiled-coil domain containing up 2.95 1.56 110 SYDE2 synapse defective 1, Rho up 2.94 1.56 GTPase, homolog 2 (C. elegans) LRRC7 leucine rich repeat containing 7 up 2.92 1.54 SYNGAP1 synaptic Ras GTPase activating up 2.91 1.54 protein 1 MMP25 matrix metallopeptidase 25 up 2.88 1.52 PLXDC1 plexin domain containing 1 up 2.87 1.52 SPIN3 spindlin family, member 3 up 2.87 1.52 SP2-AS1 SP2 antisense RNA 1 up 2.87 1.52 FAM178B family with sequence similarity up 2.87 1.52 178, member B FAM104B family with sequence similarity up 2.86 1.52 104, member B SSU72 SSU72 RNA polymerase II CTD up 2.86 1.52 phosphatase homolog (S. cerevisiae) CALY calcyon neuron-specific vesicular up 2.86 1.52 protein ACVR1B activin A receptor, type IB up 2.84 1.51 KCTD21-AS1 KCTD21 antisense RNA 1 up 2.84 1.50 GPR173 G protein-coupled receptor 173 up 2.84 1.50 LBX1-AS1 LBX1 antisense RNA 1 (head to up 2.83 1.50 head) SPDYE3 speedy/RINGO cell cycle up 2.82 1.50 regulator family member E3 CHRDL1 chordin-like 1 up 2.82 1.50 CDK20 cyclin-dependent kinase 20 up 2.80 1.49 SLC51B solute carrier family 51, beta up 2.80 1.48 subunit ZBED3-AS1 ZBED3 antisense RNA 1 up 2.78 1.48 ETV4 ets variant 4 up 2.77 1.47 KLHL15 kelch-like family member 15 up 2.75 1.46 TCTE3 t-complex-associated-testis- up 2.75 1.46 expressed 3 MAGEA2B melanoma antigen family A, 2B up 2.74 1.46 SP2-AS1 SP2 antisense RNA 1 up 2.74 1.46 RPAP2 RNA polymerase II associated up 2.74 1.45 protein 2 ITPK1-AS1 ITPK1 antisense RNA 1 up 2.73 1.45 ATP1A1-AS1 ATP1A1 antisense RNA 1 up 2.73 1.45 C2orf15 chromosome 2 open reading up 2.72 1.44 frame 15 UBE2E4P ubiquitin-conjugating enzyme up 2.71 1.44 E2E 4 pseudogene OCLN occludin up 2.71 1.44 CHAC1 ChaC glutathione-specific up 2.70 1.43 gamma-glutamylcyclotransferase 1 SPOPL speckle-type POZ protein-like up 2.69 1.43 TMEM200B transmembrane protein 200B up 2.68 1.42 TMEM184B transmembrane protein 184B up 2.68 1.42 GLTPD2 glycolipid transfer protein up 2.65 1.41 domain containing 2 OBP2B odorant binding protein 2B up 2.64 1.40 CYP4Z1 cytochrome P450, family 4, up 2.64 1.40 subfamily Z, polypeptide 1 CASC11 cancer susceptibility candidate up 2.63 1.40 11 (non-protein coding) AHCTF1 AT hook containing transcription up 2.63 1.40 factor 1 PFKFB2 6-phosphofructo-2- up 2.62 1.39 kinase/fructose-2,6- biphosphatase 2 FAM154B family with sequence similarity up 2.62 1.39 154, member B SUPT3H suppressor of Ty 3 homolog up 2.61 1.39 (S. cerevisiae) BAALC brain and acute leukemia, up 2.61 1.38 cytoplasmic RIBC1 RIB43A domain with coiled- up 2.59 1.37 coils 1 ZNF354C zinc finger protein 354C up 2.59 1.37 DIS3E2 DIS3 like 3′-5′ exoribonuclease 2 up 2.58 1.37 HIST1H2AA histone cluster 1, H2aa up 2.55 1.35 MYCNOS MYCN opposite strand up 2.55 1.35 PLA2G2D phospholipase A2, group IID up 2.54 1.34 ANKRD20A19P ankyrin repeat domain 20 family, up 2.52 1.33 member A19, pseudogene SSPO SCO-spondin up 2.52 1.33 ARMCX4 armadillo repeat containing, X- up 2.51 1.33 linked 4 SNAR-G1 small ILF3/NF90-associated up 2.51 1.33 RNA G1 MYLK3 myosin light chain kinase 3 up 2.50 1.32 NPAS3 neuronal PAS domain protein 3 up 2.49 1.31 HS1BP3-IT1 HS1BP3 intronic transcript 1 up 2.49 1.31 (non-protein coding) DTX3 deltex 3, E3 ubiquitin ligase up 2.48 1.31 PGM5P4-AS1 PGM5P4 antisense RNA 1 up 2.46 1.30 SNORA14B small nucleolar RNA, H/ACA up 2.46 1.30 box 14B SLC39A2 solute carrier family 39 (zinc up 2.46 1.30 transporter), member 2 ZNF287 zinc finger protein 287 up 2.45 1.29 GS1-259H13.2 transmembrane protein 225-like up 2.45 1.29 MRGPRG MAS-related GPR, member G up 2.45 1.29 LRRC17 leucine rich repeat containing 17 up 2.45 1.29 LANCL2 LanC lantibiotic synthetase up 2.44 1.29 component C-like 2 (bacterial) ANKEF1 ankyrin