Factor IX variants with clotting activity in absence of their cofactor and/or with increased F.IX clotting activity and their use for treating bleeding disorders

Abstract

The present invention relates to variants of factor IX (F.IX) or activated factor IX (F.IXa), wherein the variant is characterized in that it has clotting activity in absence of its cofactor. The present invention furthermore relates to variants of factor IX (F.IX) or activated factor IX (F.IXa), wherein the variant is characterized in that it has increased F.IX clotting activity compared to wildtype. The present invention furthermore relates to the use of these variants for the treatment and/or prophylaxis of bleeding disorders, in particular hemophilia A and/or hemophilia B or hemophilia caused or complicated by inhibitory antibodies to F.VIII. The present invention also relates to further variants of factor IX (F.IX) which have desired properties and can, thus be tailored for respective specific therapeutic applications.

Claims

1. A variant of factor IX (F.IX), which is characterized in that it has increased clotting activity in a presence of its cofactor compared to wild type, wherein the cofactor is factor VIII (F.VIII) or activated factor VIII (F.VIIIa), said variant of factor IX comprising the amino acid substitution R338L in combination with V10K and S377W.

2. The variant of factor IX of claim 1, further comprising one or more amino acid substitution(s) in position(s) selected from the group consisting of 4, 5, 6, 11, 44, 72, 75, 78, 86, 102, 105, 122, 135, 159, 185, 186, 211, 224, 243, 262, 263, 265, 268, 327, 367, 368, 376, 383, and 394.

3. The variant of factor IX of claim 2, wherein the one or more amino acid substitution(s) is/are selected from the group consisting of G4Y, K5A, K5F, L6F, Q11K, Q11R, Q11H, Q44H, W72R, F75V, E78D, V86A, S102N, N105S, K122R, V135A, T159S, E185D, D186E, V211I, E224G, E243D, A262D, I263S, K265T, H268R, R327S, N367D, P368I, T376A, I383A, and K394R.

4. The variant of factor IX of claim 2, wherein the amino acid substitution in position 5 is K5A.

5. The variant of factor IX of claim 1 selected from variant V10K/R338L/S377W variant V10K/R338L/S377W/L6F variant V10K/R338L/S377W/E243D variant V10K/R338L/S377W/E224G variant V10K/R338L/S377W/L6F/E224G variant V10K/R338L/S377W/E243D/E224G variant V10K/R338L/S377W/K265T and variant K5A/V10K/R338L/S377W.

6. The variant of factor IX of claim 1, comprising a further compound or moiety covalently attached to the variant.

7. A nucleic acid encoding a variant of factor IX (F.IX), which is characterized in that it has increased clotting activity in a presence of its cofactor compared to wild type, wherein the cofactor is factor VIII (F.VIII) or activated factor VIII (F.VIIIa), said variant of factor IX comprising the amino acid substitution R338L in combination with V10K and S377W.

8. A pharmaceutical composition comprising at least one variant of factor IX (F.IX) of claim 1, and optionally pharmaceutically acceptable carrier(s) and/or excipient(s).

9. A method for the diagnosis, prevention and/or treatment of a disease, wherein the disease is bleeding or a bleeding disorder, wherein said method comprises the step of administering to a subject in need thereof a therapeutically effective amount of the variant of factor IX (F.IX) of claim 1.

10. The method of claim 9, comprising cellular therapy or protein infusion therapy.

11. A method for screening of anticoagulants that directly inhibit F.IXa, comprising the steps: providing compound(s) to be tested, providing a variant of factor IX of claim 1, contacting the compound(s) to be tested with said variant of factor IX, determining whether the compound(s) bind to said variant of factor IX, and optionally, determining whether the compound(s) modulate the activity of said variant of factor IX.

12. The variant of factor IX of claim 1 with one or more amino acid substitution(s) in position(s) selected from the group consisting of 4, 5 and 265.

13. The variant of factor IX of claim 1, wherein the further amino acid substitution(s) is/are selected from the group consisting of K5A, L6F, Q11R, Q44H, W72R, F75V, E78D, V86A, S102N, N105S, K122R, E185D, D186E, V211I, E224G, E243D, I263S, K265I, T376A, and K394R.

14. The variant of factor IX of claim 1, wherein the further amino acid substitution(s) is/are selected from the group consisting of G4Y, K5A and K265T.

15. A pharmaceutical composition comprising the nucleic acid of claim 7, and optionally pharmaceutically acceptable carrier(s) and/or excipient(s).

16. A method for the diagnosis, prevention and/or treatment of a disease, wherein the disease is bleeding or a bleeding disorder, wherein said method comprises the step of administering to a subject in need thereof the pharmaceutical composition of claim 15.

17. The method of claim 16, wherein the administration comprises administering a gene therapy or delivery construct.

18. The method of claim 17, wherein the gene therapy or delivery construct is a viral or non-viral vector, and/or wherein the gene therapy or delivery construct is formulated in chitosan nanoparticles.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

(1) The following examples and drawings illustrate the present invention without, however, limiting the same thereto.

(2) FIGS. 1A-1E TGA of FIX variant ITV in F. VIII-deficient plasma (RD 1:20)

(3) (1A) lag time. (1B) peak thrombin. (1C) velocity index. (1D) AUC. (1E) Representative graph.

(4) FIGS. 2A-2E TGA of FIX variant ITV in F. VIII-deficient plasma (RD 1:20)

(5) (2A) lag time. (2B) peak thrombin. (2C) velocity index. (2D) AUC. (2E) Representative graph.

