RECOMBINANT HUMAN ACID ALPHA-GLUCOSIDASE
20210393747 · 2021-12-23
Inventors
- Hung Do (New Hope, PA)
- Russell Gotschall (Doylestown, PA)
- Richie Khanna (Somerset, NJ)
- Yi Lun (Plainsboro, NJ, US)
- Hing Char (East Brunswick, NJ)
- Sergey Tesler (Monroe, NJ)
- Wendy Sunderland (Doylestown, PA)
- Enrique Diloné (Basking Ridge, NJ, US)
Cpc classification
A61P21/00
HUMAN NECESSITIES
A61K38/47
HUMAN NECESSITIES
International classification
Abstract
Provided are a recombinant acid α-glucosidase and pharmaceutical composition comprising a recombinant acid α-glucosidase, wherein the recombinant acid α-glucosidase is expressed in Chinese hamster ovary (CHO) cells and comprises an increased content of N-glycan units bearing one or two mannose-6-phosphate residues when compared to a content of N-glycan units bearing one or two mannose-6-phosphate residues of alglucosidase alfa. Also provided herein are methods of producing, purifying, and formulating the recombinant acid α-glucosidase or pharmaceutical composition for administration to a subject and methods of treating a disease or disorder such as Pompe disease using the recombinant acid α-glucosidase or pharmaceutical composition.
Claims
1. A method of treating Pompe disease in a subject in need thereof, comprising administering to the subject a population of recombinant human acid α-glucosidase (rhGAA) molecules from Chinese hamster ovary (CHO) cells; wherein the rhGAA molecules comprise seven potential N-glycosylation sites; wherein the rhGAA molecules on average comprise 3-4 mannose-6-phosphate (M6P) residues; wherein the rhGAA molecules on average comprise at least about 0.5 mol bis-mannose-6-phosphate (bis-M6P) per mol of rhGAA at the first potential N-glycosylation site as determined using liquid chromatography-tandem mass spectrometry (LC-MS/MS); and wherein (a) the population of rhGAA is administered at a dosage capable of reversing disease progression in the subject; (b) the glycogen content in a muscle of the subject after treatment is reduced faster than when alglucosidase alfa is administered at the same dosage; (c) the population of rhGAA is administered at a dosage capable of improving motor function in the subject; (d) the population of rhGAA is administered at a dosage capable of improving upper body strength in the subject; (e) the population of rhGAA is administered at a dosage capable of improving pulmonary function in the subject; (f) the population of rhGAA is administered at a dosage capable of reducing fatigue in the subject, as measured according to a fatigue severity scale (FSS) score; and/or (g) the population of rhGAA is administered at a dosage capable of reducing the levels of at least one muscle injury biomarker selected from the group consisting of creatine kinase, alanine aminotransferase (ALT), and aspartate aminotransferase (AST).
2. The method of claim 1, wherein in (a) (i) reversing disease progression includes reducing lysosomal size in a muscle of the subject; (ii) reversing disease progression includes reducing or eliminating autophagic buildup in a muscle of the subject; (iii) fewer than 65% of muscle fibers analyzed in the subject have autophagic buildup after treatment; (iv) the subject is an ERT-switch patient; (v) the subject is an ERT-switch patient who had previously been treated with alglucosidase alfa for at least two years; and/or (vi) at least 36% of muscle fibers analyzed in the subject have normal or near-normal appearance after treatment.
3.-8. (canceled)
9. The method of claim 1, wherein in (b) (i) the glycogen content in a muscle of the subject after treatment is reduced at a rate that is at least about 1.25, 1.5, 1.75, 2.0, or 3.0 times faster than the rate when alglucosidase alfa is administered at the same dosage; (ii) the glycogen content in a muscle of the subject after treatment is reduced more effectively than when alglucosidase alfa is administered at the same dosage, when assessed after one, two, three, four, five, or six administrations, and the glycogen content is assessed after six administrations; (iii) the glycogen content in a muscle of the subject after treatment is reduced at least about 10%, 20%, 30%, 50%, 75%, or 90% more effectively than when alglucosidase alfa is administered at the same dosage, and the glycogen content is assessed after six administrations; (iv) the subject exhibits reduced levels of urine hexose tetrasaccharide after treatment; (v) the subject's levels of urine hexose tetrasaccharide at six months after treatment are reduced at least 30% compared to baseline; (vi) the subject is an ambulatory ERT-switch patient or a nonambulatory ERT-switch patient, and wherein the subject's levels of urine hexose tetrasaccharide at six months after treatment are reduced at least 35% compared to baseline; and/or (vii) the subject in an ambulatory ERT-naïve patient and the subject's levels of urine hexose tetrasaccharide at six months after treatment are reduced at least 45% compared to baseline.
10.-17. (canceled)
18. The method of claim 1, wherein in (c) the improved motor function in the subject is measured by at least one motor function test selected from the group consisting of a six-minute walk test (6MWT), a timed up and go test, a four-stair climb test, a ten-meter walk test, a gowers test, a gait-stair-gower-chair (GSGC) test, and combinations thereof; and (i) compared to baseline, the subject's 6MWT distance at six months after treatment is increased at least 20 meters, the subject's timed up and go test time at six months after treatment is decreased at least 1 second, the subject's four-stair climb test time at six months after treatment is decreased at least 0.6 seconds, the subject's ten-meter walk test time at six months after treatment is decreased at least 0.7 seconds, the subject's gowers test time at six months after treatment is decreased at least 1 second, or the subject's GSGC score at six months after treatment is decreased by at least 1; (ii) the subject is an ambulatory ERT-switch patient and wherein, compared to baseline, the subject's 6MWT distance at six months after treatment is increased at least 20 meters, the subject's timed up and go test time at six months after treatment is decreased at least 1.5 seconds, the subject's four-stair climb test time at six months after treatment is decreased at least 0.6 seconds, or the subject's gowers test time at six months after treatment is decreased at least 1 second; (iii) the subject is an ambulatory ERT-naive patient and wherein, compared to baseline, the subject's 6MWT distance at six months after treatment is increased at least 40 meters, the subject's timed up and go test time at six months after treatment is decreased at least 1 second, the subject's four-stair climb test time at six months after treatment is decreased at least 0.6 seconds, the subject's ten-meter walk test time at six months after treatment is decreased at least 0.7 seconds, or the subject's GSGC score at six months after treatment is decreased by at least 1; and/or (iv) the subject previously received alglucosidase alfa enzyme replacement therapy, wherein the subject exhibits an improvement in at least one motor function test after treatment with the population of rhGAA compared to the subject's motor function test result after the previous alglucosidase alfa enzyme replacement therapy.
19.-23. (canceled)
24. The method of claim 1, wherein in (d) (i) the improved upper body strength in the subject is measured by a manual muscle strength score, and the subject is an ambulatory ERT-switch patient and at six months after treatment exhibits an improvement in upper body manual muscle strength score of at least 1 compared to baseline, or the subject is a nonambulatory ERT-switch patient and at six months after treatment exhibits an improvement in upper body manual muscle strength score of at least 5.5 compared to baseline; (ii) the improved upper body strength in the subject is improved upper extremity strength, wherein upper extremity strength is measured by quantitative muscle testing or manual muscle testing of at least one upper extremity muscle group selected from the group consisting of shoulder adduction, shoulder abduction, elbow flexion, and elbow extension; (iii) the subject is a nonambulatory ERT-switch patient and wherein, compared to baseline, the subject's shoulder adduction at six months after treatment is improved by at least 8 pounds of force, the subject's shoulder abduction at six months after treatment is improved by at least 1 pound of force, the subject's elbow flexion at six months after treatment is improved by at least 2 pounds of force, or the subject's elbow extension at six months after treatment is improved by at least 5 pounds of force; (iv) the subject is ambulatory and further exhibits improved lower body strength and/or total body strength after treatment; and/or (v) the subject previously received alglucosidase alfa enzyme replacement therapy, wherein the subject exhibits an improvement in upper body strength after treatment with the population of rhGAA compared to the subject's upper body strength after the previous alglucosidase alfa enzyme replacement therapy.
25.-31. (canceled)
32. The method of claim 1, wherein in (e) the improved pulmonary function in the subject is measured by at least one pulmonary function test selected from the group consisting of an upright forced vital capacity (FVC) test, a maximal expiratory pressure (MEP) test, a maximal inspiratory pressure (MIP) test, and combinations thereof, and (i) compared to baseline, the subject's FVC at six months after treatment is improved by at least 4%, the subject's MEP at six months after treatment is improved by at least 16 cmH.sub.2O, or the subject's MIP at six months after treatment is improved by at least 0.3 cmH.sub.2O; (ii) the subject is an ambulatory ERT-switch patient and wherein, compared to baseline, the subject's MEP at six months after treatment is improved by at least 16 cmH.sub.2O; (iii) the subject is an ambulatory ERT-naïve patient and wherein, compared to baseline, the subject's FVC at six months after treatment is improved by at least 4% or the subject's MIP at six months after treatment is improved by at least 11 cmH.sub.2O; and/or (iv) the subject previously received alglucosidase alfa enzyme replacement therapy, wherein the subject exhibits an improvement in at least one pulmonary function test after treatment with the population of rhGAA compared to the subject's pulmonary function test result after the previous alglucosidase alfa enzyme replacement therapy.
33.-37. (canceled)
38. The method of claim 1, wherein in (f) (i) the subject's FSS score at six months after treatment is decreased by at least 3.5 compared to baseline, and the subject is a nonambulatory ERT-switch patient; (ii) the subject is an ambulatory ERT-switch patient and wherein the subject's FSS score at six months after treatment is decreased by at least 8 compared to baseline; (iii) the subject is an ambulatory ERT-naïve patient and wherein the subject's FSS score at six months after treatment is decreased by at least 5 compared to baseline; and/or (iv) the subject previously received alglucosidase alfa enzyme replacement therapy, wherein the subject has a lower FSS score after treatment with the population of rhGAA compared to the subject's FSS score after the previous alglucosidase alfa enzyme replacement therapy.
39.-43. (canceled)
44. The method of claim 1, wherein in (g) (i) the at least one muscle injury biomarker is creatine kinase; (ii) compared to baseline, the subject's creatine kinase levels at six months after treatment are reduced at least 15%, the subject's ALT levels at six months after treatment are reduced at least 5%, or the subject's AST levels at six months after treatment are reduced at least 5%; (iii) the subject is an ambulatory ERT-switch patient and wherein, compared to baseline, the subject's creatine kinase levels at six months after treatment are reduced at least 15%, the subject's ALT levels at six months after treatment are reduced at least 15%, or the subject's AST levels at six months after treatment are reduced at least 10%; (iv) the subject is a nonambulatory ERT-switch patient and wherein, compared to baseline, the subject's creatine kinase levels at six months after treatment are reduced at least 20%, the subject's ALT levels at six months after treatment are reduced at least 5%, or the subject's AST levels at six months after treatment are reduced at least 5%; and/or (v) the subject is an ambulatory ERT-naïve patient and wherein, compared to baseline, the subject's creatine kinase levels at six months after treatment are reduced at least 35%, the subject's ALT levels at six months after treatment are reduced at least 35%, or the subject's AST levels at six months after treatment are reduced at least 30%.
45.-48. (canceled)
49. The method of claim 1, wherein the population of rhGAA molecules is administered at a dose of about 1 mg/kg to about 100 mg/kg.
50. (canceled)
51. The method of claim 1, wherein the population of rhGAA molecules is administered bimonthly, monthly, bi-weekly, weekly, twice weekly, or daily.
52.-53. (canceled)
54. The method of claim 1, wherein the population of rhGAA molecules is administered concurrently or sequentially with a pharmacological chaperone, and wherein the pharmacological chaperone is miglustat or a pharmaceutically acceptable salt thereof.
55.-56. (canceled)
57. The method of claim 54, wherein the miglustat or pharmaceutically acceptable salt thereof is administered at a dose of about 200 mg to about 600 mg.
58. (canceled)
59. The method of claim 57, wherein the population of rhGAA molecules is administered intravenously at a dose of about 5 mg/kg to about 20 mg/kg and the miglustat or pharmaceutically acceptable salt thereof is administered orally at a dose of about 233 mg to about 500 mg.
60. (canceled)
61. The method of claim 54, wherein the population of rhGAA molecules is administered intravenously at a dose of about 20 mg/kg and the miglustat or pharmaceutically acceptable salt thereof is administered orally at a dose of about 260 mg.
62. The method of claim 54, wherein the miglustat or pharmaceutically acceptable salt thereof is administered prior to administration of the rhGAA.
63.-64. (canceled)
65. The method of claim 1, wherein the rhGAA molecules comprise an amino acid sequence at least 95% identical to SEQ ID NO: 1 or SEQ ID NO: 5.
66. (canceled)
67. The method of claim 1, wherein at least 30% of the rhGAA molecules comprise one or more N-glycan units bearing one mannose-6-phosphate residue (mono-M6P) or bis-M6P, as determined using LC-MS/MS.
68. The method of claim 1, wherein the rhGAA molecules comprise on average from about 0.5 mol to about 7.0 mol of mono-M6P or bis-M6P per mol of rhGAA, as determined using LC-MS/MS.
69. The method of claim 1, wherein the rhGAA molecules comprise on average at least 2.5 mol M6P per mol of rhGAA and at least 4 mol sialic acid per mol of rhGAA, as determined using LC-MS/MS.
70. The method of claim 1, wherein, per mol of rhGAA, the rhGAA molecules comprise on average: (a) about 0.4 to about 0.6 mol mono-M6P at the second potential N-glycosylation site; (b) about 0.4 to about 0.6 mol bis-M6P at the fourth potential N-glycosylation site; and (c) about 0.3 to about 0.4 mol mono-M6P at the fourth potential N-glycosylation site; wherein (a)-(c) are determined using LC-MS/MS.
71. The method of claim 70, wherein, per mol of rhGAA, the rhGAA molecules further comprise about 4 mol to about 7.3 mol sialic acid; and wherein, per mol of rhGAA, the rhGAA molecules comprise on average: (a) about 0.9 to about 1.2 mol sialic acid at the third potential N-glycosylation site; (b) about 0.8 to about 0.9 mol sialic acid at the fifth potential N-glycosylation site; and (c) about 1.5 to about 4.2 mol sialic acid at the sixth potential N-glycosylation site; wherein (a)-(c) are determined using LC-MS/MS.
72. The method of claim 1, wherein the population of rhGAA molecules is formulated in a pharmaceutical composition.
73. The method of claim 72, wherein the pharmaceutical composition further comprises at least one buffer selected from the group consisting of a citrate, a phosphate, and a combination thereof, and at least one excipient selected from the group consisting of mannitol, polysorbate 80, and a combination thereof; wherein the pharmaceutical composition has a pH of about 5.0 to about 7.0.
74.-75. (canceled)
76. The method of claim 73, wherein, in the pharmaceutical composition, the population of rhGAA molecules is present at a concentration of about 5-50 mg/mL, the at least one buffer is a sodium citrate buffer present at a concentration of about 10-100 mM, the at least one excipient is mannitol present at a concentration of about 10-50 mg/mL and polysorbate 80 present at a concentration of about 0.1-1 mg/mL, and the pharmaceutical composition further comprises water and optionally comprises an acidifying agent and/or alkalizing agent; wherein the pharmaceutical composition has a pH of about 6.0.
77. (canceled)
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0024]
[0025]
[0026]
[0027]
[0028]
[0029]
[0030]
[0031]
[0032]
[0033]
[0034]
[0035]
[0036]
[0037]
[0038]
[0039]
[0040]
[0041]
[0042]
[0043]
[0044]
[0045]
[0046]
[0047]
[0048]
[0049]
[0050]
[0051]
[0052]
[0053]
[0054]
[0055]
[0056]
[0057]
[0058]
[0059]
[0060]
[0061]
[0062]
DETAILED DESCRIPTION
[0063] Before describing several exemplary embodiments of the invention, it is to be understood that the invention is not limited to the details of construction or process steps set forth in the following description. The invention is capable of other embodiments and of being practiced or being carried out in various ways.
I. Definition
[0064] The terms used in this specification generally have their ordinary meanings in the art, within the context of this invention and in the specific context where each term is used. Certain terms are discussed below, or elsewhere in the specification, to provide additional guidance to the practitioner in describing the compositions and methods of the invention and how to make and use them. The articles “a” and “an” refer to one or to more than one (i.e., to at least one) of the grammatical object of the article. The term “or” means, and is used interchangeably with, the term “and/or,” unless context clearly indicates otherwise. In this application, the use of the singular includes the plural unless specifically stated otherwise. Furthermore, the use of the term “including,” as well as other forms, such as “includes” and “included,” are not limiting. Any range described herein will be understood to include the endpoints and all values between the endpoints. In the present specification, except where the context requires otherwise due to express language or necessary implication, the word “comprises”, or variations such as “comprising” is used in an inclusive sense, i.e., to specify the presence of the stated features but not to preclude the presence or addition of further features in various embodiments of the invention.
[0065] The term “GAA” refers to human acid α-glucosidase (GAA) enzyme that catalyzes the hydrolysis of α-1,4- and α-1,6-glycosidic linkages of lysosomal glycogen as well as to insertional, relational, or substitution variants of the GAA amino acid sequence and fragments of a longer GAA sequence that exert enzymatic activity. Human acid α-glucosidase is encoded by the GAA gene (National Centre for Biotechnology Information (NCBI) Gene ID 2548), which has been mapped to the long arm of chromosome 17 (location 17q25.2-q25.3). An exemplary DNA sequence encoding GAA is NP 000143.2, which is incorporated by reference. More than 500 mutations have currently been identified in the human GAA gene, many of which are associated with Pompe disease. Mutations resulting in misfolding or misproccssing of the acid α-glucosidase enzyme include T1064C (Leu355Pro) and C2104T (Arg702Cys). In addition, GAA mutations which affect maturation and processing of the enzyme include Leu405Pro and Met519Thr. The conserved hexapeptide WIDMNE at amino acid residues 516-521 is required for activity of the acid α-glucosidase protein. As used herein, the abbreviation “GAA” is intended to refer to human acid α-glucosidase enzyme, while the italicized abbreviation “GAA” is intended to refer to the human gene coding for the human acid α-glucosidase enzyme. The italicized abbreviation “Gad” is intended to refer to non-human genes coding for non-human acid α-glucosidase enzymes, including but not limited to rat or mouse genes, and the abbreviation “Gaa” is intended to refer to non-human acid α-glucosidase enzymes.