repeat and EF-hand up 2.44 1.29 domain containing 1 PBX2 pre-B-cell leukemia homeobox 2 up 2.43 1.28 CCDC121 coiled-coil domain containing up 2.42 1.28 121 CRYBA2 crystallin, beta A2 up 2.42 1.28 TMPO-AS1 TMPO antisense RNA 1 up 2.42 1.28 ACSBG1 acyl-CoA synthetase bubblegum up 2.41 1.27 family member 1 MR1 major histocompatibility up 2.41 1.27 complex, class I-related PPIP5K1 diphosphoinositol up 2.41 1.27 pentakisphosphate kinase 1 TRIM6 tripartite motif containing 6 up 2.41 1.27 CCDC121 coiled-coil domain containing up 2.41 1.27 121 TUSC5 tumor suppressor candidate 5 up 2.40 1.26 XPO5 exportin 5 up 2.39 1.26 SPDYE8P speedy/RINGO cell cycle up 2.39 1.26 regulator family member E8, pseudogene CSRNP3 cysteine-serine-rich nuclear up 2.39 1.26 protein 3 RBM33 RNA binding motif protein 33 up 2.37 1.25 B3GNT7 UDP-GlcNAc:betaGal beta-1,3- up 2.37 1.24 N-acetylglucosaminyltransferase 7 NME9 NME/NM23 family member 9 up 2.36 1.24 CYP4V2 cytochrome P450, family 4, up 2.36 1.24 subfamily V, polypeptide 2 CDSN corneodesmosin up 2.36 1.24 COL20A1 collagen, type XX, alpha 1 up 2.36 1.24 ZNF192P1 zinc finger protein 192 up 2.35 1.23 pseudogene 1 HERC6 HECT and RLD domain up 2.35 1.23 containing E3 ubiquitin protein ligase family member 6 SNORD25 small nucleolar RNA, C/D box up 2.35 1.23 25 FRS3 fibroblast growth factor receptor up 2.35 1.23 substrate 3 RGS5 regulator of G-protein signaling up 2.33 1.22 5 RMST rhabdomyosarcoma 2 associated up 2.33 1.22 transcript (non-protein coding) GAS2L2 growth arrest-specific 2 like 2 up 2.33 1.22 SGPP1 sphingosine-1-phosphate up 2.32 1.21 phosphatase 1 NIPSNAP3B nipsnap homolog 3B (C. elegans) up 2.31 1.21 TAB3 TGF-beta activated kinase up 2.31 1.21 1/MAP3K7 binding protein 3 RASSF10 Ras association (RalGDS/AF-6) up 2.31 1.21 domain family (N-terminal) member 10 PPIL6 peptidylprolyl isomerase up 2.31 1.20 (cyclophilin)-like 6 MPP4 membrane protein, palmitoylated up 2.30 1.20 4 (MAGUK p55 subfamily member 4) ZNF37A zinc finger protein 37A up 2.30 1.20 ATG10 autophagy related 10 up 2.29 1.20 FPR3 formyl peptide receptor 3 up 2.28 1.19 PDP2 pyruvate dehyrogenase up 2.27 1.18 phosphatase catalytic subunit 2 ZFAND4 zinc finger, AN1-type domain 4 up 2.27 1.18 RHOT1 ras homolog family member T1 up 2.26 1.18 NKAPP1 NFKB activating protein up 2.26 1.18 pseudogene 1 OPTC opticin up 2.26 1.18 FLT4 fms-related tyrosine kinase 4 up 2.26 1.18 OR2AG1 olfactory receptor, family 2, up 2.26 1.17 subfamily AG, member 1 (gene/pseudogene) C9orf72 chromosome 9 open reading up 2.25 1.17 frame 72 PPIP5K1 diphosphoinositol up 2.25 1.17 pentakisphosphate kinase 1 ASIC3 acid sensing (proton gated) ion up 2.24 1.17 channel 3 PIK3CD phosphatidylinositol-4,5- up 2.24 1.16 bisphosphate 3-kinase, catalytic subunit delta FAAHP1 fatty acid amide hydrolase up 2.24 1.16 pseudogene 1 ZNF641 zinc finger protein 641 up 2.24 1.16 SCN1B sodium channel, voltage gated, up 2.24 1.16 type I beta subunit FCN1 ficolin (collagen/fibrinogen up 2.22 1.15 domain containing) 1 HIST1H4G histone cluster 1, H4g up 2.22 1.15 CEBPA CCAAT/enhancer binding up 2.22 1.15 protein (C/EBP), alpha ANKRD20A8P ankyrin repeat domain 20 family, up 2.22 1.15 member A8, pseudogene MLYCD malonyl-CoA decarboxylase up 2.22 1.15 C5orf56 chromosome 5 open reading up 2.22 1.15 frame 56 HERC6 HECT and RLD domain up 2.22 1.15 containing E3 ubiquitin protein ligase family member 6 PRKACB protein kinase, cAMP-dependent, up 2.22 1.15 catalytic, beta SRP14-AS1 SRP14 antisense RNA1 (head to up 2.22 1.15 head) C1RL complement component 1, r up 2.21 1.15 subcomponent-like EMR2 egf-like module containing, up 2.21 1.15 mucin-like, hormone receptor- like 2 ATPAF1 ATP synthase mitochondrial F1 up 2.21 1.15 