MICROBIOLOGICAL PRODUCTION OF SHORT FATTY ACIDS AND USES THEREOF

Abstract

The present invention relates to proteins involved in fatty acid synthesis, such as fatty acid synthases (FAS) variants, comprising one or more polypeptide chains, wherein said polypeptide chain(s) comprise one or more subunits comprising a malonyl/palmitoyl transferase domain (MPT domain), acetyl transferase domain (AT domain), and ketoacyl synthase domain (KS domain), and at least one amino acid substitution in the MPT domain at a position corresponding to R130, in the AT domain at a position corresponding to 1306, and/or in the KS domain, preferably in the acyl binding channel and/or at KS domain binding site to ACP, to modulate affinities of acyl intermediates, and optionally further amino acid substitution(s). The present invention relates to the respective polypeptide domains.

The present invention further relates to nucleic acid molecules encoding the proteins (or the polypeptide domains) and to host cells containing said nucleic acid molecules. The present invention further relates to a method for the production of short fatty acids, CoA esters of short fatty acids, ethyl esters of short fatty acids, esters of short fatty acids with other metabolites, and/or enzyme bound short fatty acids (C.sub.6 to C.sub.12), comprising the expression of said nucleic acid molecules, preferably in said host cells. The present invention further relates to a method for the production of biofuels, flavoring compounds and/or fine chemicals, comprising the expression of said nucleic acid molecules, preferably in said host cells. The present invention also relates to the use of the proteins, nucleic acids molecule or host cells for the bulk production of short fatty acids (C.sub.6 to C.sub.12), the specific production of C.sub.6 fatty acids and/or C.sub.8 fatty acids, the bulk production of CoA esters of short fatty acids (C.sub.6 to C.sub.12), the specific production of C.sub.6-CoA esters and/or C.sub.8-CoA esters, the bulk production of ethyl esters of short fatty acids (C.sub.6 to C.sub.12), the specific production of C.sub.6 fatty acid ethyl esters and/or C.sub.8 fatty acid ethyl esters, the bulk production of esters of short fatty acids (C.sub.6 to C.sub.12) with other metabolites, the specific production of C.sub.6 fatty acid esters with other metabolites and/or C.sub.8 fatty acid esters with other metabolites, the bulk production of enzyme bound short fatty acids (C.sub.6 to C.sub.12), the specific production of enzyme bound C.sub.6 fatty acids and/or enzyme bound C.sub.8 fatty acids, the production of biofuels, fine chemicals and/or flavoring substances.

Claims

1. A protein involved in fatty acid synthesis, said protein comprising one or more polypeptide chains, wherein said polypeptide chain(s) comprise (i) one or more subunits comprising the amino acid sequences of SEQ ID NO: 1 (malonyl/palmitoyl transferase domain, MPT domain); SEQ ID NO: 2 (acetyl transferase domain, AT domain), and/or SEQ ID NO: 3 (ketoacyl synthase domain, KS domain); (ii) at least one amino acid substitution in the MPT domain at a position corresponding to R130 of the amino acid sequence of SEQ ID NO: 1; in the AT domain at a position corresponding to 1306 of the amino acid sequence of SEQ ID NO: 2; and/or in the KS domain, in the acyl binding channel; wherein the amino acid sequence comprising the at least one amino acid substitution has at least 80% sequence identity to the respective amino acid sequence of SEQ ID NO: 1 and/or 2, and/or at least 80% sequence identity to the respective amino acid sequence of SEQ ID NO: 3, provided that when the protein comprises an amino acid substitution G236S in the KS domain it comprises at least one additional amino acid substitution.

2. The protein according to claim 1, comprising at least one further amino acid substitution in the KS domain selected from a position corresponding to Q193, N258 and D259 of the amino acid sequence of SEQ ID NO: 3.

3. The protein according to claim 1, wherein the protein is type I FAS of Saccharomyces cerevisiae.

4. A polypeptide domain comprising (i) one or more subunits comprising the amino acid sequences of SEQ ID NO: 1 (malonyl/palmitoyl transferase domain, MPT domain); SEQ ID NO: 2 (acetyl transferase domain, AT domain), or SEQ ID NO: 3 (ketoacyl synthase domain, KS domain); (ii) at least one amino acid substitution in the MPT domain at a position corresponding to R130 of the amino acid sequence of SEQ ID NO: 1; in the AT domain at a position corresponding to 1306 of the amino acid sequence of SEQ ID NO: 2; and/or in the KS domain in the acyl binding channel; wherein the amino acid sequence comprising the at least one amino acid substitution has at least 80% sequence identity to the respective amino acid sequence of SEQ ID NO: 1 and/or 2, and/or at least 80% sequence identity to the respective amino acid sequence of SEQ ID NO: 3, provided that when the polypeptide domain comprises an amino acid substitution G236S in the KS domain it comprises at least one additional amino acid substitution.

5. The polypeptide domain according to claim 4, comprising at least one further amino acid substitution in the KS domain selected from a position corresponding to Q193, N258 and D259 of the amino acid sequence of SEQ ID NO: 3.

6. The polypeptide domain according to claim 1, comprising amino acid substitution(s) R130K in the MPT domain (SEQ ID NO. 1), and/or I306A in the AT domain (SEQ ID NO: 2).

7. The polypeptide domain according to claim 1, comprising amino acid substitution(s) in the acyl binding channel of the KS domain, wherein the amino acid substitutions comprise amino acid substitution(s) G236S, M237W and/or F265Y in the KS domain (SEQ ID NO: 3), and/or further comprising amino acid substitution(s) Q193A, Q193E, N258A, N258D and/or D259A in the KS domain (SEQ ID NO: 3).

