Nucleotide sequence and application thereof in enhancing plant pest resistance

11208668 · 2021-12-28

Assignee

Inventors

Cpc classification

International classification

Abstract

A gene RNAi vector is constructed with a V-ATPase subunit E gene fragment, a COO2 gene fragment, or a combination of the V-ATPase subunit E gene fragment and the COO2 gene fragment, then transferred into a plant, and expressed in the plant to produce dsRNA of the V-ATPase subunit E gene, the COO2 gene, or the combination of the V-ATPase subunit E gene and the COO2 double gene, and therefore the aphid growth is suppressed, and the plant is enhanced in pest resistance.

Claims

1. A recombinant nucleotide sequence, wherein the nucleotide sequence is shown in SEQ ID NO. 6.

2. A double-stranded RNA, wherein the sense strand of said dsRNA is encoded by the nucleotide sequence according to claim 1, and wherein the presence of the double-stranded RNA in a plant enhances a resistance of the plant to pests.

3. A method of enhancing resistance of a plant to pests, the method comprising: 1) constructing a recombinant expression vector that expresses the double-stranded RNA of claim 2; 2) transforming the recombinant expression vector into Agrobacterium to obtain a transformed Agrobacterium, and infecting an immature embryo of the plant with the transformed Agrobacterium to obtain immature embryogenic calli; and 3) screening the immature embryogenic calli with an antibiotic to obtain a seedling comprising said recombinant expression vector providing enhanced resistance.

4. The method according to claim 3, wherein the pests are aphids.

5. The method according to claim 3, wherein the plant is selected from the group consisting of Arabidopsis, rice, wheat, corn, cotton, soybean, rape, sorghum, tobacco, chrysanthemum, Chinese cabbage, cabbage, radish, and tomato.

6. The method according to claim 3, wherein the plant is wheat, the recombinant expression vector is a silencing RNAi vector, wherein the RNAi vector is constructed with a maize ubiquitin-1 promoter to drive expression of the double-stranded RNA, and the maize ubiquitin-1 promoter is a constitutive promoter, and wherein the step of infecting the immature embryo comprises: transferring the immature embryo of the wheat plant to a transformed Agrobacterium solution to obtain the infected immature embryo, incubating the infected immature embryo on a culture medium under dark conditions to obtain the immature embryogenic calk, and performing a screening on resistant regenerated plants of the immature embryogenic calli to obtain resistant wheat seedlings.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

(1) FIGS. 1a, 1b and 1c are schematic diagrams showing the construction of pDE1005: proUBI: V-ATPase subunit E+COO2 vector in the present invention; wherein, FIG. 1a is a schematic diagram of the pDE1005 vector; FIG. 1b is a schematic diagram of the construction of a V-ATPase subunit E+COO2 hairpin structure; and FIG. 1c is a schematic diagram showing a partial structure of the vector after being connected with the hairpin structure of FIG. 1b;

(2) FIG. 2 is a schematic diagram of PCR identification of transgenic TI generation wheat with V-ATPase subunit E gene+COO2 gene driven by ubiquitin-1 promoter in the embodiment;

(3) in this figure: M represents Marker III; + represents the pDE1005: proUBI: V-ATPase subunit E+COO2 plasmid; CK represents a wild-type Fileder spring wheat; 1-1, 1-3, 1-6, 2-3, 2-3, 2-6, 3-2, 3-4, 3-6, 4-1, 4-3, 4-4, 5-3, 5-5, and 5-8 represent transgenic T1 generation wheat plants with V-ATPase subunit E gene+COO2 gene driven by ubiquitin-1 promoter, referred to as VC; and

(4) FIG. 3 is a schematic diagram showing semi-quantitative results of V-ATPase subunit E+COO2 gene of transgenic TI-generation wheat with V-ATPase subunit E gene+COO2 gene driven by ubiquitin-1 promoter in the embodiment;

(5) in this figure: M represents Marker III; + represents the pDE1005: proUBI: V-ATPase subunit E+COO2 plasmid; CK represents a wild-type Fileder spring wheat; 1-1, 1-3, 1-6, 2-3, 2-3, 2-6, 3-2, 3-4, 3-6, 4-1, 4-3, 4-4, 5-3, 5-5, and 5-8 represent transgenic TI generation wheat plants with V-ATPase subunit E gene+COO2 gene driven by ubiquitin-1 promoter, referred to as VC.