(6) FIGS. 3A-3E TGA of FIX variants with F.VIII-independent activity in F. VIII-deficient plasma

(7) (RD 1:20)

(8) (3A) lag time. (3B) peak thrombin. (3C) velocity index. (3D) AUC. (3E) Representative graph.

(9) FIGS. 4A-4E TGA of FIX variants with F.VIII-independent activity in FIX-deficient plasma

(10) (RD 1:100)

(11) (4A) lag time. (4B) peak thrombin. (4C) velocity index. (4D) AUC. (4E) Representative graph.

(12) FIGS. 5A-5E TGA of FIX variants with hyperfunctional F.IX activity in F.IX-deficient plasma

(13) (RD 1:100)

(14) (5A) lag time. (5B) peak thrombin. (5C) velocity index. (5D) AUC. (5E) Representative graph.

(15) FIGS. 6A-6E F.X activation of

(16) (6A) FIX variant ITV in the presence of F.VIII,

(17) (6B) FIX variant ITV in the absence of F.VIII,

(18) (6C) FIX variants with F.VIII-independent activity in the presence of F.VIII,

(19) (6D) FIX variants with F.VIII-independent activity in the absence of F.VIII,

(20) (6E) FIX variants with hyperfunctional F.IX activity in the presence of F.VIII.

(21) FIGS. 7A-7B In vitro efficacy of F.IX variants

(22) (7A) Clotting activity of F.IX variants in the presence of FVIII neutralizing antibodies.

(23) (7B) Activation status of F.IX variants.

(24) FIGS. 8A-8B In vivo efficacy of F.IX variants with F. VIII-independent activity

(25) (8A) Clotting times in F.VIII-deficient mice after expression of F.IX variants with FVIII-independent activity.

(26) (8B) Phenotype correction of F.VIII-deficient mice after expression of F.IX variants with FVIII-independent activity.

(27) FIGS. 9A-9D In vivo efficacy of FIX variants with FVIII-independent activity in F.VIII-Knockout mice following hydrodynamic injection of 25 μg liver-directed minicircle vector encoding for FIX-WT (n=7), FIX-FIAV (n=7) and FIX-IDAV (n=7). Control groups include wild-type mice (n=7) and naïve mice (n=6).

(28) F.IX activity (9A) and F.VIII-independent activity (9B) measured by one-stage coagulation assay in human F.IX- or F.VIII-deficient plasma, respectively, were analyzed three days post-injection.

(29) (9C) Blood loss after tail dissection at 1.5 mm diameter terminated after 10 min.

(30) (9D) TAT levels as a marker for hypercoagulopathy. Shown are means±SEM. * p<0.05 and

(31) *** p<0.001 according to ANOVA using Holm-Sidak test for multiple comparison with the wild type FIX group.

(32) FIGS. 10A-10D In vivo transfection efficiency after oral administration of chitosan-DNA nanoparticles to HB mice.

(33) (10A) Time schedule.

(34) (10B) Immunostaining of reporter gene GFP in small intestine after oral administration of a single dose of unformulated and chitosan formulated eGFP. GFP staining remained undetectable in liver, spleen and colon.

(35) (10C) Delivery of chitosan formulated FIX-WT or hyperfunctional FIX muteins to small intestine after oral administration of a single dose.

(36) (10D) mRNA expression in tissues after single feeding determined by quantitative RT-PCR 72 h post-treatment. Data represent means±SD, n=3/group.

(37) FIGS. 11A-11C Expression of functional FIX protein in small intestine after oral administration of chitosan-DNA nanoparticles.

(38) (11A) Time schedule for feeding and blood collection.

(39) (11B) Oral delivery of chitosan formulated pcDNA3.1 vectors containing FIX variants. Bars represent means±SEM, n=5/group.

(40) (11C) Oral delivery of chitosan formulated minicircles containing FIX muteins with defective collagen IV binding sites.

(41) Shown is mean±SEM, n=5-6/group. * p<0.05 according to ANOVA using Dunnett's test for multiple comparison with the chitosan/mock group.

(42) FIGS. 12A-12D Phenotype correction of HB mice after delivery chitosan formulated FIX muteins.

(43) (12A) Time schedule.

(44) (12B) Tail-clip experiment after tail dissection at 1.5 mm diameter after oral administration of formulated vector encoding FIX-WT (n=7), FIX-KLW (n=8) and FIX-AKLW (n=7). Control groups include wild-type mice (n=6) and naïve HB mice (n=7).

(45) (12C) Coagulation time measured by one-stage aPTT.

(46) (12D) TAT levels as a marker for hypercoagulopathy.

(47) Shown are means±SEM. ** p<0.01 according to ANOVA using Dunnett's test for multiple comparison with the HB group.

EXAMPLES

Example 1

(48) Material and Methods

(49) Non-Viral Vectors

(50) Plasmid pcDNA™3.1 (Invitrogen, Carlsbad, Calif., USA) contained a human FIX mini-gene including a 1.4 kb fragment of intron A under control of the cytomegalovirus (CMV) promoter/enhancer and a bovine growth hormone polyadenylation signal (Schuettrumpf et al., 2005). For in vivo expression, the human FIX expression cassette was introduced into the minicircle producer plasmid pMC.BESPX-MCS2 (System Biosciences) and controlled by the strong liver-specific enhancer/promoter HCR/hAAT (hepatic locus control region 1/human α-1-antitrypsin). Nucleotide substitutions were introduced in the hFIX cDNA using the QuickChange II XL site-directed mutagenesis kit (Agilent technologies) and confirmed by sequencing.