8. The protein according to claim 1, selected from the group of a protein comprising the amino acid substitutions I306A and G236S; a protein comprising the amino acid substitutions I306A, R130K and F265Y; a protein comprising the amino acid substitutions I306A, R130K and G236S; a protein comprising the amino acid substitution R130K; a protein comprising the amino acid substitutions I306A, R130K, G236S and M237W; a protein comprising the amino acid substitutions I306A, G236S and M237W; a protein comprising the amino acid substitutions G236S and M237W; a protein comprising the amino acid substitutions I306A and R130K; a protein comprising the amino acid substitutions R130K and G236S; a protein comprising the amino acid substitutions I306A and F265Y; a protein comprising the amino acid substitutions I306A, G236S and F265Y; a protein comprising the amino acid substitutions R130K, G236S and M237W; a protein comprising the amino acid substitutions G236S and F265Y; a protein comprising the amino acid substitutions R130K, G236S and F265Y; a protein comprising the amino acid substitutions I306A, R130K, G236S and F265Y; a protein comprising the amino acid substitutions I306A, G236S, M237W and F265Y; a protein comprising the amino acid substitution I306A; a protein comprising the amino acid substitution M237W; a protein comprising the amino acid substitution F265Y; a protein comprising the amino acid substitutions I306A and M237W; a protein comprising the amino acid substitutions R130K and M237W; a protein comprising the amino acid substitutions R130K and F265Y; a protein comprising the amino acid substitutions I306A, R130K and M237W; a protein comprising the amino acid substitutions I306A, M237W and F265Y; a protein comprising the amino acid substitutions R130K, M237W and F265Y; a protein comprising the amino acid substitutions G236S, M237W and F265Y; a protein comprising the amino acid substitutions M237W and F265Y; a protein comprising the amino acid substitutions I306A, R130K, M237W and F265Y; a protein comprising the amino acid substitutions R130K, G236S, M237W and F265Y; a protein comprising the amino acid substitutions I306A, R130K, G236S, M237W and F265Y, a protein comprising the amino acid substitutions I306A, R130K, G236S and D259A; a protein comprising the amino acid substitutions I306A, R130K, G236S, M237W and D259A; a protein comprising the amino acid substitutions I306A, R130K, G236S and N258A; a protein comprising the amino acid substitutions I306A, R130K, G236S, M237W and N258A; a protein comprising the amino acid substitutions I306A, R130K, G236S and N258D; a protein comprising the amino acid substitutions I306A, R130K, G236S, M237W and N258D; a protein comprising the amino acid substitutions I306A, R130K, G236S and Q193A; a protein comprising the amino acid substitutions I306A, R130K, G236S, M237W and Q193A; a protein comprising the amino acid substitutions I306A, R130K, G236S and Q193E; and a protein comprising the amino acid substitutions I306A, R130K, G236S, M237W and Q193E; wherein R130K refers to R130K in the MPT domain of the amino acid sequence of SEQ ID NO: 1; I306A refers to I306A in the AT domain of the amino acid sequence of SEQ ID NO: 2; G236S refers to G236S in the KS domain of the amino acid sequence of SEQ ID NO: 3; M237W refers to M237W in the KS domain of the amino acid sequence of SEQ ID NO: 3; F265Y refers to F265Y in the KS domain of the amino acid sequence of SEQ ID NO: 3; D259A refers to D259A in the KS domain of the amino acid sequence of SEQ ID NO: 3; N258A refers to N258A in the KS domain of the amino acid sequence of SEQ ID NO: 3; N258D refers to N258D in the KS domain of the amino acid sequence of SEQ ID NO: 3; Q193A refers to Q193A in the KS domain of the amino acid sequence of SEQ ID NO: 3; and Q193E refers to Q193E in the KS domain of the amino acid sequence of SEQ ID NO: 3.

9. The protein according to claim 1, selected from variant I306A/G236S; variant I306A/R130K/F265Y; variant I306A/R130K/G236S; variant R130K; variant I306A/R130K/G236S/M237W; variant I306A/G236S/M237W; variant G236S/M237W; variant I306A/R130K; variant R130K/G236S; variant I306A/F265Y; variant I306A/G236S/F265Y; variant R130K/G236S/M237W; variant G236S/F265Y; variant R130K/G236S/F265Y; variant I306A/R130K/G236S/F265Y; variant I306A/G236S/M237W/F265Y; variant I306A; variant M237W; variant F265Y; variant I306A/M237W; variant R130K/M237W; variant RI 30K/F265Y; variant I306A/R130K/M237W; variant I306A/M237W/F265Y; variant R130K/M237W/F265Y; variant G236S/M237W/F265Y; variant M237W/F265Y; variant I306A/R130K/M237W/F265Y; variant R130K/G236S/M237W/F265Y; variant I306A/R130K/G236S/M237W/F265Y; variant I306A/RI 30K/G236S/D259A; variant I306A/R130K/G236S/M237W/D259A; variant I306A/R130K/G236S/N258A; variant I306A/R130K/G236S/M237W/N258A; variant I306A/R130K/G236S/N258D; variant I306A/R130K/G236S/M237W/N258D; variant I306A/R130K/G236S/Q193A; variant I306A/R130K/G236S/M237W/Q193A; variant I306A/R130K/G236S/Q193E; and variant I306A/R130K/G236S/M237W/Q193E; wherein R130K refers to R130K in the MPT domain of the amino acid sequence of SEQ ID NO: 1; I306A refers to I306A in the AT domain of the amino acid sequence of SEQ ID NO: 2; G236S refers to G236S in the KS domain of the amino acid sequence of SEQ ID NO: 3; M237W refers to M237W in the KS domain of the amino acid sequence of SEQ ID NO: 3; F265Y refers to F265Y in the KS domain of the amino acid sequence of SEQ ID NO: 3; D259A refers to D259A in the KS domain of the amino acid sequence of SEQ ID NO: 3; N258A refers to N258A in the KS domain of the amino acid sequence of SEQ ID NO: 3; N258D refers to N258D in the KS domain of the amino acid sequence of SEQ ID NO: 3; Q193A refers to Q193A in the KS domain of the amino acid sequence of SEQ ID NO: 3; and Q193E refers to Q193E in the KS domain of the amino acid sequence of SEQ ID NO: 3.

10. The protein according to claim 1, which causes elevated overall production of short fatty acids, CoA esters of short fatty acids, ethyl esters of short fatty acids, esters of short fatty acids with other metabolites, and/or enzyme bound short fatty acids (C.sub.6 to C.sub.12) compared to the wild type protein(s) or the protein(s) without such amino acid substitution(s).

