RNAI AGENTS FOR HEPATITIS B VIRUS INFECTION

20210395745 · 2021-12-23

Assignee

Inventors

Cpc classification

International classification

Abstract

Described are methods for inhibition of Hepatitis B virus gene expression or treating symptoms and/or diseases associated with Hepatitis B virus infection. Dosing regimens for administering these RNAi agents are also described. RNA interference (RNAi) agents for inhibiting the expression of Hepatitis B virus gene are described. The HBV RNAi agents disclosed herein may be targeted to cells, such as hepatocytes, for example, by using conjugated targeting ligands. Pharmaceutical compositions comprising one or more HBV RNAi agents optionally with one or more additional therapeutics are also described. Delivery of the described HBV RNAi agents to infected liver in vivo provides for inhibition of HBV gene expression and treatment of diseases and conditions associated with HBV infection.

Claims

1. A method of treating or preventing symptoms of a disease associated with an infection caused by Hepatitis B Virus in a human subject in need thereof, comprising administering an effective amount of a pharmaceutical composition to the human subject, the pharmaceutical composition comprising: (a) a first RNAi agent comprising: (i) an antisense strand comprising a nucleotide sequence of any one of the following: SEQ ID NO:100, SEQ ID NO:126, SEQ ID NO:127, SEQ ID NO:128, SEQ ID NO:171, SEQ ID NO: 179 and SEQ ID NO: 180, and (ii) a sense strand comprising a nucleotide sequence of any one of the following: SEQ ID NO:229, SEQ ID NO:252, SEQ ID NO:253, SEQ ID NO:273, SEQ ID NO:302, and SEQ ID NO:319 and (b) a second RNAi agent comprising: (i) an antisense strand comprising a nucleotide sequence of any one of the following: SEQ ID NO:140, SEQ ID NO: 107, SEQ ID NO: 136, SEQ ID NO: 137, SEQ ID NO:188, SEQ ID NO: 154 and SEQ ID NO: 162, and (ii) a sense strand comprising a nucleotide sequence of any one of the following: SEQ ID NO:262, SEQ ID NO:271, SEQ ID NO: 216, SEQ ID NO: 248, SEQ ID NO:274, SEQ ID NO:328, SEQ ID NO: 292, and SEQ ID NO: 294; and wherein the first and second RNAi agents are administered in a combined amount of about 25-400 mg per 28 days.

2. The method of claim 1, wherein the first RNAi agent, the second RNAi agent, or each of the first RNAi agent and the second RNAi agent, further comprises a targeting ligand conjugated to the sense strand or the antisense strand.

3. The method of claim 2, wherein the targeting ligand comprises N-acetyl-galactosamine.

4. The method of claim 3, wherein the targeting ligand is (NAG25), (NAG25)s, (NAG31), (NAG31)s, (NAG37), or (NAG37)s.

5. The method of claim 2, wherein the targeting ligand is conjugated to the 5′ end or to the 3′ end of sense strand of the RNAi agent.

6. The method of claim 2, wherein the targeting ligand is conjugated to the 3′ end of the antisense strand of the RNAi agent.

7. The method of claim 1, wherein the first RNAi agent is administered in the amount of about 20-275 mg.

8. The method of claim 1, wherein the second RNAi agent is administered in the amount of about 10-150 mg.

9. The method of claim 1, wherein the pharmaceutical composition comprises an RNAi agent comprising a duplex structure of AD04511 (SEQ ID NO: 100 and SEQ ID NO:229), AD04872 (SEQ ID NO: 126 and SEQ ID NO:252), AD04873 (SEQ ID NO: 127 and SEQ ID NO:252), AD04874 (SEQ ID NO: 128 and SEQ ID NO:253), AD05070 (SEQ ID NO:140 and SEQ ID NO:262), AD05148 (SEQ ID NO:140 and SEQ ID NO:271), AD05164 (SEQ ID NO:126 and SEQ ID NO:273), AD05165 (SEQ ID NO:140 and SEQ ID NO:274), or a mixture of any of the foregoing.

10. The method of claim 1, wherein the pharmaceutical composition comprises an RNAi agent comprising the duplex structure of AD04872 (SEQ ID NO: 126 and SEQ ID NO:252) and an RNAi agent comprising the duplex structure of AD05070 (SEQ ID NO:140 and SEQ ID NO:262).

11. The method of claim 10, wherein the duplex structure of AD04872 is conjugated to a first (NAG37) and the duplex structure of AD05070 is conjugated to a second (NAG37).

12. The method of claim 11, wherein the first (NAG37) is conjugated to the 5′ end of the sense strand of the duplex structure of AD04872 and the second (NAG37) is conjugated to the 5′ of the sense strand of the duplex structure of AD05070.

13. The method of claim 10, wherein the ratio of the duplex structure of AD04872 and the duplex structure of AD05070 is between about 1:2 to about 5:1.

14. The method of claim 13, wherein the ratio of the duplex structure of AD04872 and the duplex structure of AD05070 is about 2:1.

15. The method of claim 1, wherein the composition further comprises a pharmaceutically acceptable excipient.

16. The method of claim 1, wherein the composition is administered subcutaneously.

17. The method of claim 1, wherein the first and second RNAi agents are administered in a combined amount of about any of 25, 35, 50, 100, 200, 300 mg or 400 mg per 28 days.

18. The method of claim 1, wherein the first and second RNAi agents are administered in a combined amount of about 40 mg, about 100 mg, or about 200 mg per 28 days.

19. The method of claim 18, wherein the first and second RNAi agents are administered in a combined amount of about 40 mg per 28 days.

20. The method of claim 18, wherein the first and second RNAi agents are administered in a combined amount of about 100 mg per 28 days.

21. The method of claim 18, wherein the first and second RNAi agents are administered in a combined amount of about 200 mg per 28 days.

22. The method of claim 1, wherein the first and second RNAi agents are administered in 7-day, 14-day, 21-day or 28-day intervals.

23. The method of claim 1, wherein the first and second RNAi agents are administered in 28-day intervals.

24. The method of claim 23, wherein the first and second RNAi agents are administered in a combined amount of about 40 mg, about 100 mg, or about 200 mg per 28 days and in 28-day intervals.

25. The method of claim 24, wherein the first and second RNAi agents are administered in a combined amount of about 40 mg per 28 days and in 28 day intervals.

26. The method of claim 24, wherein the first and second RNAi agents are administered in a combined amount of about 100 mg per 28 days and in 28 day intervals.

27. The method of claim 24, wherein the first and second RNAi agents are administered in a combined amount of about 200 mg per 28 days and in 28 day intervals.

