Monoclonal antibodies specific to the plexin-semaphorin-integrin (PSI) domain of RON for drug delivery and its application in cancer therapy
11208494 · 2021-12-28
Assignee
Inventors
Cpc classification
C07K2317/24
CHEMISTRY; METALLURGY
A61K47/6803
HUMAN NECESSITIES
A61K47/6849
HUMAN NECESSITIES
C07K16/2896
CHEMISTRY; METALLURGY
C07K2317/92
CHEMISTRY; METALLURGY
C07K2319/30
CHEMISTRY; METALLURGY
C07K2317/73
CHEMISTRY; METALLURGY
International classification
Abstract
The present invention includes unique, isolated monoclonal antibodies that bind the PSI domain of human RON (RON.sup.PSI), and methods for making and using the same and novel combination therapies of anti-RON.sup.PSI antibodies, including humanized anti-RON.sup.PSI antibodies, nucleic acids that encode the heavy chain, the light chain, or both the light and heave chains of the antibody, host cells, expression vectors, and wherein the antibody or binding fragments thereof can be further conjugated with one or more cytotoxic or chemotherapeutic agents.
Claims
1. An isolated humanized monoclonal antibody or binding fragment thereof that specifically binds the Plexin-Semaphorin-Integrin (PSI) domain of human RON, comprising an immunoglobulin heavy chain variable region and an immunoglobulin light chain variable region, wherein the immunoglobulin heavy chain variable region comprises complementarity determining region (CDR) sequences as set forth in SEQ ID NO: 7, SEQ ID NO: 8, and SEQ ID NO: 9, and the immunoglobulin light chain variable region comprises CDR sequences as set forth in SEQ ID NO: 10, SEQ ID NO: 11, and SEQ ID NO: 12.
2. The antibody or binding fragment thereof of claim 1, wherein the monoclonal antibody or binding fragment thereof is combined with a cytotoxic agent, such that the antibody targets a RON protein on a cell and the RON-monoclonal antibody and the cytotoxic agent are internalized into the cell.
3. The antibody or binding fragment thereof of claim 1, wherein the antibody or binding fragment thereof is a fusion protein with a cytotoxic protein.
4. The antibody or binding fragment thereof of claim 1, further comprising a cytotoxic or chemotherapeutic agent that is conjugated to the antibody or binding fragment thereof.
5. The antibody or binding fragment thereof of claim 1, wherein the heavy chain has an amino acid sequence as shown in SEQ ID NO: 15 and the light chain has an amino acid sequence as shown in SEQ ID NO: 16.
6. The antibody or binding fragment thereof of claim 1, wherein the immunoglobulin heavy chain CDR sequences are encoded by SEQ ID NOs: 1, 2, and 3, respectively.
7. The antibody of or binding fragment thereof claim 1, wherein the immunoglobulin light chain CDR sequences are encoded by SEQ ID NOs:4, 5, and 6, respectively.
8. The antibody or binding fragment thereof of claim 1, wherein the CDR sequences are interposed between human and humanized framework sequences wherein the framework sequence comprises at least one substitution at amino acid position 27, 30, 48, 67 or 78, wherein the amino acid numbering is based on Kabat.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1) For a more complete understanding of the features and advantages of the present invention, reference is now made to the detailed description of the invention along with the accompanying figures and in which:
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
DETAILED DESCRIPTION OF THE INVENTION
(11) While the making and using of various embodiments of the present invention are discussed in detail below, it should be appreciated that the present invention provides many applicable inventive concepts that can be embodied in a wide variety of specific contexts. The specific embodiments discussed herein are merely illustrative of specific ways to make and use the invention and do not delimit the scope of the invention.
(12) To facilitate the understanding of this invention, a number of terms are defined below. Terms defined herein have meanings as commonly understood by a person of ordinary skill in the areas relevant to the present invention. Terms such as “a”, “an” and “the” are not intended to refer to only a singular entity, but include the general class of which a specific example may be used for illustration. The terminology herein is used to describe specific embodiments of the invention, but their usage does not delimit the invention, except as outlined in the claims.
(13) The present inventors have developed a number of anti-RON mAbs specific for the Plexin-Semaphorin-Integrin (PSI) domain that show biological and therapeutic effects in preclinical models. Anti-RON PSI domain mAbs in conjugation with chemoagents are effective in the delivery of cytotoxic drugs to targeted killing of cancer cells. In some instances, the PSI domain of RON can be referred to as RON.sup.PSI.
(14) The antibodies disclosed herein can be used to treat various forms of cancer, e.g., non-small cell lung cancer, breast, ovarian, prostate, cervical, colorectal, lung, pancreatic, gastric, and head and neck cancers. The cancer cells are exposed to a therapeutically effective amount of the antibody so as to inhibit or reduce proliferation of the cancer cell. In some embodiments, the antibodies inhibit cancer cell proliferation by at least 40%, 50%, 60%, 70%, 80%, 90%, 95%, 98%, 99%, or 100%.
(15) The terms “a sequence essentially as set forth in SEQ TD NO:(#)”, “a sequence similar to”, “nucleotide sequence” and similar terms, with respect to nucleotides, refers to sequences that substantially correspond to any portion of the sequence identified herein as SEQ ID NO:1. These terms refer to synthetic as well as naturally-derived molecules and includes sequences that possess biologically, immunologically, experimentally, or otherwise functionally equivalent activity, for instance with respect to hybridization by nucleic acid segments, or the ability to encode all or portions of anti-RON.sup.PSI antibodies. Naturally, these terms are meant to include information in such a sequence as specified by its linear order.