11. The protein according to claim 1, wherein the amino acid substitution(s) selected from I306A and G236S; I306A and F265Y; I306A, G236S and M237W; I306A, R130K and G236S; G236S and M237W; I306A, R130K, G236S and M237W; R130K; I306A, G236S and F265Y; I306A, R130K and F265Y; I306A and R130K; R130K and G236S; R130K, G236S and M237W; G236S and F265Y; R130K, G236S and F265Y; I306A, R130K, G236S and F265Y; I306A, G236S, M237W and F265Y; I306A; M237W; F265Y; I306A and M237W; R130K and M237W; R130K and F265Y; I306A, R130K and M237W; I306A, M237W and F265Y; R130K, M237W and F265Y; G236S, M237W and F265Y; M237W and F265Y; I306A, R130K, M237W and F265Y; R130K, G236S, M237W and F265Y; I306A, R130K, G236S, M237W and F265Y; I306A, R130K, G236S and N258A; I306A, R130K, G236S and N258D; I306A, R130K, G236S, M237W and N258A; and I306A, R130K, G236S, M237W and N258D wherein R130K refers to R130K in the MPT domain of the amino acid sequence of SEQ ID NO: 1; I306A refers to I306A in the AT domain of the amino acid sequence of SEQ ID NO: 2; G236S refers to G236S in the KS domain of the amino acid sequence of SEQ ID NO: 3; M237W refers to M237W in the KS domain of the amino acid sequence of SEQ ID NO: 3; F265Y refers to F265Y in the KS domain of the amino acid sequence of SEQ ID NO: 3; N258A refers to N258A in the KS domain of the amino acid sequence of SEQ ID NO: 3; N258D refers to N258D in the KS domain of the amino acid sequence of SEQ ID NO: 3; increase(s) the selectivity for the production of C.sub.6 fatty acids, C.sub.6 fatty acid CoA esters, C.sub.6 fatty acid ethyl esters, C.sub.6 fatty acid esters with other metabolites, and/or enzyme bound C.sub.6 fatty acids compared to wild type protein(s) or the protein without such amino acid substitution(s).

12. The protein according to claim 1, wherein the amino acid substitution(s) selected from I306A, R130K and F265Y; R130K; I306A, R130K, G236S and M237W; R130K and G236S; I306A and R130K; G236S and M237W; I306A, R130K and G236S; I306A, G236S and M237W; R130K, G236S and M237W; I306A and F265Y; M237W; I306A, G236S and F265Y; G236S and F265Y; I306A and G236S; R130K, G236S and F265Y; I306A, R130K, G236S and F265Y; I306A, G236S, M237W and F265Y; I306A; F265Y; I306A and M237W; R130K and M237W; R130K and F265Y; I306A, R130K and M237W; I306A, M237W and F265Y; R130K, M237W and F265Y; G236S, M237W and F265Y; M237W and F265Y; I306A, R130K, M237W and F265Y; R130K, G236S, M237W and F265Y; I306A, R130K, G236S, M237W and F265Y; I306A, R130K, G236S and D259A, I306A, R130K, G236S and N258A; I306A, R130K, G236S and N258D; I306A, R130K, G236S and Q193A; I306A, R130K, G236S and Q193E; I306A, R130K, G236S, M237W and D259A; I306A, R130K, G236S, M237W and N258A; I306A, R130K, G236S, M237W and N258D; I306A, R130K, G236S, M237W and Q193A; and I306A, R130K, G236S, M237W and Q193E wherein R130K refers to R130K in the MPT domain of the amino acid sequence of SEQ ID NO: 1; I306A refers to I306A in the AT domain of the amino acid sequence of SEQ ID NO: 2; G236S refers to G236S in the KS domain of the amino acid sequence of SEQ ID NO: 3; M237W refers to M237W in the KS domain of the amino acid sequence of SEQ ID NO: 3; F265Y refers to F265Y in the KS domain of the amino acid sequence of SEQ ID NO: 3; D259A refers to D259A in the KS domain of the amino acid sequence of SEQ ID NO: 3; N258A refers to N258A in the KS domain of the amino acid sequence of SEQ ID NO: 3; N258D refers to N258D in the KS domain of the amino acid sequence of SEQ ID NO: 3; Q193A refers to Q193A in the KS domain of the amino acid sequence of SEQ ID NO: 3; and Q193E refers to Q193E in the KS domain of the amino acid sequence of SEQ ID NO: 3; increase(s) the selectivity for the production of C.sub.8 fatty acids, C.sub.8 fatty acid CoA esters, C.sub.8 fatty acid ethyl esters, C.sub.8 fatty acid esters with other metabolites, and/or enzyme bound C.sub.8 fatty acids compared to wild type protein(s) or the protein without such amino acid substitution(s).

13. The protein according to claim 1, wherein the amino acid substitution(s) selected from I306A, R130K, G236S and M237W; G236S and M237W; R130K; I306A, G236S and F265Y; I306A, R130K and G236S; R130K and G236S; I306A and R130K; I306A, G236S and M237W; I306A and F265Y; M237W; I306A, R130K and F265Y; R130K, G236S and M237W; G236S and F265Y; I306A and G236S; R130K, G236S and F265Y; I306A, R130K, G236S and F265Y; I306A, G236S, M237W and F265Y; I306A; F265Y; I306A and M237W; R130K and M237W; R130K and F265Y; I306A, R130K and M237W; I306A, M237W and F265Y; R130K, M237W and F265Y; G236S, M237W and F265Y; M237W and F265Y; I306A, R130K, M237W and F265Y; R130K, G236S, M237W and F265Y; I306A, R130K, G236S, M237W and F265Y; I306A, R130K, G236S and D259A, I306A, R130K, G236S and N258A; I306A, R130K, G236S and N258D; I306A, R130K, G236S and Q193A; I306A, R130K, G236S and Q193E; I306A, R130K, G236S, M237W and D259A; I306A, R130K, G236S, M237W and N258A; I306A, R130K, G236S, M237W and N258D; I306A, R130K, G236S, M237W and Q193A; and I306A, R130K, G236S, M237W and Q193E wherein R130K refers to R130K in the MPT domain of the amino acid sequence of SEQ ID NO: 1; I306A refers to I306A in the AT domain of the amino acid sequence of SEQ ID NO: 2; G236S refers to G236S in the KS domain of the amino acid sequence of SEQ ID NO: 3; M237W refers to M237W in the KS domain of the amino acid sequence of SEQ ID NO: 3; F265Y refers to F265Y in the KS domain of the amino acid sequence of SEQ ID NO: 3; D259A refers to D259A in the KS domain of the amino acid sequence of SEQ ID NO: 3; N258A refers to N258A in the KS domain of the amino acid sequence of SEQ ID NO: 3; N258D refers to N258D in the KS domain of the amino acid sequence of SEQ ID NO: 3; Q193A refers to Q193A in the KS domain of the amino acid sequence of SEQ ID NO: 3; and Q193E refers to Q193E in the KS domain of the amino acid sequence of SEQ ID NO: 3; increase(s) the selectivity for the production of C.sub.10 to C.sub.12 fatty acids, C.sub.10 to C.sub.12 fatty acid CoA esters, C.sub.10 to C.sub.12 fatty acid ethyl esters, C.sub.10 to C.sub.12 fatty acid esters with other metabolites, and/or enzyme bound C.sub.10 to C.sub.12 fatty acids compared to wild type protein(s) or the protein without such amino acid substitution(s).