28. The method of claim 1, wherein the composition is administered to the human subject for up to 6 months.

29. The method of claim 1, further comprising administering to the human subject a second active agent.

30. The method of claim 29, wherein the second active agent is a nucleoside analog.

31. The method of claim 30, wherein the nucleoside analog is Entecavir or Tenofovir.

32. The method of claim 1, wherein the level of HBsAg, HBeAg, or serum HBV DNA in the human subject is reduced by at least 40% after the administration of the composition.

33. The method of claim 1, wherein the disease associated with the HBV infection is a chronic liver disease or disorder, liver inflammation, liver fibrotic condition, a proliferative hepatocellular disorder, hepatocellular carcinoma, Hepatitis D virus infection, acute HBV infection, chronic hepatitis B or chronic HBV infection.

34. The method of claim 33, wherein the disease associated with the HBV infection is chronic hepatitis B or chronic HBV infection.

35. The method of claim 12, wherein the ratio of the duplex structure of AD04872 and the duplex structure of AD05070 is between about 1:2 to about 5:1.

36. The method of claim 35, wherein the ratio of the duplex structure of AD04872 and the duplex structure of AD05070 is about 2:1.

37. The method of claim 36, wherein the first and second RNAi agents are administered in a combined amount of about any of 25, 35, 50, 100, 200, 300 mg or 400 mg per 28 days.

38. The method of claim 36, wherein the first and second RNAi agents are administered in a combined amount of about 40 mg per 28 days.

39. The method of claim 36, wherein the first and second RNAi agents are administered in a combined amount of about 100 mg per 28 days.

40. The method of claim 36, wherein the first and second RNAi agents are administered in a combined amount of about 200 mg per 28 days.

41. The method of claim 36, wherein the first and second RNAi agents are administered in 7-day, 14-day, 21-day or 28-day intervals.

42. The method of claim 36, wherein the first and second RNAi agents are administered in 28-day intervals.

43. The method of claim 36, wherein the first and second RNAi agents are administered in a combined amount of about 40 mg, about 100 mg, or about 200 mg per 28 days and in 28-day intervals.

44. The method of claim 36, wherein the first and second RNAi agents are administered in a combined amount of about 40 mg per 28 days and in 28-day intervals.

45. The method of claim 36, wherein the first and second RNAi agents are administered in a combined amount of about 100 mg per 28 days and in 28-day intervals.

46. The method of claim 36, wherein the first and second RNAi agents are administered in a combined amount of about 200 mg per 28 days and in 28-day intervals.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

[0515] A better understanding of features and advantages of the present disclosure will be obtained by reference to the following detailed description, which sets forth illustrative embodiments of the disclosure, and the accompanying drawings.

[0516] FIG. 1 shows the mean log HBsAg change from day 1 for CHB patients from different cohorts (c2b, c3b, c4b, c5b, c8 and c9 of Example 19)

[0517] FIG. 2 shows individual changes in HBV DNA for CHB patients from different cohorts (c2b, c8 and c9 of Example 19). Solid line indicates HBeAg positive patients and dashed line indicates HBeAg negative patients.

[0518] FIG. 3 shows individual changes in HBV DNA for CHB patients from different cohorts (c1b, c1c, c4b, c5b, c7, c9, c10 and c11 of Example 19).

[0519] FIG. 4 shows individual changes in Log HBV RNA for CHB patients from cohort 10 of Example 19.

[0520] FIG. 5 shows individual changes in Log HBV RNA for CHB patients from cohort 7 of Example 19.

[0521] FIG. 6 shows individual changes in Log HBV RNA for CHB patients from different cohorts (c2b, c3b, c4b, c5b, c8 and c9 of Example 19). Solid line indicates HBeAg positive patients and dashed line indicates HBeAg negative patients.

[0522] FIG. 7 shows individual changes in HBeAg for CHB patients from different cohorts (c2b, c4b, c5b, c8 and c9 of Example 19).

[0523] FIG. 8 shows individual changes in HBeAg for CHB patients from different cohorts (c1b, c3b and c10 of Example 19).

[0524] FIG. 9 shows individual changes in HBcrAg for CHB patients from different cohorts (c2b, c3b, c4b, c5b, c8 and c9 of Example 19). Solid line indicates HBeAg positive patients and dashed line indicates HBeAg negative patients.

[0525] FIG. 10 shows individual changes in HBcrAg for CHB patients from cohort 6 of Example 19.

[0526] FIG. 11 shows individual changes in HBcrAg for CHB patients from cohort 7 of Example 19.

[0527] FIG. 12 shows individual changes in HBcrAg for CHB patients from cohort 10 of Example 19.

[0528] FIG. 13 shows the NADIR log HBsAg reduction for HBeAg positive patients and HBeAg negative patients.

[0529] FIG. 14 shows the mean log HBsAg change from day 1 for CHB patients from different cohorts (c2b, c3b, c4b, c5b, c8 and c9 of Example 19).

[0530] FIG. 15 shows the mean change for antigen HBsAg from day 1 for CHB patients receiving three doses of HBV RNAi agents (AD04872 and AD05070) via subcutaneous injections in 28-day intervals (cohorts 1b, 1c, 2b, 3b, 4b, 5b, 8 and 9 of Example 20).

[0531] FIG. 16 shows the mean changes for antigen HBsAg and HBeAg from day 1 for HBsAg-positive CHB patients receiving three doses of HBV RNAi agents (AD04872 and AD05070) via subcutaneous injections in 28-day intervals (cohorts 1b, 1c, 2b, 3b, 4b, 5b, 8 and 9 of Example 20).

[0532] FIG. 17 shows the mean HBsAg changes from Day 1 to Day 113 for CHB patients in cohorts 1b, 1c, 2b, 3b, 4b and 5b of Example 21, respectively. The patients were given three subcutaneous doses of the RNAi component in the amount of: 25 mg (cohort 1b), 50 mg (cohort 1c), 100 mg (cohort 2b), 200 mg (cohort 3b), 300 mg (cohort 4b) or 400 mg (cohort 5b) on Day 1, 29 and 57. All patients were given NA daily.

[0533] FIG. 18 shows the mean and individual HBsAg changes on Day 113 from Day 1 for all patients in cohorts 1b, 1c, 2b, 3b, 4b and 5b of Example 21. Dots with an arrow indicate HBeAg positive patients. Dots without an arrow indicate HBeAg negative patients.