DETAILED DESCRIPTION OF THE EMBODIMENTS

(6) The experimental methods in the following embodiments without specifying specific conditions are generally conducted under conventional conditions, such as the conditions according to Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989) by Joe Sambrook et al, or as recommended by manufacturers. Unless otherwise specified, the reagents used are all commercially available or publicly available.

(7) During the growth and development of aphids, V-ATPase catalyzes ATP hydrolyzing to release and provide energy for various life activities, and the salivary protein COO2 gene also plays an important role in the protein syntheses of aphids. Therefore, in a specific embodiment of the present invention, fragments of the V-ATPase and COO2 genes are used for gene fusion to construct an element for gene silencing, through which the expression levels of the V-ATPase and COO2 genes in aphids are reduced and thus the normal growth and development of aphids are affected, thereby achieving the purpose of suppressing the growth of aphids.

(8) In a specific embodiment, fragments of non-conserved regions of V-ATPase subunit E and COO2 genes are fused to construct an element for gene silencing. The non-conserved regions are selected for preventing the interference of other homologous sequences except the aphid V-ATPase subunit E and COO2 sequences.

(9) In a specific embodiment, the element used for gene silencing is a double-stranded RNA.

(10) In a specific embodiment, the fragments of the non-conserved regions of the aphid V-ATPase subunit E and COO2 genes are fused, and a recombinant expression vector containing the forward and reverse sequences of the fusion gene is constructed. The recombinant expression vector is transferred into a plant (e.g., by Agrobacterium-mediated infection), and then the dsRNA of the fusion gene formed by the V-ATPase subunit E and COO2 genes is expressed in the plants. After eating the transgenic plants producing both siRNAs of the V-ATP and COO2 genes, the expression levels of both the V-ATPase subunit E and COO2 genes in the aphids decreased simultaneously. The above-mentioned RNA interference affects the normal growth and development of aphids, so as to achieve the purpose of suppressing the growth of aphids.

(11) “RNA interference (RNAi)” refers to a process in which some small double-stranded RNAs can efficiently and specifically block the expression of specific target genes in vivo, promote the degradation of mature mRNA, and thus cause biological individuals to exhibit the phenotype of specific gene deletion. RNA interference causes a highly specific gene silencing or suppression at the mRNA level.

(12) “Small interfering RNA (siRNA)” refers to a short double-stranded RNA molecule that can degrade specific mRNA by targeting the mRNA with homologous complementary sequences, and this process is the RNA interference pathway.

(13) By comparing the sequences of the V-ATPase subunit E and COO2 genes that have been sequenced in various species of aphids, it can be seen that these two gene sequences are extremely conservative. Although these two gene sequences in the aphids from other dicotyledonous and monocotyledonous plants have not been sequenced, it can be speculated that these two genes have extremely high homology in different species of aphids. If the RNAi can be realized in wheat, it can be realized in other plants (such as monocotyledons, dicotyledons, gymnosperms) as well.

Embodiment 1 Sequence Alignment of V-ATPase Subunit E and COO2 Genes for Homology Identification

(14) Using the NCBI database, the selected V-ATPase subunit E gene fragment (SEQ ID NO: 4) was subjected to nucleic acid sequence alignment. The results show that this sequence is 100% homologous to the V-type proton ATPase subunit E-like sequence of Acyrthosiphon pisum (NCBI accession number: XM_001162178.2), 95% homologous to the V-type proton ATPase subunit E-like sequence of Myzus persicae (NCBI accession number: XM_022312248.1), 92% homologous to the V-type proton ATPase subunit E-like sequence of Diuraphis noxia (NCBI accession number: XM_015522279.1), 94% homologous to the V-type proton ATPase subunit E-like sequence of Melanaphis sacchari (NCBI accession number: XM_025342771.1), and 86% homologous to the V-type proton ATPase subunit E-like sequence of Sipha flava (NCBI accession number: XM_025565024.1).