(16) The term “homology” refers to the extent to which two nucleic acids are complementary. There may be partial or complete homology. A partially complementary sequence is one that at least partially inhibits a completely complementary sequence from hybridizing to a target nucleic acid and is referred to using the functional term “substantially homologous.” The degree or extent of hybridization may be examined using a hybridization or other assay (such as a competitive PCR assay) and is meant, as will be known to those of skill in the art, to include specific interaction even at low stringency.
(17) An oligonucleotide sequence that is “substantially homologous” to the anti-RON antibodies of SEQ NO:#” is defined herein as an oligonucleotide sequence that exhibits greater than or equal to 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to the sequence of SEQ ID NO:# when sequences having a length of 100 bp or larger are compared. Generally, conservative amino acid substitutions will be used to modify the sequences within the listed percentages. Conservative amino acid substitutions are well-known in the art.
(18) The term “gene” is used to refer to a functional protein, polypeptide or peptide-encoding unit. As will be understood by those in the art, this functional term includes at least partially genomic sequences, cDNA sequences, or fragments or combinations thereof, as well as gene products, including those that may have been altered by the hand of man. Purified genes, nucleic acids, protein and the like are used to refer to these entities when identified and separated from at least one contaminating nucleic acid or protein with which it is ordinarily associated.
(19) The term “vector” refers to a nucleic acid molecule(s) that transfer DNA segment(s) from one cell to another. The vector may be further defined as one designed to propagate specific sequences, or as an expression vector that includes a promoter operatively linked to the specific sequence, or one designed to cause such a promoter to be introduced. The vector may exist in a state independent of the host cell chromosome, or may be integrated into the host cell chromosome.
(20) The terms “host cell”, “recombinant cell”, or “recombinant host” refer to cells that have been engineered to contain nucleic acid segments or altered segments, whether archeal, prokaryotic, or eukaryotic. Thus, engineered, or recombinant cells, are distinguishable from naturally occurring cells that do not contain recombinantly introduced genes.
(21) The term “fusion protein” refers to a hybrid protein expressed by a nucleic acid molecule comprising nucleotide sequences of at least two genes. For example, a fusion protein can comprise at least part of a first and a second polypeptide fused with a polypeptide that binds an affinity matrix.
(22) The term “antibody” encompasses polyclonal and monoclonal antibody preparations, as well as preparations including hybrid antibodies, altered antibodies, F(ab')2 fragments, F(ab) fragments, Fv fragments, single domain antibodies, chimeric antibodies, humanized antibodies, and functional fragments thereof which exhibit immunological binding properties of the parent antibody molecule.
(23) The term “monoclonal antibody” refers to an antibody composition having a homogeneous antibody population. The term is not limited regarding the species or source of the antibody, nor is it intended to be limited by the manner in which it is made. The term encompasses whole immunoglobulins as well as fragments such as Fab, F(ab')2, Fv, and other fragments that exhibit immunological binding properties of the parent monoclonal antibody molecule. In the case of the present invention, a number of hybridomas have been developed that, have unique binding properties with the PSI domain of RON (RON.sup.PSI), e.g., they trigger specific internalization of RON into RON expressing cells, e.g., cancer cells. As used herein, the hybridoma PCM5B14 and the antibody produce PCM5B14.
(24) Methods of making monoclonal antibodies are known in the art. Suitable carriers are typically large, slowly metabolized macromolecules such as proteins, polysaccharides, polylactic acids, polyglycolic acids, polymeric amino acids, amino acid copolymers, lipid aggregates (such as oil droplets or liposomes), and inactive virus particles. Such carriers are well known to those of ordinary skill in the art. Furthermore, the antigen may be conjugated to a bacterial toxoid, such as toxoid from diphtheria, tetanus, cholera, etc., in order to enhance the immunogenicity thereof.
(25) Monoclonal antibodies are generally prepared using the method of Kohler and Milstein, Nature (1975) 256:495-497, or a modification thereof. Typically, a mouse, hamster, or rat is immunized. The spleen and/or large lymph nodes are is removed and dissociated into single cells. B-cells and/or dissociated spleen cells are then induced to fuse with myeloma cells to form hybridomas (typically cells that do not express endogenous antibody heavy and/or light chains), and are cultured in, e.g., a selective medium (e.g., hypoxanthine, aminopterin, thymidine medium, “HAT”). The resulting hybridomas are plated by limiting dilution and assayed for the production of antibodies that bind specifically to RON. The selected monoclonal antibody-secreting hybridomas are then cultured either in vitro (e.g., in tissue culture bottles or hollow fiber reactors), or in vivo (e.g., as ascites in mice).
(26) The term “antibody fragment” refers to a portion of an antibody such as F(ab') 2, F(ab) 2, Fab', Fab, and the like. Regardless of structure, an antibody fragment binds with the same antigen that is recognized by the intact antibody. For example, an anti-RON monoclonal antibody fragment binds with an epitope of RON.
(27) The term “antibody fragment” refers to a synthetic or a genetically engineered polypeptide that binds to a specific antigen, such as polypeptides that include light chain variable region(s), “Fv” fragments that include the variable regions of the heavy and light chains, recombinant single chain polypeptide molecules in which light and heavy variable regions are connected by a peptide linker (“scFv proteins”), and minimal recognition units that include the amino acid residues that mimic the hypervariable region.