[0534] FIGS. 19A-19D show the individual changes in HBV DNA, HBV RNA, HBeAg and HBcrAg from Day 1 to Day 113 for CHB patients in cohorts 1b, 1c, 2b, 3b, 4b and 5b of Example 21, respectively. The patients were given three subcutaneous doses of the RNAi component in the amount of: 25 mg (cohort 1b), 50 mg (cohort 1c), 100 mg (cohort 2b), 200 mg (cohort 3b), 300 mg (cohort 4b) or 400 mg (cohort 5b) on Day 1, 29 and 57. And all patients were given NA daily. Each line represents one individual CHB patient.

[0535] FIG. 20 shows the mean change for antigen HBsAg from day 1 for CHB patients receiving three doses of HBV RNAi agents (AD04872 and AD05070) via subcutaneous injections in 28-day intervals (cohorts 1b, 1c, 2b, 3b, 4b, 5b, 8 and 9 of Example 20; until day 932).

[0536] FIG. 21 shows the mean changes for antigen HBsAg and HBeAg from day 1 for HBsAg-positive CHB patients receiving three doses of HBV RNAi agents (AD04872 and AD05070) via subcutaneous injections in 28-day intervals (cohorts 1b, 1c, 2b, 3b, 4b, 5b, 8 and 9 of Example 20; until day 392).

[0537] FIG. 22 shows sustained suppression of HBsAg in a subset of patients ˜9 months after the last RNAi dose (mean 1.74); cf. example 20:8 CHB patients/cohort (NA experienced or naïve; HBeAg +ve or −ve) received 3 subcutaneous JNJ-3989 doses (days 1, 27, 57) of 100, 200, 300 (n=16) or 400 mg; patients started/continued with an NA on day 1 and continued throughout the study.

DETAILED DESCRIPTION

[0538] Described herein are methods of treating and/or preventing symptoms or diseases associated with an infection caused by Hepatitis B Virus (HBV) in a subject in need thereof or inhibiting expression of one or more Hepatitis B Virus genes. Particularly, described herein are methods of treating or preventing an HBV-associated disease or symptoms in a subject or inhibiting expression of one or more HBV genes comprising administering RNAi agents that inhibit expression of Hepatitis B Virus (HBV) (referred to herein as HBV RNAi agents or HBV RNAi triggers). Each HBV RNAi agent comprises a sense strand and an antisense strand. The sense strand and the antisense strand each can be 16 to 30 nucleotides in length. In some embodiments, the sense and antisense strands each can be 17 to 26 nucleotides in length. The sense and antisense strands can be either the same length or they can be different lengths. In some embodiments, the sense and antisense strands are each independently 17 to 26 nucleotides in length. In some embodiments, the sense and antisense strands are each independently 17-21 nucleotides in length. In some embodiments, both the sense and antisense strands are each 21-26 nucleotides in length. In some embodiments, the sense strand is about 19 nucleotides in length while the antisense strand is about 21 nucleotides in length. In some embodiments, the sense strand is about 21 nucleotides in length while the antisense strand is about 23 nucleotides in length. In some embodiments, both the sense and antisense strands are each 26 nucleotides in length. In some embodiments, the RNAi agent sense and antisense strands are each independently 17, 18, 19, 20, 21, 22, 23, 24, 25, or 26 nucleotides in length. In some embodiments, a double-stranded RNAi agent has a duplex length of about 16, 17, 18, 19, 20, 21, 22, 23 or 24 nucleotides. This region of perfect or substantial complementarity between the sense strand and the antisense strand is typically 15-25 (e.g., 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25) nucleotides in length and occurs at or near the 5′ end of the antisense strand (e.g., this region may be separated from the 5′ end of the antisense strand by 0, 1, 2, 3, or 4 nucleotides that are not perfectly or substantially complementary).

[0539] The sense strand and antisense strand each contain a core stretch sequence that is 16 to 23 nucleobases in length. An antisense strand core stretch sequence is 100% (perfectly) complementary or at least about 85% (substantially) complementary to a nucleotide sequence (sometimes referred to, e.g., as a target sequence) present in the HBV mRNA target. A sense strand core stretch sequence is 100% (perfectly) complementary or at least about 85% (substantially) complementary to a core stretch sequence in the antisense strand, and thus the sense strand core stretch sequence is perfectly identical or at least about 85% identical to a nucleotide sequence (target sequence) present in the HBV mRNA target. A sense strand core stretch sequence can be the same length as a corresponding antisense core sequence or it can be a different length. In some embodiments, the antisense strand core stretch sequence is 16, 17, 18, 19, 20, 21, 22, or 23 nucleotides in length. In some embodiments, the sense strand core stretch sequence is 16, 17, 18, 19, 20, 21, 22, or 23 nucleotides in length.

[0540] Examples of sense and antisense strand nucleotide sequences used in forming HBV RNAi agents are provided in Tables 3 and 4. Examples of RNAi agent duplexes, that include the nucleotide sequences in Tables 3 and 4, are provided in Table 5.

[0541] The HBV RNAi agent sense and antisense strands anneal to form a duplex. A sense strand and an antisense strand of an HBV RNAi agent may be partially, substantially, or fully complementary to each other. Within the complementary duplex region, the sense strand core stretch sequence is at least about 85% complementary or 100% complementary to the antisense core stretch sequence. In some embodiments, the sense strand core stretch sequence contains a sequence of at least 16, at least 17, at least 18, at least 19, at least 20, or at least 21 nucleotides that is at least about 85% or 100% complementary to a corresponding 16, 17, 18, 19, 20, or 21 nucleotide sequence of the antisense strand core stretch sequence (i.e., the sense strand and antisense core stretch sequences of an HBV RNAi agent have a region of at least 16, at least 17, at least 18, at least 19, at least 20, or at least 21 nucleotides that is at least 85% base paired or 100% base paired.).

[0542] In some embodiments, the antisense strand of an HBV RNAi agent disclosed herein differs by 0, 1, 2, or 3 nucleotides from any of the antisense strand sequences in Table 2 or Table 3. In some embodiments, the sense strand of an HBV RNAi agent disclosed herein differs by 0, 1, 2, or 3 nucleotides from any of the sense strand sequences in Table 2 or Table 4.