(15) The selected COO02 gene fragment (SEQ ID NO: 5) was subjected to nucleic acid sequence alignment. The results show that this sequence is 99% homologous to the sequence of Acyrthosiphon pisum (NCBI accession number: XM_001948323.3), 89%0 homologous to the sequence of Myzus persicae (NCBI accession number: XM_022310905.1), 89% homologous to the sequence of Aphis gossypii (NCBI accession number: KJ451424.1), and 80% homologous to the sequence of Melanaphis sacchari (NCBI accession number: XM_025338353.1).

(16) According to the principle of the RNAi technique, gene sequences with more than 80%.sup.0 homology to the V-ATPase subunit E and COO2 gene sequences of the present invention have resistance to aphids.

Embodiment 2 Synthesis of RNAi Vector Containing V-ATPase Subunit E Gene and COO2 Gene

(17) A V-ATPase subunit E gene fragment, a COO02 gene fragment, and a fusion gene fragment formed by the V-ATPase subunit E gene and COO02 gene were synthesized to separately construct a hairpin structure containing a forward gene, an intron sequence, and a reverse gene, and then the hairpin structures were constructed into the pDE1005 vector (purchased from Beijing BioDee Biotechnology Co., Ltd.) by multiple cloning sites to obtain a gene silencing vector of pDE1005: proUBI: V-ATPase subunit E, a gene silencing vector of pDE1005: proUBI: COO2, and a gene silencing vector of pDE1005: proUBI: V-ATPase subunit E+COO2. The genes were synthesized by Sangon Biotech Engineering (Shanghai) Co. Ltd. The schematic diagram of the construction of the RNAi vector containing the fusion gene fragment formed by the V-ATPase subunit E gene and the COO02 double gene is shown in FIGS. 1a, 1b and 1c.

(18) In an optional embodiment, the pDE1005 vector contains a rice intron, where a maize ubiquitin-1 promoter is located in the upstream of the rice intron. The fusion sequence of the maize ubiquitin-1 promoter and the rice intron is shown in SEQ ID NO: 7. In the hairpin structures of the three constructed RNAi vectors, the forward gene sequences of the hairpin structures for constructing the three RNAi vectors are shown in SEQ ID NO: 4, SEQ ID NO: 5 and SEQ ID NO: 6, respectively, the intron sequence is shown in SEQ ID NO: 8, and the reverse-complementary sequences are reverse-complementary to the sequences of SEQ ID NO: 4, SEQ ID NO: 5 and SEQ ID NO: 6, respectively.

Embodiment 3 Agrobacterium tumefaciens-Mediated Transformation of Fielder Spring Wheat with RNAi Vectors of pDE1005: proUBI: V-ATPase Subunit E, pDE1005: proUBI: COO2, and pDE 1005: proUBI: V-ATPase Subunit E+COO2

(19) 1.1. Pre-Culture of Immature Embryos

(20) Immature seeds at 13-14 days after flowering and pollination (1.0-1.2 mm in size of immature embryo) were sterilized with 70% alcohol for 1-2 minutes and 15% sodium hypochlorite for 15 minutes, and washed with sterile water for 4-5 times.

(21) 1.2. Co-Culture of Agrobacterium and Immature Embryogenic Callus

(22) At room temperature, the Agrobacterium cells were collected by centrifugation at 3500 rpm for 10 minutes and removing the supernatant, and then resuspended with 1/10 WCC resuspending solution (i.e., MS basic medium) in a ratio of 1:2. The wheat immature embryos were transferred to the Agrobacterium solution for 30 minutes of infection, and then the callus was transferred onto a sterile filter paper in a sterilized Petri dish, and co-cultured for 2 days (immature embryos) under dark conditions at 25° C.