[0066] The term “rhGAA” is intended to refer to the recombinant human acid α-glucosidase enzyme and is used to distinguish endogenous GAA from synthetic or recombinant-produced GAA (e.g., GAA produced from CHO cells transformed with DNA encoding GAA). The term “rhGAA” encompasses a population of individual rhGAA molecules. Characteristics of the population of rhGAA molecules are provided herein. The term “conventional rhGAA product” is intended to refer to products containing alglucosidase alfa, such as Lumizyme® or Myozyme®.
[0067] The term “genetically modified” or “recombinant” refers to cells, such as CHO cells, that express a particular gene product, such as rhGAA, following introduction of a nucleic acid comprising a coding sequence which encodes the gene product, along wife regulatory elements feat control expression of fee coding sequence. Introduction of fee nucleic acid may be accomplished by any method known in fee art including gene targeting and homologous recombination. As used herein, fee term also includes cells feat have been engineered to express or overexpress an endogenous gene or gene product not normally expressed by such cell, e.g., by gene activation technology.
[0068] The term “purified” as used herein refers to material feat has been isolated under conditions feat reduce or eliminate fee presence of unrelated materials, i.e., contaminants, including native materials from which fee material is obtained. For example, a purified protein is preferably substantially free of other proteins or nucleic acids with which it is associated in a cell: a purified nucleic acid molecule is preferably substantially free of proteins or other unrelated nucleic acid molecules wife which it can be found within a cell. As used herein, fee term “substantially free” is used operationally, in fee context of analytical testing of fee material. Preferably, purified material substantially free of contaminants is at least 95% pure; more preferably, at least 97% pure, and more preferably still at least 99% pure. Purity can be evaluated by chromatography, gel electrophoresis, immunoassay, composition analysis, biological assay, enzymatic assay and other methods known in fee art. In a specific embodiment, purified means feat fee level of contaminants is below a level acceptable to regulatory authorities for safe administration to a human or non-human animal. Recombinant proteins, such as rhGAA may be isolated or purified from CHO cells using methods known in fee art including by chromatographic size separation, affinity chromatography, or anionic exchange chromatography. In some embodiments, rhGAA is purified by a method comprising anionic exchange chromatography followed by immobilized metal affinity chromatography, optionally followed by purification using a third chromatography column.
[0069] As used herein, the term “alglucosidase alfa” is intended to refer to a recombinant human acid α-glucosidase identified as [199-arginine,223-histidine]prepro-α-glucosidase (human); Chemical Abstracts Registry Number 420794-05-0. Alglucosidase at fa is approved for marketing in the United States by Genzyme, as the products Lumizyme® and Myozyme®.
[0070] As used herein, the term “ATB200” is intended to refer to a recombinant human acid α-glucosidase described in International Application PCT/US2015/053252, the disclosure of which is herein incorporated by reference.
[0071] As used herein, the term “glycan” is intended to refer to a polysaccharide chain covalently bound to an amino acid residue on a protein or polypeptide. As used herein, the term “N-glycan” or “N-linked glycan” is intended to refer to a polysaccharide chain attached to an amino acid residue on a protein or polypeptide through covalent binding to a nitrogen atom of the amino acid residue. For example, an N-glycan can be covalently bound to the side chain nitrogen atom of an asparagine residue. Glycans may contain one or several monosaccharide units, and the monosaccharide units may be covalently linked to form a straight chain or a branched chain. In at least one embodiment, N-glycan units attached to a rhGAA may comprise one or more monosaccharide units each independently selected from N-acetylglucosamine, mannose, galactose, fucose, mannose-6-phosphate, or sialic acid. The N-glycan units on the protein may be determined by any appropriate analytical technique, such as mass spectrometry. In some embodiments, the N-glycan units attached to a rhGAA are determined by liquid chromatography-tandem mass spectrometry (LC-MS/MS) utilizing an instrument such as the Thermo Scientific™ Orbitrap Velos Pro™ Mass Spectrometer, Thermo Scientific™ Orbitrap Fusion™ Lumos Tribid™ Mass Spectrometer or Waters Xevo® G2-XS QTof Mass Spectrometer.
[0072] As used herein, the term “high-mannose N-glycan” is intended to refer to an N-glycan having one to six or more mannose units. In some embodiment, a high mannose N-glycan unit may contain a bis(N-acetylglucosamine) chain bonded to an asparagine residue and further bonded to a branched polymannose chain. As used herein interchangeably, the term “M6P” or “mannose-6-phosphate” is intended to refer to a mannose unit phosphorylated at the 6 position, i.e., having a phosphate group bonded to the hydroxyl group at the 6 position. In some embodiments, one or more mannose units of one or more N-glycan units are phosphorylated at the 6 position to form mannose-6-phosphate units. In some embodiment, the term “M6P” or “mannose-6-phosphate” refers to both a mannose phosphodiester having N-acetylglucosamine (GlcNAc) as a “cap” on the phosphate group, as well as a mannose unit having an exposed phosphate group lacking the GlcNAc cap. In at least one embodiment, the N-glycans of a protein may have multiple M6P groups, with at least one M6P group having a GlcNAc cap and at least one other M6P group lacking a GlcNAc cap.
[0073] As used herein, the term “complex N-glycan” is intended to refer to an N-glycan comprising types of saccharides other than GlcNac and mannose, for example, one or more galactose and/or sialic acid units. In at least one embodiment, a complex N-glycan can be a high-mannose N-glycan in which one or mannose units are further bonded to one or more monosaccharide units each independently selected from N-acetylglucosamine, galactose, and sialic acid. As used herein, a “hybrid N-glycan” is intended to refer to an N-glycan comprising at least one high-mannose branch and at least one complex branch. Representative structures for non-phosphorylated, mono-M6P. and bis-M6P N-glycans are shown in
[0074] As used herein, “normalization” of lysosomes in a muscle refers to the process of restoring the affected muscle to a lysosomal morphology of a wild-type muscle by reducing the size and number of its accumulated glycogen so that the affected muscle would substantially resemble the normal lysosomal morphology, ultimately leading to reverse disease progression.
[0075] As used herein, “reversal of disease progression” means, among other things, adequately (i) reducing or eliminating glycogen accumulation, (ii) reducing or eliminating lysosomal swelling and/or dysfunction, and (iii) reducing or eliminating the buildup of autophagic debris. Reversal of disease progression may manifest in an ambulatory ERT-experienced Pompe disease patient as two or more of the following “clinical improvements”: (a) an average increase in six-minute walk test distance of at least 20 meters, (b) an average improvement in maximum expiratory pressure of at least 16 cmH.sub.2O, and (c) an average decrease in fatigue severity scale score of at least 7. Reversal of disease progression may manifest in a nonambulatory ERT-experienced Pompe disease patient as two or more of the following “clinical improvements”: (a) an average improvement in shoulder adduction of at least 8 pounds of force, (b) an average improvement in elbow extension of at least 5 pounds of force, and (c) an average decrease in fatigue severity scale score of at least 3.5. Reversal of disease progression may manifest in an ERT-naive Pompe disease patient as two or more of the following “clinical improvements”: (a) an average increase in six-minute walk test distance of at least 40 meters, (b) an average improvement in upright (sitting) forced vital capacity of at least 4%, (c) an average improvement in maximum inspiratory pressure of at least 11 cmH.sub.2O, and (d) an average decrease in fatigue severity scale score of at least 5.
[0076] An advantage of the method of treatment disclosed herein compared to administration of alglucosidase alfa is that Pompe patients treated with the former exhibit prolonged clinical improvement. For example, improvements may be observed at two to three years from the administration of first treatment or beyond, including, for example, four, five, or six years from the administration of first treatment. In contrast, after two years of enzyme replacement therapy with the standard of care (e.g., alglucosidase alfa), Pompe disease patients either (i) maintain their gains from baseline prior to treatment, but exhibit no discernable improvement beyond the two or three-year mark or (ii) experience a gradual decline and lose any gains achieved through two or three years after treatment with the standard of care. Kuperus et al. 2017. Long-term benefit of enzyme replacement therapy in Pompe disease: A 5-year prospective study. Neurology. 89:2365-2373. In contrast, the rhGAA described herein clears lysosomal glycogen more efficiently than docs the standard of care and has been shown to elicit improvements in patients (e.g., “ERT-switch ambulatory,” Cohort 1 of Study ATB200-02) not expected to improve after taking an enzyme replacement therapy for at least two years. Clinical data to date using the rhGAA or pharmaceutical composition described herein is expected to deliver continued improvement in patient outcomes even after two-years post-treatment. Thus, in some embodiments, a patient treated with the rhGAA or pharmaceutical composition described herein continues to exhibit progress in one or more clinical improvements for more than two years after treatment (e.g., experiences further gains beyond the gain achieved by or at the two-year mark).
[0077] As used herein, “reversal of lysosomal pathology” means partial or complete clearance of glycogen that had accumulated in the cell due to lack of optimal GAA activity.
[0078] As used herein, forced vital capacity, or “FVC,” is the amount of air that can be forcibly exhaled from the lungs of a subject after the subject takes the deepest breath possible.
[0079] As used herein, a “six-minute walk test” (6MWT) is a test for measuring the distance an individual is able to walk over a total of six minutes on a hard, flat surface. The test is conducted by having the individual to walk as far as possible in six minutes.
[0080] As used herein, a “ten-meter walk test” (10MWT) is a test for measuring the time it takes an individual in walking shoes to walk ten meters on a flat surface.
[0081] As used herein, the compound miglustat, also known as N-butyl-1-deoxynojirimycin or NB-DNJ or (2R,3R,4R,5S)-1-butyl-2-(hydroxymethyl)piperidine-3,4,5-triol, is a compound having the following chemical formula:
##STR00001##
[0082] One formulation of miglustat is marketed commercially under the trade name Zavcsca® as monotherapy for type 1 Gaucher disease. In some embodiments, miglustat is referred to as AT2221.
[0083] As discussed below, pharmaceutically acceptable salts of miglustat may also be used in the present invention. When a salt of miglustat is used, the dosage of the salt will be adjusted so that the dose of miglustat received by the patient is equivalent to the amount which would have been received had the miglustat free base been used.
[0084] As used herein, the compound duvoglustat, also known as 1-dcoxynojirimycin or DNJ or (2R,3R,4R,5S)-2-(hydroxymethyl)piperidine-3,4,5-triol, is a compound having the following chemical formula:
##STR00002##
[0085] As used herein, the term “pharmacological chaperone” or sometimes simply the term “chaperone” is intended to refer to a molecule that specifically binds to acid α-glucosidase and has one or more of the following effects: [0086] enhances the formation of a stable molecular conformation of the protein; [0087] enhances proper trafficking of the protein from the endoplasmic reticulum to another cellular location, preferably a native cellular location, so as to prevent endoplasmic reticulum-associated degradation of the protein; [0088] prevents aggregation of conformationally unstable or misfolded proteins; [0089] restores and/or enhances at least partial wild-type function, stability, and/or activity of the protein; and/or [0090] improves the phenotype or function of the cell harboring acid α-glucosidase.
[0091] Thus, a pharmacological chaperone for acid α-glucosidase is a molecule that binds to acid α-glucosidase, resulting in proper folding, trafficking, non-aggregation, and activity of acid α-glucosidase. As used herein, this term includes but is not limited to active site-specific chaperones (ASSCs) which bind in the active site of the enzyme, inhibitors or antagonists, and agonists. In at least one embodiment, the pharmacological chaperone can be an inhibitor or antagonist of acid α-glucosidase. As used herein, the term “antagonist” is intended to refer to any molecule that binds to acid α-glucosidase and either partially or completely blocks, inhibits, reduces, or neutralizes an activity of acid α-glucosidase. In at least one embodiment, the pharmacological chaperone is miglustat. Another non-limiting example of a pharmacological chaperone for acid α-glucosidase is duvoglustat.
[0092] As used herein, the term “active site” is intended to refer to a region of a protein feat is associated with and necessary for a specific biological activity of fee protein. In at least one embodiment, the active site can be a site feat binds a substrate or other binding partner and contributes fee amino acid residues feat directly participate in the making and breaking of chemical bonds. Active sites in this invention can encompass catalytic sites of enzymes, antigen binding sites of antibodies, ligand binding domains of receptors, binding domains of regulators, or receptor binding domains of secreted proteins. The active sites can also encompass transactivation, protein-protein interaction, or DNA binding domains of transcription factors and regulators.
[0093] As used herein, the term “AUC” or “area under the curve” is intended to refer to a mathematical calculation to evaluate the body's total exposure over time to a given drug. In a graph plotting how concentration in the blood of a drug administered to a subject changes with time after dosing, the drug concentration variable lies on the y-axis and time lies on the x-axis. The area between the drug concentration curve and the x-axis for a designated time interval is the AUC. AUCs are used as a guide for dosing schedules and to compare the bioavailability of different drugs' availability in the body.
[0094] As used herein, the term “Cmax” is intended to refer to the maximum plasma concentration of a drug achieved after administration to a subject.
[0095] As used herein, the term “volume of distribution” or “V” is intended to refer to the theoretical volume that would be necessary to contain the total amount of an administered drug at the same concentration that it is observed in the blood plasma, and represents the degree to which a drug is distributed in body tissue rather than the plasma. Higher values of V indicate a greater degree of tissue distribution. “Central volume of distribution” or “Vc” is intended to refer to the volume of distribution within the blood and tissues highly perfused by blood. “Peripheral volume of distribution” or “V2” is intended to refer to the volume of distribution within the peripheral tissue.
[0096] As used interchangeably herein, the term “clearance,” “systemic clearance,” or “CL” is intended to refer to the volume of plasma that is completely cleared of an administered drug per unit time. “Peripheral clearance” is intended to refer to the volume of peripheral tissue that is cleared of an administered drug per unit time.
[0097] As used herein, the term “pharmaceutically acceptable” is intended to refer to molecular entities and compositions that are physiologically tolerable and do not typically produce untoward reactions when administered to a human. Preferably, as used herein, the term “pharmaceutically acceptable” means approved by a regulatory agency of the federal or a state government or listed in the U.S. Pharmacopeia or other generally recognized pharmacopeia for use in animals, and more particularly in humans. As used herein, the term “carrier” is intended to refer to a diluent, adjuvant, excipient, or vehicle with which a compound is administered. Suitable pharmaceutical carriers are known in the art and, in at least one embodiment, are described in “Remington's Pharmaceutical Sciences” by E. W. Martin, 18th Edition, or other editions.
[0098] The term “pharmaceutically acceptable salt” as used herein is intended to mean a salt which is, within the scope of sound medical judgment, suitable for use in contact with the tissues of humans and lower animals without undue toxicity, irritation, allergic response, and the like, commensurate with a reasonable benefit/risk ratio, generally water or oil-soluble or dispersible, and effective for their intended use. The term includes pharmaceutically-acceptable acid addition salts and pharmaceutically-acceptable base addition salts. Lists of suitable salts are found in, for example, S. M. Beige et al., J. Pharm. Sci., 1977, 66, pp. 1-19, herein incorporated by reference. The term “pharmaceutically-acceptable acid addition salt” as used herein is intended to mean those salts which retain the biological effectiveness and properties of the fee bases and which are not biologically or otherwise undesirable, formed with inorganic acids. The term “pharmaceutically-acceptable base addition salt” as used herein is intended to mean those salts which retain the biological effectiveness and properties of the free acids and which are not biologically or otherwise undesirable, formed with inorganic bases.
[0099] As used herein, the term “buffer” refers to a solution containing a weak acid and its conjugate base that helps to prevent changes in pH.
[0100] As used herein, the terms “therapeutically effective dose” and “effective amount” are intended to refer to an amount of acid α-glucosidase and/or of miglustat and/or of a combination thereof, which is sufficient to result in a therapeutic response in a subject. A therapeutic response may be any response that a user (for example, a clinician) will recognize as an effective response to the therapy, including any surrogate clinical markers or symptoms described herein and known in the art. Thus, in at least one embodiment, a therapeutic response can be an amelioration or inhibition of one or more symptoms or markers of Pompe disease such as those known in the art. Symptoms or markers of Pompe disease include but are not limited to decreased acid α-glucosidase tissue activity: cardiomyopathy; cardiomegaly; progressive muscle weakness, especially in the trunk or lower limbs; profound hypotonia: macroglossia (and in some cases, protrusion of the tongue): difficulty swallowing, sucking, and/or feeding: respiratory insufficiency: hepatomegaly (moderate); laxity of facial muscles; areflexia; exercise intolerance: exertional dyspnea: orthopnea: sleep apnea; morning headaches; somnolence; lordosis and/or scoliosis; decreased deep tendon reflexes; lower back pain; and failure to meet developmental motor milestones. It should be noted that a concentration of miglustat that has an inhibitory effect on acid α-glucosidase may constitute an “effective amount” for purposes of this invention because of dilution (and consequent shift in binding due to the change in equilibrium and pH), bioavailability, and metabolism of miglustat upon administration in vivo.
[0101] The therapeutic response may also include molecular responses such as glycogen accumulation, lysosomal proliferation, and formation of autophagic zones. The therapeutic responses may be evaluated by comparing physiological and molecular responses of muscle biopsies before and after treatment with a rhGAA described herein. For instance, the amount of glycogen present in the biopsy samples can be used as a marker for determining the therapeutic response. Another example includes biomarkers such as LAMP-1, LC3, and Dysferlin, which can be used as an indicator of lysosomal storage dysfunction. For instance, muscle biopsies collected prior to and after treatment with a rhGAA described herein may be stained with an antibody that recognizes one of the biomarkers.
[0102] As used herein, the term “enzyme replacement therapy” or “ERT” is intended to refer to the introduction of a non-native, purified enzyme into an individual having a deficiency in such enzyme. The administered protein can be obtained from natural sources or by recombinant expression. The term also refers to the introduction of a purified enzyme in an individual otherwise requiring or benefiting from administration of a purified enzyme. In at least one embodiment, such an individual suffers from enzyme insufficiency. The introduced enzyme may be a purified, recombinant enzyme produced in vitro, or a protein purified from isolated tissue or fluid, such as, for example, placenta or animal milk, or from plants.