14. A nucleic acid molecule, encoding a a polypeptide domain according to claim 4.

15. A host cell, containing a nucleic acid molecule according to claim 14.

16. The host cell according to claim 15, which has an elevated overall production of short fatty acids, CoA esters of short fatty acids, ethyl esters of short fatty acids, esters of short fatty acids with other metabolites, and/or enzyme bound short fatty acids (C.sub.6 to C.sub.12) compared to a cell not containing said nucleic acid molecule, or which has an increased yield of C.sub.6 fatty acids, C.sub.6 fatty acid CoA esters, C.sub.6 fatty acid ethyl esters, C.sub.6 fatty acid esters with other metabolites, and/or enzyme bound C.sub.6 fatty acids compared to a cell not containing said nucleic acid molecule, or which has an increased yield of C.sub.8 fatty acids, C.sub.8 fatty acid CoA esters, C.sub.8 fatty acid ethyl esters, C.sub.8 fatty acid esters with other metabolites, and/or enzyme bound C.sub.8 fatty acids compared to a cell not containing said nucleic acid molecule, or which has an increased yield of C.sub.10 to C.sub.12 fatty acids, C.sub.10 to C.sub.12 fatty acid CoA esters, C.sub.10 to C.sub.12 fatty acid ethyl esters, C.sub.10 to C.sub.12 fatty acid esters with other metabolites, and/or enzyme bound C.sub.10 to C.sub.12 fatty acids compared to a cell not containing said nucleic acid molecule.

17. A method for the production of short fatty acids, CoA esters of short fatty acids, short fatty acid ethyl esters, short fatty acid esters with other metabolites, and/or enzyme bound short fatty acids (C.sub.6 to C.sub.12), comprising the expression of a nucleic acid molecule according to claim 14.

18. A method for the production of a biofuel, a flavoring compound and/or a fine chemical (such as natural compounds), comprising the expression of a nucleic acid molecule according to claim 14.

19. A method for: the bulk production of short fatty acids (C.sub.6 to C.sub.12), the specific production of C.sub.6 fatty acids, the specific production of C.sub.8 fatty acids, the bulk production of CoA esters of short fatty acids (C.sub.6 to C.sub.12), the specific production of C.sub.6 fatty acid CoA esters, the specific production of C.sub.8 fatty acid CoA esters, the bulk production of ethyl esters of short fatty acids (C.sub.6 to C.sub.12), the specific production of C.sub.6 fatty acid ethyl esters, the specific production of C.sub.8 fatty acid ethyl esters, or the bulk production of short fatty acids (C.sub.6 to C.sub.12) esters with other metabolites, the specific production of C.sub.6 fatty acid esters with other metabolites, the specific production of C.sub.8 fatty acid esters with other metabolites, the bulk production of enzyme bound short fatty acids (C.sub.6 to C.sub.12), the specific production of enzyme bound C.sub.6 fatty acids, the specific production of enzyme bound C.sub.8 fatty acids, the production of biofuels, the production of fine chemicals, where short fatty acids (C.sub.6 to C.sub.12) or their derivatives are used as a building block, or the production of flavoring substances, wherein said method comprises the use of a nucleic acid molecule according to claim 14.

20. The polypeptide domain, according to claim 4, having at least one amino acid substitution selected from G236, M237, and F265.

21. The host cell, according to claim 15, wherein said host cell is a Saccharomyces cerevisiae.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

[0752] FIG. 1. Fatty acid cycle and its manipulation.

[0753] The FAS carries modifications in the KS, AT and MPT domain to produce shorter fatty acids (instead of its native product, typically C.sub.16- or C.sub.18-CoA) from acetyl-CoA, malonyl-CoA and NADPH. The KS mutations (G236S, M237W and F265Y) were constructed to restrict the loading of substrates beyond a certain length (indicated with a dotted line leading to the KS domain) and thus leading to the formation of shorter products. The AT (with the I306A mutation) was to enhance the loading of acetyl-CoA (indicated with the bold arrow at the AT domain) and/or act as a transferase to cleave off short chain products (dashed arrow from acyl products through the AT domain), a reaction not found in wild type FAS. The MPT mutation R130K was introduced to shift the balance in binding of malonyl and acyl chains in favor of the latter. Both the lowered malonyl loading (indicated by an arrow with a smaller tip at the MPT domain) as well as the easier acyl chain release add to an increase of short fatty acids. S. cerevisiae FAS naturally produces CoA esters, which are hydrolyzed by thioesterases, if they are shorter than a certain length. The free FA are then transported out of the cell into the media, from which they are extracted for their analysis.

[0754] FIG. 2. Product spectra of selected mutated strains in YPD.

[0755] For the measurements of the product spectra, cultures of S. cerevisiae were grown for 48 h at 30° C., the media extracted and later quantified via GC-FID. Error bars shown here reflect the standard deviation from two independent experiments (beginning from separate transformations into S. cerevisiae). The strain carrying the I306A-R130K-G236S-M11251W mutations and the strain with the I306A-R130K-F265Y mutations (both marked #) only grew to approximately one third of the regular cell density of the rest.

[0756] FIG. 3. Growing curve of manipulated Yeast strains.