[0543] The length of the HBV RNAi agent sense and antisense strands described herein are independently 16 to 30 nucleotides in length. In some embodiments, the sense and antisense strands are independently 17 to 26 nucleotides in length. In some embodiments, the sense and antisense strands are 19-26 nucleotides in length. In some embodiments, the described RNAi agent sense and antisense strands are independently 17, 18, 19, 20, 21, 22, 23, 24, 25, or 26 nucleotides in length. The sense and antisense strands can be either the same length or they can be different lengths. In some embodiments, a sense strand and an antisense strand are each 26 nucleotides in length. In some embodiments, a sense strand is 23 nucleotides in length and an antisense strand is 21 nucleotides in length. In some embodiments, a sense strand is 22 nucleotides in length and an antisense strand is 21 nucleotides in length. In some embodiments, a sense strand is 21 nucleotides in length and an antisense strand is 21 nucleotides in length. In some embodiments, a sense strand is 19 nucleotides in length and an antisense strand is 21 nucleotides in length.

[0544] The sense strand and/or the antisense strand may optionally and independently contain an additional 1, 2, 3, 4, 5, or 6 nucleotides (extension) at the 3′ end, the 5′ end, or both the 3′ and 5′ ends of the core sequences. The antisense strand additional nucleotides, if present, may or may not be complementary to the corresponding sequence in an HBV mRNA. The sense strand additional nucleotides, if present, may or may not be identical to the corresponding sequence in an HBV mRNA. The antisense strand additional nucleotides, if present, may or may not be complementary to the corresponding sense strand's additional nucleotides, if present.

[0545] As used herein, an extension comprises 1, 2, 3, 4, 5, or 6 nucleotides at the 5′ and/or 3′ end of the sense strand core stretch sequence and/or antisense strand core stretch sequence. The extension nucleotides on a sense strand may or may not be complementary to nucleotides, either core stretch sequence nucleotides or extension nucleotides, in the corresponding antisense strand. Conversely, the extension nucleotides on an antisense strand may or may not be complementary to nucleotides, either core stretch sequence nucleotides or extension nucleotides, in the corresponding sense strand. In some embodiments, both the sense strand and the antisense strand of an RNAi agent contain 3′ and 5′ extensions. In some embodiments, one or more of the 3′ extension nucleotides of one strand base pairs with one or more 5′ extension nucleotides of the other strand. In other embodiments, one or more of 3′ extension nucleotides of one strand do not base pair with one or more 5′ extension nucleotides of the other strand. In some embodiments, an HBV RNAi agent has an antisense strand having a 3′ extension and a sense strand having a 5′ extension.

[0546] In some embodiments, an HBV RNAi agent comprises an antisense strand having a 3′ extension of 1, 2, 3, 4, 5, or 6 nucleotides in length. In other embodiments, an HBV RNAi agent comprises an antisense strand having a 3′ extension of 1, 2, or 3 nucleotides in length. In some embodiments, one or more of the antisense strand extension nucleotides comprise uracil or thymidine nucleotides or nucleotides which are complementary to a corresponding HBV mRNA sequence. In some embodiments, a 3′ antisense strand extension includes or consists of, but is not limited to: AUA, UGCUU, CUG, UG, UGCC, CUGCC, CGU, CUU, UGCCUA, CUGCCU, UGCCU, UGAUU, GCCUAU, T, TT, U, UU (each listed 5′ to 3′).

[0547] In some embodiments, the 3′ end of the antisense strand may include additional abasic nucleosides (Ab). In some embodiments, Ab or AbAb may be added to the 3′ end of the antisense strand.

[0548] In some embodiments, an HBV RNAi agent comprises an antisense strand having a 5′ extension of 1, 2, 3, 4, or 5 nucleotides in length. In other embodiments, an HBV RNAi agent comprises an antisense strand having a 5′ extension of 1 or 2 nucleotides in length. In some embodiments, one or more of the antisense strand extension nucleotides comprises uracil or thymidine nucleotides or nucleotides which are complementary to a corresponding HBV mRNA sequence. In some embodiments, the 5′ antisense strand extension includes or consists of, but is no limited to, UA, TU, U, T, UU, TT, CUC (each listed 5′ to 3′). An antisense strand may have any of the 3′ extensions described above in combination with any of the 5′ antisense strand extensions described, if present.

[0549] In some embodiments, an HBV RNAi agent comprises a sense strand having a 3′ extension of 1, 2, 3, 4, or 5 nucleotides in length. In some embodiments, one or more of the sense strand extension nucleotides comprises adenosine, uracil, or thymidine nucleotides, AT dinucleotide, or nucleotides which correspond to nucleotides in the HBV mRNA sequence. In some embodiments, the 3′ sense strand extension includes or consists of, but is not limited to: T, UT, TT, UU, UUT, TTT, or TTTT (each listed 5′ to 3′).

[0550] In some embodiments, the 3′ end of the sense strand may include additional abasic nucleosides. In some embodiments, UUAb, UAb, or Ab may be added to the 3′ end of the sense strand. In some embodiments, the one or more abasic nucleosides added to the 3′ end of the sense strand may be inverted (invAb). In some embodiments, one or more inverted abasic nucleosides may be inserted between the targeting ligand and the nucleobase sequence of the sense strand of the RNAi agent. In some embodiments, the inclusion of one or more inverted abasic nucleosides at or near the terminal end or terminal ends of the sense strand of an RNAi agent may allow for enhanced activity or other desired properties of an RNAi agent.

[0551] In some embodiments, an HBV RNAi agent comprises a sense strand having a 5′ extension of 1, 2, 3, 4, 5, or 6 nucleotides in length. In some embodiments, one or more of the sense strand extension nucleotides comprise uracil or adenosine nucleotides or nucleotides which correspond to nucleotides in the HBV mRNA sequence. In some embodiments, the sense strand 5′ extension can be, but is not limited to: CA, AUAGGC, AUAGG, AUAG, AUA, A, AA, AC, GCA, GGCA, GGC, UAUCA, UAUC, UCA, UAU, U, UU (each listed 5′ to 3′). A sense strand may have a 3′ extension and/or a 5′ extension.

[0552] In some embodiments, the 5′ end of the sense strand may include an additional abasic nucleoside (Ab) or nucleosides (AbAb). In some embodiments, the one or more abasic nucleosides added to the 5′ end of the sense strand may be inverted (invAb). In some embodiments, one or more inverted abasic nucleosides may be inserted between the targeting ligand and the nucleobase sequence of the sense strand of the RNAi agent. In some embodiments, the inclusion of one or more inverted abasic nucleosides at or near the terminal end or terminal ends of the sense strand of an RNAi agent may allow for enhanced activity or other desired properties of an RNAi agent.