[0103] As used herein, the term “combination therapy” is intended to refer to any therapy wherein two or more individual therapies are administered concurrently or sequentially. In some embodiment, the results of the combination therapy are enhanced as compared to the effect of each therapy when it is performed individually. Enhancement may include any improvement of the effect of the various therapies that may result in an advantageous result as compared to the results achieved by the therapies when performed alone. Enhanced effect or results can include a synergistic enhancement, wherein the enhanced effect is more than the additive effects of each therapy when performed by itself; an additive enhancement, wherein the enhanced effect is substantially equal to the additive effect of each therapy when performed by itself; or less than additive effect, wherein the enhanced effect is lower than the additive effect of each therapy when performed by itself, but still better than the effect of each therapy when performed by itself. Enhanced effect may be measured by any means known in the art by which treatment efficacy or outcome can be measured.
[0104] The term “concurrently” as used herein is intended to mean at the same time as or within a reasonably short period of time before or after, as will be understood by those skilled in the art. For example, if two treatments are administered concurrently with each other, one treatment can be administered before or after the other treatment, to allow for time needed to prepare for the later of the two treatments. Therefore “concurrent administration” of two treatments includes but is not limited to one treatment following the other by about 30 minutes or less, about 30 minutes, 20 minutes or less, about 20 minutes, about 15 minutes, about 10 minutes, about 9 minutes, about 8 minutes, about 7 minutes, about 6 minutes about 5 minutes, about 4 minutes, about 3 minutes, about 2 minutes, about 1 minute, or less than 1 minute.
[0105] “Pompe Disease” refers to an autosomal recessive LSD characterized by deficient acid alpha glucosidase (GAA) activity which impairs lysosomal glycogen metabolism. The enzyme deficiency leads to lysosomal glycogen accumulation and results in progressive skeletal muscle weakness, reduced cardiac function, respiratory insufficiency, and/or CNS impairment at late stages of disease. Genetic mutations in the GAA gene result in either lower expression or produce mutant forms of the enzyme with altered stability, and/or biological activity ultimately leading to disease, (see generally Hirschhorn R, 1995, Glycogen Storage Disease Type II: Acid a-Glucosidase (Acid Maltase) Deficiency, The Metabolic and Molecular Bases of Inherited Disease, Scriver et al., eds., McGraw-Hill, New York, 7th ed., pages 2443-2464). The three recognized clinical forms of Pompe Disease (infantile, juvenile and adult) are correlated with the level of residual α-glucosidase activity (Reuser A J et al., 1995, Glycogenosis Type 11 (Acid Maltase Deficiency), Muscle & Nerve Supplement 3, S61-S69). Infantile Pompe disease (type I or A) is most common and most severe, characterized by failure to thrive, generalized hypotonic, cardiac hypertrophy, and cardiorespiratory failure within the second year of life. Juvenile Pompe disease (type II or B) is intermediate in severity and is characterized by a predominance of muscular symptoms without cardiomegaly. Juvenile Pompe individuals usually the before reaching 20 years of age due to respiratory failure. Adult Pompe disease (type III or C) often presents as a slowly progressive myopathy in the teenage years or as late as the sixth decade (Felicia K J et al., 1995, Clinical Variability in Adult-Onset Acid Maltase Deficiency: Report of Affected Sibs and Review of the Literature, Medicine 74, 131-135). In Pompe, it has been shown that α-glucosidase is extensively modified post-translationally by glycosylation, phosphorylation, and proteolytic processing. Conversion of the 110 kilodalton (kDa) precursor to 76 and 70 KDa mature forms by proteolysis in the lysosome is required for optimum glycogen catalysis. As used herein, the term “Pompe Disease” refers to all types of Pompe Disease. The formulations and dosing regimens disclosed in this application may be used to treat, for example, Type I, Type II or Type III Pompe Disease.
[0106] A “subject” or “patient” is preferably a human, though other mammals and non-human animals having disorders involving accumulation of glycogen may also be treated. A subject may be a fetus, a neonate, child, juvenile, or an adult with Pompe disease or other glycogen storage or accumulation disorder. One example of an individual being treated is an individual (fetus, neonate, child, juvenile, adolescent, or adult human) having GSD-II (e.g., infantile GSD-II, juvenile GSD-II, or adult-onset GSD-II). The individual can have residual GAA activity, or no measurable activity. For example, the individual having GSD-11 can have GAA activity that is less than about 1% of normal GAA activity (infantile GSD-II), GAA activity that is about 1-10% of normal GAA activity (juvenile GSD-II), or GAA activity that is about 10-40% of normal GAA activity (adult GSD-II). In some embodiments, the subject or patient is an “ERT-experienced” or “ERT-switch” patient, referring to a Pompe disease patient who has previously received enzyme replacement therapy. In some embodiments, the subject or patient is an “ERT-naïve” patient, referring to a Pompe disease patient who has not previously received enzyme replacement therapy. In certain embodiments, the subject or patient is ambulatory (e.g., an ambulatory ERT-switch patient or an ambulatory ERT-naïve patient). In certain embodiments, the subject or patient is nonambulalory (e.g., a nonambulatory ERT-switch patient). Ambulatory or nonambulatory status may be determined by a six-minute walk test (6MWT). In some embodiments, an ambulatory patient is a Pompe disease patient who is able to walk at least 200 meters in the 6MWT. In some embodiments, a nonambulatory patient is a Pompe disease patient who is unable to walk unassisted or who is wheelchair bound.
[0107] The terms, “treat” and “treatment,” as used herein, refer to amelioration of one or more symptoms associated with the disease, prevention or delay of the onset of one or more symptoms of the disease, and/or lessening of the severity or frequency of one or more symptoms of the disease. For example, treatment can refer to improvement of cardiac status (e.g. increase of end-diastolic and/or end-systolic volumes, or reduction, amelioration or prevention of the progressive cardiomyopathy that is typically found in GSD-II) or of pulmonary function (e.g., increase in crying vital capacity over baseline capacity, and/or normalization of oxygen desaturation during crying): improvement in neurodevelopment and/or motor skills (e.g., increase in AIMS score); reduction of glycogen levels in tissue of the individual affected by the disease; or any combination of these effects. In one preferred embodiment, treatment includes improvement of cardiac status, particularly in reduction or prevention of GSD-II-associated cardiomyopathy.
[0108] The terms, “improve,” “increase,” and “reduce,” as used herein, indicate values that are relative to a baseline measurement, such as a measurement in the same individual prior to initiation of the treatment described herein, or a measurement in a control individual (or multiple control individuals) in the absence of the treatment described herein. A control individual is an individual afflicted with the same form of GSD-II (either infantile, juvenile, or adult-onset) as the individual being treated, who is about the same age as the individual being treated (to ensure that the stages of the disease in the treated individual and the control individual(s) are comparable).
[0109] As used herein, the terms “about” and “approximately” are intended to refer to an acceptable degree of error for the quantity measured given the nature or precision of the measurements. For example, the degree of error can be indicated by the number of significant figures provided for the measurement, as is understood in the art, and includes but is not limited to a variation of ±1 in the most precise significant figure reported for the measurement. Typical exemplary degrees of error are within 20 percent (%), preferably within 10%, and more preferably within 5% of a given value or range of values. Numerical quantities given herein are approximate unless stated otherwise, meaning that the term “about” or “approximately” can be inferred when not expressly stated.
II. Recombinant Human Acid α-Glucosidase (rhGAA)
[0110] In some embodiments, the recombinant human acid α-glucosidase (rhGAA) is an enzymic having an amino acid sequence as set forth in SEQ ID NO; 1, SEQ ID NO: 3, SEQ ID NO; 4, or SEQ ID NO: 5. In some embodiments, the rhGAA is encoded by a nucleotide sequence as set forth in SEQ ID NO: 2
TABLE-US-00001 Table 1 Nucleotide Sequences and Protein Sequences SEQ ID NO: Sequences 1 MGVRHPPCSHRLLAVCALVS LATAALLGHILLHDFLLVPR ELSGSSPVLEETHPAHQQGA SRPGPRDAQAHPGRPRAVPT QCDVPPNSRFDCAPDKAITQ EQCEARGCCYIPAKQGLQGA QMGQPWCFFPPSYPSYKLEN LSSSEMGYTATLTRTTPTFF PKDILTLRLDVMMETENRLH FTIKDPANRRYEVPLETPRV HSRAPSPLYSVEFSEEPFGV IVHRQLDGRVLLNTTVAPLF FADQFLQLSTSLPSQYITGL AEHLSPLMLSTSWTRITLWN RDLAPTPGANLYGSHPFYLA LEDGGSAHGVFLLNSNAMDV VLQPSPALSWRSTGGILDVY IFLGPEPKSVVQQYLDVVGY PFMPPYWGLGFHLCRWGYSS TAITRQVVENMTRAHFPLDV QWNDLDYMDSRRDFTFNKDG FRDFPAMVQELHQGGRRYMM IVDPAISSSGPAGSYRPYDE GLRRGVFITNETGQPLIGKV WPGSTAFPDFTNPTALAWWE DMVAEFHDQVPFDGMWIDMN EPSNFIRGSEDGCPNNELEN PPYVPGVVGGTLQAATICAS SHQFLSTHYNLHNLYGLTEA IASHRALVKARGTRPFVISR STFAGHGRYAGHWTGDVWSS WEQLASSVPEILQFNLLGVP LVGADVCGFLGNTSEELCVR WTQLGAFYPFMRNHNSLLSL PQEPYSFSEPAQQAMRKALT LRYALLPHLYTLFHQAHVAG ETVARPLFLEFPKDSSTWTV DHQLLWGEALLITPVLQAGK AEVTGYFPLGTWYDLQTVPI EALGSLPPPPAAPREPAIHS EGQWVTLPAPLDTINVHLRA GYIIPLQGPGLTTTESRQQP MALAVALTKGGEARGELFWD DGESLEVLERGAYTQVIFLA RNNTIVNELVRVTSEGAGLQ LQKVTVLGVATAPQQVLSNG VPVSNFTYSPDTKVLDICVS LLMGEQFLVSWC 2 cagttgggaaagctgaggtt gtcgccggggccgcgggtgg aggtcggggatgaggcagca ggtaggacagtgacctcggt gacgcgaaggaccccggcca cctctaggttctcctcgtcc gcccgttgttcagcgaggga ggctctgggcctgccgcagc tgacggggaaactgaggcac ggagcgggcctgtaggagct gtccaggccatctccaacca tgggagtgaggcacccgccc tgctcccaccggctcctggc cgtctgcgccctcgtgtcct tggcaaccgctgcactcctg gggcacatcctactccatga tttcctgctggttccccgag agctgagtggctcctcccca gtcctggaggagactcaccc agctcaccagcagggagcca gcagaccagggccccgggat gcccaggcacaccccggccg tcccagagcagtgcccacac agtgcgacgtcccccccaac agccgcttcgattgcgcccc tgacaaggccatcacccagg aacagtgcgaggcccgcggc tgctgctacatccctgcaaa gcaggggctgcagggagccc agatggggcagccctggtgc ttcttcccacccagctaccc cagctacaagctggagaacc tgagctcctctgaaatgggc tacacggccaccctgacccg taccacccccaccttcttcc ccaaggacatcctgaccctg cggctggacgtgatgatgga gactgagaaccgcctccact tcacgatcaaagatccagct aacaggcgctacgaggtgcc cttggagaccccgcgtgtcc acagccgggcaccgtcccca ctctacagcgtggagttctc cgaggagcccttcggggtga tcgtgcaccggcagctggac ggccgcgtgctgctgaacac gacggtggcgcccctgttct ttgcggaccagttccttcag ctgtccacctcgctgccctc gcagtatatcacaggcctcg ccgagcacctcagtcccctg atgctcagcaccagctggac caggatcaccctgtggaacc gggaccttgcgcccacgccc ggtgcgaacctctacgggtc tcaccctttctacctggcgc tggaggacggcgggtcggca cacggggtgttcctgctaaa cagcaatgccatggatgtgg tcctgcagccgagccctgcc cttagctggaggtcgacagg tgggatcctggatgtctaca tcttcctgggcccagagccc aagagcgtggtgcagcagta cctggacgttgtgggatacc cgttcatgccgccatactgg ggcctgggcttccacctgtg ccgctggggctactcctcca ccgctatcacccgccaggtg gtggagaacatgaccagggc ccacttccccctggacgtcc aatggaacgacctggactac atggactcccggagggactt cacgttcaacaaggatggct tccgggacttcccggccatg gtgcaggagctgcaccaggg cggccggcgctacatgatga tegtggatcctgccatcagc agctcgggcectgccgggag etacaggccctacgacgagg gtctgcggaggggggttttc atcaccaacgagaceggcca gecgctgattgggaaggtat ggcccgggtccactgccttc cccgacttcaccaaccccac agccctggcctggtgggagg acatggtggctgagttccat gaccaggtgcccttcgacgg catgtggattgacatgaacg agccttccaacttcatcaga ggctctgaggacggctgccc caacaatgagctggagaacc caccctacgtgcctggggtg gttggggggaccctccaggc ggccaccatctgtgcctcca gccaccagtttctctcxaca cactacaacctgcacaacct ctacggcctgaccgaagcca tcgcctcccacagggcgctg gtgaaggctcgggggacacg cccatttgtgatctcccgct cgacctttgctggccacggc cgatacgccggccactggac gggggacgtgtggagctcct gggagcagctcgcctcctcc gtgccagaaatectgcagtt taacctgctgggggtgcctc tggtcggggccgacgtctgc ggcttcctgggcaaeacetc agaggagctgtgtgtgcgct ggacccagctgggggccttc taccccttcatgcggaacca caacagcctgctcagtctgc cccaggagccgtacagcttc agcgagccggcccagcaggc catgaggaaggccctcaccc tgcgctacgcaetcctcccc cacetctacacactgttcca ccaggcccacgtcgcggggg agaccgtggcccggcccctc ttcctggagttccccaagga ctctagcacctggactgtgg accaccagctcctgtggggg gaggccctgctcatcacccc agtgctccaggccgggaagg ccgaagtgactggctacttc cccttgggcacatggtacga cctgcagacggtgccaatag aggcccttggcagcctccca cccccacctgcagctccccg tgagccagccatccacagcg aggggcagtgggtgacgctg ccggcccccctggacaccat caacgtccacctccgggctg ggtacatcatccccctgcag ggccctggcctcacaaccac agagtcccgccagcagccca tggccctggctgtggccctg accaagggtggagaggcccg aggggagctgttctgggacg atggagagagcctggaagtg ctggagcgaggggcctacac acaggtcatcttcctggcca ggaataacacgatcgtgaat gagctggtacgtgtgaccag tgagggagctggcctgcagc tgcagaaggtgactgtcctg ggcgtggccacggcgcccca gcaggtcctctccaacggtg tccctgtctccaacttcacc tacagccccgacaccaaggt cctggacatctgtgtctcgc tgttgatgggagagcagttt ctcgtcagctggtgttagcc gggcggagtgtgttagtctc tccagagggaggctggttcc ccagggaagcagagcctgtg tgcgggcagcagctgtgtgc gggcctgggggttgcatgtg tcacctggagctgggcacta accattccaagccgccgcat cgcttgtttccacctcctgg gccggggctctggcccccaa cgtgtctaggagagctttct ccctagatcgcactgtgggc cggggcctggagggctgctc tgtgttaataagattgtaag gtttgccctcctcacctgtt gccggcatgcgggtagtatt agccacccccctccatctgt tcccagcaccggagaagggg gtgctcaggtggaggtgtgg ggtatgcacctgagctcctg cttcgcgcctgctgctctgc cccaacgcgaccgcttcccg gctgcccagagggctggatg cctgccggtccccgagcaag cctgggaactcaggaaaatt cacaggacttgggagattct aaatcttaagtgcaattatt ttaataaaaggggcatttgg aatc 3 MGVRHPPCSHRLLAVCALVS LATAALLGHILLHDFLLVPR ELSGSSPVLEETHPAHQQGA SRPGPRDAQAHPGRPRAVPT QCDVPPNSRFDCAPDKAITQ EQCEARGCCYTPAKQGLQGA QMGQPWCFFPPSYPSYKLEN LSSSEMGYTATLTRTTPTFF PKDILTLRLDVMMETENRLH FTIKDPANRRYEVPLETPRV HSRAPSPLYSVEFSEEPFGV IVHRQLDGRVLLNTTVAPLF FADQFLQLSTSLPSQYITGL AEHLSPLMLSTSWTRITLWN RDLAPTPGANLYGSHPFYLA LEDGGSAHGVFLLNSNAMDV VLQPSPALSWRSTGGILDVY IFLGPEPKSVVQQYLDVVGY PFMPPYWGLGFHLCRWGYSS TAITRQVVENMTRAHFPLDV QWNDLDYMDSRRDFTFNKDG FRDFPAMVQELHQGGRRYMM IVDPAISSSGPAGSYRPYDE GLRRGVFITNETGQPLIGKV WPGSTAFPDFTNPTALAWWE DMVAEFHDQVPFDGMWIDMN EPSNFIRGSEDGCPNNELEN PPYVPGVVGGTLQAATICAS SHQFLSTHYNLHNLYGLTEA IASHRALVKARGTRPFVISR STFAGHGRYAGHWTGDVWSS WEQLASSVPEILQFNLLGVP LVGADVCGFLGNTSEELCVR WTQLGAFYPFMRNHNSLLSL PQEPYSFSEPAQQAMRKALT LRYALLPHLYTLFHQAHVAG ETVARPLFLEFPKDSSTWTV DHQLLWGEALLITPVLQAGK AEVTGYFPLGTWYDLQTVPI EALGSLPPPPAAPREPAIHS EGQWVTLPAPLDTINVHLRA GYIIPLQGPGLTTTESRQQP MALAVALTKGGEARGELFWD DGESLEVLERGAYTQVIFLA RNNTIVNELVRVTSEGAGLQ LQKVTVLGVATAPQQVLSNG VPVSNFTYSPDTKVLDICVS LLMGEQFLVSWC 4 MGVRHPPCSHRLLAVCALVS LATAALLGHILLHDFLLVPR ELSGSSPVLEETHPAHQQGA SRPGPRDAQAHPGRPRAVPT QCDVPPNSRFDCAPDKAITQ EQCEARGCCYIPAKQGLQGA QMGQPWCFFPPSYPSYKLEN LSSSEMGYTATLTRTTPTFF PKDILTLRLDVMMETENRLH FTIKDPANRRYEVPLETPHV HSRAPSPLYSVEFSEEPFGV IVRRQLDGRVLGNTTVAPLF FADQFLQLSTSLPSQYITGL AEHLSPLMLSTSWTRITLWN RDLAPTPGANLYGSHPFYLA LEDGGSAHGVFLLNSNAMDV VLQPSPALSWRSTGGILDVY IFLGPEPKSVVQQYLDVVGY PFMPPYWGLGFHLCRWGYSS TAITRQVVENMTRAHFPLDV QWNDLDYMDSRRDFTFNKDG FRDFPAMVQELHQGGRRYMM IVDPAISSSGPAGSYRPYDE GLRRGVFITNETGQPLIGKV WPGSTAFPDFTNPTALAWWE DMVAEFHDQVPFDGMWIDMN EPSNFIRGSEDGCPNNELEN PPYVPGVVGGTLQAATICAS SHQFLSTHYNLHNLYGLTEA IASHRALVKARGTRPFVISR STFAGHGRYAGHWTGDVWSS WEQLASSVPEILQFNLLGVP LVGADVCGFLGNTSEELCVR WTQLGAFYPFMRNHNSLLSL PQEPYSFSEPAQQAMRKALT LRYALLPHLYTLFHQAHVAG ETVARPLFLEFPKDSSTWTV DHQLLWGEALLITPVLQAGK AEVTGYFPLGTWYDLQTVPV EALGSLPPPPAAPREPAIHS EGQWVTLPAPLDTINVHLRA GYIIPLQGPGLTTTESRQQP MALAVALTKGGEARGELFWD DGESLEVLERGAYTQVIFLA RNNTIVNELVRVTSEGAGLQ LQKVTVLGVATAPQQVLSNG VPVSNFTYSPDTKVLDICVS LLMGEQFLVSWC 5 QQGASRPGPRDAQAHPGRPR AVPTQCDVPPNSRFDCAPDK AITQEQCEARGCCYIPAKQG LQGAQMGQPWCFFPPSYPSY KLENLSSSEMGYTATLTRTT PTFFPKDILTLRLDVMMETE NRLHFTIKDPANRRYEVPLE TPRVHSRAPSPLYSVEFSEE PFGVIVHRQLDGRVLLNTVV APLFFADQFLQLSTSLPSQY ITGLAEHLSPLMLSTSWTRI TLWNRDLAPTPGANLYGSHP FYLALEDGGSAHGVFLLNSN AMDVVLQPSPALSWRSTGGI LDVYTFLGPEPKSVVQQYLD VVGYPFMPPYWGLGFHLCRW GYSSTAITRQVVENMTRAHF PLDVQWNDLDYMDSRRDFTF NKDGFRDFPAMVQELHQGGR RYMMIVDPAISSSGPAGSYR PYDEGLRRGVFITNETGQPL IGKVWPGSTAFPDFTNPTAL AWWEDMVAEFHDQVPFDGMW IDMNEPSNFIRGSEDGCPNN ELENPPYVPGVVGGTLQAAT ICASSHQFLSTHYNLHNLYG LTEAIASHRALVKARGTRPF VISRSTFAGHGRYAGHWTGD VWSSWEQLASSVPETLQFNL LGVPLVGADVCGFLGNTSEE LCVRWTQLGAFYPFMRNHNS LLSLPQEPYSFSEPAQQAMR KALTERYALLPHLYTLFHQA HVAGETVARPLFLEFPKDSS TWTVDHQLLWGEALLITPVL QAGKAEVTGYFPLGTWYDLQ TVPIEALGSLPPPPAAPREP ATHSEGQWVTLPAPLDTINV HLRAGYIIPLQGPGLTTTES RQQPMALAVALTKGGEARGE LFWDDGESLEVLERGAYTQV IFLARNNTIVNELVRVTSEG AGLQLQKVTVLGVATAPQQV LSNGVPVSNFTYSPDTKVLD ICVSLLMGEQFLVSWC
[0111] In some embodiments, the rhGAA has a wild-type GAA amino acid sequence as set forth in SEQ ID NO: 1, as described in U.S. Pat. No. 8,592,362 and has GenBank accession number AHE24104.1 (GI:568760974). In some embodiments, the rhGAA has a wild-type GAA amino acid sequence as encoded in SEQ ID NO: 2, the mRNA sequence having GenBank accession number Y00839.1. In some embodiments, the rhGAA has a wild-type GAA amino acid sequence as set forth in SEQ ID NO: 3. In at some embodiments, the rhGAA has a GAA amino acid sequence as set forth in SEQ ID NO: 4, and has National Center for Biotechnology Information (NCBI) accession number NP 000143.2. In some embodiments, the rhGAA is alglucosidase alfa, the human acid α-glucosidase enzyme encoded by the most predominant of nine observed haplotypes of the GAA gene.