(51) Random Screening for FIX Muteins

(52) Random mutations were introduced into the hFIX expression cassette of pcDNA™3.1 possessing already the substitutions V181I, K265T and I383V (named FIX-ITV; Milanov et al., 2012) by the GeneMorph II EZClone Domain Mutagenesis Kit (Agilent technologies) as described by the manufacturer. Megaprimer synthesis was performed using forward 5′ TCTGAATCGGCCAAAGAGG ‘3 [SEQ ID NO. 3] and reverse 5’ CAGTTGACATACCGGGATACC ′3 [SEQ ID NO. 4] primers which tense over exon 2 to 8 of hFIX cDNA amplifying a 1.2 kb fragment. Initial amount of target DNA was set to 750 ng to get a mutation frequency of 2.7 per 1 kb. Plasmid DNA was extracted from each individual transformed E. coli colony (total number: 1600) using the QIAprep 96 Turbo Miniprep Kit (Qiagen). HEK 293T cells were transfected with 2.5 μg plasmid DNA encoding FIX-WT, FIX-ITV or individual variant by lipofection (Lipofectamine; Invitrogen) in 96-well-plates, initial cell density was 5×10.sup.4 cells/well. Protein expression in OptiMem medium supplemented with 10 μg/ml vitamin K was performed for 48 h. Collected supernatants of each variant were assayed for FIX- and FVIII-bypassing activity using a commercially available chromogenic assay (Biophen Faktor IX; Hyphen BioMed) with minor modifications in the presence and absence of FVIII, respectively. Normal human plasma (Control Plasma N; Siemens) was used for a standard curve and the engineered variant FIX-ITV was used as gold standard for comparison of activity levels. Promising variants/clones were sequenced to identify specific amino acids substitutions responsible for activity increase.

(53) Recombinant Protein Production

(54) HEK 293T cells were cultured in DMEM supplemented with 10% FBS, 1% Pen/Strep and 1% L-glutamine and plated 24 h prior to transfection into 6-well-plates with an initial cell density of 1×10.sup.6 cells/well. For transient expression, cells were transfected with 15 μg of CMV-hFIX pcDNA™3.1 plasmids using the calcium phosphate-mediated precipitation method. Protein expression was performed in serum- and antibiotic-free Opti-MEM containing 10 μg/ml vitamin K. Supernatants were collected 24 h post-transfection and assayed for FIX activity, ELISA, kinetic parameters and thrombin generation.

(55) Clotting Activity Assay and FIX Antigen

(56) Clotting activity was determined by a modified one-stage activated partial thromboplastin time (aPTT) and nonactivated aPTT (naPTT) assay in FIX- or FVIII-deficient plasma, as described previously (Milanov et al., 2012). FIX specific activity was calculated by dividing the clotting activity by the antigen levels and normalized to wild type protein (set as 100%). FIX antigen levels were determined by ELISA as described (Schuettrumpf et al., 2005).

(57) Thrombin Generation Assay

(58) Thrombin generation was measured with a commercial assay (Technothrombin TGA; Technoclone) according to manufacturer's instructions. TGA RD buffer was used at a final dilution of 1:20 or 1:100 in FVIII- or FIX-deficient plasma, respectively. Final concentration of FIX protein was 0.05% to 5% of normal plasma levels, diluted in TGA buffer (Technoclone). Preparations of rhFIX (BeneFIX; Pfizer) or rhFVIII (Kogenate; Bayer) were used as controls. Analysis of thrombin generation was evaluated by the provided Technothrombin TGA evaluation software.

(59) FX Activation by FIXa in the Presence or Absence of FVIIIa

(60) FIX protein samples were activated to FIXa by activated FXI (Haematologic Technologies) in the presence of 5 mM CaCl.sub.2 at a molar enzyme/substrate ratio of 1:100 for 5 h at room temperature. Then, FXIa was removed by affinity-purified goat anti-FXI IgG (Haemachromdiagnostica) coupled to Protein G coated magnetic beads (Dynabeads protein G; Invitrogen). FX activation was performed in the presence of 10 nM rhFVIII (Kogenate®; Bayer) and 1 nM FIX or in the absence of FVIII with 4 nM FIX, as described (7). The reaction was measured at 405 nm in 1-min intervals for 10 min at 37° C. in a microtiter plate reader. Absorbance values were converted into molar concentrations using a molar extinction coefficient of 9600 M.sup.−1 cm.sup.−1 for pNA and a path length of 0.5 cm for a total volume of 100 Kinetic parameters were calculated by SigmaPlot version 12.0 following the Michaelis-Menten equation.

(61) Animal Procedures

(62) All animal procedures were approved by the local animal care, protection and use authorities (Regierungspräsidium Darmstadt). C57Bl/6 mice were purchased from Harlan Laboratories. FXIII-deficient mice containing a disruption in exon 16 of the FVIII gene were obtained from Charles River Laboratories. Mice were 9-12 weeks old at the onset of experiments. For liver-directed gene transfer, the non-viral vector MC.HCR/hAAT. FIX encoding FIX-WT or variant was administered hydrodynamically into the tail vein with a vector dose of 25 μg per mouse, as described previously (Milanov et al., 2012). Three days after injection blood samples were taken from the retro-orbital plexus. Tail-clip bleeding assay was performed as previously described (Milanov et al., 2012) and quantified by measuring the absorbance of hemoglobin at 575 nm. TAT complexes were measured by ELISA (Enzygnost TAT; Siemens) according to the manufacturer's instructions.