[0757] For selected strains, the cell density was monitored at several time points.

[0758] FIG. 4. Binding channel of the KS domain with mutation sites.

[0759] Here, the KS domain from the S. cerevisiae FAS (light grey) is shown in cartoon depiction with important residues shown in stick representation (based on PDB code 2VKZ). The active center C291 is located on the left with a bound Cerulenin molecule (dark grey), a known FAS inhibitor mimicking a bound acyl. The binding channel extends to the right, where three mutation sites, G236S, M1250W and F265Y are shown with their initial amino acids.

[0760] FIG. 5. Product Spectra at additional time points of selected strains.

[0761] Besides the regular product spectra after 48 h, additional measurements were performed for selected strains after 12 h and 24 h.

[0762] FIGS. 6A-6E. Glucose and Ethanol concentration over time.

[0763] For selected strains, the medium was monitored at several time points during the 48 h cultivation. The amount of remaining glucose and produced ethanol in the fermentation medium was measured with HPLC.

[0764] FIGS. 7A-7E. Acetate and Glycerol concentration over time.

[0765] For the same selected strains as in FIGS. 6A-6E, also the acetate and glycerol concentrations in the medium were analyzed by HPLC.

[0766] FIG. 8. Product spectrum of a further mutated strain in YPD.

[0767] The product spectrum of a strain carrying the I306A-R130K-G236S-D259A mutations is shown in comparison to the wild type. In this case, the medium was buffered to pH 6.5 (100 mM K.sub.2HPO.sub.4/KH.sub.2PO.sub.4) and the promotor was exchanged for both the wild type and the construct to ADH2. For the measurements of the product spectrum, cultures of S. cerevisiae were grown at 30° C., cell growth was hindered and after 72 h cell density was only 5.0 (OD.sub.600), the media extracted and later quantified via GC-FID. Error bars shown here reflect the standard deviation from three independent results (beginning from separate clones of S. cerevisiae).

[0768] FIG. 9. Product spectrum of a further mutated strain in YPD.

[0769] The product spectrum of a strain carrying the I306A-R130K-G236S-N258A mutations is shown in comparison to the wild type. In this case, the medium was buffered to pH 6.5 (100 mM K.sub.2HPO.sub.4/KH.sub.2PO.sub.4) and the promotor was exchanged for both the wild type and the construct to ADH2).

[0770] For the measurements of the product spectrum, cultures of S. cerevisiae were grown at 30° C., cell growth was hindered and after 72 h cell density was only 5.0 (OD.sub.600), the media extracted and later quantified via GC-FID. Error bars shown here reflect the standard deviation from three independent results (beginning from separate clones of S. cerevisiae).

EXAMPLES

Example 1

1. Materials and Methods

1.1 Description Yeast Strain

[0771] The haploid S. cerevisiae strain BY.PK1238_1A_KO, used in this work, has a BY background and the reading frames of FAS1 and FAS2 are each replaced by a kanMX4 cassette, resulting in a clean knock out of FAS I and antibiotic resistance against Geneticin. The exact genotype is Mata; ura3Δ0; his3Δ0; leu2Δ0; TRP1; lys2Δ0; MET15; fas1::uptag-kanMX4-downtag; fas2::uptag-kanMX4-downtag.

1.2 Vector Description

[0772] The vectors used in this work are centromeric pRS shuttle vectors of types pRS313 and pRS315 (Sikorski & Meter, 1989) with single copy number and HIS3 and LEU2 auxotrophy marker, respectively. FAS1 or mutations thereof were always provided on pRS315, while FAS2 or mutations thereof were always provided on pRS313, each regulated by its according native promoter (995 bp upstream for FAS1 and 480 bp upstream for FAS2) (Chirala 1992). Terminator sequences were set to 295 bp and 258 bp, respectively, downstream of the open reading frames. Cloning was always done in E. coli using the Infusion HD cloning kit (Clontech, Mountain View, USA).

[0773] Wild type FAS1 and FAS2 genes were assembled from several fragments, which were amplified from S. cerevisiae genomic DNA, into pRS vectors using BamHI and Sail restriction sites. Exact chromosomal coordinates including promoter and terminator sequences according to strain S288C are for FAS1 (YKL182w): Chr XI 99676-107121 and for FAS2 (YPL231w): ChrXVI 108172-114573.

1.3 Primers

[0774] For the introduction of mutations by site-directed mutagenesis, the primers are listed below. The mutation site is indicated in bold typing, while the overlap between the primers is underlined.

[0775] For FAS 1 variants:

TABLE-US-00008 I306A forward SEQ ID NO: 7 5′-TTCTTCGCTGGTGTTCGTTGTTACGAAGCATACCCAAACACTTCC- 3′ I306A reverse SEQ ID NO: 8 5′-ACACCAGCG AAG AATAATACAGTAATTGCTTTTCTTACGGAGA CG-3′ R13 OK forward SEQ ID NO: 9 5′-AGTTGTGTTCTACAAAGGTATGACTATGCAAGTTGCTGTTCC-3′ R130K reverse SEQ ID NO: 10 5′-CATAGTCATACCTTTGTAGAACACAACTTCAACTAAAGATTCGATAG AC-3′

[0776] For FAS 2 variants:

TABLE-US-00009 G236S forward SEQ ID NO: 11 5′-TCTGGTTCTTCTATGGGTGGTGTTTCTGCCTTACG-3′ G236S reverse SEQ ID NO: 12 5′-CATAGAAGAACCAGAACAGTTACCAACCTCAGAAACATGTACG-3′ M237W forward SEQ ID NO: 13 5′-TCTGGTTCTTCTTGGGGTGGTGTTTCTGCCTTACG-3′ M237W reverse SEQ ID NO: 14 5′-CCAAGAAGAACCAGAACAGTTACCAACCTCAGAAACATGTACG-3′ F265Y forward SEQ ID NO: 15 5′-ATTTTACAAGAATCA TAT ATCAACACCATGTCCGC-3′ F265Y reverse SEQ ID NO: 16 5′-TGATTCTTGTAAAATATCATTTTGGACAGGC-3′