[0112] In some embodiments, the rhGAA is initially expressed as having the full-length 952 amino acid sequence of wild-type GAA as set forth in SEQ ID NO: 1, and the rhGAA undergoes intracellular processing that removes a portion of the amino acids, e.g. the first 56 amino acids. Accordingly, the rhGAA that is secreted by the host cell can have a shorter amino acid sequence than the rhGAA that is initially expressed within the cell. In one embodiment, the shorter protein has the amino acid sequence set forth in SEQ ID NO: 5, which only differs from SEQ ID NO: 1 in that the first 56 amino acids comprising the signal peptide and precursor peptide have been removed, thus resulting in a protein having 896 amino acids. Other variations in the number of amino acids are also possible, such as having 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or more deletions, substitutions and/or insertions relative to the amino acid sequence described by SEQ ID NO: 1 or SEQ ID NO: 5. In some embodiments, the rhGAA product includes a mixture of recombinant human acid α-glucosidase molecules having different amino acid lengths.
[0113] In some embodiments, the rhGAA comprises an amino acid sequence that is at least 90%, 95%, 98% or 99% identical to SEQ ID NO: 1 or SEQ ID NO: 5. Various alignment algorithms and/or programs may be used to calculate the identity between two sequences, including FASTA, or BLAST which are available as a part of the GCG sequence analysis package (University of Wisconsin, Madison. Wis.), and can be used with, e.g., default setting. For example, polypeptides having at least 90%, 95%, 98% or 99% identity to specific polypeptides described herein and preferably exhibiting substantially the same functions, as well as polynucleotide encoding such polypeptides, are contemplated. Unless otherwise indicated a similarity score will be based on use of BLOSUM62. When BLASTP is used, the percent similarity is based on the BLASTP positives score and the percent sequence identity is based on the BLASTP identities score. BLASTP “Identities” shows the number and fraction of total residues in the high scoring sequence pairs which are identical: and BLASTP “Positives” shows the number and fraction of residues for which the alignment scores have positive values and which are similar to each other. Amino acid sequences having these degrees of identity or similarity or any intermediate degree of identity of similarity to the amino acid sequences disclosed herein are contemplated and encompassed by this disclosure. The polynucleotide sequences of similar polypeptides are deduced using the genetic code and may be obtained by conventional means, in particular by reverse translating its amino acid sequence using the genetic code.
[0114] In some embodiments, the rhGAA undergoes post-translational and/or chemical modifications at one or more amino acid residues in the protein. For example, methionine and tryptophan residues can undergo oxidation. As another example, the N-terminal glutamine can form pyro-glutamate. As another example, asparagine residues can undergo deamidation to aspartic acid. As yet another example, aspartic acid residues can undergo isomerization to iso-aspartic acid. As yet another example, unpaired cysteine residues in the protein can form disulfide bonds with free glutathione and/or cysteine. Accordingly, in some embodiments, the enzyme is initially expressed as having an amino acid sequence as set forth in SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 4, or SEQ ID NO: 5, or an amino acid sequence encoded by SEQ ID NO: 2 and the enzyme undergoes one or more of these post-translational and/or chemical modifications. Such modifications are also within the scope of the present disclosure.
III. N-Linked Glycosylation of rhGAA
[0115] There are seven potential N-linked glycosylation sites on a single rhGAA molecule. These potential glycosylation sites are at the following positions of SEQ ID NO: 5: N84, N177, N334, N414, N596, N826, and N869. Similarly, for the full-length amino acid sequence of SEQ ID NO: 1, these potential glycosylation sites are at the following positions: N140, N233, N390, N470, N652, N882, and N925. Other variants of rhGAA can have similar glycosylation sites, depending on the location of asparagine residues. Generally, sequences of Asn-X-Ser or Asn-X-Thr in the protein amino acid sequence indicate potential glycosylation sites, with the exception that X cannot be His or Pro.
[0116] The rhGAA molecules described herein may have, on average, 1, 2, 3, or 4 mannose-6-phosphate (M6P) groups on their N-glycans. For example, only one N-glycan on a rhGAA molecule may bear M6P (mono-phosphorylated or mono-M6P), a single N-glycan may bear two M6P groups (bis-phosphorylated or bis-M6P), or two different N-glycans on the same rhGAA molecule may each bear single M6P groups. In some embodiments, the rhGAA molecules described herein on average have 3-4 M6P groups on their N-glycans. Recombinant human acid α-glucosidase molecules may also have N-glycans bearing no M6P groups. In another embodiment, on average the rhGAA comprises greater than 2.5 mol M6P per mol rhGAA and greater than 4 mol sialic acid per mol rhGAA. In some embodiments, on average the rhGAA comprises about 3-3.5 mol M6P per mol rhGAA. In some embodiments, on average the rhGAA comprises about 4-5.4 mol sialic acid per mol rhGAA. On average at least about 3, 4, 5, 6, 7, 8, 9, 10%, or 20% of the total N-glycans on the rhGAA may be in the form of a mono-M6P N-glycan, for example, about 6.25% of the total N-glycans may carry a single M6P group and on average, at least about 0.5, 1, 1.5, 2.0, 2.5, 3.0% of the total N-glycans on the rhGAA are in the form of a bis-M6P N-glycan and on average less than 25% of total rhGAA contains no phosphorylated N-glycan binding to CIMPR. In some embodiments, on average about 10% to about 14% of the total N-glycans on the rhGAA are mono-phosphorylated. In some embodiments, on average about 7% to about 25% of the total N-glycans on the rhGAA are bis-phosphorylated. In some embodiments, on average the rhGAA comprises about 1.3 mol bis-M6P per mol rhGAA.
[0117] The rhGAA described herein may have an average content of N-glycans carrying M6P ranging from 0.5 to 7.0 mol M6P per mol rhGAA or any intermediate value or subrange thereof including 0.5, 1.0, 1.5, 2.0, 2.5, 3.0, 3.5, 4.0, 4.5, 5.0, 5.5, 6.0, 6.5, or 7.0 mol M6P per mol rhGAA. The rhGAA can be fractionated to provide rhGAA preparations with different average numbers of mono-M6P-bearing or bis-M6P-bearing N-glycans, thus permitting further customization of rhGAA targeting to the lysosomes in target tissues by selecting a particular fraction or by selectively-combining different fractions.
[0118] In some embodiments, up to 60% of the N-glycans on the rhGAA may be fully sialylated, for example, up to 10%, 20%, 30%, 40%, 50% or 60% of the N-glycans may be fully sialylated. In some embodiments, no more than 50% of the N-glycans on the rhGAA are fully sialylated. In some embodiments, from 4% to 20% of the total N-glycans are fully sialylated. In other embodiments, no more than 5%, 10%, 20% or 30% of N-glycans on the rhGAA carry sialic acid and a terminal galactose residue (Gal). This range includes all intermediate values and subranges, for example, 7% to 30% of the total N-glycans on the rhGAA can carry sialic acid and terminal galactose. In yet other embodiments, no more than 5%, 10%, 15%, 16%, 17%, 18%, 19%, or 20% of the N-glycans on the rhGAA have a terminal galactose only and do not contain sialic acid. This range includes all intermediate values and subranges, for example, from 8% to 19% of the total N-glycans on the rhGAA in the composition may have terminal galactose only and do not contain sialic acid.
[0119] In some embodiments, 40% 45%, 50%, or 55% to 60% of the total N-glycans on the rhGAA are complex type N-glycans; or no more than 1%, 2%, 3%, 4%, 5% 6,%, or 7% of total N-glycans on the rhGAA are hybrid-type N-glycans; no more than 5%, 10%, 15%, 20%, or 25% of the high mannose-type N-glycans on the rhGAA are non-phosphorylated; at least 5% or 10% of the high mannose-type N-glycans on the rhGAA are mono-phosphorylated; and/or at least 1% or 2% of the high mannose-type N-glycans on the rhGAA are bis-phosphorylated. These values include all intermediate values and subranges. A rhGAA may meet one or more of the content ranges described above.
[0120] In some embodiments, the rhGAA may bear, on average, 2.0 to 8.0 moles of sialic acid residues per mole of rhGAA. This range includes all intermediate values and subranges thereof, including 2.0, 2.5, 3.0, 3.5, 4.0, 4.5, 5.0, 5.5, 6.0, 6.5, 7.0, 7.5, and 8.0 mol sialic acid residues per mol rhGAA. Without being bound by theory, it is believed that the presence of N-glycan units bearing sialic acid residues may prevent non-productive clearance of the rhGAA by asialoglycoprotein receptors.
[0121] In one or more embodiments, the rhGAA has a certain N-glycosylation profile at certain potential N-glycosylation sites. In some embodiments, the rhGAA has seven potential N-glycosylation sites. In some embodiments, at least 20% of the rhGAA is phosphorylated at the first potential N-glycosylation site (e.g., N84 for SEQ ID NO: 5 and N140 for SEQ ID NO: 1). For example, at least 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95% of the rhGAA can be phosphorylated at the first potential N-glycosylation site. This phosphorylation can be the result of mono-M6P and/or bis-M6P units. In some embodiments, at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95% of the rhGAA bears a mono-M6P unit at the first potential N-glycosylation site. In some embodiments, at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95% of the rhGAA bears a bis-M6P unit at the first potential N-glycosylation site. In some embodiments, the rhGAA comprises on average about 1.4 mol M6P (mono-M6P and bis-M6P) per mol rhGAA at the first potential N-glycosylation site. In some embodiments, the rhGAA comprises on average about at least 0.5 mol bis-M6P per mol rhGAA at the first potential N-glycosylation site. In some embodiments, the rhGAA comprises on average about 0.25 mol mono-M6P per mol rhGAA at the first potential N-glycosylation site. In some embodiments, the rhGAA comprises on average about 0.2 mol to about 0.3 mol sialic acid per mol rhGAA at the first potential N-glycosylation site. In at least one embodiment, the rhGAA comprises a first potential N-glycosylation site occupancy as depicted in
[0122] In some embodiments, at least 20% of the rhGAA is phosphorylated at the second potential N-glycosylation site (e.g., N177 for SEQ ID NO: 5 and N223 for SEQ ID NO: 1). For example, at least 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95% of the rhGAA can be phosphorylated at the second N-glycosylation site. This phosphorylation can be the result of mono-M6P and/or bis-M6P units. In some embodiments, at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65% 70% 75%, 80%, 85% 90% or 95% of the rhGAA bears a mono-M6P unit at the second N-glycosylation site. In some embodiments, at least 10% 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50% 55% 60%, 65% 70% 75%, 80% 85%, 90%, or 95% of the rhGAA bears a bis-M6P unit at the second N-glycosylation site. In some embodiments, the rhGAA comprises on average about 0.5 mol M6P (mono-M6P and bis-M6P) per mol rhGAA at the second potential N-glycosylation site. In some embodiments, the rhGAA comprises on average about 0.4 to about 0.6 mol mono-M6P per mol rhGAA at the second potential N-glycosylation site. In at least one embodiment, the rhGAA comprises a second potential N-glycosylation site occupancy as depicted in
[0123] In one or more embodiments, at least 5% of the rhGAA is phosphorylated at the third potential N-glycosylation site (e.g., N334 for SEQ ID NO: 5 and N390 for SEQ ID NO: 1). In other embodiments, less than 5%, 10%, 15%, 20%, or 25% of the rhGAA is phosphorylated at the third potential N-glycosylation site. For example, the third potential N-glycosylation site can have a mixture of non-phosphorylated high mannose N-glycans, di-, tri-, and tetra-antennary complex N-glycans, and hybrid N-glycans as the major species. In some embodiments, at least 3%, 5%, 8%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, or 50% of the rhGAA is sialylated at the third potential N-glycosylation site. In some embodiments, the rhGAA comprises on average about 0.9 to about 1.2 mol sialic acid per mol rhGAA at the third potential N-glycosylation site. In at least one embodiment, the rhGAA comprises a third potential N-glycosylation site occupancy as depicted in
[0124] In some embodiments, at least 20% of the rhGAA is phosphorylated at the fourth potential N-glycosylation site (e.g., N414 for SEQ ID NO: 5 and N470 for SEQ ID NO: 1). For example, at least 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95% of the rhGAA can be phosphorylated at the fourth potential N-glycosylation site. This phosphorylation can be the result of mono-M6P and/or bis-M6P units. In some embodiments, at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65% 70% 75%, 80%, 85% 90% or 95% of the rhGAA bears a mono-M6P unit at the fourth potential N-glycosylation site. In some embodiments, at least 10%, 15%, 20%, 25%, 30% 35%, 40%, 45% 50%, 55%, 60%, 65%, 70% 75%, 80% 85%, 90%, or 95% of the rhGAA bears a bis-M6P unit at the fourth potential N-glycosylation site. In some embodiments, at least 3%, 5%, 8%, 10%, 15% 20%, or 25% of the rhGAA is sialylated at the fourth potential N-glycosylation site. In some embodiments, the rhGAA comprises on average about 1.4 mol M6P (mono-M6P and bis-M6P) per mol rhGAA at the fourth potential N-glycosylation site. In some embodiments, the rhGAA comprises on average about 0.4 to about 0.6 mol bis-M6P per mol rhGAA at the fourth potential N-glycosylation site. In some embodiments, the rhGAA comprises on average about 0.3 to about 0.4 mol mono-M6P per mol rhGAA at the fourth potential N-glycosylation site. In at least one embodiment, the rhGAA comprises a fourth potential N-glycosylation site occupancy as depicted in
[0125] In some embodiments, at least 5% of the rhGAA is phosphorylated at the fifth potential N-glycosylation site (e.g., N596 for SEQ ID NO: 5 and N692 for SEQ ID NO: 1). In other embodiments, less than 5%, 10%, 15% 20%, or 25% of the rhGAA is phosphorylated at the fifth potential N-glycosylation site. For example, the fifth potential N-glycosylation site can have fucosylated di-antennary complex N-glycans as the major species. In some embodiments, at least 3%, 5% 8% 10%, 15%, 20%, 25%, 30%, 35%, 40% 45% 50%, 55% 60% 65%, 70% 75%, 80%, 85% 90%, or 95% of the rhGAA is sialylated at the fifth potential N-glycosylation site. In some embodiments, the rhGAA comprises on average about 0.8 to about 0.9 mol sialic acid per mol rhGAA at the fifth potential N-glycosylation site. In at least one embodiment, the rhGAA comprises a fifth potential N-glycosylation site occupancy as depicted in
[0126] In some embodiments, at least 5% of the rhGAA is phosphorylated at the sixth N-glycosylation site (e g. N826 for SEQ ID NO: 5 and N882 for SEQ ID NO: 1). In other embodiments, less than 5%, 10% 15% 20% or 25% of the rhGAA is phosphorylated at the sixth N-glycosylation site. For example, the sixth N-glycosylation site can have a mixture of di-, tri-, and tetra-antennary complex N-glycans as the major species. In some embodiments, at least 3%, 5% 8%, 10%, 15% 20% 25%, 30% 35%, 40%, 45% 50% 55%, 60%, 65% 70%, 75% 80%, 85%, 90% or 95% of the rhGAA is sialylated at the sixth N-glycosylation site. In some embodiments, the rhGAA comprises on average about 1.5 to about 4.2 mol sialic acid per mol rhGAA at the sixth potential N-glycosylation site. In some embodiments, the rhGAA comprises on average about 0.9 mol acetylated sialic acid per mol rhGAA at the sixth potential N-glycosylation site. In at least one embodiment, the rhGAA comprises a sixth potential N-glycosylation site occupancy as depicted in
[0127] In some embodiments, at least 5% of the rhGAA is phosphorylated at the seventh potential N-glycosylation site (e.g., N869 for SEQ ID NO: 5 and N925 for SEQ ID NO: 1). In other embodiments, less than 5% 10% 15%, 20%, or 25% of the rhGAA is phosphorylated at the seventh potential N-glycosylation site. In some embodiments, less than 40%, 45%, 50% 55%, 60%, or 65% of the rhGAA has any N-glycan at the seventh potential N-glycosylation site. In some embodiments, at least 30% 35%, or 40% of the rhGAA has an N-glycan at the seventh potential N-glycosylation site. In some embodiments, the rhGAA comprises on average about 0.86 mol sialic acid per mol rhGAA at the seventh potential N-glycosylation site. In at least on embodiment, all N-glycans identified at the seventh potential N-glycosylation site are complex N-glycans. In at least one embodiment, the rhGAA comprises a seventh potential N-glycosylation site occupancy as depicted in
[0128] In some embodiments, the rhGAA comprises on average 3-4 M6P residues per rhGAA molecule and about 4 to about 7.3 mol sialic acid per mol rhGAA. In some embodiments, the rhGAA further comprises on average at least about 0.5 mol bis-M6P per mol rhGAA at the first potential N-glycosylation site, about 0.4 to about 0.6 mol mono-M6P per mol rhGAA at the second potential N-glycosylation site, about 0.9 to about 1.2 mol sialic acid per mol rhGAA at the third potential N-glycosylation site, about 0.4 to about 0.6 mol bis-M6P per mol rhGAA at the fourth potential N-glycosylation site, about 0.3 to about 0.4 mol mono-M6P per mol rhGAA at the fourth potential N-glycosylation site, about 0.8 to about 0.9 mol sialic acid per mol rhGAA at the fifth potential N-glycosylation site, and about 1.5 to about 4.2 mol sialic acid per mol rhGAA at the sixth potential N-glycosylation site. In at least one embodiment, the rhGAA further comprises on average about 0.86 mol sialic acid per mol rhGAA at the seventh potential N-glycosylation site. In at least one embodiment, the rhGAA comprises seven potential N-glycosylation sites with occupancy and N-glycosylation profiles as depicted in
[0129] Methods of making rhGAA are disclosed in U.S. Provisional Patent Application No. 62/057,842, filed Sep. 30, 2014, the entire content of which is incorporated herein by reference.