(28) The term Fab' is defined herein as a polypeptide comprising a heterodimer of the variable domain and the first constant domain of an antibody heavy chain, plus the variable domain and constant domain of an antibody light chain, plus at least one additional amino acid residue at the carboxy terminus of the heavy chain C.sub.H1 domain including one or more cysteine residues. F(ab').sub.2 antibody fragments are pairs of Fab' antibody fragments which are linked by a covalent bond(s). The Fab' heavy chain may include a hinge region. This may be any desired hinge amino acid sequence. Alternatively the hinge may be entirely omitted in favor of a single cysteine residue or, a short (about 1-10 residues) cysteine-containing polypeptide. In certain applications, a common naturally occurring antibody hinge sequence (cysteine followed by two prolines and then another cysteine) is used; this sequence is found in the hinge of human IgG.sub.1 molecules (E. A. Kabat, et al., Sequences of Proteins of Immunological Interest 3rd edition (National Institutes of Health, Bethesda, Md., 1987)). In other embodiments, the hinge region is selected from another desired antibody class or isotype. In certain preferred embodiments of this invention, the C-terminus of the C.sub.H1 of Fab' is fused to the sequence Cys X X X preferably is Ala, although it may be any other residue such as Arg, Asp, or Pro. One or both X amino acid residues may be deleted.
(29) The “hinge region” is the amino acid sequence located between C.sub.H1 and C.sub.H2 in native immunoglobulins or any sequence variant thereof. Analogous regions of other immunoglobulins will be employed, although it will be understood that the size and sequence of the hinge region may vary widely. For example, the hinge region of a human IgG1 is only about 10 residues, whereas that of human IgG3 is about 60 residues.
(30) The term Fv is defined to be a covalently or non-covalently associated heavy and light chain heterodimer which does not contain constant domains.
(31) The term Fv-SH or Fab'-SH is defined herein as a Fv or Fab' polypeptide having a cysteinyl free thiol. The free thiol is in the hinge region, with the light and heavy chain cysteine residues that ordinarily participate in inter-chain bonding being present in their native form. In the most preferred embodiments of this invention, the Fab'-SH polypeptide composition is free of heterogeneous proteolytic degradation fragments and is substantially (greater than about 90 mole percent) free of Fab' fragments wherein heavy and light chains have been reduced or otherwise derivatized so as not to be present in their native state, e.g. by the formation of aberrant disulfides or sulfhydryl addition products.
(32) The term “chimeric antibody” refers to a recombinant protein that contains the variable domains and complementary determining regions derived from a rodent antibody, while the remainder of the antibody molecule is derived from a human antibody.
(33) The term “humanized antibody” refers to an immunoglobulin amino acid sequence variant or fragment thereof that is capable of binding to a predetermined antigen and that includes an FR region having substantially the amino acid sequence of a human immunoglobulin and a complementarity determining regions (CDR) having substantially the amino acid sequence of a non-human immunoglobulin or a sequence engineered to bind to a preselected antigen. Humanizing an antibody is often referred to as “veneering” an antibody with the CDRs in the variable regions of the heavy, light chain or both.
(34) The term “antibody-drug conjugate” refers to antibodies or antibody fragments thereof, including antibody derivatives that bind to the PSI domain of RON and are conjugated to cytotoxic, cytostatic, and/or therapeutic agents. The term “therapeutic agent” refers to an agent that exerts a cytotoxic, cytostatic, and/or immunomodulatory effect on cancer cells or activated immune cells. Non-limiting examples of therapeutic agents include cytotoxic agents, chemotherapeutic agents, cytostatic agents, and immunomodulatory agents. The term “chemotherapeutic agent” refers to a chemical compound useful in the treatment of cancer. The term “cytotoxic effect” refers to the depletion, elimination, and/or the killing of a target cell(s) using the present invention. The term “cytotoxic agent” refers to an agent of the present invention that has a cytotoxic and/or cytostatic effect on a cell. The term “cytostatic effect” refers to the inhibition of cell proliferation using the present invention. The term “cytostatic agent” refers to an agent of the present invention that has a cytostatic effect on a cell, thereby inhibiting the growth and/or expansion of a specific subset of cells.
(35) As discussed herein, minor variations in the amino acid sequences of antibodies or immunoglobulin polypeptides are contemplated, e.g., providing that the variations in the amino acid sequence maintain at least 75%, more preferably at least 80%, 90%, 95%, 96%, 97%, 98%, 99%, and 100% homology to the human framework regions of the heavy and/or light chain variable domain. Specifically, in the present invention if the humanized antibody maintains at least 95%, 96%, 97%, 98%, 99%, or 100% homology to the non-CDR portions of the human variable domain and the constant domain, then the humanized antibody is considered to be fully humanized.
(36) Certain variations in the amino acid sequences are considered conservative amino acid substitutions. Conservative substitutions are those between amino acids with similar side chains. Amino acids are generally divided into families: (1) non-polar: alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan; (2) acidic: aspartate, glutamate; (3) basic: lysine, arginine, histidine; and (4) polar: lysine, asparagine, glutamine, cysteine, serine, threonine, tyrosine. Additional amino acid families include: serine and threonine are aliphatic-hydroxy family; asparagine and glutamine are an amide-containing family; alanine, valine, leucine and isoleucine are an aliphatic family; and phenylalanine, tryptophan, and tyrosine are an aromatic family. Thus, it is reasonable to expect that a single replacement of a leucine with an isoleucine or valine, an aspartate with a glutamate, a threonine with a serine, or a similar replacement of an amino acid with a structurally related amino acid will not have a major effect on the binding or properties of the resulting molecule, especially if the replacement does not involve an amino acid within a framework region. Whether an amino acid change results in a functional peptide is readily determined by assaying the specific activity of the polypeptide derivative. Fragments or analogs of antibodies or immunoglobulin molecules can be readily prepared by those of ordinary skill in the art, including substitutions at the amino- and carboxy-terminus, including making fusion proteins with, e.g., cytotoxic proteins. Structural and functional domains can also be identified by comparison of the nucleotide and/or amino acid sequence data (as shown herein) and/or sequence databases. Computerized comparison methods can be used to identify sequence motifs or predicted protein conformation domains that occur in other proteins of known structure and/or function. Generally, conservative amino acid substitution will not substantially change the structural characteristics of the parent sequence (e.g., a replacement amino acid should not tend to break a helix that occurs in the parent sequence, or disrupt other types of secondary structure that characterizes the parent sequence).