(63) Statistics

(64) Statistical evaluation of data was performed by analysis of variance (ANOVA) using SigmaPlot version 12.0 (Systat software Inc., San Jose, USA).

(65) Results

(66) To further improve the properties of the ITV and the IAV variant, the inventors introduced further mutations in order to generate F.IX molecules with different properties.

(67) Tables 1 to 4 show the tested mutations and the activity of the variants in F.VIII.- or F.IX-deficient plasma.

(68) Table 1:

(69) Clotting activities of factor IX variants showing a F.VIII-independent activity generated by random mutagenesis measured by a FAX chromogenic assay in absence and presence of F.VIII. Values are shown relative to either wild type factor IX (WT-F.IX) or ITV. WT-F.IX refers to V181/K265/I383 and ITV refers to V181I/K265T/I383V. Standard deviation (S.D.).

(70) TABLE-US-00006 TABLE 1 Activity Activity with without F.VIII F.VIII relative Variants relative to ITV SD to WT-FIX SD WT-FIX 0.38 0.07 1.00 0.32 ITV 1.00 0.028 0.73 0.27 Single exchange ITV + L336H 0.72 0.45 0 0 ITV + D154N 1.09 0.89 0.34 0.08 ITV + S102N 1.07 0.18 0.65 0.28 ITV + Q11R 1.48 0.11 1.35 0.24 ITV + E185D 0.61 0.44 1 0.42 ITV + I251V 0.77 0.21 0.6 0.05 ITV + F25V 0.72 0.15 0.06 0.04 ITV + V211I 1.04 0.09 0.58 0.31 ITV + F75V 0.6 0.01 0.53 0.32 ITV + V135A 0.98 0.06 0.9 0.35 ITV + K394 0.6 0.1 0.38 0.19 ITV + Q44H 1 0.01 0.85 0.65 ITV + E243D 0.84 0.35 1.25 1.58 Double exchange ITV + N89D + F302Y 0.94 0.28 0.09 0.01 ITV + E113V + G310R 0.66 0.43 0.03 0.05 ITV + L6F + W72R 1.41 0.15 0.98 0.03 ITV + N54D + Q139E 1.46 0.87 0.63 0.18 ITV + K392E + T399S 1.11 0.83 0 0.16 ITV + E125D + A219V 0.83 0.23 0 0.01 ITV + A262D + P368I 2.75 1.61 0.62 0.79 ITV + H268D + A334S 1.12 1.06 0 0.19 ITV + N105S + I383A 0.2 0.05 0 0.05 ITV + E224G + I263S 1.05 0.27 0.55 0.03 Triple exchange ITV + V196I + C289R + 1.41 0.36 0.94 0.08 G366R ITV + C222Y + S304F + 0.96 0.54 0.09 0.06 T386A ITV + N260K + F299T + 1.24 1.54 0 0.01 L330I Quadruple exchange ITV + K122R + R338E + 0.41 0.21 0.55 0.18 I383A + T376A ITV + Q195L + H236L + 1.58 1.22 0.18 0.22 K319R + M391K ITV + V86A + A262D + 0.88 0.23 0.09 0.12 E119V + P368S
Table 2:

(71) Clotting activities of factor IX variants generated by random mutagenesis measured by a F.IX chromogenic assay in presence of F.VIII. Values are shown relative to either wild type factor IX (WT-F.IX) or ITV. WT-F.IX refers to V181/K265/I383 and ITV refers to V181I/K265T/I383V. Standard deviation (S.D.).

(72) TABLE-US-00007 TABLE 2 Activity with F.VIII Variants relative to WT-FIX SD WT-FIX 1.00 0.32 ITV 0.73 0.27 Single exchange ITV + E243D 1.25 1.58 ITV + T159S 1.17 0.5 ITV + Q11R 1.35 0.24 ITV + E185D 1 0.42 ITV + V135A 0.9 0.35 ITV + Q44H 0.85 0.65 Double exchange ITV + L6F + W72R 0.98 0.03 ITV + E78D + D186E 1.2 0.6 ITV + A262D + P368I 0.62 0.79 ITV + E224G + I263S 0.55 0.03 Quadruple exchange ITV + K122R + R338E + 0.55 0.18 I383A T376A ITV + T159S + H243R + 0.54 0.91 N367D + R327S
Table 3:

(73) Clotting activities of factor IX variants with single exchange showing a FVIII-independent activity measured by one stage aPTT in absence and presence of F.VIII. Values are shown in percent, being 100% the activity of wild type factor IX in nonnal human pool plasma with normal human levels of both F.IX and F.VIII. Standard error of mean (S.E.M.).

(74) TABLE-US-00008 TABLE 3 Activity Activity without with Variants F.VIII (%) S.E.M. F.VIII (%) S.E.M. WT-FIX 1 0 100 7 V181I + K265A + I383V 8.5 1 264 21 (ITV) ITV + L6F 11 4 57 5 ITV + W72R 11 4 57 5 ITV + N89D 11 0 202 18 ITV + S102N 11 2 345 34 ITV + N105S 14 1 212 18 ITV + K122R 12 4 2083 197 ITV + E185D 9 3 300 44 ITV + F302Y 11 0 202 18 ITV + R338E 12 4 2083 197 ITV + T376A 12 4 2083 197
Table 4:

(75) Clotting activities of factor IX variants with multiple amino acid substitutions including substitution in the 99-loop of FIX in absence and presence of F.VIII measured by a one stage aPTT. Values are shown in percent, being 100% the activity of wild type factor IX in normal human pool plasma with normal human levels of both F.IX and F.VIII. Standard error of mean (S.E.M.).