complex assembly factor 1 ZNF222 zinc finger protein 222 up 2.20 1.14 SCGB1B2P secretoglobin, family 1B, up 2.20 1.14 member 2, pseudogene CCDC113 coiled-coil domain containing up 2.20 1.14 113 C15orf48 chromosome 15 open reading up 2.20 1.14 frame 48 ETV3 ets variant 3 up 2.20 1.14 SCP2 sterol carrier protein 2 up 2.20 1.14 MGC34796 sepiapterin reductase (7,8- up 2.19 1.13 dihydrobiopterin:NADP+ oxidoreductase) pseudogene RAP1GAP RAP1 GTPase activating protein up 2.19 1.13 MAGOHB mago-nashi homolog B up 2.19 1.13 (Drosophila) ZBED4 zinc finger, BED-type containing up 2.19 1.13 4 FAM98B family with sequence similarity up 2.18 1.13 98, member B EPHB1 EPH receptor B1 up 2.18 1.13 POM121 POM121 transmembrane up 2.18 1.12 nucleoporin SNX21 sorting nexin family member 21 up 2.18 1.12 OR6Y1 olfactory receptor, family 6, up 2.18 1.12 subfamily Y, member 1 LMBRD2 LMBR1 domain containing 2 up 2.18 1.12 FLVCR2 feline leukemia virus subgroup C up 2.17 1.12 cellular receptor family, member 2 LRRC15 leucine rich repeat containing 15 up 2.17 1.12 TGFBR3 transforming growth factor, beta up 2.17 1.12 receptor III NXT2 nuclear transport factor 2-like up 2.17 1.11 export factor 2 HCRP1 hepatocellular carcinoma-related up 2.17 1.11 HCRP1 HEPACAM hepatic and glial cell adhesion up 2.16 1.11 molecule OBSCN obscurin, cytoskeletal calmodulin up 2.16 1.11 and titin-interacting RhoGEF SQSTM1 sequestosome 1 up 2.16 1.11 LGALS8 lectin, galactoside-binding, up 2.15 1.11 soluble, 8 RHBDL1 rhomboid, veinlet-like 1 up 2.15 1.11 (Drosophila) KIF21B kinesin family member 21B up 2.15 1.10 CEP170 centrosomal protein 170 kDa up 2.15 1.10 CYP51A1-AS1 CYP51A1 antisense RNA 1 up 2.15 1.10 LIMD1 LIM domains containing 1 up 2.15 1.10 ANKRD53 ankyrin repeat domain 53 up 2.14 1.10 INGX inhibitor of growth family, X- up 2.14 1.10 linked, pseudogene CDH15 cadherin 15, type 1, M-cadherin up 2.14 1.10 (myotubule) APCS amyloid P component, serum up 2.14 1.10 SYN2 synapsin II up 2.14 1.10 SMKR1 small lysine-rich protein 1 up 2.13 1.09 KCNK7 potassium channel, two pore up 2.13 1.09 domain subfamily K, member 7 TEX28 testis expressed 28 up 2.13 1.09 DYNLRB2 dynein, light chain, roadblock- up 2.13 1.09 type 2 CNNM2 cyclin and CBS domain divalent up 2.13 1.09 metal cation transport mediator 2 RSG1 REM2 and RAB-like small up 2.13 1.09 GTPase 1 FRMD8 FERM domain containing 8 up 2.13 1.09 STK33 serine/threonine kinase 33 up 2.13 1.09 OPLAH 5-oxoprolinase (ATP- up 2.13 1.09 hydrolysing) EFHC1 EF-hand domain (C-terminal) up 2.13 1.09 containing 1 C16orf47 chromosome 16 open reading up 2.13 1.09 frame 47 GSTO2 glutathione S-transferase omega up 2.12 1.09 2 PTPLB protein tyrosine phosphatase-like up 2.12 1.09 (proline instead of catalytic arginine), member b HIST1H2APS1 histone cluster 1, H2a, up 2.12 1.09 pseudogene 1 OR10W1 olfactory receptor, family 10, up 2.12 1.08 subfamily W, member 1 PEX5 peroxisomal biogenesis factor 5 up 2.12 1.08 ASS1 argininosuccinate synthase 1 up 2.11 1.08 LRRC16B leucine rich repeat containing up 2.11 1.08 16B CWC15 CWC15 spliceosome-associated up 2.11 1.08 protein SUV420H1 suppressor of variegation 4-20 up 2.11 1.08 homolog 1 (Drosophila) TET3 tet methylcytosine dioxygenase 3 up 2.11 1.07 POLD2 polymerase (DNA directed), up 2.10 1.07 delta 2, accessory subunit CCDC169 coiled-coil domain containing up 2.10 1.07 169 QRICH2 glutamine rich 2 up 2.10 1.07 SLC9A5 solute carrier family 9, subfamily up 2.10 1.07 A (NHE5, cation proton antiporter 5), member 5 CFAP69 cilia and flagella associated up 2.10 1.07 protein 69 HSF1 heat shock transcription factor 1 up 2.09 1.07 ACTB actin, beta up 2.09 1.06 MYPOP Myb-related transcription factor, up 2.09 1.06 partner of profilin HOXA11 