(23) The immature embryogenic calli after being co-cultured for 2 days were transferred to IESX1 selection medium (MS basic medium (containing MS vitamins)+30 g L.sup.−1 of sucrose+2.0 mg L.sup.−1 of dicamba+250 mg L.sup.−1 of carbenicillin (Cb)+5 mg L.sup.−1 of phosphinothricin (PPT), and pH 5.8) and cultured under dark conditions at 25° C. for 2 weeks, then transferred to IESX2 selection medium (MS basic medium (containing MS vitamins)+30 g L.sup.−1 of sucrose+2.0 mg L.sup.−1 of dicamba+250 mg L.sup.−1 of carbenicillin (Cb)+10 mg L.sup.−1 of phosphinothricin (PPT), and pH 5.8) and cultured under dark conditions at 25° C. for 2-3 weeks.

(24) 1.3. Screening of Resistant Regenerated Plants

(25) The screened immature embryogenic calli were transferred to IEFH medium (MS basic medium (containing MS vitamins)+20 g L.sup.−1 of sucrose+0.2 mg L.sup.−1 of 2,4-Dichlorophenoxyacetic acid (2,4-D)+250 mg L.sup.−1 of Cb+5 mg L.sup.−1 of PPT, and pH=5.8) and cultured at 25° C. for 3-4 weeks under light. The MS vitamins were purchased from Sigma.

(26) The screened mature embryogenic calli were transferred to XCFH differentiation medium (MS basic medium (without MS vitamins)+20 g L.sup.−1 of sucrose+10.0 mg L.sup.−1 of B1 vitamin+1.0 mg L.sup.−1 of B3 vitamin+1.0 mg L.sup.−1 of B6 vitamin+2.0 mg L.sup.−1 of glycine+5.0 mg L.sup.−1 of Glutamine+0.2 mg L.sup.−1 of indoleacetic acid (IAA)+250 mg L.sup.−1 of Cb+5 mg L.sup.−1 of PPT, and pH 5.8) and cultured at 25° C. for 3-4 weeks to differentiate plants.

(27) The seedlings growing to 2-3 cm were transferred to a rooting culture medium (½MS medium (containing MS vitamins)+20 g L.sup.−1 of sucrose+250 mg L.sup.−1 of Cb+5 mg L.sup.−1 of PPT, and pH 5.8), and cultured at 25° C. under light for 3-4 weeks. Then, the robust, resistant plants were transplanted into flower pots.

(28) Among them, the Agrobacterium used was Agrobacterium EHA105. The composition of MS basic medium included: 4.4 g/L of MS, 30 g/L of sucrose, and pH 5.8, and the MS medium is purchased from Sigma company.

(29) PCR Detection of Transgenic Wheat

(30) Positively identified PCR primers (PDE1005-FP: ATGACAGTTCCACGGCAGTAGATA (SEQ ID NO: 9) and intron-RP: TTTCTTGGTTAGGACCCTTTTCTCTT (SEQ ID NO: 10)) were used to detect the target gene. The results showed that specific DNA fragments were amplified by the designed PCR-specific primers. However, when using non-transformed wheat genomic DNA as a template, no fragments were amplified.

(31) In this embodiment, the plant expression vector was transformed into Agrobacterium tumefaciens, and the Agrobacterium tumefaciens strains respectively containing V-ATPase subunit E, COO2 and V-ATPase subunit E+COO2 gene plant overexpression vectors were obtained for transforming wheat. The constructed Agrobacterium tumefaciens strains were used to transform wheat immature embryos to obtain the transgenic wheat plants detected by PCR.