1.4 Transformation

[0777] For yeast transformation, approximately 1 μg of each plasmid DNA was co-transformed following a modified lithium acetate protocol (Schiestl & Gietz, 1989). A 5 mL overnight culture of strain BY.PK1238_1A_KO in YPD (1% yeast extract, 2% peptone, both produced by BD, Difco Laboratories, Sparks, USA; 2% dextrose, purchased from Roth, Karlsruhe, Germany) containing 200 μg/mL Geneticin disulfate, free fatty acids (myristic, palmitic and stearic acid, each 50 μg/mL) and 1% Tween20 grown at 30° C. and 200 rpm was used to inoculate a main culture in the same medium. After shaking at 30° C. and 200 rpm to OD.sub.600=0.8, a volume of 5 mL of this culture was harvested by centrifugation (3000 rcf, 5 min, 24° C.). The cells were washed by resuspending in 1 mL water and centrifuged again. After resuspension in lithium acetate solution (0.1 M), cells were incubated for 5 min at 24° C. and centrifuged (5000 rcf, 15 s, 24° C.), before the transformation mix was added (240 μL PEG 1,500 solution (50%), 76 μL water, 36 μL lithium acetate solution (1.0 M), 5.0 μL single stranded DNA solution from salmon testis (10 mg/mL), 2 μL of each plasmid DNA solution). The cell suspension was mixed well and incubated for 30 min at 30° C. followed by 20 min at 42° C. After pelleting the cells by centrifugation (4000 rcf, 15 s, 4° C.), they were washed with 1 mL water, pelleted again (4000 rcf, 15 s, 4° C.) and resuspended in 100 μL water. For selection of the yeast transformants, the cell suspension was spread on SCD −ura; −leu agar plates containing 200 μg/mL Geneticin disulfate, free fatty acids (myristic, palmitic and stearic acid, each 50 μg/mL) and 1% Tween20.

1.5 Cultures for Product Analysis

[0778] For the product analysis, several colonies of the S. cerevisiae strains were picked and united in one pre-culture (5 ml YPD with 200 μg/mL Geneticin disulfate, 50 mg/ml final concentration). After shaking at 200 rpm at 30° C. overnight, the OD.sub.600 was measured. The main culture (50 ml YPD with 200 μg/mL Geneticin disulfate, 50 mg/ml final concentration) was inoculated to OD.sub.600=0.1 and shaken for 48 h at 200 rpm and 30° C. Before further processing, the OD.sub.600 was measured again.

[0779] For samples with long FA supplementation, C.sub.151 and Tergitol NP-40 (solution in water, 70%) were added to all cultures to a final concentration of 1 mM or 1% in the case of Tergitol.

1.6 Sample Processing

[0780] For FA extraction, a protocol similar to a previously published one (Leber & da Silva, 2014) was used: First cells were spun down at 3,500 ref for 15 min. The supernatant was aliquoted in 10 ml portions and 0.2 mg of the internal standard, heptanoic acid (C.sub.7), was added. After acidification with 1 ml HCl (1 M), 2.5 ml of a mixture of equal amounts of methanol and chloroform were added. The samples were shaken vigorously for 5 min and then centrifuged again at 3 500 rcf for 10 min. The chloroform layer was transferred to a new vial and any residual water removed. The liquid was then fully evaporated in a SpeedVac.

[0781] For methylation a previously published protocol was used (Ichihara & Fukubayashi, 2010).

1.7 Determination of Free Fatty Acid by Gas Chromatography (GC)

[0782] The resulting fatty acid methyl esters dissolved in hexane (Ichihara & Fukubayashi, 2010), were measured with a Perkin Elmer Clarus 400 gaschromatograph (Perkin Elmer, Rodgau, Germany) equipped with an Elite FFAP capillary column (30 m×0.25 mm, film thickness: 0.25 urn; Perkin Elmer, Rodgau, Germany) and a flame ionization detector (Perkin Elmer, Rodgau, Germany). 1 μL of the sample was analyzed after split injection (10 mL/min) and helium as carrier gas. The temperatures of the injector and detector were 200° C. and 250° C., respectively. The following temperature program was applied: 50° C. for 5 min, increase of 10° C./min to 120° C. (hold for 5 min), increase of 15° C./min to 180° C. (hold for 10 min), and increase of 20° C./min to 220° C. for 37 min.

1.8 Metabolite Analysis by HPLC

[0783] For quantification of glucose, ethanol, glycerol and acetate 450 μL cell-free samples were mixed with 50 μL of 50% (w/v) 5-sulfosalicylic acid, vigorously shaken and centrifuged (4° C., 5 min, 13 000 rcf). The supernatant was analyzed with an UHPLC+ system (Dionex UltiMate 3000, Thermo Scientific, Dreieich, Germany) equipped with a HyperREZ XP Carbohydrate H+ 8 μm column. To detect the substrates a refractive index detector (Thermo Shodex RI-101) was used. Separation was carried out at 65° C. with 5 mM sulfuric acid as mobile phase (flow rate of 0.6 ml/min). Five standards (mixtures of D-glucose, ethanol, glycerol and acetate with concentrations of 0.05-2% (w/v)) were analyzed for quantification of the different compounds.

1.9 Determination of Cell Density

[0784] The cell density in a liquid culture was measured with an Ultrospec 2100 pro spectrophotometer (GE Healthcare, USA) by determination of the optical density at 600 nm (OD.sub.600).

2. Results

[0785] For the production of short FA in S. cerevisiae, a Δfas1 Δfas2 strain was created. Two heterozygotic strains with one deletion each, were mated and then sporulated to gain the double knockout strain. The two chains of FAS were transformed into cells on two separate low copy vectors (pRS315 and pRS313 respectively) under control of their natural promoters and terminators (Chirala 1992). The plasmid FAS system was then the only source of de-novo fatty acids.

2.1 Short FA Yield in YPD Supplemented with C.sub.18:1

[0786] In some strains, growth was severely inhibited in regular YPD media, most likely because the plasmid FAS system did not produce enough long fatty acids necessary for cell growth. As an alternative, strains were also tested in YPD media supplemented with oleic acid (C.sub.18:1, 1 mM) where all strains showed similar growth (Table 2). The reestablishment in growth is proof that an insufficient production of long chains prevented cells from growing before.