homeobox A11 up 2.08 1.06 GNG12-AS1 GNG12 antisense RNA 1 up 2.08 1.06 TAPBP TAP binding protein (tapasin) up 2.08 1.06 DLEU2L deleted in lymphocytic leukemia up 2.08 1.06 2-like TESC tescalcin up 2.08 1.06 ITGA8 integrin, alpha 8 up 2.08 1.05 PPARGC1B peroxisome proliferator-activated up 2.08 1.05 receptor gamma, coactivator 1 beta FAM26E family with sequence similarity up 2.08 1.05 26, member E OR2A9P olfactory receptor, family 2, up 2.08 1.05 subfamily A, member 9 pseudogene WHAMMP3 WAS protein homolog associated up 2.07 1.05 with actin, golgi membranes and microtubules pseudogene 3 BTNL10 butyrophilin-like 10 up 2.07 1.05 PADI6 peptidyl arginine deiminase, type up 2.07 1.05 VI TMEM86A transmembrane protein 86A up 2.06 1.04 PARK2 parkin RBR E3 ubiquitin protein up 2.06 1.04 ligase MAPT microtubule-associated protein up 2.06 1.04 tau MAGEC1 melanoma antigen family C, 1 up 2.06 1.04 PYCR1 pyrroline-5-carboxylate up 2.06 1.04 reductase 1 CTBP1-AS2 CTBP1 antisense RNA 2 (head up 2.05 1.04 to head) GGCT gamma-glutamylcyclotransferase up 2.05 1.04 FAM25A family with sequence similarity up 2.05 1.03 25, member A PTCH1 patched 1 up 2.05 1.03 ALDH5A1 aldehyde dehydrogenase 5 up 2.05 1.03 family, member A1 CCDC68 coiled-coil domain containing 68 up 2.05 1.03 DAB2IP DAB2 interacting protein up 2.05 1.03 ATAD3C ATPase family, AAA domain up 2.05 1.03 containing 3C MARVELD2 MARVEL domain containing 2 up 2.04 1.03 KLC4 kinesin light chain 4 up 2.04 1.03 SREK1IP1 SREK1-interacting protein 1 up 2.04 1.03 CHAC2 ChaC, cation transport regulator up 2.04 1.03 homolog 2 (E. coli) HDHD3 haloacid dehalogenase-like up 2.04 1.03 hydrolase domain containing 3 ELMO2 engulfment and cell motility 2 up 2.04 1.03 TMSB4Y thymosin beta 4, Y-linked up 2.04 1.03 CYP2B6 cytochrome P450, family 2, up 2.03 1.02 subfamily B, polypeptide 6 EDNRB endothelin receptor type B up 2.03 1.02 ZNF660 zinc finger protein 660 up 2.03 1.02 SLC2A3 solute carrier family 2 (facilitated up 2.03 1.02 glucose transporter), member 3 ZNF749 zinc finger protein 749 up 2.03 1.02 C2orf27A chromosome 2 open reading up 2.03 1.02 frame 27A STRADA STE20-related kinase adaptor up 2.03 1.02 alpha MIR99AHG mir-99a-let-7c cluster host gene up 2.03 1.02 (non-protein coding) ZNF671 zinc finger protein 671 up 2.02 1.02 CEP44 centrosomal protein 44 kDa up 2.02 1.02 VPS9D1-AS1 VPS9D1 antisense RNA 1 up 2.02 1.01 SMAD1-AS1 SMAD1 antisense RNA 1 up 2.02 1.01 UBE3C ubiquitin protein ligase E3C up 2.02 1.01 PRSS33 protease, serine, 33 up 2.02 1.01 TTC28 tetratricopeptide repeat domain up 2.02 1.01 28 RASGRF1 Ras protein-specific guanine up 2.01 1.01 nucleotide-releasing factor 1 CFH complement factor H up 2.01 1.01 GNG12-AS1 GNG12 antisense RNA 1 up 2.01 1.01 GUSBP5 glucuronidase, beta pseudogene up 2.01 1.01 5 MMRN2 multimerin 2 up 2.00 1.00 HIF1A hypoxia inducible factor 1, alpha up 2.00 1.00 subunit (basic helix-loop-helix transcription factor) ZNF271P zinc finger protein 271, up 2.00 1.00 pseudogene DBF4B DBF4 zinc finger B up 2.00 1.00 NRCAM neuronal cell adhesion molecule up 2.00 1.00 MKS1 Meckel syndrome, type 1 up 2.00 1.00 GAREML GRB2 associated, regulator of down −6.04 −2.59 MAPK1-like SNORA2A small nucleolar RNA, H/ACA down −6.04 −2.59 box 2A MUC3A mucin 3A, cell surface associated down −6.04 −2.59 MAP3K10 mitogen-activated protein kinase down −6.12 −2.61 kinase kinase 10 SASS6 spindle assembly 6 homolog down −6.15 −2.62 (C. elegans) BANP BTG3 associated nuclear protein down −6.16 −2.62 TSPAN15 tetraspanin 15 down −6.23 −2.64 SLC25A17 solute carrier family 25 down −6.27 −2.65 (mitochondrial carrier; peroxisomal membrane protein, 34 kDa), member 17 SLC5A1 solute carrier family 5 down −6.36 −2.67 (sodium/glucose