[0553] Examples of nucleotide sequences used in forming HBV RNAi agents are provided in Tables 3 and 4. In some embodiments, an HBV RNAi agent antisense strand includes a nucleotide sequence of any of the sequences in Table 3. In some embodiments, an HBV RNAi agent antisense strand includes the sequence of nucleotides 1-17, 2-15, 2-17, 1-18, 2-18, 1-19, 2-19, 1-20, 2-20, 1-21, 2-21, 1-22, 2-22, 1-23, 2-23, 1-24, 2-24, 1-25, 2-25, 1-26, or 2-26 of any of the sequences in Table 3. In some embodiments, an HBV RNAi agent sense strand includes the nucleotide sequence of any of the sequences in Table 4. In some embodiments, an HBV RNAi agent sense strand includes the sequence of nucleotides 1-18, 1-19, 1-20, 1-21, 1-22, 1-23, 1-24, 1-25, 1-26, 2-19, 2-20, 2-21, 2-22, 2-23, 2-24, 2-25, 2-26, 3-20, 3-21, 3-22, 3-23, 3-24, 3-25, 3-26, 4-21, 4-22, 4-23, 4-24, 4-25, 4-26, 5-22, 5-23, 5-24, 5-25, 5-26, 6-23, 6-24, 6-25, 6-26, 7-24, 7-25, 7-25, 8-25, 8-26 of any of the sequences in Table 4.

[0554] In some embodiments, the sense and antisense strands of the RNAi agents described herein contain the same number of nucleotides. In some embodiments, the sense and antisense strands of the RNAi agents described herein contain different numbers of nucleotides. In some embodiments, the sense strand 5′ end and the antisense strand 3′ end of an RNAi agent form a blunt end. In some embodiments, the sense strand 3′ end and the antisense strand 5′ end of an RNAi agent form a blunt end. In some embodiments, both ends of an RNAi agent form blunt ends. In some embodiments, neither end of an RNAi agent is blunt-ended. As used herein a blunt end refers to an end of a double stranded RNAi agent in which the terminal nucleotides of the two annealed strands are complementary (form a complementary base-pair). In some embodiments, the sense strand 5′ end and the antisense strand 3′ end of an RNAi agent form a frayed end. In some embodiments, the sense strand 3′ end and the antisense strand 5′ end of an RNAi agent form a frayed end. In some embodiments, both ends of an RNAi agent form a frayed end. In some embodiments, neither end of an RNAi agent is a frayed end. As used herein a frayed end refers to an end of a double stranded RNAi agent in which the terminal nucleotides of the two annealed strands from a pair (i.e. do not form an overhang) but are not complementary (i.e. form a non-complementary pair). As used herein, an overhang is a stretch of one or more unpaired nucleotides at the end of one strand of a double stranded RNAi agent. The unpaired nucleotides may be on the sense strand or the antisense strand, creating either 3′ or 5′ overhangs. In some embodiments, the RNAi agent contains: a blunt end and a frayed end, a blunt end and 5′ overhang end, a blunt end and a 3′ overhang end, a frayed end and a 5′ overhang end, a frayed end and a 3′ overhang end, two 5′ overhang ends, two 3′ overhang ends, a 5′ overhang end and a 3′ overhang end, two frayed ends, or two blunt ends.

[0555] A nucleotide base (or nucleobase) is a heterocyclic pyrimidine or purine compound which is a constituent of all nucleic acids and includes adenine (A), guanine (G), cytosine (C), thymine (T), and uracil (U). As used herein, the term “nucleotide” can include a modified nucleotide (such as, for example, a nucleotide mimic, abasic site (Ab), or a surrogate replacement moiety). Modified nucleotides, when used in various polynucleotide or oligonucleotide constructs, may preserve activity of the compound in cells while at the same time increasing the serum stability of these compounds, and can also minimize the possibility of activating interferon activity in humans upon administering of the polynucleotide or oligonucleotide construct.

[0556] In some embodiments, an HBV RNAi agent is prepared or provided as a salt, mixed salt, or a free-acid. In some embodiments, an HBV RNAi agent is prepared as a sodium salt. Such forms are within the scope of the inventions disclosed herein.

Modified Nucleotides

[0557] In some embodiments, an HBV RNAi agent contains one or more modified nucleotides. As used herein, a “modified nucleotide” is a nucleotide other than a ribonucleotide (2′-hydroxyl nucleotide). In some embodiments, at least 50% (e.g., at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100%) of the nucleotides are modified nucleotides. As used herein, modified nucleotides include, but are not limited to, deoxyribonucleotides, nucleotide mimics, abasic nucleotides (represented herein as Ab), 2′-modified nucleotides, 3′ to 3′ linkages (inverted) nucleotides (represented herein as invdN, invN, invn, invAb), non-natural base-comprising nucleotides, bridged nucleotides, peptide nucleic acids (PNAs), 2′,3′-seco nucleotide mimics (unlocked nucleobase analogues, represented herein as NUNA or NUNA), locked nucleotides (represented herein as NLNA or NLNA), 3′-O-methoxy (2′ internucleoside linked) nucleotides (represented herein as 3′-OMen), 2′-F-Arabino nucleotides (represented herein as NfANA or NfANA), 5′-Me, 2′-fluoro nucleotide (represented herein as 5Me-Nf), morpholino nucleotides, vinyl phosphonate deoxyribonucleotides (represented herein as vpdN), vinyl phosphonate containing nucleotides, and cyclopropyl phosphonate containing nucleotides (cPrpN). 2′-modified nucleotides (i.e. a nucleotide with a group other than a hydroxyl group at the 2′ position of the five-membered sugar ring) include, but are not limited to, 2′-O-methyl nucleotides (represented herein as a lower case letter ‘n’ in a nucleotide sequence), 2′-deoxy-2′-fluoro nucleotides (represented herein as Nf, also represented herein as 2′-fluoro nucleotide), 2′-deoxy nucleotides (represented herein as dN), 2′-methoxyethyl (2′-O-2-methoxylethyl) nucleotides (represented herein as NM or 2′-MOE), 2′-amino nucleotides, and 2′-alkyl nucleotides. It is not necessary for all positions in a given compound to be uniformly modified. Conversely, more than one modification may be incorporated in a single HBV RNAi agent or even in a single nucleotide thereof. The HBV RNAi agent sense strands and antisense strands may be synthesized and/or modified by methods known in the art. Modification at one nucleotide is independent of modification at another nucleotide.