(37) The terms “cell” and “cell culture” are used interchangeably to refer to cell that are mostly but not always in a single cell suspension or attached to a plate or tissue, and include their progeny. The terms “transformants” and “transformed cells” include the primary subject cell and cultures derived therefrom without regard for the number of transfers. It is also understood that all progeny may not be precisely identical in DNA content, due to deliberate or inadvertent mutations. Mutant progeny that have the same function or biological activity as screened for in the originally transformed cell are included. Different designations are will be clear from the contextually clear.
(38) The terms “protein”, “polypeptide” or “peptide” refer to compounds comprising amino acids joined via peptide bonds and are used interchangeably.
(39) The term “endogenous” refers to a substance the source of which is from within a cell. Endogenous substances are produced by the metabolic activity of a cell. Endogenous substances, however, may nevertheless be produced as a result of manipulation of cellular metabolism to, for example, make the cell express the gene encoding the substance.
(40) The term “exogenous” refers to a substance the source of which is external to a cell. An exogenous substance may nevertheless be internalized by a cell by any one of a variety of metabolic or induced means known to those skilled in the art.
(41) The term “gene” is used to refer to a functional protein, polypeptide or peptide-encoding unit. As will be understood by those in the art, this functional term includes both genomic sequences, cDNA sequences, or fragments or combinations thereof, as well as gene products, including those that may have been altered by the hand of man. Purified genes, nucleic acids, protein and the like are used to refer to these entities when identified and separated from at least one contaminating nucleic acid or protein with which it is ordinarily associated. The term “sequences” as used herein is used to refer to nucleotides or amino acids, whether natural or artificial, e.g., modified nucleic acids or amino acids. When describing “transcribed nucleic acids” those sequence regions located adjacent to the coding region on both the 5′, and 3′, ends such that the deoxyribonucleotide sequence corresponds to the length of the full-length mRNA for the protein as included. The term “gene” encompasses both cDNA and genomic forms of a gene. A gene may produce multiple RNA species that are generated by differential splicing of the primary RNA transcript. cDNAs that are splice variants of the same gene will contain regions of sequence identity or complete homology (representing the presence of the same exon or portion of the same exon on both cDNAs) and regions of complete non-identity (for example, representing the presence of exon “A” on cDNA I wherein cDNA 2 contains exon “B” instead). Because the two cDNAs contain regions of sequence identity they will both hybridize to a probe derived from the entire gene or portions of the gene containing sequences found on both cDNAs the two splice variants are therefore substantially homologous to such a probe and to each other.
(42) The term “vector” is used in reference to nucleic acid molecules that transfer DNA segment(s) from one cell to another. The term “vehicle” is sometimes used interchangeably with “vector,” The term “vector” as used herein also includes expression vectors in reference to a recombinant DNA molecule containing a desired coding sequence and appropriate nucleic acid sequences necessary for the expression of the operably linked coding sequence in a particular host organism. Nucleic acid sequences necessary for expression in prokaryotes usually include a promoter, an operator (optional), and a ribosome-binding site, often along with other sequences. Eukaryotic cells are known to utilize promoters, enhancers, and termination and polyadenylation signals.
(43) The term a “pharmaceutically acceptable” refers to a component that is suitable for use with humans and/or animals without undue adverse side effects (such as toxicity, irritation, and allergic response) commensurate with a reasonable benefit/risk ratio.
(44) The term “safe and effective amount” refers to the quantity of a component that is sufficient to yield a desired therapeutic response without undue adverse side effects (such as toxicity, irritation, or allergic response) commensurate with a reasonable benefit/risk ratio when used in the manner of this invention. By “therapeutically effective amount” is meant an amount of a compound of the present invention effective to yield the desired therapeutic response. For example, an amount effective to delay the growth of or to cause a cancer, either a sarcoma or lymphoma, to shrink or not metastasize. The specific safe and effective amount or therapeutically effective amount will vary with such factors as the particular condition being treated, the physical condition of the patient, the type of mammal being treated, the duration of the treatment, the nature of concurrent therapy (if any), and the specific formulations employed and the structure of the compounds or its derivatives.
(45) The term “pharmaceutical salts” refers to a salt for making an acid or base salts of a compounds. Examples of pharmaceutically acceptable salts include, but are not limited to, mineral or organic acid salts of basic residues such as amities; alkali or organic salts of acidic residues such as phenols. Preferably the salts are made using an organic or inorganic acid. These preferred acid salts are chlorides, bromides, sulfates, nitrates, phosphates, sulfonates, formates, tartrates, maleates, malates, citrates, benzoates, salicylates, ascorbates, and the like. The preferred phenolate salts are the alkaline earth metal salts, sodium, potassium or lithium.