(76) TABLE-US-00009 TABLE 4 Activity (%) Without Activity (%) Variants F.VIII S.E.M. With F.VIII S.E.M. Wild type 0.85 0.07 102 5 V181I + K265A + I383V 11.15 1.17 140 9 (IAV) IAV + L6F 11.48 1.29 185 17 IAV + W72R 11.88 2.99 255 46 IAV + S102N 13.2 0.99 277 57 IAV + K122R 10.26 0.66 163 11 IAV + E185D 15.16 2.01 228 20 IAV + E185F 17.44 5.24 271 28 IAV + E185K 11.47 2.82 161.29 74 IAV + E185Q 16.57 4.62 233 4 IAV + E185S 17.10 4.17 181 60 IAV + I263S 11.90 1.16 244 26 IAV + L6F + S102K 13.02 1.18 361 41 IAV + L6F + S102N 14.27 0.82 219 46 IAV + L6F + S102P 14.72 2.18 237 49 IAV + S102N + E185D 14.05 0.85 266 10 IAV + S102N + E185F 8.6 0.89 312 24 IAV + S102N + E185K 6.42 0.25 204 44 IAV + S102N + E185S 9.11 0.99 392 37 IAV + L6F + I263S 13.57 0.57 311 9 IAV + E185D + I263S 10.38 0.96 166 5
Hepatic Expression of F.IX Mutants with F.VIII-Independent Activity Provides Hemostasis in F.VIII-Knockout Mice

(77) To examine the potential of FIX mutants to improve in vivo clotting activity and correct the bleeding phenotype of HA mice, we hydrodynamically injected liver-directed minicircles encoding FIX-WT or the variants FIX-FIAV (IAV+L6F) or FIX-IDAV (IAV+E185D) at vector doses of 25 μg into the tail vein of FVIII-knockout mice. Three days after gene delivery, mutant FIX expression levels were similar in all treatment groups and reached plasma activity levels of around 300% of normal (FIG. 9A). Only mice treated with FIX-IDAV showed significantly shorter clotting times resulting in 10% of FVIII-independent activity when measured in FVIII-deficient plasma by one-stage aPTT assay (FIG. 9B). Nevertheless, both mutants, FIX-FIAV and -IDAV, partially corrected the hemophilic phenotype after a tail-clip bleeding assay (FIG. 9C) suggesting that low amounts of FVIII-bypassing activity are sufficient to initiate and restore the coagulation cascade. We also investigated the effect of FIX mutants on TAT complex levels, which represent a general activation marker of the coagulation system. TAT levels remained similar in all groups, albeit with high inter-individual variation (FIG. 9D).

Example 2

(78) Material and Methods

(79) Recombinant Protein Production and Measurement of Clotting Activity

(80) See above, Example 1.

(81) Thrombin Generation Assay

(82) Thrombin generation was measured with a commercial assay (TechnothrombinTGA; Technoclone) according to manufacturer's instructions. TGA RD buffer was used at a final dilution of 1:20 or 1:100 in FVIII- or FIX-deficient plasma, respectively. Final concentration of FIX protein was 0.05% to 5% of normal plasma levels, diluted in TGA buffer (Technoclone). Preparations of rhFIX (BeneFIX; Pfizer) or rhFVIII (Kogenate; Pfizer) were used as controls. Analysis of thrombin generation was evaluated by the provided Technothrombin TGA evaluation software.

(83) FX Activation by FIXa in Presence and Absence of FVIIIa

(84) FIX protein samples were activated to FIXa by activated FXI (Haematologic Technologies) in presence of 5 mM CaCl.sub.2 at a molar enzyme/substrate ratio of 1:100 for 5 h at room temperature. Then, FXIa was removed by affinity-purified goat anti-FXI IgG (Haemachrom diagnostica) coupled to Protein G coated magnetic beads (Dynabeads protein G; Invitrogen). FX activation was performed in the presence of 10 nM rhFVIII (Kogenate®, Bayer) and 1 nM FIX, as described (Hartmann et al., 2009). The reaction was measured at 405 nm in 1-min intervals for 10 min at 37° C. in a mircotiter plate reader. Absorbance values were converted into molar concentrations using a molar extinction coefficient of 9600 M.sup.−1 cm.sup.−1 for pNA and a path length of 0.5 cm for a total volume of 100 μl. Kinetic parameters were calculated by SigmaPlot version 12.0 following the Michaelis-Menten equation.

(85) Chitosan/DNA Nanoparticle Preparation

(86) Nanoparticles were prepared by complex coacervation as described (Mao et al., 2001). High molecular weight chitosan with a deacetylation degree of >75% (Sigma-Aldrich) was dissolved in 50 mM NaOAc buffer to a 0.02% to 0.08% solution at pH 5.5. Chitosan and plasmid DNA solutions of 50 μg/ml or 100 μg/ml in 50 mM Na.sub.2SO.sub.4 buffer were heated separately to 55° C. Equal volumes (500 μl) of both solutions were mixed together under high-speed vortex for 30 sec. Nanoparticles were stored at room temperature until oral administration.