[0558] Modified nucleobases include synthetic and natural nucleobases, such as 5-substituted pyrimidines, 6-azapyrimidines and N-2, N-6 and 0-6 substituted purines, (e.g., 2-aminopropyladenine, 5-propynyluracil, or 5-propynylcytosine), 5-methylcytosine (5-me-C), 5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-alkyl (e.g., 6-methyl, 6-ethyl, 6-isopropyl, or 6-n-butyl) derivatives of adenine and guanine, 2-alkyl (e.g., 2-methyl, 2-ethyl, 2-isopropyl, or 2-n-butyl) and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine, 2-thiocytosine, 5-halouracil, cytosine, 5-propynyl uracil, 5-propynyl cytosine, 6-azo uracil, 6-azo cytosine, 6-azo thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-sulfhydryl, 8-thioalkyl, 8-hydroxyl and other 8-substituted adenines and guanines, 5-halo (e.g., 5-bromo), 5-trifluoromethyl, and other 5-substituted uracils and cytosines, 7-methylguanine and 7-methyladenine, 8-azaguanine and 8-azaadenine, 7-deazaguanine, 7-deazaadenine, 3-deazaguanine, and 3-deazaadenine.

[0559] In some embodiments, all or substantially all of the nucleotides of an RNAi agent are modified nucleotides. As used herein, an RNAi agent wherein substantially all of the nucleotides present are modified nucleotides is an RNAi agent having four or fewer (i.e., 0, 1, 2, 3, or 4) nucleotides in both the sense strand and the antisense strand being ribonucleotides. As used herein, a sense strand wherein substantially all of the nucleotides present are modified nucleotides is a sense strand having two or fewer (i.e., 0, 1, or 2) nucleotides in the sense strand being ribonucleotides. As used herein, an antisense sense strand wherein substantially all of the nucleotides present are modified nucleotides is an antisense strand having two or fewer (i.e., 0, 1, or 2) nucleotides in the sense strand being ribonucleotides. In some embodiments, one or more nucleotides of an RNAi agent is a ribonucleotide.

Modified Internucleoside Linkages

[0560] In some embodiments, one or more nucleotides of an HBV RNAi agent are linked by non-standard linkages or backbones (i.e., modified internucleoside linkages or modified backbones). In some embodiments, a modified internucleoside linkage is a non-phosphate-containing covalent internucleoside linkage. Modified internucleoside linkages or backbones include, but are not limited to, 5′-phosphorothioate groups (represented herein as a lower case “s”), chiral phosphorothioates, thiophosphates, phosphorodithioates, phosphotriesters, aminoalkyl-phosphotriesters, alkyl phosphonates (e.g., methyl phosphonates or 3′-alkylene phosphonates), chiral phosphonates, phosphinates, phosphoramidates (e.g., 3′-amino phosphoramidate, aminoalkylphosphoramidates, or thionophosphoramidates), thionoalkyl-phosphonates, thionoalkylphosphotriesters, morpholino linkages, boranophosphates having normal 3′-5′ linkages, 2′-5′ linked analogs of boranophosphates, or boranophosphates having inverted polarity wherein the adjacent pairs of nucleoside units are linked 3′-5′ to 5′-3′ or 2′-5′ to 5′-2′. In some embodiments, a modified internucleoside linkage or backbone lacks a phosphorus atom. Modified internucleoside linkages lacking a phosphorus atom include, but are not limited to, short chain alkyl or cycloalkyl inter-sugar linkages, mixed heteroatom and alkyl or cycloalkyl inter-sugar linkages, or one or more short chain heteroatomic or heterocyclic inter-sugar linkages. In some embodiments, modified internucleoside backbones include, but are not limited to, siloxane backbones, sulfide backbones, sulfoxide backbones, sulfone backbones, formacetyl and thioformacetyl backbones, methylene formacetyl and thioformacetyl backbones, alkene-containing backbones, sulfamate backbones, methyleneimino and methylenehydrazino backbones, sulfonate and sulfonamide backbones, amide backbones, and other backbones having mixed N, O, S, and CH2 components.

[0561] In some embodiments, a sense strand of an HBV RNAi agent can contain 1, 2, 3, 4, 5, or 6 phosphorothioate linkages, an antisense strand of an HBV RNAi agent can contain 1, 2, 3, 4, 5, or 6 phosphorothioate linkages, or both the sense strand and the antisense strand independently can contain 1, 2, 3, 4, 5, or 6 phosphorothioate linkages. In some embodiments, a sense strand of an HBV RNAi agent can contain 1, 2, 3, or 4 phosphorothioate linkages, an antisense strand of an HBV RNAi agent can contain 1, 2, 3, or 4 phosphorothioate linkages, or both the sense strand and the antisense strand independently can contain 1, 2, 3, or 4 phosphorothioate linkages.

[0562] In some embodiments, an HBV RNAi agent sense strand contains at least two phosphorothioate internucleoside linkages. In some embodiments, the at least two phosphorothioate internucleoside linkages are between the nucleotides at positions 1-3 from the 3′ end of the sense strand. In some embodiments, the at least two phosphorothioate internucleoside linkages are between the nucleotides at positions 1-3, 2-4, 3-5, 4-6, 4-5, or 6-8 from the 5′ end of the sense strand. In some embodiments, an HBV RNAi agent antisense strand contains four phosphorothioate internucleoside linkages. In some embodiments, the four phosphorothioate internucleoside linkages are between the nucleotides at positions 1-3 from the 5′ end of the sense strand and between the nucleotides at positions 19-21, 20-22, 21-23, 22-24, 23-25, or 24-26 from the 5′ end. In some embodiments, an HBV RNAi agent contains at least two phosphorothioate internucleoside linkages in the sense strand and three or four phosphorothioate internucleoside linkages in the antisense strand.

[0563] In some embodiments, an HBV RNAi agent contains one or more modified nucleotides and one or more modified internucleoside linkages. In some embodiments, a 2′-modified nucleoside is combined with modified internucleoside linkage.

HBV RNAi Agents

[0564] In some embodiments, the HBV RNAi agents disclosed herein target an HBV gene at or near the positions of the HBV genome shown in the following Table 1. In some embodiments, the antisense strand of an HBV RNAi agent disclosed herein includes a core stretch sequence that is fully, substantially, or at least partially complementary to a target HBV 19-mer sequence disclosed in Table 1.