(46) The term “pharmaceutical carrier” refers to a pharmaceutically acceptable solvent, suspending agent or vehicle, for delivering the anti-RON antibodies, fragments thereof, and/or Antibody drug conjugates (ADCs), compound to the animal or human. The carrier may be liquid or solid and is selected with the planned manner of administration in mind. Liposomes are also a pharmaceutical carrier.
(47) The term “cancer” refers to all types of cancer or neoplasm or malignant tumors found in mammals, including carcinomas and sarcomas that express RON. Examples of cancers are cancer of the brain, breast, cervix, pancreatic, skin, prostate, liver, bladder, colon, head neck, kidney, lung, non-small cell lung, melanoma, mesothelioma, ovary, sarcoma, stomach, uterus and medulloblastoma.
(48) Generation of monoclonal antibodies targeting the RON extracellular PSI domain: The RON extracellular PSI domain acts as a hinge during RON activation, which facilitates Cell surface RON internalization. A peptide containing 61 amino acids covering the entire the RON PSI domain was used as the immunogen for mice immunization. Hybridoma cells were screened for monoclonal antibodies that recognize the PSI domain and are able to induce robust RON internalization by cancer cells. A clone designated as PCM5B14 was selected as the lead candidate.
(49) Humanization of PCM5B14 and generation of antibody-drug conjugate (ADC): Humanization was performed by grafting the complementarity-determining regions (CDRs) from both heavy and light chains of PCM5B14 into human IgG1/κ, acceptor frameworks to generate five light and five heavy chains to create 25 different parings of humanized IgG1/κ (molecules. Individual humanized PCM5B14s were analyzed for specificity, sensitivity, and binding affinities (
(50) Validation of H5B14 in induction of cell surface RON internalization by cancer cells: A panel of 15 human cancer cell lines from breast, colon, lung, and pancreatic tumors representing different levels of RON expression were used as the model to determine the effectiveness of H5B14 in induction of cell surface RON internalization. Representative results confirming the H5B14-induced robust RON internalization are shown in
(51) Detailed Summary of Action of a Novel Anti-RON Monoclonal Antibody (H5B14) Recognizing the RON.sup.PSI domain for Cytotoxic Drug Delivery in Targeted Cancer Therapy.
(52) Generation of monoclonal antibodies targeting the RON extracellular PSI domain for induction of robust RON internalization: Mice were immunized with RON proteins containing specific PSI domains in the RON extracellular sequences. Hybridoma cells were screened for monoclonal antibodies that are specific to the RON PSI domain and able to induce robust RON internalization by cancer cells. A clone designated as PCM5B14 was selected as the lead candidate.
(53) Humanization of PCM5B14 and generation of antibody-drug conjugate (ADC): Humanization was performed by grafting the complementarity-determining regions (CDRs) from both heavy and light chains of PCM5B14 into human IgG1/κ acceptor framework to generate five light chains and five heavy chains to create 25 different parings of H5B14 IgG1/κ molecules. Individual humanized PCM5B14s were analyzed for specificity, sensitivity, and binding affinities. Humanized PCM5B14 H2L4 was selected (IgG1/κ, designated as H5B14) for drug conjugation. Chemotherapeutics including doxorubicin, maytansinoid derivatives, monomethyl auristatin E (MMAE), and duocarmycin were used. H5B14 was conjugated with MMAE (H5B14-MMAE) as the model for further study.
(54) Therapeutic efficacy of H5B14-MMAE in killing cancer cells in vitro and eradicating xenograft tumors in vivo. The effect of H5B14-MMAE in killing cancer cells were confirmed in vitro using human cancer cell lines derived from breast, colon, lung, and pancreatic cancers. The therapeutic efficacy of H5B14-MMAE in vivo was validated using tumor xenografts derived from human breast, colon, lung, and pancreatic cancer cell lines in mouse models.
(55) The PSI motif in the RON extracellular domain acts as a hinge that facilitates cell surface RON dimerization followed by internalization in cancer cells. To generate monoclonal antibodies specific to the RON PSI domain, a sequence containing 54 amino acids covering the entire PSI domain was synthesized as antigen for mouse immunization. Analyses of various hybridoma cells lead to identification of a mAb designated as clone PCM5B14, which specifically recognizes the RON.sup.PSI domain without cross-reactivity to other homologue proteins. PCM5B14 was then selected for further development.
(56) Results from these studies demonstrate that generation of MABs specific to the RON extracellular PSI motif provides the pharmaceutical basis for using PCM5B14 to induce robust RON internalization for drug d for targeted drug delivery.
(57) DNA Sequences:
(58) CDRs from PCM5B14 VH (Heavy Chain variable region):
(59) TABLE-US-00001 CDR1: (SEQ ID NO: 1) GGCTACACCTTCACAGACTATCACATGGAT (30 nt) CDR2: (SEQ ID NO: 2) GACATCAACCCAAACAATGGCGGCGCCATCTACAATCAGAAGTTTAAGGG C (51 nt) CDR3: (SEQ ID NO: 3) TGTCACTACGATTATGCTGGAGGAGCTTGGTTCGCTTAC (39 nt)
(60) CDRs from PCM5B14 VL (Light Chain variable region):
(61) TABLE-US-00002 CDR1: (SEQ ID NO: 4) AAGAGCTCCCAGAGCCTGCTGTTCTCCGGCAACCAGAAGAATTACCTGGC T (51 nt) CDR2: (SEQ ID NO: 5) TGGGCTTCTACCAGAGCTAGC (21 nt) CDR3: (SEQ ID NO: 6) CAGCAGTACTATAGCTTCCCAAGAACC (27 nt)
Amino Acid Sequences:
(62) TABLE-US-00003 CDRs from PCM5B14 VH (Heavy Chain variable region): CDR1: (SEQ ID NO: 7) GYTFTDYHMD (10aa) CDR2: (SEQ ID NO:8) DINPNNGGAIYNQKFKG (17aa) CDR3: (SEQ ID NO: 9) SHYDYAGGAWFAY (13aa) CDRs from PCM5B14 VL (Light Chain variable region): CDR1: (SEQ ID NO: 10) KSSQSLLFSGNQKNYLA (17aa) CDR2: (SEQ ID NO: 11) WASTRAS (7aa)
(63) CDR3: QQYYSFPRT (9aa) (SEQ ID NO:12)
(64)
(65) Table 1 shows the individual values reflecting the binding affinity and sensitivity of individual H5B14 clones to human RON receptor.