[0130] Once inside the lysosome, rhGAA can enzymatically degrade accumulated glycogen. However, conventional rhGAA products have low total levels of mono-M6P- and bis-M6P bearing N-glycans and, thus, target muscle cells poorly, resulting in inferior delivery of rhGAA to the lysosomes. The majority of rhGAA molecules in these conventional products do not have phosphorylated N-glycans, thereby lacking affinity for the CIMPR. Non-phosphorylated high mannose N-glycans can also be cleared by the mannose receptor, which results in non-productive clearance of the ERT (
IV. Production and Purification of N-Linked Glycosylated rhGAA
[0131] As described in International Application PCT/US2015/053252, the entirety of which is incorporated herein by reference, cells such as Chinese hamster ovary (CHO) cells may be used to produce the rhGAA described therein. Expressing high M6P rhGAA in CHO cells is advantageous over modifying the glycan profile of an rhGAA post-translationally at least in part because only the former may be converted by glycan degration to a form of rhGAA with optimal glycogen hydrolysis, thus enhancing therapeutic efficacy.
[0132] In some embodiments, the rhGAA is preferably produced by one or more CHO cell lines that are transformed with a DNA construct encoding the rhGAA described therein. Such CHO cell lines may contain multiple copies of a gene, such as S, 10, 15, or 20 or more copies, of a polynucleotide encoding GAA. DNA constructs, which express allelic variants of acid α-glucosidase or other variant acid α-glucosidase amino acid sequences such as those that are at least 90%, 95%, 98%, or 99% identical to SEQ ID NO: 1 or SEQ ID NO: 5, may be constructed and expressed in CHO cells. Those of skill in the art may select alternative vectors suitable for transforming CHO cells for production of such DNA constructs.
[0133] Methods for making such CHO cell lines are described in International Application PCT/US2015/053252, the entirety of which is incorporated herein by reference. Briefly, these methods involve transforming a CHO cell with DNA encoding GAA or a GAA variant, selecting a CHO cell that stably integrates the DNA encoding GAA into its chromosome(s) and that stably expresses GAA, and selecting a CHO cell that expresses GAA having a high content of N-glycans bearing mono-M6P or bis-M6P, and, optionally, selecting a CHO cell having N-glycans with high sialic acid content and/or having N-glycans with a low non-phosphorylated high-mannose content. The selected CHO cell lines may be used to produce rhGAA and rhGAA compositions by culturing the CHO cell line and recovering said composition from the culture of CHO cells. In some embodiments, a rhGAA produced from the selected CHO cell lines contains a high content of N-glycans bearing mono-M6P or bis-M6P that target the CIMPR. In some embodiments, a rhGAA produced as described herein has low levels of complex N-glycans with terminal galactose. In some embodiments, the selected CHO cell lines are referred to as GA-ATB200 or ATB200-X5-14. In some embodiments, the selected CHO cell lines encompass a subculture or derivative of such a CHO cell culture. In some embodiments, a rhGAA produced from the selected CHO cell lines is referred to as ATB200.
[0134] A rhGAA produced as described herein may be purified by following methods described in International Application PCT/US2017/024981 and in U.S. Provisional Application No. 62/506,569, both of which are incorporated herein by reference in their entirety. An exemplary process for producing, capturing, and purifying a rhGAA produced from CHO cell lines is shown in
[0135] Briefly, bioreactor 601 contains a culture of cells, such as CHO cells, that express and secrete rhGAA into the surrounding liquid culture media. The bioreactor 601 may be any appropriate bioreactor for culturing the cells, such as a perfusion, batch or fed-batch bioreactor. The culture media is removed from the bioreactor after a sufficient period of time for cells to produce rhGAA. Such media removal may be continuous for a perfusion bioreactor or may be batch-wise for a batch or fed-batch reactor. The media may be filtered by filtration system 603 to remove cells. Filtration system 603 may be any suitable filtration system, including an alternating tangential flow filtration (ATF) system, a tangential flow filtration (TFF) system, and/or centrifugal filtration system. In various embodiments, the filtration system utilizes a filter having a pore size between about 10 nanometers and about 2 micrometers.
[0136] After filtration, the filtrate is loaded onto a protein capturing system 605. The protein capturing system 605 may include one or more chromatography columns. If more than one chromatography column is used, then the columns may be placed in series so that the next column can begin loading once the first column is loaded. Alternatively, the media removal process can be stopped during the time that the columns are switched.
[0137] In various embodiments, the protein capturing system 605 includes one or more anion exchange (AEX) columns for the direct product capture of rhGAA, particularly rhGAA having a high M6P content. The rhGAA captured by the protein capturing system 605 is eluted from the column(s) by changing the pH and/or salt content in the column. Exemplary conditions for an AEX column are provided in Table 2.
TABLE-US-00002 TABLE 2 Exemplary conditions for an AEX column Flow rate Volume Temperature Procedure Buffer (cm/h) (CV) (° C.) Pre-used 0.1-10M NaOH ≤25-2500 ≥1-3 15-25 Sanitization (≥10-120 min) Pre- 20-2000 mM phosphate ≤25-2500 ≥1-5 15-25 Equilibration buffer (PB), pH 6 9-7.3 Equilibration 4-400 mM PB, pH 6.9-7.3 ≤25-2500 ≥1-5 2-15 Load NA ≤10-1000 NA 2-15 Wash1 4-400 mM PB, pH 6.9-7.3 ≤25-2500 ≥2-10 2-15 Wash2 4-400 mM PB, pH 6.9-7.3 ≤25-2500 ≥2-10 15-25 Elution 4-400 mM PB, 20-2000 mM ≤25-2500 NA 15-25 NaCl, pH 6.1-6.5 Strip 4-400 mM PB, 0.1-10 M ≤25-2500 ≥1-5 15-25 NaCl, pH 6.1-6.5 Post-use 0.1-10M NaOH ≤25-2500 ≥1-3 15-25 Sanitization (≥10-120 min) Storage 0.01-1.0M NaOH ≤25-2500 ≥1-5 15-25
[0138] The eluted rhGAA can be subjected to further purification steps and/or quality assurance steps. For example, the eluted rhGAA may be subjected to a virus kill step 607. Such a virus kill 607 may include one or more of a low pH kill, a detergent kill, or other technique known in the art. The rhGAA from the virus kill step 607 may be introduced into a second chromatography system 609 to further purify the rhGAA product. Alternatively, the eluted rhGAA from the protein capturing system 605 may be fed directly to the second chromatography system 609. In various embodiments, the second chromatography system 609 includes one or more immobilized metal affinity chromatography (IMAC) columns for further removal of impurities. Exemplary conditions for an IMAC column are provided in Table 3 below.
TABLE-US-00003 TABLE 3 Exemplary conditions for an IMAC column Flow rate Procedure Buffer (cm/h) Vol Rinse 4-400 mM PB, pH 6.3-6.7 ≤25-2500 ≥1-5 Pre-use 0.01-1.0M NaOH ≤25-2500 ≥1-3 Sanitization (10-30 min) Equilibration 4-400 mM PB, pH 6.5 ≤25-2500 ≥1-5 Wash with WFI Water For Injection (WFI) ≤25-2500 ≥1-3 Chelating 0.01-1.0 M Copper Acetate ≤25-2500 ≥1-5 Wash with WFI WFI ≤25-2500 ≥2-10 Wash with acidic 2-200 mM Sodium Acetate, 0.05-5M ≤25-2500 ≥2-10 buffer NaCl, pH 3.5-4.5 Equilibration 4-400 mM PB, pH 6.3-6.7 ≤25-2500 ≥1-5 Blank run with 4-400 mM PB, 15-1500 mM Glycine, ≤25-2500 ≥2-20 elution buffer pH 6.1-6.5 Equilibration 4-400 mM PB, pH 6.3-6.7 ≤25-2500 ≥1-5 Load NA ≤25-2500 ≥1-5 Wash1 4-400 mM PB, pH 6.3-6.7 ≤25-2500 ≥2-10 Wash2 4-400 mM PB, 0.1-10M NaCl, ≤25-2500 ≥2-10 5-30% propylene glycol, pH 6.3-6.7 Wash3 4-400 mM PB, pH 6.3-6.7 ≤25-2500 ≥2-10 Elution 4-400 mM PB, 15-1500 mM Glycine, ≤25-2500 NA pH 6.1-6.5 Strip 4-400 mM PB, 50-5000 mM ≤25-2500 ≥1-5 imidazole, pH 6.3-6.7 Post-use 0.01-1M NaOH ≤25-2500 ≥1-3 Sanitization (10-30 min) Rinse 4-400 mM PB, pH 6.3-6.7 ≤25-2500 ≥1-5 Storage 5-30% ethanol ≤25-2500 ≥1-5
[0139] After the rhGAA is loaded onto the second chromatography system 609, the recombinant protein is eluted from the column(s). The eluted rhGAA can be subjected to a virus kill step 611. As with vims kill 607, vims kill 611 may include one or more of a low pH kill, a detergent kill, or other technique known in the art. In some embodiments, only one of vims kill 607 or 611 is used, or the vims kills are performed at the same stage in the purification process.
[0140] The rhGAA from the vims kill step 611 may be introduced into a third chromatography system 613 to further purify the recombinant protein product. Alternatively, the eluted recombinant protein from the second chromatography system 609 may be fed directly to the third chromatography system 613. In various embodiments, the third chromatography system 613 includes one or more cation exchange chromatography (CEX) columns and/or size exclusion chromatography (SEC) columns for further removal of impurities. The rhGAA product is then eluted from the third chromatography system 613. Exemplary conditions for a CEX column are provided in Table 4 below.
TABLE-US-00004 TABLE 4 Exemplary conditions for a CEX column Flow rate Vol Procedure Buffer (cm/h) (CV) Pre-used 0.1-10M NaOH ≤25-2500 ≥1-3 Sanitization (≥10-120 min) Equilibration 2-200 mM Sodium citrate, pH 4.0-5.0 ≤30-3000 ≥2-10 Load NA ≤30-3000 NA Wash 2-200 mM Sodium citrate, pH 4.0-5.0 ≤30-3000 ≥2-10 Elution 2-200 mM Sodium citrate, 15-1500 mM ≤30-3000 ≥2-10 NaCl, pH 4.0-5.0 Strip 2-200 mM Sodium citrate, 0.1-10M NaCl, ≤30-3000 ≥1-5 pH 4.0-5.0 Post-use 0.1-10M NaOH ≤25-2500 ≥1-3 Sanitization (≥10-120 min) Storage 0.01-1.0M NaOH ≤30-3000 ≥1-5
[0141] The rhGAA product may also be subjected to further processing. For example, another filtration system 615 may be used to remove viruses. In some embodiments, such filtration can utilize filters with pore sizes between 5 and 50 μm. Other product processing can include a product adjustment step 617, in which the recombinant protein product may be sterilized, filtered, concentrated, stored, and/or have additional components for added for the final product formulation.
[0142] As used herein, the term “ATB200” refers to a rhGAA with a high content of N-glycans bearing mono-M6P and bis-M6P, which is produced from a GA-ATB200 cell line and purified using methods described herein.
V. Pharmaceutical Composition
[0143] In various embodiments, a pharmaceutical composition comprising the rhGAA described herein, either alone or in combination with other therapeutic agents, and/or a pharmaceutically acceptable carrier, is provided.
[0144] In one or more embodiments, a pharmaceutical composition described herein comprises a pharmaceutically acceptable salt.
[0145] In some embodiments, the pharmaceutically acceptable salt used herein is a pharmaceutically-acceptable acid addition salt. The pharmaceutically-acceptable acid addition salt may include, but is not limited to, hydrochloric acid, hydrobromic acid, sulfuric acid, sulfamic acid, nitric acid, phosphoric acid, and the like, and organic acids including but not limited to acetic acid, trifluoroacetic acid, adipic acid, ascorbic acid, aspartic acid, benzenesulfonic acid, benzoic acid, butyric acid, camphoric acid, camphorsulfonic acid, cinnamic acid, citric acid, digluconic acid, ethanesulfonic acid, glutamic acid, glycolic acid, glycerophosphoric acid, hemisulfic acid, hexanoic acid, formic acid, fumaric acid, 2-hydroxyethanesulfonic acid (isethionic acid), lactic acid, hydroxymaleic acid, malic acid, malonic acid, mandelic acid, mesitylenesulfonic acid, methanesulfonic acid, naphthalenesulfonic acid, nicotinic acid, 2-naphthalenesulfonic acid, oxalic acid, pamoic acid, pectinic acid, phenylacetic acid, 3-phenylpropionic acid, pivalic acid, propionic acid, pyruvic acid, salicylic acid, stearic acid, succinic acid, sulfanilic acid, tartaric acid, p-toluenesulfonic acid, undecanoic acid, and the like.
[0146] In some embodiments, the pharmaceutically acceptable salt used herein is a pharmaceutically-acceptable base addition salt. The pharmaceutically-acceptable base addition salt may include, but is not limited to, ammonia or the hydroxide, carbonate, or bicarbonate of ammonium or a metal cation such as sodium, potassium, lithium, calcium, magnesium, iron, zinc, copper, manganese, aluminum, and the like. Salts derived from pharmaceutically-acceptable organic nontoxic bases include, but are not limited to, salts of primary, secondary, and tertiary amines, quaternary amine compounds, substituted amines including naturally occurring substituted amines, cyclic amines and basic ion-exchange resins, such as methylamine, dimethylamine, trimethylamine, ethylamine, diethylamine, triethylamine, isopropylamine, tripropylamine, tributylamine, ethanolamine, diethanolamine, 2-dimethylaminoethanol, 2-diethylaminoethanol, dicyclohexylamine, lysine, arginine, histidine, caffeine, hydrabamine, choline, betaine, ethylenediamine, glucosamine, methylglucamine, theobromine, purines, piperazine, piperidine, N-ethylpiperidine, tetramethylammonium compounds, tetraethylammonium compounds, pyridine, N,N-dimethylaniline, N-methylpiperidine. N-methylmorpholine, dicyclohexylamine, dibenzylamine, N,N-dibenzylphenethylamine, 1-ephenamine, N,N′-dibenzylethylenediamine, polyamine resins, and the like.