2.2 Vitality Parameters

[0787] In our in vivo study, the cells themselves were closely monitored. The cell density was measured for all samples at the end of the growing period and the wet cell pellet weight was noted (Table 2). In addition, for selected samples OD.sub.600 was recorded at several time points (FIG. 3). For the growth in regular YPD, three groups can be distinguished: Strains that showed regular growth, ones with reduced growth and a group, were only an extremely low or no detectable growth could be seen. When the media was supplemented with C.sub.18:1 (1 mM) all strains showed similar growth.

[0788] In order to test the theory, that reduced growth for the I306A-R130K-G236S-M237W mutant could derive from a strong initial production of C.sub.8 eventually inhibiting further growth, product spectra of selected strains were measured after 12 h and 24 h in addition to the regular measurements after 48 h (FIG. 5). While cell density of the I306A-R130K-G236S-M237W mutant reached its stationary phase already after 24 h instead of a later time (as for the R130K mutant for example, FIG. 3), the FA production follows a similar pattern for both the samples.

TABLE-US-00010 TABLE 2 Cell density (OD.sub.600 and wet pellet weight) after 48 h. Samples in regular Samples in YPD with YPD C.sub.18:1 wet cell wet cell OD.sub.600 pellet (g) OD.sub.600 pellet (g) wild type 24.7 1.1 17.4 1.3 G236S 21.9 1.1 19.2 1.4 G236S M237W 15.6 1.0 19.5 1.5 I306A 23.1 1.1 19.2 1.4 I306A G236S M237W 15.9 1.1 18.8 1.4 R130K G236S M237W 3.5 0.2 22.0 1.5 I306A R130K G236S M237W 5.4 0.5 20.4 1.7 R130K 20.7 1.1 24.1 1.4 I306 R130K 22.5 1.2 20.3 1.5 I306A G236S 15.6 1.3 18.9 1.4 R130K G236S 10.2 0.9 19.6 1.4 I306A R130K G236S 14.0 1.1 18.3 1.3 G236S F265Y 0.1 0.3 17.5 1.4 I306A G236S F265Y 0.3 0.3 16.7 1.3 R130K G236S F265Y 0.1 0.3 15.8 1.4 I306A R130K G236S F265Y 0.1 0.3 17.0 1.5 I306A F265Y 15.6 1.2 16.9 1.3 I306A G236S M237W F265Y — * — * 18.2 1.4 I306A F265W — * — * 17.7 1.3 I306A G236S F265W — * — * 21.8 1.4 I306A G236S M237W F265W — * — * 18.4 1.3 I306A R130K F265Y 4.3 0.6 21.1 1.4 I306A R130K G236S M237W — * — * 20.5 1.3 F265Y I306A R130K F265W — * — * 23.6 1.4 I306A R130K G236S F265W — * — * 15.8 1.4 I306A R130K G236S M237W — * — * 21.1 1.3 F265W

[0789] Just before further processing, the OD.sub.600 was measured for selected samples, both when they were grown in regular YPD and in YPD supplemented with C.sub.18:1 (1 mM). For the growth in regular YPD, samples could be divided into three groups: regular growth (white background), reduced growth (light gray background) and very little/no growth (dark gray background). In YPD supplemented with C.sub.18:1 all samples showed nearly the same densities. Also, the wet pellet weight was noted. It is, however, prone to errors since residual media that is stuck to the tube can make the results less reliable. For samples marked with an asterisk (*), no main culture was grown, after the preculture already showed no significant growth.

2.3 Glucose Consumption, Ethanol Production, FA Production on Ethanol

[0790] For cells grown with YPD media the glucose consumption and ethanol synthesis was measured. For all tested strains (FIGS. 6A-6E) glucose is entirely consumed after 20 h, whereas the synthesis of ethanol starts after approx. 10 h, when a low glucose concentration (<1.2% (wt/vol)) is measurable. Corresponding to this, the amount of glycerol and acetate (FIGS. 7A-7E) increases after 10 h of fermentation, which can be compared to the strain with the wild type FAS.

Example 2

1. Materials and Methods

[0791] For this example, materials and methods were the same as in Example 1, if not stated otherwise.

1.1 Vector Description

[0792] See Example 1. For constructs carrying any of the mutations Q193A, Q193E, N258A, N258D, D259A, the ADH2 promotor was used. For comparison, also one wild type construct was cloned with this promotor and used as a reference when constructs with this particular promotor were tested.

1.2 Primers

[0793] For the introduction of the point mutations in a PCR, the primers are listed below. The PCR products were then cloned into the vector containing the ADH2 promotor via homologous recombination. fw=forward, rv=reverse

TABLE-US-00011 FAS2-D259A_rv SEQ ID NO: 17 TCTTGTAAAATAGCATTTTGGACAGGCTCATCCTTGAAACGGTCCTTAA AC FAS2-D259A-fw SEQ ID NO: 18 CCTGTCCAAAATGCTATTTTACAAGAATCATTTATCAACACCATGTCCG CTTGGG FAS2-N258A_rv SEQ ID NO: 19 TCTTGTAAAATATCAGCTTGGACAGGCTCATCCTTGAAACGGTCCTTAA AC FAS2-N258A_fw SEQ ID NO: 20 CCTGTCCAAGCTGATATTTTACAAGAATCATTTATCAACACCATGTCCG CTTGGG FAS2_Q193A_rv SEQ ID NO: 21 GAATAATGTGATTGGGTCAACCGCAGAAATGATATCATCAGAGATACCA TAAGTC FAS2_Q193A_fw SEQ ID NO: 22 CTGCGGTTGACCCAATCACATTATTCGTTTTGGTCTCTGTTGTGGAAG FAS2_Q193E_rv SEQ ID NO: 23 GAATAATGTGATTGGGTCAACCTCAGAAATGATATCATCAGAGATACCA TAAGTC FAS2_Q193E_fw SEQ ID NO: 24 CTGAGGTTGACCCAATCACATTATTCGTTTTGGTCTCTGTTGTGGAAG FAS2_N258D_rv SEQ ID NO: 25 TCTTGTAAAATATCATCTTGGACAGGCTCATCCTTGAAACGGTCCTTAA AC FAS2_N258D_fw SEQ ID NO: 26 CCTGTCCAAGATGATATTTTACAAGAATCATTTATCAACACCATGTCCG CTTGGG

[0794] The following primers were designed for homologous recombination of the cut vector and the ADH2 promotor.