(66) TABLE-US-00004 Bing Property 5B14-WT 5B14-H2L2 5B14-H2L4* 5B14-H4L2 5B14-H5L2 5B14-H5L4 Best-fit values LogEC50(μg/ml) 0.2653 0.3361 0.3456 0.3182 0.386 0.4108 HillScope 4.193 3.695 2.921 3.728 3.167 3.231 EC50 1.842 2.168 2.216 2.081 2.432 2.575 Std. Error LogEC50 0.01448 0.01198 0.05194 0.01157 0.03217 0.03578 HillScope 0.3864 0.3051 0.816 0.285 0.6132 0.7205
(67) Results from these studies demonstrate that humanized PCM5B14, including the clone H2L4 is highly specific and sensitive to human RON.
(68) Human cancer cell lines including H129, L3.6pl, H358, and T-47D cells expressing RON receptors in the range of 10,000 to 19,000 molecules per cells, respectively, were used as the model. Cells were incubated with 5 μg/ml of H5B14 for various times. Mouse anti-RON antibodies Zt/g4, PCM5B14, and humanized Zt/g4 were used as the control. After removing the bound antibodies in the cell surface by acidic buffer, the remaining cell surface RON was detected by anti-RON mAb Zt/f2 followed by FITC-coupled goat anti-mouse IgG1 antibody. Immunofluorescence intensities from individual samples were analyzed using the BD flow cytometer. The minimal time (hours) required to reach a 50% reduction of cell surface RON was defined as the EC.sub.50.
(69) Results from these studies demonstrated that H5B14 specific to the RON PSI domain is superior in induction of cell surface RON internalization with EC50 from 5.3 to 8.2 hours depending on individual 15 cancer cell lines. Table 2 shows that clone H5B14 had superior binding characteristics for inducing cell surface endocytosis by cancer cells when compared to other antibodies.
(70) Table 2 shows that clone H5B14 had superior binding characteristics for inducing cell surface endocytosis by cancer cells when compared to other antibodies.
(71) TABLE-US-00005 Internalization efficacy of cell surface RON (EC.sub.50, hours) Anti-RON- Colon Breast Pancreatic Lung ADCs HT-29 T-47D L3.6p1 H358 Mouse Zt/g4 11.02 ± 0.75 23.46 ± 1.24 14.14 ± 0.77 7.47 ± 0.48 Humanized 12.35 ± 1.13 21.70 ± 0.89 11.61 ± 0.69 9.44 ± 0.71 Zt/g4 Mouse 7.11 ± 0.45 9.28 ± 0.78 6.59 ± 0.34 7.02 ± 0.82 PCM5B14 Humanized 5.33 ± 0.23 8.26 ± 0.62 8.17 ± 0.44 7.94 ± 0.36 5B14
(72)
(73) H5B14 is versatile for conjugation with various cytotoxic chemotherapeutics through various chemical conjugation methods. An example shown in
(74)
(75)
(76) To determine the toxic effect and the maximal tolerated dose (MTD) of H5B14-MMAE, mouse was selected as the model. To this end, Balb/C mice (5 animals per group) were injected once with H5B14-MMAE at different doses through the tail vein. Individual mouse body weights were measured accordingly to reach the average body weight for each group. Mouse body weight (˜18-20 g per mouse) before injection was set as 100%. Daily activities, body weight, and animal death were monitored daily.
(77) Results from these studies demonstrate that H5B14-MMAE at therapeutic doses has not toxic activity. Also, H5B14-MMAE is well tolerated in mice with MTD at ˜60 mg/kg. An increase in H5B14-MMAE up to 80 mg/kg has visible toxicities with significant reduction in the average mouse body weight.
(78)
(79)
(80)
(81) Complete Humanized Anti-RON PCM5B14 IgG1/κ Sequences (Subtype H2L4).
(82) Complete Nucleotide Sequences of Humanized PCM5B14 Heavy Chain (IgG1): 1425 nt (SEQ ID NO:13), the Kozak sequence is underlined, the leader peptide is underlined and italicized, the CDRs are in bold, and the CH1-CH2-CH3 domains are italicized.