[0147] In some embodiments, the rhGAA or a pharmaceutically acceptable salt thereof may be formulated as a pharmaceutical composition adapted for intravenous administration. In some embodiments, the pharmaceutical composition is a solution in sterile isotonic aqueous buffer. Where necessary, the composition may also include a solubilizing agent and a local anesthetic to ease pain at the site of the injection. The ingredients of the pharmaceutical composition may be supplied either separately or mixed together in unit dosage form, for example, as a dry lyophilized powder or water free concentrate in a hermetically sealed container such as an ampule or sachet indicating the quantity of active agent. Where the composition is to be administered by infusion, it may be dispensed with an infusion bottle containing sterile pharmaceutical grade water, saline or dextrose/water. In some embodiments, the infusion may occur at a hospital or clinic. In some embodiments, the infusion may occur outside the hospital or clinic setting, for example, at a subject's residence. Where the composition is administered by injection, an ampule of sterile water for injection or saline may be provided so that the ingredients may be mixed prior to administration.
[0148] In some embodiments, the rhGAA or a pharmaceutically acceptable salt thereof may be formulated for oral administration. Orally administrate compositions may be formulated in a form of tablets, capsules, ovules, elixirs, solutions or suspensions, gels, syrups, mouth washes, or a dry powder for reconstitution with water or other suitable vehicle before use, optionally with flavoring and coloring agents for immediate-, delayed-, modified-, sustained-, pulsed-, or controlled-release applications. Solid compositions such as tablets, capsules, lozenges, pastilles, pills, boluses, powder, pastes, granules, bullets, dragees, or premix preparations can also be used. Solid and liquid compositions for oral use may be prepared according to methods well known in the art. Such compositions can also contain one or more pharmaceutically acceptable carriers and excipients which can be in solid or liquid form. Tablets or capsules can be prepared by conventional means with pharmaceutically acceptable excipients, including but not limited to binding agents, fillers, lubricants, disintegrants, or wetting agents. Suitable pharmaceutically acceptable excipients are known in the art and include but are not limited to pregelatinized starch, polyvinylpyrrolidone, povidone, hydroxypropyl methylcellulose (HPMC), hydroxypropyl ethylcellulose (HPEC), hydroxypropyl cellulose (HPC), sucrose, gelatin, acacia, lactose, microcrystalline cellulose, calcium hydrogen phosphate, magnesium stearate, stearic acid, glyceryl behenate, talc, silica, corn, potato or tapioca starch, sodium starch glycolate, sodium lauryl sulfate, sodium citrate, calcium carbonate, dibasic calcium phosphate, glycine croscarmellose sodium, and complex silicates. Tablets can be coated by methods well known in the art.
[0149] In some embodiments, a pharmaceutical composition described herein may be formulated according to International Application PCT/US2017/024982 and U.S. Provisional Application No. 62/506,574, both incorporated herein by reference in their entirety. For instance, in some embodiments, the pH of a pharmaceutical composition described herein is from about 5.0 to about 7.0 or about 5.0 to about 6.0. In some embodiments, the pH ranges from about 5.5 to about 6.0. In some embodiments, the pH of the pharmaceutical composition is 6.0. In some embodiments, the pH may be adjusted to a target pH by using pH adjusters (e.g., alkalizing agents and acidifying agents) such as sodium hydroxide and/or hydrochloric acid.
[0150] The pharmaceutical composition described herein may comprise a buffer system such as a citrate system, a phosphate system, and a combination thereof. The citrate and/or phosphate may be a sodium citrate or sodium phosphate. Other salts include potassium and ammonium salts. In one or more embodiments, the buffer comprises a citrate. In further embodiments, the buffer comprises sodium citrate (e.g., a mixture of sodium citrate dehydrate and citric acid monohydrate). In one or more embodiments, buffer solutions comprising a citrate may comprise sodium citrate and citric acid. In some embodiments, both a citrate and phosphate buffer are present.
[0151] In some embodiments, a pharmaceutical composition described herein comprises at least one excipient. The excipient may function as a tonicity agent, bulking agent, and/or stabilizer. Tonicity agents are components which help to ensure the formulation has an osmotic pressure similar to or the same as human blood. Bulking agents are ingredients which add mass to the formulations (e.g. lyophilized) and provide an adequate structure to the cake. Stabilizers are compounds that can prevent or minimize the aggregate formation at the hydrophobic air-water interfacial surfaces. One excipient may function as a tonicity agent and bulking agent at the same time. For instance, mannitol may function as a tonicity agent and also provide benefits as a bulking agent.
[0152] Examples of tonicity agents include sodium chloride, mannitol, sucrose, and trehalose. In some embodiments, the tonicity agent comprises mannitol. In some embodiments, the total amount of tonicity agent(s) ranges in an amount of from about 10 mg/mL to about 50 mg/mL. In further embodiments, the total amount of tonicity agent(s) ranges in an amount of from about 10, 11, 12, 13, 14, or 15 mg/mL to about 16, 20, 25, 30, 35, 40, 45, or 50 mg/mL.
[0153] In some embodiments, the excipient comprises a stabilizer. In some embodiments, the stabilizer is a surfactant. In some embodiments, the stabilizer is polysorbate 80. In one or mote embodiments, the total amount of stabilizer ranges from about 0.1 mg/mL to about 1.0 mg/mL. In further embodiments, the total amount of stabilizer ranges from about 0.1, 0.2, 0.3, 0.4, or 0.5 mg/mL to about 0.5, 0.6, 0.7, 0.8, 0.9, or 1.0 mg/mL. In yet further embodiments, the total amount of stabilizer is about 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, or 1.0 mg/mL.
[0154] In some embodiments, a pharmaceutical composition comprises (a) a rhGAA (such as ATB200), (b) at least one buffer selected from the group consisting of a citrate, a phosphate, and a combination thereof, and (c) at least one excipient selected from the group consisting of mannitol, polysorbate 80, and a combination thereof, and has a pH of (i) from about 5.0 to about 6.0, or (ii) from about 5.0 to about 7.0. In some embodiments, the composition further comprises water. In some embodiments, the composition may further comprise an acidifying agent and/or alkalizing agent.
[0155] In some embodiments, the pharmaceutical composition comprises (a) a rhGAA (such as ATB200) at a concentration of about 5-50 mg/mL, about 5-30 mg/mL, or about 15 mg/mL, (b) sodium citrate buffer at a concentration of about 10-100 mM or about 25 mM, (c) mannitol at a concentration of about 10-50 mg/mL, or about 20 mg/mL, (d) polysorbate 80, present at a concentration of about 0.1-1 mg/mL, about 0.2-0.5 mg/mL, or about 0.5 mg/mL, and (e) water, and has a pH of about 6.0. In at least one embodiment, the pharmaceutical composition comprises (a) 15 mg/mL rhGAA (such as ATB200) (b) 25 mM sodium citrate buffer, (c) 20 mg/mL mannitol (d) 0.5 mg/mL polysorbate 80, and (e) water, and has a pH of about 6.0. In some embodiments, the composition may further comprise an acidifying agent and/or alkalizing agent.
[0156] In some embodiments, the pharmaceutical composition comprising rhGAA is diluted prior to administration to a subject in need thereof.
[0157] In some embodiments, a pharmaceutical composition described herein comprises a chaperone. In some embodiments, the chaperone is miglustat or a pharmaceutically acceptable salt thereof. In another embodiment, the chaperone is duvoglustat or a pharmaceutically acceptable salt thereof.
[0158] In some embodiments, a rhGAA described herein is formulated in one pharmaceutical composition while a chaperone such as miglustat is formulated in another pharmaceutical composition. In some embodiments, the pharmaceutical composition comprising miglustat is based on a formulation available commercially as Zavesca® (Actelion Pharmaceuticals).
[0159] In some embodiments, the pharmaceutical composition described herein may undergo lyophilization (freeze-drying) process to provide a cake or powder. Accordingly, another aspect of the invention pertains to a pharmaceutical composition after lyophilization. The lyophilized mixture may comprise the rhGAA described herein (e.g., ATB200), buffer selected from the group consisting of a citrate, a phosphate, and combinations thereof, and at least one excipient selected from the group consisting of trehalose, mannitol, polysorbate 80, and a combination thereof. In some embodiments, other ingredients (e.g., other excipients) may be added to the lyophilized mixture. The pharmaceutical composition comprising the lyophilized formulation may be provided vial, which then can be stored, transported, reconstituted and/or administered to a patient.
VI. Methods of Treatment
[0160] A. Treatment of Diseases
[0161] Another aspect of the invention pertains to a method of treatment of a disease or disorder related to glycogen storage dysregulation by administering the rhGAA or pharmaceutical composition described herein. In some embodiments, the disease is Pompe disease (also known as acid maltase deficiency (AMD) and glycogen storage disease type II (GSDII)). In some embodiments, the rhGAA is ATB200. In some embodiments, the pharmaceutical composition comprises ATB200.
[0162] The rhGAA or pharmaceutical composition described herein is administered by an appropriate route. In one embodiment, the rhGAA or pharmaceutical composition is administered intravenously. In other embodiments, the rhGAA or pharmaceutical composition is administered by direct administration to a target tissue, such as to heart or skeletal muscle (e.g., intramuscular), or nervous system (e.g., direct injection into the brain; intraventricularly; intrathecally). In some embodiments, the rhGAA or pharmaceutical composition is administered orally. More than one route can be used concurrently, if desired.
[0163] In some embodiments, the therapeutic effects of the rhGAA or pharmaceutical composition described herein may be assessed based on one or more of the following criteria: (1) cardiac status (e.g., increase of end-diastolic and/or end-systolic volumes, or reduction, amelioration or prevention of the progressive cardiomyopathy that is typically found in GSD-II), (2) pulmonary function (e.g., increase in crying vital capacity over baseline capacity, and/or normalization of oxygen desaturation during crying), (3) neurodevelopment and/or motor skills (e.g., increase in AIMS score), and (4) reduction of glycogen levels in tissue of the individual affected by the disease.
[0164] In some embodiments, the cardiac status of a subject is improved by 10%, 20%, 30%, 40%, or 50% (or any percentage in-between) after administration of one or more dosages of the rhGAA or pharmaceutical composition described herein, as compared to that of a subject treated with a vehicle or that of a subject prior to treatment. The cardiac status of a subject may be assessed by measuring end-diastolic and/or end-systolic volumes and/or by clinically evaluating cardiomyopathy. In some embodiments, the pulmonary function of a subject is improved by 10%, 20%, 30%, 40%, or 50% (or any percentage in-between) after administration of one or more dosages of ATB200 or pharmaceutical composition comprising ATB200, as compared to that of a subject treated with a vehicle or that of a subject prior to treatment. In certain embodiments, the improvement is achieved after 1 week, 2 weeks, 3 weeks, 1 month, 2 months, or more from administration (or any time period in between). In certain embodiments, ATB200 or pharmaceutical composition comprising ATB200 improves the pulmonary function of a subject after 1 week, 2 weeks, 3 weeks, 1 month, 2 months, or more from administration (or any time period in between).
[0165] In some embodiments, the pulmonary function of a subject is improved by 10%, 20%, 30%, 40%, or 50% (or any percentage in-between) after administration of one or more dosages of the rhGAA or pharmaceutical composition described herein, as compared to that of a subject treated with a vehicle or that of a subject prior to treatment. The pulmonary function of a subject may be assessed by crying vital capacity over baseline capacity, and/or normalization of oxygen desaturation during crying. In some embodiments, the pulmonary function of a subject is improved by 10%, 20%, 30%, 40%, or 50% (or any percentage in-between) after administration of one or more dosages of ATB200 or pharmaceutical composition comprising ATB200, as compared to that of a subject treated with a vehicle or that of a subject prior to treatment. In certain embodiments, the improvement is achieved after 1 week, 2 weeks, 3 weeks, 1 month, 2 months, or more from administration (or any time period in between). In certain embodiments, ATB200 or pharmaceutical composition comprising ATB200 improves the pulmonary function of a subject after 1 week, 2 weeks, 3 weeks, 1 month, 2 months, or more from administration (or any time period in between).
[0166] In some embodiments, the neurodevelopment and/or motor skills of a subject is improved by 10%, 20%, 30%, 40%, or 50% (or any percentage in-between) after administration of one or more dosages of the rhGAA or pharmaceutical composition described herein, as compared to that of a subject treated with a vehicle or that of a subject prior to treatment. The neurodevelopment and/or motor skills of a subject may be assessed by determining an AIMS score. The AIMS is a 12-item anchored scale that is clinician-administered and scored (see Rush J A Jr., Handbook of Psychiatric Measures, American Psychiatric Association, 2000, 166-168). Items 1-10 are rated on a 5-point anchored scale. Items 1-4 assess orofacial movements. Items 5-7 deal with extremity and truncal dyskinesia. Items 8-10 deal with global severity as judged by the examiner, and the patient's awareness of the movements and the distress associated with them. Items 11-12 are yes/no questions concerning problems with teeth and/or dentures (such problems can lead to a mistaken diagnosis of dyskinesia). In some embodiments, the neurodevelopment and/or motor skills of a subject is improved by 10%, 20%, 30%, 40%, or 50% (or any percentage in-between) after administration of one or more dosages of ATB200 or pharmaceutical composition comprising ATB200, as compared to that of a subject treated with a vehicle or that of a subject prior to treatment. In certain embodiments, the improvement is achieved after 1 week, 2 weeks, 3 weeks, 1 month, 2 months, or more from administration (or any time period in between). In certain embodiments, ATB200 or pharmaceutical composition comprising ATB200 improves the neurodevelopment and/or motor skills of a subject after 1 week, 2 weeks, 3 weeks, 1 month, 2 months, or more from administration (or any time period in between).
[0167] In some embodiments, the glycogen level of a certain tissue of a subject is reduced by 10%, 20%, 30%, 40%, or 50% (or any percentage in-between) after administration of one or more dosages of the rhGAA or pharmaceutical composition described herein, as compared to that of a subject treated with a vehicle or that of a subject prior to treatment. In some embodiment, the tissue is muscle such as quadriceps, triceps, and gastrocnemius. The glycogen level of a tissue can be analyzed using methods known in the art. The determination of glycogen levels is well known based on amyloglucosidase digestion, and is described in publications such as: Amalfitano et al. (1999), “Systemic correction of the muscle disorder glycogen storage disease type ii after hepatic targeting of a modified adenovirus vector encoding human acid-alphaglucosidase,” Proc Natl Acad Sci USA, 96:8861-8866. In some embodiments, the glycogen level in muscle of a subject is reduced by 10%, 20%, 30%, 40%, or 50% (or any percentage in between) after administration of one or more dosages of ATB200 or pharmaceutical composition comprising ATB200, as compared to that of a subject treated with a vehicle or that of a subject prior to treatment. In certain embodiments, the reduction is achieved after 1 week, 2 weeks, 3 weeks, 1 month, 2 months, or more from administration (or any-time period in between). In certain embodiments, ATB200 or pharmaceutical composition comprising ATB200 reduces the glycogen level in muscle of a subject after 1 week, 2 weeks, 3 weeks, 1 month, 2 months, or more from administration (or any time period in between).
[0168] B. Biomarkers
[0169] Biomarkers of glycogen accumulation in a muscle fiber in a subject, such as urine hexose tetrasaccharide (Hex4), may be used to assess and compare the therapeutic effects of enzyme replacement therapy in a subject with Pompe disease. In some embodiments, the therapeutic effect of the rhGAA or a pharmaceutical composition comprising rhGAA on glycogen accumulation is assessed by measuring the levels of Hex4 in a subject.
[0170] Biomarkers of muscle injury or damage such as creatine kinase (CK), alanine aminotransferase (ALT), and aspartate aminotransferase (AST) may be used to assess and compare the therapeutic effects of enzyme replacement therapy in a subject with Pompe disease. In some embodiments, the therapeutic effect of the rhGAA or a pharmaceutical composition comprising rhGAA on muscle damage is assessed by measuring the levels of CK, ALT, and/or AST in a subject. In at least one embodiment, the therapeutic effect of the rhGAA or a pharmaceutical composition comprising rhGAA on muscle damage is assessed by measuring the levels of CK in a subject.
[0171] Biomarkers such as LAMP-1, LC3, and Dysferlin may also be used to assess and compare the therapeutic effects of the rhGAA or pharmaceutical composition described herein. In Pompe disease, the failure of GAA to hydrolyze lysosomal glycogen leads to the abnormal accumulation of large lysosomes filled with glycogen in some tissues. (Raben et al., JBC 273: 19086-19092, 1998.) Studies in a mouse model of Pompe disease have shown that the enlarged lysosomes in skeletal muscle cannot adequately account for the reduction in mechanical performance, and that the presence of large inclusions containing degraded myofibrils (i.e., autophagic buildup) contributes to the impairment of muscle function. (Raben et al., Human Mol Genet 17: 3897-3908, 2008.) Reports also suggest that impaired autophagy flux is associated with poor therapeutic outcome in Pompe patients. (Nascimbeni et al., Neuropathology and Applied Neurobiology doi: 10.1111/nan.12214, 2015; Fukuda et al., Mol Ther 14: 831-839, 2006.) In addition, late-onset Pompe disease is prevalent in unclassified limb-girdle muscular dystrophies (LGMDs) (Preisler et al., Mol Genet Metab 110. 287-289, 2013), which is a group of genetically heterogeneous neuromuscular diseases with more than 30 genetically defined subtypes of varying severity. IHC examination revealed substantially elevated sarcoplasmic presence of dysferlin in the skeletal muscle fibers of Gaa KO mice.
[0172] Various known methods can be used to measure the gene expression level and/or protein level of such biomarkers. For instance, a sample from a subject treated with the rhGAA or pharmaceutical composition described herein can be obtained, such as biopsy of tissues, in particular muscle. In some embodiments, the sample is a biopsy of muscle in a subject. In some embodiments, the muscle is selected from quadriceps, triceps, and gastrocnemius. The sample obtained from a subject may be stained with one or more antibodies or other detection agents that detect such biomarkers or be identified and quantified by mass spectrometry. The samples may also or alternatively be processed for detecting the presence of nucleic acids, such as mRNAs, encoding the biomarkers via, e.g., RT-qPCR methods.