(87) DNase I Protection Assay

(88) Chitosan/DNA nanoparticles (20 equivalent to 1 μg) or uncomplexed DNA (1 μg) were incubated with either 1, 100 or 300 mU of DNase I (ThermoFisher) for 1 h at 37° C. The reaction was stopped by heat-inactivation at 65° C. for 10 min in the presence of EDTA. Additional incubation with 0.8 U of chitosanase (Sigma-Aldrich) for 4 h at 37° C. released the DNA from nanoparticles. The integrity of vector DNA was examined by subsequent electrophoresis on a 0.8% agarose gel.

(89) Animal Procedures

(90) All animal procedures were approved by the local animal care, protection and use authorities (Regierungsprasidium Daiinstadt). C57Bl/6 mice were purchased from Harlan Laboratories. FIX-deficient mice on a C57Bl/6 background (HB mice) were kindly provided by Katherine High (Children's Hospital of Philadelphia). Mice were 9-12 weeks old at the onset of experiments. For liver-directed gene transfer, the non-viral gene transfer vector MC.HCR/hAAT encoding FIX-WT or variant was administered hydrodynamically into the tail vein with a vector dose of 10 μg per mouse, as described previously (Milanov et al., 2012). For oral FIX gene delivery, mice were fed with CMV promoter driven vectors (pcDNA3.1 or MC) formulated as chitosan nanoparticles and mixed with baby cereal. Immunization of FIX-deficient mice was performed by two subcutaneous injections of 2 IU of rhFIX protein (BeneFIX®; Pfizer) in the presence of incomplete Freund's adjuvant at intervals of 2 weeks. Blood was taken from the retro-orbital plexus under isoflurane anesthesia into 1/10 volume of 3.8% sodium citrate buffer. Tail-clip bleeding assay was performed as previously described (Milanov et al., 2012) and quantified by measuring the absorbance of hemoglobin at 575 nm.

(91) Immunohistochemistry

(92) Serial cryosections (8-10 μm) were obtained from liver, spleen, small intestine, and colon for immunofluorescence staining. The antibodies used are listed in table S1. Images were captured using a confocal Laser Scanning Microscope (LSM, Zeiss) and analyzed with the Zeiss software LSM Image Browser.

(93) RT-PCR for FIX Expression after Oral Administration of Nanoparticles

(94) Total RNA was isolated from spleen, liver, duodenum/jejunum, ileum and colon using the High pure RNA isolation kit (Roche Diagnostics Deutschland GmbH). High capacity cDNA reverse transcriptase kit (Applied Biosystems) was used for translation of mRNA into cDNA. Quantitative real-time PCR was performed with Power SYBR Green (Applied Biosystems). Primer sequences are listed in table S2.

(95) Statistics

(96) Statistical evaluation of data was performed by analysis of variance (ANOVA) using SigmaPlot version 12.0 (Systat software Inc., San Jose, Calif.).

(97) Results

(98) To further improve the properties of the wild-type protein, the ITV and the IAV variant, the inventors introduced further mutations, single or in combination, in order to generate F.IX molecules with different properties.

(99) Tables 5 and 6 show the tested mutations and the activity of the variants.

(100) Table 5:

(101) Clotting activities of factor IX variants including a single amino acid substitution introduced into the wild type F.IX expression cassette resulting in hyperfunctional variants in presence of F.VIII. Clotting activities were measured in FIX-deficient plasma by a one stage aPTT assay. Values are shown in percent, being 100% the activity of wild type factor IX in normal human pool plasma with normal human levels of F.IX. Standard error of mean (S.E.M.).

(102) TABLE-US-00010 TABLE 5 specific FIX Variants activity (%) S.E.M. (%) WT-FIX 100.00 7.00 K5F 141.28 4.53 L6F 165.46 19.4 V10F 140.20 5.8 V10R 194.98 11.3 Q11H 285.39 15.02 Q11K 248.95 15.6 Q11R 126.45 26.21 Q44H 179.37 42.51 W72R 125.64 21.44 F75V 114.12 18.44 S102N 144.67 26.13 N105S 107 7 K122R 178 43 E185D 139.28 21.02 E224G 148.48 31.47 E243D 119 0.1 I263S 177.91 19.8 R338E 451.7 27.35 T376A 258.38 65.68
Table 6:

(103) Clotting activities of factor IX variants including multiple amino acid substitutions resulting in hyperfunctional variants in presence of F.VIII measured by a one stage aPTT assay. Values are shown in percent, being 100% the activity of wild type factor IX in normal human pool plasma with normal human levels of F.IX. Standard error of mean (S.E.M.).