TABLE-US-00012 pRS315-pADH2 SEQ ID NO: 27 CAGTGAATTGTAATACGACTCACTATAGGGCGAATTGGAGCTGGCAAAA CGTAGGGGCAAACAAACG pADH2-Fas2 SEQ ID NO: 28 GCAAAATATGAGCTAATTCTTGCTCAACTTCCGGCTTCATTGTGTATTA CGATATAGTTAATAG Fas2-pADH2 SEQ ID NO: 29 GCATACAATCAACTATCAACTATTAACTATATCGTAATACACAATGAAG CCGGAAGTTGAGCAAGAATTAG pRS42_hxt7 SEQ ID NO: 30 CACACAGGAAACAGCTATGAC

1.3 Cultures for Product Analysis

[0795] In contrast to the procedure described in Example 1, the main culture was buffered to pH 6.5 ((100 mM K.sub.2HPO.sub.4/KH.sub.2PO.sub.4). Cell cultivation was 72 hours.

[0796] The features disclosed in the foregoing description, in the claims and/or in the accompanying drawings may, both separately and in any combination thereof, be material for realizing the invention in diverse forms thereof.

REFERENCES

[0797] Aritomi K, et al. (2004) Self-cloning Yeast Strains Containing Novel <I>FAS2</I> Mutations Produce a Higher Amount of Ethyl Caproate in Japanese Sake TI. Bioscience, Biotechnology, and Biochemistry 68(1):206-214. [0798] Beld J, Lee D J, & Burkart M D (2015) Fatty acid biosynthesis revisited: structure elucidation and metabolic engineering. Molecular BioSystems 11(1):38-59. [0799] Bunkoczi G, et al. (2009) Structural Basis for Different Specificities of Acyltransferases Associated with the Human Cytosolic and Mitochondrial Fatty Acid Synthases. Chemistry & Biology 16(6):667-675. [0800] Chirala S S (1992) Coordinated regulation and inositol-mediated and fatty acid-mediated repression of fatty acid synthase genes in Saccharomyces cerevisiae. Proceedings of the National Academy of Sciences of the United States of America 89(21):10232-10236. [0801] Choi Y J & Lee S Y (2013) Microbial production of short-chain alkanes. Nature 502(7472):571-574. [0802] Christensen C E, Kragelund B B, von Wettstein-Knowles P, & Henriksen A (2007) Structure of the human β-ketoacyl [ACP] synthase from the mitochondrial type II fatty acid synthase. Protein Science 16(2):261-272. [0803] Grininger M (2014) Perspectives on the evolution, assembly and conformational dynamics of fatty acid synthase type I (FAS I) systems. Current Opinion in Structural Biology 25(0):49-56. [0804] Hitchman T S, et al. (2001) Hexanoate Synthase, a Specialized Type I Fatty Acid Synthase in Aflatoxin B1 Biosynthesis. Bioorganic Chemistry 29(5):293-307. [0805] Ichihara Ki & Fukubayashi Y (2010) Preparation of fatty acid methyl esters for gas-liquid chromatography. Journal of Lipid Research 51(3):635-640. [0806] Jenni S, et al. (2007) Structure of Fungal Fatty Acid Synthase and Implications for Iterative Substrate Shuttling. Science 316(5822):254-261. [0807] Johansson P, et al. (2008) Inhibition of the fungal fatty acid synthase type I multienzyme complex. Proceedings of the National Academy of Sciences 105(35):12803-12808. [0808] Kawaguchi A, Arai K, Seyama Y, Yamakawa T, & Okuda S (1980) Substrate Control of Termination of Fatty Acid Biosynthesis by Fatty Acid Synthetase from Brevibacterium ammoniagenes TI. The Journal of Biochemistry 88(2):303-306. [0809] Knight M J, Bull I D, & Curnow P (2014) The yeast enzyme Eht1 is an octanoyl-CoA:ethanol acyltransferase that also functions as a thioesterase. Yeast 31(12):463-474. [0810] Leber C & Da Silva N A (2014) Engineering of Saccharomyces cerevisiae for the synthesis of short chain fatty acids. Biotechnology and Bioengineering 111(2):347-358. [0811] Leber C, Polson B, Fernandez-Moya R, & Da Silva N A (2015) Overproduction and secretion of free fatty acids through disrupted neutral lipid recycle in Saccharomyces cerevisiae. Metabolic Engineering 28(0):54-62. [0812] Leibundgut M, Jenni S, Frick C, & Ban N (2007) Structural Basis for Substrate Delivery by Acyl Carrier Protein in the Yeast Fatty Acid Synthase. Science 316(5822):288-290. [0813] Liu H, et al. (2012) Production of extracellular fatty acid using engineered Escherichia coli. Microbial Cell Factories 11. [0814] Peralta-Yahya, P. P., Zhang, F., del Cardayre, S. B. & Keasling, J. D. (2012) Microbial engineering for the production of advanced biofuels. Nature 488: 320-328. [0815] Runguphan W & Keasling J D (2014) Metabolic engineering of Saccharomyces cerevisiae for production of fatty acid-derived biofuels and chemicals. Metabolic Engineering 21(0):103-113. [0816] Schiestl R & Gietz R D (1989) High efficiency transformation of intact yeast cells using single stranded nucleic acids as a carrier. Curr Genet 16(5-6):339-346. [0817] Sikorski R S & Hieter P (1989) A System of Shuttle Vectors and Yeast Host Strains Designed for Efficient Manipulation of DNA in Saccharomyces Cerevisiae. Genetics 122(1):19-27. [0818] Tehlivets O, Scheuringer K, & Kohlwein S D (2007) Fatty acid synthesis and elongation in yeast. Regulation of Lipid Metabolism in Yeast 1771(3):255-270. [0819] Zhang L, Joshi A K, Hofmann J, Schweizer E, & Smith S (2005) Cloning, Expression, and Characterization of the Human Mitochondrial β-Ketoacyl Synthase: COMPLEMENTATION OF THE YEAST CEM1 KNOCK-OUT STRAIN. Journal of Biological Chemistry 280(13):12422-12429.