[0173] In some embodiments, the gene expression level and/or protein level of one or more biomarkers is measured in a muscle biopsy obtained from an individual prior to and post treatment with the rhGAA or pharmaceutical composition described herein. In some embodiments, the gene expression level and/or protein level of one or more biomarkers is measured in a muscle biopsy obtained from an individual treated with a vehicle. In some embodiments, the gene expression level and/or protein level of one or more biomarkers is reduced by 10%, 20%, 30%, 40%, or 50% (or any percentage in-between) after administration of one or more dosages of the rhGAA or pharmaceutical composition described herein, as compared to that of a subject treated with a vehicle or that of a subject prior to treatment. In some embodiments, the gene expression level and/or protein level of one or more biomarkers is reduced by 10%, 20%, 30%, 40%, or 50% (or any percentage in-between) after administration of one or more dosages of ATB200 or pharmaceutical composition comprising ATB200, as compared to that of a subject treated with a vehicle or that of a subject prior to treatment. In certain embodiments, the reduction is achieved after 1 week, 2 weeks, 3 weeks, 1 month, 2 months, or more from administration (or any time period in between). In certain embodiments, ATB200 or pharmaceutical composition comprising ATB200 reduces the gene expression level and/or protein level of one or more biomarkers after 1 week, 2 weeks, 3 weeks, 1 month, 2 months, or more from administration (or any time period in between).
[0174] C. Dosages of rhGAA
[0175] The pharmaceutical formulation or reconstituted composition is administered in a therapeutically effective amount (e.g., a dosage amount that, when administered at regular intervals, is sufficient to treat the disease, such as by ameliorating symptoms associated with the disease, preventing or delaying the onset of the disease, and/or lessening the severity or frequency of symptoms of the disease). The amount which is therapeutically effective in the treatment of the disease may depend on the nature and extent of the disease's effects, and can be determined by standard clinical techniques. In addition, in vitro or in vivo assays may optionally be employed to help identify optimal dosage ranges. In at least one embodiment, a rhGAA described herein or pharmaceutical composition comprising the rhGAA is administered at a dose of about 1 mg/kg to about 100 mg/kg, such as about 5 mg/kg to about 30 mg/kg, typically about 5 mg/kg to about 20 mg/kg. In at least one embodiment, the rhGAA or pharmaceutical composition described herein is administered at a dose of about 5 mg/kg, about 10 mg/kg, about 15 mg/kg, about 20 mg/kg, about 25 mg/kg, about 30 mg/kg, about 35 mg/kg, about 40 mg/kg, about 50 mg/kg, about 50 mg/kg, about 60 mg/kg, about 70 mg/kg, about 80 mg/kg, about 90 mg/kg, or about 100 mg/kg. In some embodiments, the rhGAA is administered at a dose of 5 mg/kg, 10 mg/kg, 20 mg/kg, 50 mg/kg, 75 mg/kg, or 100 mg/kg. In at least one embodiment, the rhGAA or pharmaceutical composition is administered at a dose of about 20 mg/kg. In some embodiments, the rhGAA or pharmaceutical composition is administered concurrently or sequentially with a pharmacological chaperone. In some embodiments, the pharmacological chaperone is miglustat. In at least one embodiment, the miglustat is administered as an oral dose of about 260 mg. The effective dose for a particular individual can be varied (e.g. increased or decreased) over time, depending on the needs of the individual. For example, in times of physical illness or stress, or if anti-acid α-glucosidase antibodies become present or increase, or if disease symptoms worsen, the amount can be increased.
[0176] In some embodiments, the therapeutically effective dose of the rhGAA or pharmaceutical composition described herein is lower than that of conventional rhGAA products. For instance, if the therapeutically effective dose of a conventional rhGAA product is 20 mg/kg, the dose of the rhGAA or pharmaceutical composition described herein required to produce the same as or better therapeutic effects than the conventional rhGAA product may be lower than 20 mg/kg. Therapeutic effects may be assessed based on one or more criteria discussed above (e.g., cardiac status, glycogen level, or biomarker expression). In some embodiments, the therapeutically effective dose of the rhGAA or pharmaceutical composition described herein is at least about 5%, 10%, 15%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or more lower than that of conventional rhGAA products.
[0177] In some embodiments, the therapeutic effect of the rhGAA or pharmaceutical composition described herein comprises an improvement in motor function, an improvement in muscle strength (upper-body, lower-body, or total-body), an improvement in pulmonary function, decreased fatigue, reduced levels of at least one biomarker of muscle injury, reduced levels of at least one biomarker of glycogen accumulation, or a combination thereof. In some embodiments, the therapeutic effect of the rhGAA or pharmaceutical composition described herein comprises a reversal of lysosomal pathology in a muscle fiber, a faster and/or mote effective reduction in glycogen content in a muscle fiber, an increase in six-minute walk test distance, a decrease in timed up and go test time, a decrease in four-stair climb test time, a decrease in ten-meter walk test time, a decrease in gait-stair-gower-chair score, an increase in upper extremity strength, an improvement in shoulder adduction, an improvement in shoulder abduction, an improvement in elbow flexion, an improvement in elbow extension, an improvement in upper body strength, an improvement in lower body strength, an improvement in total body strength, an improvement in upright (sitting) forced vital capacity, an improvement in maximum expiratory pressure, an improvement in maximum inspiratory pressure, a decrease in fatigue severity scale score, a reduction in urine hexose tetrasaccharide levels, a reduction in creatine kinase levels, a reduction in alanine aminotransferase levels, a reduction in asparate aminotransferase levels, or any combination thereof.
[0178] In some embodiments, the rhGAA or pharmaceutical composition described herein achieves desired therapeutic effects faster than conventional rhGAA products when administered at the same dose. Therapeutic effects may be assessed based on one or more criteria discussed above (e.g., cardiac status, glycogen level, or biomarker expression). For instance, if a single dose of a conventional rhGAA product decreases glycogen levels in tissue of a treated individual by 10% in a week, the same degree of reduction may be achieved in less than a week when the same dose of the rhGAA or pharmaceutical composition described herein is administered. In some embodiments, when administered at the same dose, the rhGAA or pharmaceutical composition described herein may achieves desired therapeutic effects at least about 1.25, 1.5, 1.75, 2.0, 3.0, or more faster than conventional rhGAA products.
[0179] In some embodiments, the therapeutically effective amount of rhGAA (or composition or medicament comprising rhGAA) is administered more than once. In some embodiments, the rhGAA or pharmaceutical composition described herein is administered at regular intervals, depending on the nature and extent of the disease's effects, and on an ongoing basis. Administration at a “regular interval,” as used herein, indicates that the therapeutically effective amount is administered periodically (as distinguished from a one-time dose). The interval can be determined by standard clinical techniques. In certain embodiments, rhGAA is administered bimonthly, monthly, bi-weekly, weekly, twice weekly, or daily. In some embodiments, the rhGAA is administered intravenously twice weekly, weekly, or every other week. The administration interval for a single individual need not be a fixed interval, but can be varied over time, depending on the needs of the individual. For example, in times of physical illness or stress, if anti-rhGAA antibodies become present or increase, or if disease symptoms worsen, the interval between doses can be decreased.
[0180] In some embodiments, when used at the same dose, the rhGAA or pharmaceutical composition as described herein may be administered less frequently than conventional rhGAA products and yet capable of producing the same as or better therapeutic effects than conventional rhGAA products. For instance, if a conventional rhGAA product is administered at 20 mg/kg weekly, the rhGAA or pharmaceutical composition as described herein may produce the same as or better therapeutic effects than the conventional rhGAA product when administered at 20 mg/kg, even though the rhGAA or pharmaceutical composition is administered less frequently, e.g., biweekly or monthly. Therapeutic effects may be assessed based on one or more criterion discussed above (e.g., cardiac status, glycogen level, or biomarker expression). In some embodiments, an interval between two doses of the rhGAA or pharmaceutical composition described herein is longer than that of conventional rhGAA products. In some embodiments, the interval between two doses of the rhGAA or pharmaceutical composition is at least about 1.25, 1.5, 1.75, 2.0, 3.0, or more longer than that of conventional rhGAA products.
[0181] In some embodiments, under the same treatment condition (e.g., the same dose administered at the same interval), the rhGAA or pharmaceutical composition described herein provides therapeutic effects at a degree superior than that provided by conventional rhGAA products. Therapeutic effects may be assessed based on one or more criteria discussed above (e.g., cardiac status, glycogen level, or biomarker expression). For instance, when compared to a conventional rhGAA product administered at 20 mg/kg weekly, the rhGAA or pharmaceutical composition administered at 20 mg/kg weekly may reduce glycogen levels in tissue of a treated individual at a higher degree. In some embodiments, when administered under the same treatment condition, the rhGAA or pharmaceutical composition described herein provides therapeutic effects that are at least about 1.25, 1.5, 1.75, 2.0, 3.0, or more greater than those of conventional rhGAA products.
[0182] D. Combination Therapy
[0183] In one or more embodiments, the rhGAA or pharmaceutical composition comprising the rhGAA described herein is administered concurrently or sequentially with a pharmacological chaperone. In some embodiments, the rhGAA or pharmaceutical composition is administered via a different route as compared to the pharmacological chaperone. For instance, a pharmacological chaperone may be administered orally while the rhGAA or pharmaceutical composition is administered intravenously.
[0184] In various embodiments, the pharmacological chaperone is miglustat. In some embodiments, the miglustat is administered at an oral dose of about 50 mg to about 600 mg. In at least one embodiment, the miglustat is administered at an oral dose of about 200 mg to about 600 mg, or at an oral dose of about 200 mg, about 250 mg, about 300 mg, about 350 mg, about 400 mg, about 450 mg, about 500 mg, about 550 mg, or about 600 mg. In at least one embodiment, the miglustat is administered at an oral dose of about 233 mg to about 500 mg. In at least one embodiment, the miglustat is administered at an oral dose of about 250 to about 270 mg, or at an oral dose of about 250 mg, about 255 mg, about 260 mg, about 265 mg or about 270 mg. In at least one embodiment, the miglustat is administered as an oral dose of about 260 mg.
[0185] It will be understood by those skilled in the art that an oral dose of miglustat in the range of about 200 mg to 600 mg or any smaller range therewith can be suitable for an adult patient depending on his/her body weight. For instance, for patients having a significantly lower body weight than about 70 kg, including but not limited to infants, children, or underweight adults, a smaller dose may be considered suitable by a physician. Therefore, in at least one embodiment, the miglustat is administered as an oral dose of from about 50 mg to about 200 mg, or as an oral dose of about 50 mg, about 75 mg, about 100 mg, 125 mg, about 150 mg, about 175 mg, or about 200 mg. In at least one embodiment, the miglustat is administered as an oral dose of from about 65 mg to about 195 mg, or as an oral dose of about 65 mg, about 130 mg, or about 195 mg.
[0186] In some embodiments, the rhGAA is administered intravenously at a dose of about 5 mg/kg to about 20 mg/kg and the miglustat is administered orally at a dose of about 50 mg to about 600 mg. In some embodiments, the rhGAA is administered intravenously at a dose of about 5 mg/kg to about 20 mg/kg and the miglustat is administered orally at a dose of about 50 mg to about 200 mg. In some embodiments, the rhGAA is administered intravenously at a dose of about 5 mg/kg to about 20 mg/kg and the miglustat is administered orally at a dose of about 200 mg to about 600 mg. In some embodiments, the rhGAA is administered intravenously at a dose of about 5 mg/kg to about 20 mg/kg and the miglustat is administered orally at a dose of about 233 mg to about 500 mg. In one embodiment, the rhGAA is administered intravenously at a dose of about 20 mg/kg and the miglustat is administered orally at a dose of about 260 mg.
[0187] In some embodiments, the miglustat and the rhGAA are administered concurrently. For instance, the miglustat may administered within 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 minute(s) before or after administration of the rhGAA. In some embodiments, the miglustat is administered within 5, 4, 3, 2, or 1 minute(s) before or after administration of the rhGAA.
[0188] In some embodiments, the miglustat and the rhGAA are administered sequentially. In at least one embodiment, the miglustat is administered prior to administration of the rhGAA. In at least one embodiment, the miglustat is administered less than three hours prior to administration of the rhGAA. In at least one embodiment, the miglustat is administered about two hours prior to administration of the rhGAA. For instance, the miglustat may be administered about 1.5 hours, about 1 hour, about 50 minutes, about 30 minutes, or about 20 minutes prior to administration of the rhGAA. In at least one embodiment, the miglustat is administered about one hour prior to administration of the rhGAA.
[0189] In some embodiments, the miglustat is administered after administration of the rhGAA. In at least one embodiment, the miglustat is administered within three hours after administration of the rhGAA. In at least one embodiment, the miglustat is administered within two hours after administration of the rhGAA. For instance, the miglustat may be administered within about 1.5 hours, about 1 hour, about 50 minutes, about 30 minutes, or about 20 minutes after administration of the rhGAA.
[0190] In some embodiments, the subject fasts for at least two hours before and at least two hours after administration of miglustat.
[0191] E. Kit
[0192] Another aspect of the invention pertains to kits comprising the rhGAA or pharmaceutical composition described herein. In one or more embodiments, the kit comprises a container (e.g., vial, tube, bag, etc.) comprising the rhGAA or pharmaceutical composition (cither before or after lyophilization) and instructions for reconstitution, dilution and administration.
EXAMPLES
Example 1: Preparation of CHO Cells Producing rhGAA Having a High Content of Mono- or Bis-M6P-Bearing N-Glycans
[0193] DG44 CHO (DHFR−) cells w ere transfected with a DNA construct that expresses rhGAA. The DNA construct is shown in
[0194] Cell pools that expressed high amounts of GAA were identified by GAA enzyme activity assays and were used to establish individual clones producing rhGAA. Individual clones were generated on semisolid media plates, picked by ClonePix system, and were transferred to 24-deep well plates. The individual clones were assayed for GAA enzyme activity to identify clones expressing a high level of GAA. Conditioned media for determining GAA activity used a 4-MU-α-Glucosidase substrate. Clones producing higher levels of GAA as measured by GAA enzyme assays were further evaluated for viability, ability to grow, GAA productivity, N-glycan structure and stable protein expression. CHO cell lines, including CHO cell line GA-ATB200, expressing rhGAA with enhanced mono-M6P or bis-M6P N-glycans were isolated using this procedure.
Example 2: Purification of rhGAA
[0195] Multiple batches of the rhGAA according to the invention were produced in shake flasks and in perfusion bioreactors using CHO cell line GA-ATB200, the product of which is referred to as “ATB200.” Weak anion exchange (“WAX”) liquid chromatography was used to fractionate ATB200 rhGAA according to terminal phosphate and sialic acid. Elution profiles were generated by eluting the ERT with increasing amount of salt. The profiles were monitored by UV (A280 nm). Similar CIMPR receptor binding (at least ˜70%) profiles were observed for purified ATB200 rhGAA from different production batches (
Example 3: Oligosaccharide Characterization of ATB200 rhGAA
[0196] ATB200 rhGAA was analyzed for site-specific N-glycan profiles using different LC-MS/MS analytical techniques. The results of the first two LC-MS/MS methods are shown in
[0197] In the first LC-MS/MS analysis, the protein was denatured, reduced, alkylated, and digested prior to LC-MS/MS analysis. During protein denaturation and reduction, 200 μg of protein sample, 5 μL of 1 mol/L tris-HCl (final concentration 50 mM), 75 μL of 8 mol/L guanidine HCl (final concentration 6 M), 1 μL of 0.5 mol/L EDTA (final concentration 5 mM), 2 μL of 1 mol/L DTT (final concentration 20 mM), and Milli-Q® water were added to a 1.5 mL tube to provide a total volume of 100 μL. The sample was mixed and incubated at 56° C. for 30 minutes in a dry bath. During alkylation, the denatured and reduced protein sample was mixed with 5 μL of 1 mol/L iodoacetamide (IAM, final concentration 50 mM), then incubated at 10-30° C. in the dark for 30 minutes. After alkylation, 400 μL of precooled acetone w as added to the sample and the mixture was frozen at −80° C. refrigeration for 4 hours. The sample was then centrifuged for 5 min at 13000 rpm at 4° C. and the supernatant was removed. 400 μL of precooled acetone was added to the pellets, which was then centrifuged for 5 min at 13000 rpm at 4° C. and the supernatant was removed. The sample w as then air dried on ice in the dark to remove acetone residue. Forty microliters of 8M urea and 160 μL of 100 mM NH.sub.4HCO.sub.3 w ere added to the sample to dissolve the protein. During trypsin digestion, 50 μg of the protein was then added with trypsin digestion buffer to a final volume of 100 μL, and 5 μL of 0.5 mg/mL trypsin (protein to enzyme ratio of 20/1 w/w) was added. The solution was mixed well and incubated overnight (16±2 hours) at 37° C. Two and a half microliters of 20% TFA (final concentration 0.5%) were added to quench the reaction. The sample was then analyzed using the Thermo Scientific™ Orbitrap Velos Pro™ Mass Spectrometer.
[0198] In the second LC-MS/MS analysis, the ATB200 sample was prepared according to a similar denaturation, reduction, alkylation, and digestion procedure, except that iodoacetic acid (IAA) was used as the alkylation reagent instead of LAM, and then analyzed using the Thermo Scientific™ Orbitrap Fusion™ Lumos Tribid™ Mass Spectrometer.
[0199] The results of the first and second analyses are shown in
[0200] As can be seen from
[0201]
[0202]
[0203]
[0204]
[0205]
[0206]
[0207]
[0208] An analysis of the N-glycosylation at the seventh site, N869, showed approximately 40% N-glycosylation, with the most common N-glycans being A4S3S3GF (12%), A5S3G2F (10%), A4S2G2F (8%) and A6S3G3F (8%).
[0209]
[0210] Another N-glycosylation analysis of ATB200 was performed according to an LC-MS/MS method as described below. This analysis yielded an average N-glycosylation profile over ten lots of ATB200 (
[0211] N-linked glycans from ATB200 were released enzymatically with PNGase-F and labeled with 2-Anthranilic acid (2-AA). The 2-AA labeled N-glycans were further processed by solid phase extraction (SPE) to remove excess salts and other contaminants. The purified 2-AA N-glycans were dissolved in acetonitrile/water (20/80; v/v), and 10 micrograms were loaded on an amino-polymer analytical column (apHera™, Supelco) for High Performance Liquid Chromatography with Fluorescence detection (HPLC-FLD) and High Resolution Mass Spectrometry (HRMS) analysis.