co transporter), member 1 HYOU1 hypoxia up-regulated 1 down −6.37 −2.67 MYH3 myosin, heavy chain 3, skeletal down −6.38 −2.67 muscle, embryonic FCRL5 Fc receptor-like 5 down −6.39 −2.67 DIS3L2 DIS3 like 3′-5′ exoribonuclease 2 down −6.43 −2.69 SUCNR1 succinate receptor 1 down −6.44 −2.69 NPBWR1 neuropeptides B/W receptor 1 down −6.53 −2.71 MDM2 MDM2 proto-oncogene, E3 down −6.56 −2.71 ubiquitin protein ligase HIST1H2AC histone cluster 1, H2ac down −6.56 −2.71 KLRC1 killer cell lectin-like receptor down −6.58 −2.72 subfamily C, member 1 CDCA7L cell division cycle associated 7- down −6.59 −2.72 like RNA28S5 RNA, 28S ribosomal 5 down −6.65 −2.73 MAGT1 magnesium transporter 1 down −6.68 −2.74 HYDIN HYDIN, axonemal central pair down −6.68 −2.74 apparatus protein FAM96B family with sequence similarity down −6.70 −2.74 96, member B FPGT fucose-1-phosphate down −6.70 −2.74 guanylyltransferase USP45 ubiquitin specific peptidase 45 down −6.72 −2.75 FAM87A family with sequence similarity down −6.72 −2.75 87, member A LMO7DN LMO7 downstream neighbor down −6.78 −2.76 LACC1 laccase (multicopper down −6.80 −2.77 oxidoreductase) domain containing 1 BAIAP2-AS1 BAIAP2 antisense RNA 1 (head down −6.87 −2.78 to head) CACNA1I calcium channel, voltage- down −6.88 −2.78 dependent, T type, alpha 11 subunit MB21D2 Mab-21 domain containing 2 down −6.91 −2.79 AMOTL1 angiomotin like 1 down −7.01 −2.81 PALLD palladin, cytoskeletal associated down −7.02 −2.81 protein HTT huntingtin down −7.09 −2.83 CASC8 cancer susceptibility candidate 8 down −7.14 −2.84 (non-protein coding) C11orf68 chromosome 11 open reading down −7.20 −2.85 frame 68 ZNF778 zinc finger protein 778 down −7.25 −2.86 FUT7 fucosyltransferase 7 (alpha (1,3) down −7.26 −2.86 fucosyltransferase) CT55 cancer/testis antigen 55 down −7.29 −2.87 ULK4 unc-51 like kinase 4 down −7.51 −2.91 EIF2AK1 eukaryotic translation initiation down −7.53 −2.91 factor 2-alpha kinase 1 STON1 stonin 1 down −7.56 −2.92 NOX1 NADPH oxidase 1 down −7.63 −2.93 METAP1D methionyl aminopeptidase type down −7.67 −2.94 1D (mitochondrial) FAM120B family with sequence similarity down −7.68 −2.94 120B IMPG1 interphotoreceptor matrix down −7.76 −2.96 proteoglycan 1 PBX2 pre-B-cell leukemia homeobox 2 down −7.77 −2.96 POLR2F polymerase (RNA) II (DNA down −7.81 −2.97 directed) polypeptide F GLI2 GLI family zinc finger 2 down −7.93 −2.99 MRPL28 mitochondrial ribosomal protein down −7.94 −2.99 L28 STEAP3 STEAP family member 3, down −8.08 −3.01 metalloreductase USP2 ubiquitin specific peptidase 2 down −8.09 −3.02 SEL1L sel-1 suppressor of lin-12-like down −8.21 −3.04 (C. elegans) PCDH17 protocadherin 17 down −8.25 −3.04 ASB1 ankyrin repeat and SOCS box down −8.30 −3.05 containing 1 PER2 period circadian clock 2 down −8.39 −3.07 KRT8P12 keratin 8 pseudogene 12 down −8.45 −3.08 SYNJ2-IT1 SYNJ2 intronic transcript 1 (non- down −8.46 −3.08 protein coding) ADCK5 aarF domain containing kinase 5 down −8.46 −3.08 ATP2B1 ATPase, Ca++ transporting, down −8.49 −3.09 plasma membrane 1 GEMIN2 gem (nuclear organelle) down −8.50 −3.09 associated protein 2 EIF4B eukaryotic translation initiation down −8.54 −3.09 factor 4B IFNK interferon, kappa down −8.63 −3.11 SPATS2L spermatogenesis associated, down −8.63 −3.11 serine-rich 2-like SUCLG2-AS1 SUCLG2 antisense RNA 1 (head down −8.67 −3.12 to head) OTUD7B OTU deubiquitinase 7B down −8.67 −3.12 HAPLN2 hyaluronan and proteoglycan link down −8.69 −3.12 protein 2 TRMT13 tRNA methyltransferase 13 down −8.72 −3.12 homolog (S. cerevisiae) PRR27 proline rich 27 down −8.73 −3.13 RCSD1 RCSD domain containing 1 down −8.81 −3.14 FBXO24 F-box protein 24 down −8.99 −3.17 SYK spleen tyrosine kinase down −9.02 −3.17 TMEM129 