(83) Kozak sequence—Leader peptide—VH (CDR1-CDR2-CDR3)—CH (CH1-CH2-CH3)—Stop
(84) TABLE-US-00006 GCCGCCACCATGGGTTGGTCATGTATTATTCTGTTTCTGGTGGCTACTGC TACCGGCGTGCATTCCCAGGTGCACGCTGGTCCAGTCTGGGGCTGAAGTG AAGAAGCCCGGCGCCACCGTGAAGATCAGCTGCAAGGTGTCCGGCTACAC CTTCACAGACTATCACATGGATTGGGTGCAGCAGGCTCCTGGCAAGGGCC TCGAGTGGATGGGCGACATCAACCCAAACAATGGCGGCGCCATCTACAAT CAGAAGTTTAAGGGCCGGGTGACCATCACAGCTGACACCTCTACAGATAC CGCCTATATGGAGCTGAGCTCCCTGAGATCCGAGGACACAGCCGTGTACT ATTGCGCCCGGTCTCACTACGATTATGCTGGAGGAGCTTGGTTCGCTTAC TGGGGACAGGGCACACTGGTGACCGTGAGCCGGGCTTCCACCAAGGGCCC TAGCGTGTTTCCACTGGCCCCCTCTTCCAAGTCTACAAGCGGAGGAACCG CCGCTCTGGGATGTCTGGTGAAGGATTACTTCCCAGAGCCCGTGACCGTG TCTTGGAACAGCGGCGCTCTGACAAGCGGCGTGCACACATTTCCTGCCGT GCTGCAGTCCTCTGGCCTGTACTCCCTGAGCTCCGTGGTGACAGTGCCAT CTAGCTCCCTGGGCACACAGACCTATATCTGCAACGTGAATCACAAGCCA AGCAATACCAAGGTGGACAAGAAGGTGGAGCCCAAGTCCTGTGATAAGAC ACACACCTGCCCCCCTTGTCCTGCTCCAGAGCTGCTGGGAGGACCTTCCG TGTTCCTGTTTCCACCCAAACCTAAGGACACACTGATGATCTCTCGGACA CCAGAGGTGACCTGCGTGGTGGTGGACGTGAGCCACGAGGATCCCGAGGT GAAGTTCAACTGGTATGTCGATGGCGTGGAGGTGCACAATGCCAAGACCA AGCCCCGGGAGGAGCAGTACAACTCTACATATAGGGTGGTGAGCGTGCTG ACCGTGCTGCACCAGGACTGGCTCAACGGCAAGGAGTATAAGTGCAAGGT GTCCAATAAGGCTCTGCCCGCCCCTATCGAGAAGACAATCTCTAAGGCTA AGGGCCAGCCTAGGGAGCCACAGGTGTACACCCTGCCTCCATCTAGAGAC GAGCTGACAAAGAACCAGGTGAGCCTGACCTGTCTGGTGAAGGGCTTCTA TCCCAGCGATATCGCCGTGGAGTGGGAGTCCAATGGCCAGCCTGAGAACA ATTACAAGACCACACCCCCTGTGCTGGACTCCGATGGCTCTTTCTTTCTG TATTCCAAGCTGACCGTGGATAAGTCTCGGTGGCAGCAGGGCAACGTGTT CAGCTGTTCTGTGATGCACGAAGCCCTGCATAATCACTATACCCAGAAAT CCCTGAGTCTGTCACCTGGAAATGA
(85) Complete Nucleotide Sequences of Humanized PCM5BL4 Light Chain (κ): 729 nt (SEQ ID NO:14) the Kozak sequence is underlined, the leader peptide is underlined and italicized, the CDRs are in bold, and the CL domain is italicized.
(86) Kozak sequence—Leader peptide—VL (CDR1-CDR2-CDR3)—CL—Stop
(87) TABLE-US-00007 GCCGCCACCATGGGCTGGTCATGTATTATTCTGTTTCTGGTCGCAACTGC TACTGGGGTGCATAGCGAAATCGTGATGACTCAGTCTCCCGGAACCCTGT CCCTGTCTCCAGGCGAGCGGGCCACCCTGTCCTGCAAGAGCTCCCAGAGC CTGCTGTTCTCCGGCAACCAGAAGAATTACCTGGCTTGGTATCAGCAGAA GCCAGGCCAGGCTCCCAGGCTGCTGATCTACTGGGCTTCTACCAGAGCTA GCGGCATCCCCGACAGGTTCAGCGGCTCCGGCTCTGGCACAGACTTCACC CTGACAATCTCTAGACTGGAGCCTGAGGACTTCGCCGTGTACTATTGCCA GCAGTACTATAGCTTCCCAAGAACCTTTGGCCAGGGCACAAAGCTGGAGA TCAAGCGGACCGTGGCCGCTCCCAGCGTGTTCATCTTTCCCCCTTCCGAC GAGCAGCTGAAGTCCGGCACAGCTTCTGTGGTGTGCCTGCTGAACAACTT CTACCCCAGGGAGGCCAAGGTCCAGTGGAAGGTGGATAACGCTCTGCAGA GCGGCAATTCCCAGGAGTCTGTGACCGAGCAGGACAGCAAGGATTCCACA TATTCTCTGTCTAGCACCCTGACACTGTCTAAGGCCGATTACGAGAAGCA CAAGGTGTATGCTTGTGAAGTCACCCACCAGGGTCTGTCATCACCCGTCA CTAAGTCTTTTAACCGAGGCGAATGCTGA
Complete Amino Acid Sequences of Humanized PCM5B14 Heavy Chain (IgG1): 471 amino acids
(SEQ ID NO:15), methionines underlined, *-stop.