[0212] The liquid chromatographic (LC) separation was performed under normal phase conditions in a gradient elution mode with mobile phase A (2% acetic acid in acetonitrile) and mobile phase B (5% acetic acid; 20 millimolar ammonium acetate in water adjusted to pH 4.3 with ammonium hydroxide). The initial mobile phase composition was 70% A/30% B. For the fluorescence detection, the parameters for the detector (RF-20Axs, Shimadzu) were Excitation (Ex):320 nm; Emission (Em):420 nm. The HRMS analysis was carried out using a Quadrupole Time of Flight mass spectrometer (Sciex X500B QTOF) operating in Independent Data Acquisition (IDA) mode. The acquired datafiles were converted into mzML files using MSConvert from ProteoWizard, and then GRITS Toolbox 1.2 Morning Blend software (UGA) was utilized for glycan database searching and subsequent annotation of identified N-glycans. The N-glycans were identified using both precursor monoisotopic masses (m/z) and product ion m/z. Experimental product ions and fragmentation patterns were confirmed in-silico using the GlycoWorkbcnch 2 Application.
[0213] To determine the relative quantitation of N-linked glycans from ATB200, data acquired from the HPLC-FLD-QTOF MS/MS experiment was processed as follows. All of the N-glycan peaks in the FLD chromatogram were integrated, and each peak was assigned a percentage of the total area of all peaks in the FLD chromatogram. The fluorescent signal, expressed as a peak area, is a quantitative measure of the amount of each N-glycan in the sample (
[0214] The results of this LC-MS/MS analysis are provided in Table 5 below. The symbol nomenclature for glycan representation is in accordance with Wopereis W, et al. 2006. Abnormal glycosylation with hypersialylated O-glycans in patients with Sialuria. Biochimica et Biophysica Acta. 1762:598-607; Gornik O, et al. 2007. Changes of serum glycans during sepsis and acute pancreatitis. Glycobiology. 17:1321-1332 https://doi.org/10.1093/glycob/cwm106; Kattla J J, et al. 2011. Biologic protein glycosylation. In: Murray Moo-Young (ed.), Comprehensive Biotechnology, Second Edition, 3:467-486; Tharmalingam-Jaikaran T, et al. N-glycan profiling of bovine follicular fluid at key dominant follicle developmental stages. 2014. Reproduction. 148:569-580; Clerc F, et al. Human plasma protein N-glycosylation. 2015. Glycoconj J. DOI 10.1007/s10719-015-9626-2; and Blackler R J, et al. 2016. Single-chain antibody-fragment M6P-1 possesses a mannose 6-phosphate monosaccharide-specific binding pocket that distinguishes N-glycan phosphorylation in a branch-specific manner. Glycobiology. 26-2:181-192.
TABLE-US-00005 TABLE 5 Type and Prevalence of Oligosaccharides identified on ATB200 based on 2-AA glycan mapping and LC-MS/MS identification High Mannose Complex Complex Complex N-Glycans % Total N-Glycans % Total N-Glycans % Total N-Glycans % Total 2P-M7 11.39 FA2G2S1 3.89 A3G3S1 + 1Ac 0.65 FA2G2S1 + 1AC 0.29 P-M7 7.97 FA2G2S2 3.42 A3G2S2 + 1Ac 0.64 A4G3 0.29 M6 6.89 A2G2S2 3.32 A1G1S1 0.63 A4G4 + 3KDN 0.29 P-M6 3.42 FA2G2 2.77 A4G3S1 0.61 A4G4S3 0.28 M5 2.06 FA4G4S3 2.26 FA3G3 0.61 FA5G4 0.24 P-M5 1.67 A2G2S1 2.25 A1G1 0.6 A4G3S2 0.21 2P-M8 1.27 FA3G3S1 2.12 FA2G2S2 + 1Ac 0.57 FA1 0.21 P-M8 1.17 A3G3S2 1.8 A3G2S1 0.57 FA4G4 0.21 BP-M6 0.9 FA2G1 1.66 A3G2S1 0.56 A3G1 0.21 M7 0.81 A2G2 1.46 A2G2S2 + 1Ac 0.5 FA4G3S2 0.21 BP-M7 0.69 FA3G3S1 1.42 FA3G2 0.45 FA3G2S2 0.21 M4 0.14 A4G4S1 1.28 A3G3 + 3KDN 0.45 A1 0.2 BP2-M5 0.04 FA3G3S2 1.25 A4G3S1 0.45 A4G2 0.19 BP2-M6 0.01 FA4G4(1LN)S3 1.1 A2G1S1 0.41 FA4G3 0.19 Hybrid % Total FA4G4S1 1.08 A3G2 0.4 FA3 0.18 N-Glycans FA1P-M6 2.16 A3G3 1.08 FA4G4S1 + LN 0.4 A1G1S1 0.18 M5A1G1S1 1.56 FA4G4S4 1.07 FA3G2S1 0.39 A4G1S1 0.16 FP-M6A1G1S1 0.42 FA3G3S3 1.04 FA2 0.38 FA1G1 0.15 A1M5 0.36 FA4G4S2 0.94 FA4G4S2 + LN 0.38 FA3G1 0.14 A1G1M5 0.32 A2G1 0.94 A3G2S2 0.37 FA5G4S2 0.12 P-M6A1G1S1 0.17 FA2G1S1 0.94 A2 0.34 A3G1S1 0.11 Summary Total A4G4 0.91 FA4G4(2LN)S3 0.33 A3 0.11 High Mannose 38% FA1G1S1 0.91 FA2G2Sg1 0.32 FA3G3S3 + 1Ac 0.1 N-Glycans Hybrid 5% FA2G2S2 + 2Ac 0.76 FA4G4(1LN)S4 0.31 A2G2S1 + 1Ac 0.09 N-Glycans Complex 57% A4G4S2 0.69 A3G3S3 0.29 FA3G1S1 0.06 N-Glycans
[0215] Based on this 2-AA and LC-MS/MS analysis, and as further summarized in
[0216] As shown in
[0217] Also according to this 2-AA and LC-MS/MS analytical technique, an average of about 65% of the N-glycans at the first potential N-glycosylation site of ATB200 are high mannose N-glycans, about 89% of the N-glycans at the second potential N-glycosylation site of ATB200 are high mannose N-glycans, over half of the N-glycans at the third potential N-glycosylation site of ATB200 are sialylated (with nearly 20% fully sialylated) and about 85% of the N-glycans at the third potential N-glycosylation site of ATB200 are complex N-glycans, about 84% of the N-glycans at the fourth potential N-glycosylation site of ATB200 are high mannose N-glycans, about 70% of the N-glycans at the fifth potential N-glycosylation site of ATB200 are sialylated (with about 26% fully sialylated) and about 100% of the N-glycans at the fifth potential N-glycosylation site of ATB200 are complex N-glycans, about 85% of the N-glycans at the sixth potential N-glycosylation site of ATB200 are sialylated (with nearly 27% fully sialylated) and about 98% of the N-glycans at the sixth potential N-glycosylation site of ATB200 are complex N-glycans, and about 87% of the N-glycans at the seventh potential N-glycosylation site of ATB200 are sialylated (with nearly 8% fully sialylated) and about 100% of the N-glycans at the seventh potential N-glycosylation site of ATB200 are complex N-glycans.
Example 4: Analytical Comparison of ATB200 and Myozyme®/Lumizyme®
[0218] Purified ATB200 and Lumizyme® N-glycans were evaluated by MALDI-TOF to determine the individual N-glycan structures found on each ERT. Lumizyme® was obtained from a commercial source. As shown in
[0219] To evaluate the ability of the conventional rhGAAs in Myozyme® and Lumizyme® to interact with the CIMPR, the two conventional rhGAA preparations were injected onto a CIMPR affinity column (which binds rhGAA having M6P groups) and the flow through collected. The bound material was eluted with a free M6 gradient. Fractions were collected in 96-well plate and GAA activity assayed by 4MU-α-glucosidase substrate. The relative amounts of unbound (flow through) and bound (M6P eluted) rhGAA were determined based on GAA activity and reported as the fraction of total enzyme.
[0220] In addition to having a greater percentage of rhGAA that can bind to the CIMPR, it is important to understand the quality of that interaction. Lumizyme® and ATB200 receptor binding was determined using a CIMPR plate binding assay. Briefly, CIMPR-coated plates were used to capture GAA. Varying concentrations of rhGAA were applied to the immobilized receptor and unbound rhGAA was washed off. The amount of remaining rhGAA was determined by GAA activity. As shown in
[0221] Overall, the higher content of M6P N-glycans in ATB200 than in Lumizyme® indicates that the higher portion of rhGAA molecules in ATB200 can target muscle cells. As shown above, the high percentage of mono-phosphorylated and bis-phosphorylated structures determined by MALDI agree with the CIMPR profiles which illustrated significantly greater binding of ATB200 to the CIMPR receptor. N-glycan analysis via MALDI-TOF mass spectrometry confirmed that on average each ATB200 molecule contains at least one natural bis-M6P N-glycan structure. This higher bis-M6P N-glycan content on ATB200 directly correlated with high-affinity binding to CIMPR in M6P receptor plate binding assays (Ku about 2-4 nM).
[0222] The relative cellular uptake of ATB200 and Lumizyme® rhGAA were compared using normal and Pompe fibroblast cell lines. Comparisons involved 5-100 nM of ATB200 according to the invention with 10-500 nM conventional rhGAA product Lumizyme® After 16-hr incubation, external rhGAA was inactivated with TRIS base and cells were washed 3-times with PBS prior to harvest. Internalized GAA measured by 4MU-α-Glucoside hydrolysis and was graphed relative to total cellular protein and the results appear in
[0223] ATB200 was also shown to be efficiently internalized into cells. As depicted in
Example 5: ATB200 and Pharmacological Chaperone
[0224] The stability of ATB200 in acidic or neutral pH buffers was evaluated in a thermostability assay using SYPRO Orange, as the fluorescence of the dye increases when proteins denature. As shown in
TABLE-US-00006 TABLE 6 Stability of ATB200 In Combination with AT2221 Test Condition Tm (° C.) pH 7.4 56.2 pH 7.4 + 10 μM AT2221 61.6 pH 7.4 + 30 μM AT2221 62.9 pH 7.4 + 100 μM AT2221 66.0 pH 5.2 67.3
Example 6: Co-Administration of ATB200 and AT2221 in Gaa KO Mice
[0225] The therapeutic effects of ATB200 and AT2221 were evaluated and compared against those of Alglucosidase alfa in Gaa KO mice. For the study, male Gaa KO (3- to 4-month old) and age-matched wild-type (WT) mice were used. Alglucosidase alfa was administered via bolus tail vein intravenous (IV) injection. In the co-administration regimen, AT2221 was administered via oral gavage (PO) 30 minutes prior to the IV injection of ATB200. Treatment was given biweekly. Treated mice were sacrificed after 14 days from the last administration and various tissues were collected for further analysis. Table 7 summarizes the study design:
TABLE-US-00007 TABLE 7 Co-administration Study Design Drug Dosage per Administration Number of Genotype Treatment (bi-weekly) Administration Gaa KO Vehicle N/A 6 Gaa KO Alglucosidase alfa 20 mg/kg 6 Gaa KO ATB200/AT2221 20 mg/kg (ATB200) 6 10 mg/kg (AT2221) WT (Sve 129) Not Treated N/A N/A
[0226] Tissue glycogen content in tissues samples was determined using amyloglucosidase digestion, as discussed above. As shown in
[0227] Tissue samples were also analyzed for biomarker changes following the methods discussed in: Khanna R, et al. (2012), “The pharmacological chaperone AT2220 increases recombinant human acid α-glucosidase uptake and glycogen reduction in a mouse model of Pompe disease,” Plos One 7(7): e40776; and Khanna. R et al. (2014), “The Pharmacological Chaperone AT2220 Increases the Specific Activity and Lysosomal Delivery of Mutant Acid α-Glucosidase, and Promotes Glycogen Reduction in a Transgenic Mouse Model of Pompe Disease,” PLoS ONE 9(7): e102092. As shown in
[0228] Similarly, intense LC3-positive aggregates in the muscle fibers of untreated Gaa KO mice signify the presence of autophagic zones and autophagy build-up. LC3-positive aggregates (ted) were preferentially reduced in mice treated with ATB200/AT2221 co-administration as compared to mice treated with alglucosidase alfa (
[0229] Dysferlin, a protein involved in membrane repair and whose deficiency/mistrafficking is associated with a number of muscular dystrophies, w as also assessed. As shown in
[0230] These data are consistent with improvements at the cellular level demonstrated in human Pompe disease patients treated with ATB200 and miglustat, (e.g., the patients exhibit reduced levels of biomarkers of glycogen accumulation and muscle injury), leading not only to effective treatment of Pompe disease but also a reversal in disease progression. Clinical data in human Pompe disease patients are summarized in Examples 8-13, below.
Example 7: Single Fiber Analysis
[0231] As shown in
TABLE-US-00008 TABLE 8 Single Fiber Analysis Fibers with Total Number Fibers with Normal or Near- Animal of Fibers Lysosome Autophagy normal Treatment Analyzed Analyzed (n) Enlargement Buildup Appearance WT 2 65 − — 100% Vehicle 2 65 + >90% <10% Alglucosidase 4 150 + >90% <10% alfa ATB200 5 188 Dramatic size 40-64%* 36-60%.sup. decrease in most fibers *This included fibers with varying degree of reduction in autophagic buildup. Overall, the extent of the buildup was smaller in ATB200-treated group compared to Vehicle- or alglucosidase alfa-treated group.
[0232] Overall, the data indicate that ATB200, with its higher M6P content, both alone and further stabilized by the pharmacological chaperone AT2221 at the neutral pH of blood, is more efficient in tissue targeting and lysosomal trafficking compared to alglucosidase alfa when administered to Gaa KO mice, consistent with the stabilization of ATB200 by AT2221 as depicted in
Example 8: The ATB200-02 Trial: An In-Human Study of ATB200/AT2221 in Patients with Pompe Disease
[0233] Preclinical studies were conducted in Gaa knockout mice to evaluate the pharmacokinetics (PK) and efficiency of glycogen reduction at varying ATB200 enzyme replacement therapy (ERT) and AT2221 chaperone doses. These data were used to estimate the comparable AT2221 chaperone doses in humans. Study ATB200-02 (NCT02675465) was then designed as an open-label fixed-sequence, ascending dose, first-in-human, phase 1/2 study to evaluate the safety, tolerability, PK, pharmacodynamics (PD), and efficacy of ATB200 co-administered with AT2221 in patients with Pompe disease.
[0234] Sixteen clinical sites in five countries participated in the ATB200-02 study. The study employed the following key inclusion criteria: males and females aged 18-65 years who were diagnosed with Pompe disease based on documented deficiency of GAA enzyme activity or by GAA phenotyping, and who had received enzyme replacement therapy with alglucosidase alfa for 2-6 years (or ≥2 years for Cohort 2) prior to trial initiation (Cohort 1). Eligible subjects were those currently receiving alglucosidase alfa at a frequency of every other week and having completed the last 2 infusions without a drug-related adverse event (AE) resulting in dose interruption (Cohorts 1 and 2). Subjects had to be able to walk between 200 and 500 meters on the 6-Minute Walk Test (6MWT) (Cohorts 1 and 3), have an upright forced vital capacity (FVC) of 30-80% of predicted normal value (Cohorts 1 and 3), or be wheelchair-bound and unable to walk unassisted (Cohort 2). Protocols for the 6MWT and FVC test can be found, for example, in Lachman and Schoser, Journal of Rare Diseases, 2013, 8:160, and in Bittner and Singh, The 6 Minute Walk Test, Cardiology Advisor, 2013.
Example 9: Interim PK Results from the ATB200-02 Trial
[0235] A summary of pharmacokinetics data for AT2221 is provided in
[0236] AT2221 PK analyses were also performed for 11 Cohort 1 patients who completed Stages 1 and 2, as well as for five Cohort 2 patients who completed the PK study in Stage 3. Blood samples for plasma AT2221 concentrations were taken just prior to AT2221 oral administration (time 0) and at 1, 1.5, 2, 2.5, 3, 4, 5, 6, 9, 11, and 25 hour(s) after AT2221 oral administration. Plasma AT2221 was determined by a validated LC-MS/MS assay.
[0237] As shown in
Example 10: Interim Efficacy Results from the ATB200-02 Trial
[0238] As shown in
[0239] As shown in
[0240] As shown in
[0241] As shown in
[0242] The Fatigue Severity Scale (“FSS”) is a self-assessment questionnaire consisting of nine questions, each scored on a scale of 1 to 7. The total score ranges from 9 to 63, with higher values representing higher level of fatigue due to the disease condition. The normative value in the healthy population is approximately 21 (Grace J et al. Parkinsonism Relat Disord. 2007:13:443-445). As shown in
Example 11: Interim Results from the ATB200-02 Trial: Markers of Muscle Injury
[0243] The following muscle damage markers were assessed: creatine kinase (CK) enzyme, alanine aminotransferase (ALT), and aspartate aminotransferase (AST). Results available after nine months of the clinical trial are reported in
[0244] Urine hexose tetrasaccharide (Hex4) was assessed as a marker of glycogen accumulation. Results for Hex4 available after twelve months of the clinical trial are reported in
Example 12: Interim Safety Results from the ATB200-02 Trial
[0245] The longest duration of treatment was over 20 months. Adverse events (AEs) were generally mild and transient, with a very low rate of infusion-associated reactions (less than 1%) after over 400 total infusions across all three Cohorts. These incidences were controlled by standard premedication.
[0246] The most common AEs reported as treatment-related at up to 72 weeks were nausea (3/20), tremor (3/20), headache (3/20), fatigue (3/20), diarrhea (2/20), muscle spasm (2/20), and joint swelling (2/20).
[0247] The most common AEs reported as treatment-related at up to 20+ months were abdominal pain (including upper and lower abdominal pain) (8/20), diarrhea (8/20), nasopharyngitis (6/20), nausea (5/20), headache (5/20), and upper respiratory tract infection (5/20) (
[0248] There were three incidents of infusion-associated reactions (IARs) in 550+ infusions, which were controlled by standard premedication. One IAR event (skin discoloration) occurred in a nonambulatory ERT-switch patient (Cohort 2). Two IAR events (localized pruritus, erythema, and burning sensation) occurred in an ERT-naïve patient (Cohort 3) (
Example 13: Summary and Conclusions of Interim Results from the ATB200-02 Trial
[0249] As summarized in
[0250] Thus, the multi-dimensional impact of the therapy suggests that the combination regimen of ATB200/AT2221 has the potential to be an important treatment option for patients with Pompe disease. These clinical results support the results from the single fiber analysis studies described in Example 7, which demonstrate that the treatment is effective at clearing pathology from muscle fibers. Further study of the clinical trial is ongoing.