transmembrane protein 129, E3 down −9.04 −3.18 ubiquitin protein ligase CDRT1 CMT1A duplicated region down −9.05 −3.18 transcript 1 CDK5RAP3 CDK5 regulatory subunit down −9.11 −3.19 associated protein 3 OPTN optineurin down −9.13 −3.19 CYLC1 cylicin, basic protein of sperm down −9.21 −3.20 head cytoskeleton 1 CAPN3 calpain 3, (p94) down −9.35 −3.23 LARGE-AS1 LARGE antisense RNA 1 down −9.36 −3.23 CXorf40B chromosome X open reading down −9.44 −3.24 frame 40B NINL ninein-like down −9.44 −3.24 ETV5 ets variant 5 down −9.45 −3.24 ZNF585A zinc finger protein 585A down −9.59 −3.26 ARHGAP5-AS1 ARHGAP5 antisense RNA 1 down −9.63 −3.27 (head to head) ZNF594 zinc finger protein 594 down −9.65 −3.27 ALS2 amyotrophic lateral sclerosis 2 down −9.76 −3.29 (juvenile) SNX10 sorting nexin 10 down −9.76 −3.29 LGI2 leucine-rich repeat LGI family, down −9.80 −3.29 member 2 BTG3 BTG family, member 3 down −9.93 −3.31 LCE2A late cornified envelope 2A down −10.02 −3.32 CC2D1B coiled-coil and C2 domain down −10.29 −3.36 containing 1B DIP2A DIP2 disco-interacting protein 2 down −10.43 −3.38 homolog A (Drosophila) RFNG RFNG O-fucosylpeptide 3-beta- down −10.55 −3.40 N-acetylglucosaminyltransferase SLN sarcolipin down −10.56 −3.40 NUP98 nucleoporin 98 kDa down −10.65 −3.41 NSA2 NSA2 ribosome biogenesis down −10.70 −3.42 homolog (S. cerevisiae) KIF1C kinesin family member 1C down −10.72 −3.42 ZIC3 Zic family member 3 down −11.34 −3.50 MFAP3 microfibrillar-associated protein down −11.37 −3.51 3 GNA15 guanine nucleotide binding down −11.46 −3.52 protein (G protein), alpha 15 (Gq class) MAGEA6 melanoma antigen family A, 6 down −11.60 −3.54 MCAT malonyl CoA:ACP down −11.65 −3.54 acyltransferase (mitochondrial) MCFD2 multiple coagulation factor down −12.07 −3.59 deficiency 2 SNORD15A small nucleolar RNA, C/D box down −12.11 −3.60 15A KCNE5 potassium channel, voltage gated down −12.25 −3.61 subfamily E regulatory beta subunit 5 MAGI2-AS3 MAGI2 antisense RNA 3 down −12.33 −3.62 NAA60 N(alpha)-acetyltransferase 60, down −12.34 −3.63 NatF catalytic subunit GABBR1 gamma-aminobutyric acid down −12.73 −3.67 (GABA) B receptor, 1 TGFB1I1 transforming growth factor beta down −12.84 −3.68 1 induced transcript 1 LPAR6 lysophosphatidic acid receptor 6 down −13.11 −3.71 RNASE7 ribonuclease, RNase A family, 7 down −13.47 −3.75 MAFG v-maf avian musculoaponeurotic down −13.80 −3.79 fibrosarcoma oncogene homolog G COL6A4P1 collagen, type VI, alpha 4 down −15.64 −3.97 pseudogene 1 NAV2-AS5 NAV2 antisense RNA 5 down −15.83 −3.98 OR52B2 olfactory receptor, family 52, down −17.06 −4.09 subfamily B, member 2 SLC19A1 solute carrier family 19 (folate down −17.20 −4.10 transporter), member 1 HIST1H2BM histone cluster 1, H2bm down −17.25 −4.11 LRRC17 leucine rich repeat containing 17 down −17.46 −4.13 TNFRSF10C tumor necrosis factor receptor down −17.69 −4.15 superfamily, member 10c, decoy without an intracellular domain ARHGEF7 Rho guanine nucleotide down −18.02 −4.17 exchange factor (GEF) 7 OR4C6 olfactory receptor, family 4, down −18.80 −4.23 subfamily C, member 6 CCDC158 coiled-coil domain containing down −18.86 −4.24 158 RNFT2 ring finger protein, down −19.57 −4.29 transmembrane 2 MAPKAPK5- MAPKAPK5 antisense RNA 1 down −19.79 −4.31 AS1 MYO15B myosin XVB pseudogene down −20.06 −4.33 ANKRD54 ankyrin repeat domain 54 down −20.15 −4.33 CLCA4 chloride channel accessory 4 down −20.19 −4.34 DNAJB1 DnaJ (Hsp40) homolog, down −20.40 −4.35 subfamily B, member 1 REEP3 receptor accessory protein 3 down −21.78 −4.44 PGBD2 piggyBac transposable element down −21.84 −4.45 derived 2 CENPV centromere protein V down −22.45 −4.49 CEP83 centrosomal protein 83 kDa down −22.45 −4.49 TMEM200C transmembrane protein 200C down −24.02 −4.59 RALBP1 ralA binding protein 1 down −24.51 −4.62 DHFRL1 dihydrofolate reductase-like 1 down −24.69 −4.63 TDRKH tudor and KH domain containing down −25.59 −4.68 ALG3 ALG3, alpha-1,3- down −26.75 −4.74 mannosyltransferase CKS1B CDC28 protein kinase regulatory down −27.57 −4.78 subunit 1B KIAA1841 KIAA1841 down −27.85 −4.80 BHLHE41 basic helix-loop-helix family, down −28.68 −4.84 member e41 DNAJC3 DnaJ (Hsp40) homolog, down −29.22 −4.87 subfamily C, member 3 C3orf17 chromosome 3 open reading down −29.27 −4.87 frame 17 GTF2H5 general transcription factor IIH, down −29.36 −4.88 polypeptide 5 PTGR1 prostaglandin reductase 1 down −30.46 −4.93 JUN jun proto-oncogene down −31.81 −4.99 TTC28-AS1 TTC28 antisense RNA 1 down −32.23 −5.01 CHST2 carbohydrate (N- down −32.67 −5.03 acetylglucosamine-6-O) sulfotransferase 2 KIF22 kinesin family member 22 down −34.17 −5.09 CRHR1-IT1 CRHR1 intronic transcript 1 down −34.51 −5.11 (non-protein coding) ZNF746 zinc finger protein 746 down −34.76 −5.12 ZNF658 zinc finger protein 658 down −36.25 −5.18 ALS2 amyotrophic lateral sclerosis 2 down −38.73 −5.28 (juvenile) MTHFD1L methylenetetrahydrofolate down −39.85 −5.32 dehydrogenase (NADP+ dependent) 1-like AMACR alpha-methylacyl-CoA racemase down −41.76 −5.38 COMMD7 COMM domain containing 7 down −45.82 −5.52 FIP1L1 factor interacting with PAPOLA down −47.06 −5.56 and CPSF1 PARP9 poly (ADP-ribose) polymerase down −50.35 −5.65 family, member 9 HIPK2 homeodomain interacting protein down −50.40 −5.66 kinase 2 AFF4 AF4/FMR2 family, member 4 down −50.87 −5.67 EPB41L4A erythrocyte membrane protein down −52.62 −5.72 band 4.1 like 4A ZNF658 zinc finger protein 658 down −54.60 −5.77 EDARADD EDAR-associated death domain down −60.04 −5.91 PHB prohibitin down −62.21 −5.96 ZNF532 zinc finger protein 532 down −67.26 −6.07 HOXD-AS2 HOXD cluster antisense RNA 2 down −69.02 −6.11 DSE dermatan sulfate epimerase down −72.55 −6.18 NR2C1 nuclear receptor subfamily 2, down −75.82 −6.24 group C, member 1 ACSF3 acyl-CoA synthetase family down −76.12 −6.25 member 3 SNORA11C small nucleolar RNA, H/ACA down −76.18 −6.25 box 11C TMEM144 transmembrane protein 144 down −77.84 −6.28 CD2AP CD2-associated protein down −83.67 −6.39 CHML choroideremia-like (Rab escort down −90.20 −6.50 protein 2) RNF2 ring finger protein 2 down −106.09 −6.73 HIST1H2BB histone cluster 1, H2bb down −108.05 −6.76 INTS1 integrator complex subunit 1 down −112.31 −6.81 IFT172 intraflagellar transport 172 down −118.33 −6.89 PPIA peptidylprolyl isomerase A down −123.27 −6.95 (cyclophilin A) SLC26A6 solute carrier family 26 (anion down −125.10 −6.97 exchanger), member 6 DOPEY1 dopey family member 1 down −125.80 −6.98 SLC22A23 solute carrier family 22, member down −131.70 −7.04 23 SH3BP4 SH3-domain binding protein 4 down −132.76 −7.05 WDR13 WD repeat domain 13 down −134.84 −7.08 CSNK1G3 casein kinase 1, gamma 3 down −141.58 −7.15 ROM1 retinal outer segment membrane down −145.30 −7.18 protein 1 MCM4 minichromosome maintenance down −148.04 −7.21 complex component 4 HHIP-AS1 HHIP antisense RNA 1 down −158.31 −7.31 MFAP3L microfibrillar-associated protein down −162.61 −7.35 3-like ALG1 ALG1, down −181.56 −7.50 chitobiosyldiphosphodolichol beta-mannosyltransferase TAPT1 transmembrane anterior posterior down −183.15 −7.52 transformation 1 AASDHPPT aminoadipate-semialdehyde down −194.22 −7.60 dehydrogenase- phosphopantetheinyl transferase RHOU ras homolog family member U down −207.00 −7.69 AP1G2 adaptor-related protein complex down −208.91 −7.71 1, gamma 2 subunit HSPA4 heat shock 70 kDa protein 4 down −222.32 −7.80 HERC2P2 hect domain and RLD 2 down −257.78 −8.01 pseudogene 2 PABPC1 poly(A) binding protein, down −285.37 −8.16 cytoplasmic 1 ANKRD17 ankyrin repeat domain 17 down −292.05 −8.19 SERP1 stress-associated endoplasmic down −302.29 −8.24 reticulum protein 1 RALGAPB Ral GTPase activating protein, down −322.52 −8.33 beta subunit (non-catalytic) UBE2Q2P1 ubiquitin-conjugating enzyme down −326.90 −8.35 E2Q family member 2 pseudogene 1 PLXNA1 plexin A1 down −423.72 −8.73 ATXN2 ataxin 2 down −427.53 −8.74 ANKRD40 ankyrin repeat domain 40 down −644.04 −9.33 RECK reversion-inducing-cysteine-rich down −655.93 −9.36 protein with kazal motifs EIF4E2 eukaryotic translation initiation down −682.42 −9.41 factor 4E family member 2 CYC1 cytochrome c-1 down −994.35 −9.96

    [0171] The above studies, including in vitro experiments and in vivo mouse models of lymphedema, illustrate the potential of therapeutic use of ADSC-EVs for lymphedema treatment. In vitro studies revealed that ADSC-EVs not only have angiogenesis activity, but also lymphangiogeneisis activity. In vivo local injection of ADSC-EVs in lymphedema legs contributed the reduction of enlarged circumference and the induction of capillary vessels and lymphatic vessels. Also, fibrosis of tissue was decreased in ADSC-EVs treatment. Furthermore, the results show that inducing angiogenesis and lymphangiogenesis simultaneously may lead to formation of vessels which expressed both vascular and lymphatic markers and may have function for draining lymphatic system to vascular system, which may work as drainage routes of accumulated fluids and lead to reduction of swelling in lymphedema animal models. Importantly, the results show that lymphedema may be treated with a local application of ADSC-EVs, which also may reduce inflammatory responses, thus decreasing the formation of fibrosis. Results also show that ADSC-EVs contain heterogeneous miRNAs including miR-199a-3p, miR-145-5p, miR-143-3p, miR-377-3p, miR-100-3p, miR-29a-3p, miR-495-3p, and miR-29c-3p which target MDM2, and miR-658, miR-493-3p, miR-184, and miR-27a-3p which target PHB, related to lymphangiogenesis and angiogenesis. MDM2 is a cellular oncoprotein encoded by a gene located on chromosome 12q13-14. MDM2 can suppress p53, a cancer suppressor gene (Duffy, et al., Semin Cancer Biol., S1044-579X(20):30160-7 (2020)). The inhibition of MDM2 exerts antiinflammatory effects and may lead to the treatment of autoimmune diseases and cancer (Ebrihim, et al., Histol Histopathol., 30(11):1271-82) (2015). Previous studies have shown that MDM2 negatively regulates the stability of hypoxiainducible factor-1 alpha (HIF1a) at the protein level (Shweta, et al., J Biol Chem., 289(33):22785-97 (2014)). The studies reported herein found that the expression level of HIF1a was elevated in LECs after the addition of ADSC-EVs. HIF1a is a transcription factor that controls the cellular response to hypoxia. HIF1a promotes the transcription of various proteins, such as VEGF, Erythropoietin (EPO) and glucose transporters, and plays a key role in lymphangiogenesis and angiogenesis. Thus, these results are consistent with the conclusions that reduced expression of MDM2 caused by eight lymphangiogenic miRNAs in ADSC-EVs led to increase in HIF1a expression in LECs, which caused angiogenesis and lymphangiogenesis.

    [0172] Unless defined otherwise, all technical and scientific terms used herein have the same meanings as commonly understood by one of skill in the art to which the disclosed invention belongs. Publications cited herein and the materials for which they are cited are specifically incorporated by reference.

    [0173] Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the invention described herein. Such equivalents are intended to be encompassed by the following claims.