(88) TABLE-US-00008 MGWSCIILFL VATATGVHSO VQLVQSGAEV KKPGATVKIS CKVSGYTFTD YHMDWVQQAP GKGLEWMGDI NPNNGGAIYN QKFKGRVTIT ADTSTDTAYM ELSSLRSEDT AVYYCARSHY DYAGGAWFAY WGQGTLVTVS RASTKGPSVF PLAPSSKSTS GGTAALGCLV KDYFPEPVTV SWNSGALTSG VHTFPAVLQS SGLYSLSSVV TVPSSSLGTQ TYICNVNHKP SNTKVDKKVE PKSCDKTHTC PPCPAPELLG GPSVFLEPPK PKDTLMISRT PEVTCVVVDV SHEDPEVKFN WYVDGVEVHN AKTKPREEQY NSTYRVVSVL TVLHQDWLNG KEYKCKVSNK ALPAPIEKTI SKAKGQPREP QVYTLPPSRD ELTKNQVSLT CLVKGFYPSD IAVEWESNGQ PENNYKTTPP VLDSDGSFFL YSKLTVDKSR WQQGNVESCS VMHEALHNHY TQKSLSLSPG K*
Complete Amino Acid Sequences of Humanized PCM5B14 Light Chain (κ): 239 amino acids
(SEQ ID NO:16), methionines underlined, *-stop.
(89) TABLE-US-00009 MGWSCIILFL VATATGVHSE IVMTQSPGTL SLSPGERATL SCKSSQSLLF SGNQKNYLAW YQQKPGQAPR LLIYWASTRA SGIPDRFSGS GSGTDFTLTI SRLEPEDFAV YYCQQYYSFP RTFGQGTKLE IKRTVAAPSV FIFPPSDEQL KSGTASVVCL LNNFYPREAK VQWKVDNALQ SGNSQESVTE QDSKDSTYSL SSTLTLSKAD YEKHKVYACE VTHQGLSSPV TKSFNRGEC*
(90) It is contemplated that any embodiment discussed in this specification can be implemented with respect to any method, kit, reagent, or composition of the invention, and vice versa. Furthermore, compositions of the invention can be used to achieve methods of the invention.
(91) It will be understood that particular embodiments described herein are shown by way of illustration and not as limitations of the invention. The principal features of this invention can be employed in various embodiments without departing from the scope of the invention. Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, numerous equivalents to the specific procedures described herein. Such equivalents are considered to be within the scope of this invention and are covered by the claims.
(92) All publications and patent applications mentioned in the specification are indicative of the level of skill of those skilled in the art to which this invention pertains. All publications and patent applications are herein incorporated by reference to the same extent as if each individual publication or patent application was specifically and individually indicated to be incorporated by reference.
(93) The use of the word “a” or “an” when used in conjunction with the term “comprising” in the claims and/or the specification may mean “one,” but it is also consistent with the meaning of “one or more,” “at least one,” and “one or more than one,” The use of the term “or” in the claims is used to mean “and/or” unless explicitly indicated to refer to alternatives only or the alternatives are mutually exclusive, although the disclosure supports a definition that refers to only alternatives and “and/or,” Throughout this application, the term “about” is used to indicate that a value includes the inherent variation of error for the device, the method being employed to determine the value, or the variation that exists among the study subjects.
(94) As used in this specification and claim(s), the words “comprising” (and any form of comprising, such as “comprise” and “comprises”), “having” (and any form of having, such as “have” and “has”), “including” (and any form of including, such as “includes” and “include”) or “containing” (and any form of containing, such as “contains” and “contain”) are inclusive or open-ended and do not exclude additional, unrecited elements or method steps. In embodiments of any of the compositions and methods provided herein, “comprising” may be replaced with “consisting essentially of” or “consisting of”. As used herein, the phrase “consisting essentially of” requires the specified integer(s) or steps as well as those that do not materially affect the character or function of the claimed invention. As used herein, the term “consisting” is used to indicate the presence of the recited integer (e.g., a feature, an element, a characteristic, a property, a method/process step or a limitation) or group of integers (e.g., feature(s), element(s), characteristic(s), propertie(s), method/process steps or limitation(s)) only.
(95) The term “or combinations thereof” as used herein refers to all permutations and combinations of the listed items preceding the term. For example, “A, B, C, or combinations thereof” is intended to include at least one of: A, B, C, AB, AC, BC, or ABC, and if order is important in a particular context, also BA, CA, CB, CBA, BCA, ACB, BAC, or CAB. Continuing with this example, expressly included are combinations that contain repeats of one or more item or term, such as BB, AAA, AB, BBC, AAABCCCC, CBBAAA, CABABB, and so forth. The skilled artisan will understand that typically there is no limit on the number of items or terms in any combination, unless otherwise apparent from the context.
(96) As used herein, words of approximation such as, without limitation, “about”, “substantial” or “substantially” refers to a condition that when so modified is understood to not necessarily be absolute or perfect but would be considered close enough to those of ordinary skill in the art to warrant designating the condition as being present. The extent to which the description may vary will depend on how great a change can be instituted and still have one of ordinary skilled in the art recognize the modified feature as still having the required characteristics and capabilities of the unmodified feature. In general, but subject to the preceding discussion, a numerical value herein that is modified by a word of approximation such as “about” may vary from the stated value by at least ±1, 2, 3, 4, 5, 7, 10, 12 or 15%.
(97) All of the compositions and/or methods disclosed and claimed herein can be made and executed without undue experimentation in light of the present disclosure. While the compositions and methods of this invention have been described in terms of preferred embodiments, it will be apparent to those of skill in the art that variations may be applied to the compositions and/or methods and in the steps or in the sequence of steps of the method described herein without departing from the concept, spirit and scope of the invention. All such similar substitutes and modifications apparent to those skilled in the art are deemed to be within the spirit, scope and concept of the invention as defined by the appended claims.