(32) Among them, the Agrobacterium tumefaciens used was Agrobacterium tumefaciens EHA105, and the competent cells were purchased from Shanghai Wedi Biotechnology Co., Ltd.

Embodiment 4 Identification of TI Generation Wheat Plants with RNAi Vectors of pDE1005: proUBI: V-ATPase Subunit E, pDE1005: proUBI: COO2, and pDE1005: proUBI: V-ATPase Subunit E+COO2 in Aphid Resistance

(33) Wheat aphids of the same age were inoculated on the tender leaves of the transgenic plants to be detected and three wild-type wheat. Each plant was inoculated with 10 aphids. After 10 days of cultivation, the number of aphids on the leaves was counted. The results were shown in Tables 1-3. Compared with the wild-type control, the TI generation wheat plants with RNAi vectors of pDE1005: proUBI: V-ATPase subunit E, pDE1005: proUBI: COO2, and pDE1005: proUBI: V-ATPase subunit E+COO2 obtained were significantly improved in aphid resistance.

(34) By comparing the insect-resistant effects of T1 generation wheat plants with RNAi vectors of pDE1005: proUBI: V-ATPase subunit E, pDE1005: proUBI: COO2, and pDE1005: proUBI: V-ATPase subunit E+COO2, the transgenic wheat plants with pDE1005: proUBI: V-ATPase subunit E+COO2 had the best insect-resistant effect.

(35) TABLE-US-00001 TABLE 1 Identification of transgenic wheat plants with pDE1005: proUBI: V-ATPase subunit E in aphid resistance Significant Total number of difference analysis Material aphids per plant Average value (p-value) CK1 246 244 CK2 212 CK3 274 V1-1 43 47 0.007373 V1-4 47 V1-7 51 V2-1 62 67.7 0.0122738 V2-2 73 V2-4 68 V3-3 55 54.7 0.0060112 V3-4 49 V3-5 60 V4-2 39 36.3 0.008315 V4-5 37 V4-7 33 V5-1 52 50 0.007877 V5-2 48 V5-3 50

(36) TABLE-US-00002 TABLE 2 Identification of transgenic wheat plants with pDE1005: proUBI: COO2 in aphid resistance Significant Total number of difference analysis Material aphids per plant Average value (p-value) CK1 246 244 CK2 212 CK3 274 C1-3 77 75 0.0077974 C1-4 69 C1-7 79 C2-2 60 58.7 0.0086244 C2-5 57 C2-7 59 C3-3 66 68.3 0.0076491 C3-4 65 C3-5 74 C4-1 70 66 0.0106326 C4-3 65 C4-4 63 C5-1 55 54.7 0.0064858 C5-5 50 C5-7 59

(37) TABLE-US-00003 TABLE 3 Identification of transgenic wheat plants with pDE1005: proUBI: V-ATPase subunit E + COO2 in aphid resistance Significant Total number of difference analysis Material aphids per plant Average value (p-value) CK1 246 244 CK2 212 CK3 274 VC1-1 14 14 0.0072 VC1-3 17 VC1-6 11 VC2-2 0 1 0.0056 VC2-3 2 VC2-6 1 VC3-2 17 20 0.0059 VC3-4 20 VC3-6 23 VC4-1 9 12 0.0070 VC4-3 16 VC4-4 11 VC5-3 21 26.7 0.0056 VC5-5 26 VC5-8 33

(38) The results showed that the five TI generation wheat plants with the RNAi vector of pDE1005: proUBI: V-ATPase subunit E+COO2 had significantly lower number of aphids than that of the wild-type control, and had better anti-insect effect than those of the TI generation wheat plants with RNAi vectors of pDE1005: proUBI: V-ATPase subunit E and pDE1005: proUBI: COO2.

(39) The above-mentioned specific implementation can be partially adjusted by those skilled in the art in different ways without departing from the principle and purpose of the present invention. The protective scope of the present invention is subject to the claims and is not limited by the above specific implementation, and each implementation within the protective scope of the present invention is bound by the present invention.