(104) TABLE-US-00011 TABLE 6 specific FIX Variants activity (%) S.E.M. (%) WT-FIX 100.00 4.00 V10K 170 8 R338L 735 36 K5A + R338L 491 36 V10K + R338L 607 22 R338L + S377W 1231 39 K5A + R338L + S377W (ALW) 881 33 V10K + R338L + S377W (KLW) 1920 97 K5A + V10K + R338L + S377W (AKLW) 1139 82 KLW + L6F 2212 448 KLW + E243D 2140 383 KLW + E224G 2021 451 KLW + L6F + E224G 2008 400 KLW + E224G + E243D 2049 371 KLW + K265T 3396 151 G4Y + V86A + R338L + S377W (YALW) 1535 130 YALW + K265T 1581 136
Hepatic Expression of FIX Mutants Effectively Triggers Hemostasis

(105) To examine the expression and clotting activity of FIX mutants in vivo, we hydrodynamically injected liver-directed minicircles encoding either FIX-KLW, -AKLW, -YALW or FIX-WT at vector doses of 10 μg into the tail vein of HB mice. Three days after gene delivery, FIX expression levels reached around 100% of normal plasma levels in all treated groups (data not shown). As expected, given the selection of hyperfunctional FIX mutants, the clotting activities of all three mutants were significantly higher up to 10-fold than that of FIX-WT (FIG. 8C). The ratio of activity and antigen revealed a 10- to 17-fold increase in specific FIX activity (p<0.05). Moreover, tail-cut bleeding assay revealed a complete normalization of the bleeding phenotype comparable to that of hemostatically normal mice (FIG. 8D).

(106) Oral Gene Delivery

(107) Oral Administration of Chitosan-DNA Nanoparticles Results in Production of FIX Protein in Small Intestines of HB Mice

(108) First, characterization of nanoparticle stability and transfection efficiency was performed in series of in vitro experiments (data not shown). Next, nanoparticles were administered orally (FIG. 10A). In vivo, GFP expression was successfully stained in small intestine after oral administration of a single dose of chitosan formulated eGFP to HB mice (FIG. 10B). No signal was detected in liver, spleen or colon (data not shown) and after administration of unformulated vector, as expected. Oral delivery of chitosan formulated FIX-WT revealed FIX presentation primarily located in microvilli around endothelial cells and partially in the extracellular matrix (ECM) (FIG. 10C, row 1). However, there was also a co-localization of FIX protein and collagen IV, a natural ligand for FIX, so that we hypothesized that collagen IV might interfere with release of FIX protein into the circulation (FIG. 10C, row 3). To overcome this obstacle, the FIX variants KLW or AKLW, both associated with reduced collagen IV affinity, were administered to HB mice. An overall similar expression pattern was observed, although extracellular collagen IV binding of FIX variants in the gut seemed slightly decreased (FIG. 10C, row 4-5). FIX mRNA expression was detected exclusively in the entire small intestine confirming the result obtained by immunohistochemical staining and indicating a preference for nanoparticle uptake in this area. Application of naked DNA and nanoparticles containing mock plasmid resulted in undetectable expression levels (FIG. 10D).

(109) Repeated Oral Administration of Human FIX Mutants Provides Hemostasis in HB Mice

(110) HB mice received seven consecutive daily doses of hyperfunctional FIX variants mediated by chitosan formulated plasmid or MC vectors, as indicated in the experimental design schedule (FIG. 11A). FIX antigen expression remained below the detection limit of 1% (data not shown). However, FIX activities of mutants with impaired collagen IV binding (FIX-KLW and -AKLW vs. FIX-YALW) seemed to accumulate between day 3 and 8 and reached levels in the range up to 3% in plasmid treated (FIG. 11B) or 14% in MC treated group (FIG. 11C) on day 8 (longest time point of treatment). After discontinuation of the oral gene therapy, clotting activities of FIX mutants persisted for at least 3 weeks, albeit with significant variation which was not related to antibody formation (data not shown). By comparison, after oral delivery of chitosan formulated FIX-WT or mock clotting activity remained below the limit of detection (1%) (FIG. 11B+C). We further investigated in vivo efficacy in a tail-clip bleeding assay (FIG. 12A). The mice had significantly shorter in vitro clotting times after oral administration of FIX mutants measured by one-stage aPTT (FIG. 12B). In agreement with that observation, FIX-KLW and -AKLW expression partially corrected the bleeding phenotype of HB mice (FIG. 12C). TAT complex levels, which represent a general activation marker of the coagulation system and would, in the context of substitution therapy for hemophilia, indicate hyperfunctional or spontaneous coagulation, remained similar in all groups (FIG. 12D).

(111) Here, we demonstrate the efficacy of oral gene delivery of FIX mutants based on the biopolymer chitosan for the treatment of FIB. By combining oral gene delivery and hyperfunctional mutants, functional FIX levels can be achieved. Sensitization of mice to and hence, neutralizing Abs against human FIX were not observed with the regimens used. While the general principle of oral gene therapy has previously been described (e.g. Bowman et al., 2008), including for hemophilia A (HA), the significant progress marked by our present studies lies in the combination of function-optimized FIX and improved delivery system with this approach, as a result of which clinically relevant quantities of therapeutic protein are released. Therefore, the data provided not only reflect confirmatory proof-of-principle data but show the possibility of clinical beneficence of nanoparticle-based oral gene therapy.

(112) The features disclosed in the foregoing description, in the claims and/or in the accompanying drawings may, both separately and in any combination thereof, be material for realizing the invention in diverse forms thereof.