TABLE-US-00001 TABLE 1 Example 19-mer HBV cDNA target sequences for HBV RNAi agents  (taken from Hepatitis B virus (subtype ADW2), genotype A.  complete genome GenBank AM282986.1 (SEQ ID NO: 1)). HBV 19-mer Genome Region of SEQ ID Target Sequences Position of HBV Gene No. (5′.fwdarw.3′) SEQ ID NO: 1 Targeted 2 GTGGTGGACTTCTCTCAAT  256-274 S ORF 3 TGGTGGACTTCTCTCAATT  257-275 S ORF 4 GGACTTCTCTCAATTTTCT  261-279 S ORF 5 GCTGTAGGCATAAATTGGT 1780-1798 X ORF 6 CTGTAGGCATAAATTGGTC 1781-1799 X ORF

[0565] In some embodiments, an HBV RNAi agent includes an antisense strand wherein position 19 of the antisense strand (5′.fwdarw.3′) is capable of forming a base pair with position 1 of a 19-mer target sequence disclosed in Table 1. In some embodiments, an HBV RNAi agent includes an antisense strand wherein position 1 of the antisense strand (5′.fwdarw.3′) is capable of forming a base pair with position 19 of the 19-mer target sequence disclosed in Table 1.

[0566] In some embodiments, an HBV RNAi agent includes an antisense strand wherein position 2 of the antisense strand (5′.fwdarw.3′) is capable of forming a base pair with position 18 of the 19-mer target sequence disclosed in Table 1. In some embodiments, an HBV RNAi agent includes an antisense strand wherein positions 2 through 18 of the antisense strand (5′.fwdarw.3′) are capable of forming base pairs with each of the respective complementary bases located at positions 18 through 2 of the 19-mer target sequence disclosed in Table 1.

[0567] In some embodiments, the HBV RNAi agents include core 19-mer nucleotide sequences shown in the following Table 2.

TABLE-US-00002 TABLE 2 HBV RNAi agent antisense strand and sense strand core stretch sequences (N = any nucleotide). Antisense Sequence Sense Sequence Genome SEQ ID (5′.fwdarw.3′) SEQ ID (5′.fwdarw.3′) Position of NO: (19-mer) NO: (19-mer) SEQ ID NO: 1  7 AUUGAGAGAAGUCCACCAC 34 GUGGUGGACUUCUCUCAAU  256-274  8 UUUGAGAGAAGUCCACCAC 35 GUGGUGGACUUCUCUCAAA  256-274  9 AUUGAGAGAAGUCCACCAN 36 NUGGUGGACUUCUCUCAAU  256-274 10 UUUGAGAGAAGUCCACCAN 37 NUGGUGGACUUCUCUCAAA  256-274 11 NUUGAGAGAAGUCCACCAN 38 NUGGUGGACUUCUCUCAAN  256-274 12 AAUUGAGAGAAGUCCACCA 39 UGGUGGACUUCUCUCAAUU  257-275 13 UAUUGAGAGAAGUCCACCA 40 UGGUGGACUUCUCUCAAUA  257-275 14 AAUUGAGAGAAGUCCACCN 41 NGGUGGACUUCUCUCAAUU  257-275 15 UAUUGAGAGAAGUCCACCN 42 NGGUGGACUUCUCUCAAUA  257-275 16 NAUUGAGAGAAGUCCACCN 43 NGGUGGACUUCUCUCAAUN  257-275 17 AGAAAAUUGAGAGAAGUCC 44 GGACUUCUCUCAAUUUUCU  261-279 18 UGAAAAUUGAGAGAAGUCC 45 GGACUUCUCUCAAUUUUCA  261-279 19 AGAAAAUUGAGAGAAGUCN 46 NGACUUCUCUCAAUUUUCU  261-279 20 UGAAAAUUGAGAGAAGUCN 47 NGACUUCUCUCAAUUUUCA  261-279 21 NGAAAAUUGAGAGAAGUCN 48 NGACUUCUCUCAAUUUUCN  261-279 22 ACCAAUUUAUGCCUACAGC 49 GCUGUAGGCAUAAAUUGGU 1780-1798 23 UCCAAUUUAUGCCUACAGC 50 GCUGUAGGCAUAAAUUGGA 1780-1798 24 ACCAAUUUAUGCCUACAGN 51 NCUGUAGGCAUAAAUUGGU 1780-1798 25 UCCAAUUUAUGCCUACAGN 52 NCUGUAGGCAUAAAUUGGA 1780-1798 26 NCCAAUUUAUGCCUACAGN 53 NCUGUAGGCAUAAAUUGGN 1780-1798 27 GACCAAUUUAUGCCUACAG 54 CUGUAGGCAUAAAUUGGUC 1781-1799 28 AACCAAUUUAUGCCUACAG 55 CUGUAGGCAUAAAUUGGUU 1781-1799 29 UACCAAUUUAUGCCUACAG 56 CUGUAGGCAUAAAUUGGUA 1781-1799 30 GACCAAUUUAUGCCUACAN 57 NUGUAGGCAUAAAUUGGUC 1781-1799 31 AACCAAUUUAUGCCUACAN 58 NUGUAGGCAUAAAUUGGUU 1781-1799 32 UACCAAUUUAUGCCUACAN 59 NUGUAGGCAUAAAUUGGUA 1781-1799 33 NACCAAUUUAUGCCUACAN 60 NUGUAGGCAUAAAUUGGUN 1781-1799

[0568] The HBV RNAi agent sense strands and antisense strands that comprise or consist of the nucleotide sequences in Table 2 can be modified nucleotides or unmodified nucleotides. In some embodiments, the HBV RNAi agents having the sense and antisense strand sequences that comprise or consist of the nucleotide sequences in Table 2 are all or substantially all modified nucleotides.

[0569] In some embodiments, the antisense strand of an HBV RNAi agent disclosed herein differs by 0, 1, 2, or 3 nucleotides from any of the antisense strand sequences in Table 2. In some embodiments, the sense strand of an HBV RNAi agent disclosed herein differs by 0, 1, 2, or 3 nucleotides from any of the sense strand sequences in Table 2.

[0570] Modified HBV RNAi agent antisense strand sequences, as well as their underlying unmodified sequences, are provided in Table 3. Modified HBV RNAi agent sense strands, as well as their underlying unmodified sequences, are provided in Table 4. In forming HBV RNAi agents, each of the nucleotides in each of the unmodified sequences listed in Tables 3 and 4 may be a modified nucleotide.