REFERENCES

(113) Arruda et al. Blood 2004, 104:85. Bowman K, Leong K W. Chitosan nanoparticles for oral drug and gene delivery. Int J Nanomedicine. 2006; 1(2):117-28. Bowman K, Sarkar R, Raut S, Leong K W. Gene transfer to hemophilia A mice via oral delivery of FVIII-chitosan nanoparticles. J Control Release. 2008 Dec. 18; 132(3):252-9. Chang J, Jin J, Lollar P, Bode W, Brandstetter H, Hamaguchi N, Straight D L, Stafford D W. Changing residue 338 in human factor IX from arginine to alanine causes an increase in catalytic activity. J Biol Chem. 1998 May 15; 273(20):12089-94. Chang Y J, Wu H L, Hamaguchi N, Hsu Y C, Lin S W. Identification of functionally important residues of the epidermal growth factor-2 domain of factor IX by alanine-scanning mutagenesis. Residues Asn(89)-Gly(93) are critical for binding factor VIIIa. J Biol Chem. 2002 Jul. 12; 277(28):25393-9. Davie, E. W., Fujikawa, K., and Kisiel, W. (1991) Biochemistry 30, 10363-10370. DiScipio, R. G., Hermodson, M. A., Yates, S. G., and Davie, E. W. (1977) Biochemistry 16, 698-706. Di Scipio R G, Kurachi K and Davie E W (1978) Activation of human factor IX (Christmas factor). J Clin Invest, 61, 1528-1538. Duffy E J and Lollar P (1992) Intrinsic pathway activation of factor X and its activation peptide-deficient derivative, factor Xdes-143-191. J Biol Chem, 267, 7821-7827. Freedman S J, Blostein M D, Baleja J D, Jacobs M, Furie B C, Furie B. Identification of the phospholipid binding site in the vitamin K-dependent blood coagulation protein factor IX. J Biol Chem. 1996 Jul. 5; 271 (27):16227-36. Fujikawa, K., Legaz, M. E., Kato, H., and Davie, E. W. (1974) Biochemistry 13, 4508-4516. Furie B and Furie B C (1988) The molecular basis of blood coagulation. Cell, 53, 505-518. Giannelli, F., Green, P. M., Sommer, S. S., Poon, M., Ludwig, M., Schwaab, R., Reitsma, P. H., Goossens, M., Yoshioka, A., Figueiredo, M. S., and Brownlee, G. G. (1998) Nucleic Acids Res. 26, 265-268. HartmannR, Dockal M, Kammlander W, Panholzer E, Nicolaes G A, Fiedler C, Rosing J and Scheiflinger F. Factor IX mutants with enhanced catalytic activity. J Thromb Haemost 2009; 7: 1656-62. Hopfner K P, Brandstetter H, Karcher A, Kopetzki E, Huber R, Engh R A, Bode W. (1997) EMBO J. 16(22):6626-35. Kao C Y, Yang S J, Tao M H, Jeng Y M, Yu I S, Lin S W. Incorporation of the factor IX Padua mutation into FIX-Triple improves clotting activity in vitro and in vivo. Thromb Haemost. 2013 Jul. 29; 110(2):244-56. Kurachi and Davie (1982) PNAS 79:6461-6464. Langdell R D, Wagner R H, Brinkhous K M (1953). “Effect of antihemophilic factor on one-stage clotting tests; a presumptive test for hemophilia and a simple one-stage antihemophilic factor assay procedure”. J. Lab. Clin. Med. 41 (4): 637-47. Lindquist, P. A., Fujikawa, K., and Davie, E. W. (1978) J. Biol. Chem. 253, 1902-1909. Mann et al. Arterioscler Thromb Vasc Biol. 2003; 23:17-25. Mao H Q, Roy K, Troung-Le V L, Janes K A, Lin K Y, Wang Y, et al. Chitosan-DNA nanoparticles as gene carriers: synthesis, characterization and transfection efficiency. J Control Release. 2001 Feb. 23; 70(3):399-421. McRae B J, Kurachi K, Heimark R L, Fujikawa K, Davie E W and Powers J C (1981) Mapping the active sites of bovine thrombin, factor IXa, factor Xa, factor XIa, factor XIIa, plasma kallikrein, and trypsin with amino acid and peptide thioesters: development of new sensitive substrates. Biochemistry, 20, 7196-7206. Milanov P, Ivanciu L, Abriss D, Quade-Lyssy P, Miesbach W, Alesci S, Toon T, Grez M, Seifried E and Schuttrumpf J. Engineered factor IX variants bypass FVIII and correct haemophilia A phenotype in mice. Blood 2012 Jan. 12; 119(2):602-11. Quade-Lyssy P, Milanov P, Schuettrumpf J (2012) Engineered Factor VII, Factor IX, and Factor X Variants for Hemophilia Gene Therapy. J Genet Syndr Gene Ther 2012, S1:013. doi:10.4172/2157-7412.S1-013. Schuettrumpf J, Herzog R W, Schlachterman A, Kaufhold A, Stafford D W, Arruda V R. (2005) Blood. 105(6):2316-23. Schuettrumpf J. Milanov P, Roth S, Seifried E, Tonn T. Non-viral gene transfer results in therapeutic factor IX levels in haemophilia B mice, Haemost. 2008; 1:S92-95. Sichler K, Kopetzki E, Huber R, Bode W, Hopfner K P, Brandstetter H. Physiological fIXa activation involves a cooperative conformational rearrangement of the 99-loop. (2003) J Biol Chem. 278(6):4121-6. Wilkinson FIT, London F S, Walsh P N. Residues 88-109 of factor IXa are important for assembly of the factor X activating complex. J Biol Chem. 2002 Feb. 22; 277(8):5725-33. Wilkinson F H, Ahmad S S, Walsh P N. The factor IXa second epidermal growth factor (EGF2) domain mediates platelet binding and assembly of the factor X activating complex. J Biol Chem. 2002 Feb. 22; 277(8):5734-41.