[0571] As used herein (including in Tables 3 and 4), the following notations are used to indicate modified nucleotides, targeting groups, and linking groups. As the person of ordinary skill in the art would readily understand, unless otherwise indicated by the sequence, that when present in an oligonucleotide, the monomers are mutually linked by 5′-3′-phosphodiester bonds: [0572] A=adenosine-3′-phosphate; [0573] C=cytidine-3′-phosphate; [0574] G=guanosine-3′-phosphate; [0575] U=uridine-3′-phosphate [0576] n=any 2′-OMe modified nucleotide [0577] a=2′-O-methyladenosine-3′-phosphate [0578] as=2′-O-methyladenosine-3′-phosphorothioate [0579] c=2′-O-methylcytidine-3′-phosphate [0580] cs=2′-O-methylcytidine-3′-phosphorothioate [0581] g=2′-O-methylguanosine-3′-phosphate [0582] gs=2′-O-methylguanosine-3′-phosphorothioate [0583] t=2′-O-methyl-5-methyluridine-3′-phosphate [0584] ts=2′-O-methyl-5-methyluridine-3′-phosphorothioate [0585] u=2′-O-methyluridine-3′-phosphate [0586] us=2′-O-methyluridine-3′-phosphorothioate [0587] Nf=any 2′-fluoro modified nucleotide [0588] Af=2′-fluoroadenosine-3′-phosphate [0589] Afs=2′-fluoroadenosine-3′-phosporolhioate [0590] Cf=2′-fluorocytidine-3′-phosphate [0591] Cfs=2′-nuorocytidine-3′-phosphorothioate [0592] Gf=2′-fluoroguanosine-3′-phosphate [0593] Gfs=2′-fluoroguanosine-3′-phosphorothioate [0594] Tf=2′-fIuoro-5′-methyluridine-3′-phosphate [0595] Tfs=2′-fluoro-5′-methyluridine-3′-phosphorothioate [0596] Uf=2′-fluorouridine-3′-phosphate [0597] Ufs=2′-fluorouridine-3′-phosphorothioate [0598] dN=any 2′-deoxyribonucleotide [0599] dT=2′-deoxythymidine-3′-phosphate [0600] Nun a =2′,3′-seco nucleotide mimics (unlocked nucleobase analogs) [0601] Nlna=locked nucleotide [0602] NFana=2′-F-Arabino nucleotide [0603] NM=2′-methoxyethyl nucleotide [0604] AM=2′-methoxyethyladenosine-3′-phosphate [0605] AMs=2′-methoxyethyladenosine-3′phosphorothioate [0606] TM=2′-methoxyethylthymidine-3′-phosphate [0607] TMs=2′-methoxyethylthymidine-3′-phosphorothioate [0608] R=ribitol [0609] (invdN)=any inverted deoxyribonucleotide (3′-3′linked nucleotide) [0610] (invAb)=inverted (3′-3′linked) abasic deoxyribonucleotide, see Table 6 [0611] (invAb)s=inverted (3′-3′linked) abasic deoxyribonucleotide-5′- phosphorothioate. see Table 6 [0612] (invn)=any inverted 2′-OMe nucleotide (3′-3′linked nucleotide) [0613] s=phosphorothioate linkage [0614] vpdN=vinyl phosphonate deoxyribonucleotide [0615] (5Me-Nf)=5′-Me, 2′-fluoro nucleotide [0616] cPrp=cyclopropyl phosphonate, see Table 6 [0617] epTcPr=see Table 6 [0618] epTM=see Table 6

[0619] The person or ordinary skill in the art would readily understand that the terminal nucleotide at the 3′ end of a given oligonucleotide sequence would typically have a hydroxyl (—OH) group at the respective 3′ position of the given monomer instead of a phosphate moiety ex vivo. Thus, for example, as shown above in the structure representation of AD05070, above, the “g” modified nucleotide on the terminal 3′ end of the antisense strand of AM06606-AS has a hydroxyl group positioned at its 3′ position. Unless expressly indicated otherwise herein, such understandings of the person of ordinary skill in the art are used when describing the HBV RNAi agents and compositions of HBV RNAi agents disclosed herein.

[0620] Targeting groups and linking groups include the following, for which their chemical structures are provided below in Table 6: (PAZ), (NAG13), (NAG13)s, (NAG18), (NAG18)s, (NAG24), (NAG24)s, (NAG25), (NAG25)s, (NAG26), (NAG26)s, (NAG27), (NAG27)s, (NAG28), (NAG28)s, (NAG29), (NAG29)s, (NAG30), (NAG30)s, (NAG31), (NAG31)s, (NAG32), (NAG32)s, (NAG33), (NAG33)s, (NAG34), (NAG34)s, (NAG35), (NAG35)s, (NAG36), (NAG36)s, (NAG37), (NAG37)s, (NAG38), (NAG38)s, (NAG39), (NAG39)s. Each sense strand and/or antisense strand can have any targeting groups or linking groups listed above, as well as other targeting or linking groups, conjugated to the 5′ and/or 3′ end of the sequence.

TABLE-US-00003 TABLE 3 HBV RNAi Agent antisense strand sequences. SEQ SEQ AS Strand Modified ID Unmodified  ID ID sequence (5′.fwdarw.3′) NO. sequence (5′.fwdarw.3′) NO. AM03508-AS usAfscCfaAfuUfuAfuGfcCfuAfcAfgGfccsusuAu  61 UACCAAUUUAUGCCUACAGGCCUUAU 149 AM04441-AS usAfscCfaAfuUfuAfuGfcCfuAfcAfgGfcscsu  62 UACCAAUUUAUGCCUACAGGCCU 150 AM04442-AS usAfscsCfaAfuUfuAfuGfcCfuAfcAfgGfccsu  63 UACCAAUUUAUGCCUACAGGCCU 150 AM04443-AS usAfscsCfaAfuUfuAfuGfcCfuAfcAfgGfsc  64 UACCAAUUUAUGCCUACAGGC 151 AM04661-AS usGfsugaAfgCfGfaaguGfcAfcacsusu  65 UGUGAAGCGAAGUGCACACUU 152 AM04768-AS usAfscCfaAfuUfuAfuGfcCfuAfcAfgCfcsusccgc  66 UACCAAUUUAUGCCUACAGCCUCCGC 153 AM04769-AS vpusAfscCfaAfuUfuAfuGfcCfuAfcAfgCfcsusccgc  67 UACCAAUUUAUGCCUACAGCCUCCGC 153 AM05011-AS usAfscsCfaAfuUfuAfuGfcCfuAfcAfgusu  68 UACCAAUUUAUGCCUACAGUU 154 AM05012-AS usAfscsCfaAfuUfuAfuGfcCfuAfcAfggsc  69 UACCAAUUUAUGCCUACAGGC 151 AM05013-AS vpusAfscsCfaAfuUfuAfuGfcCfuAfcAfgGfsc  70 UACCAAUUUAUGCCUACAGGC 151 AM05014-AS vpusAfscsCfaAfuUfuAfuGfcCfuAfcAfgusu  71 UACCAAUUUAUGCCUACAGUU 154 AM05052-AS asUfsusGfaGfaGfaAfgUfcCfaCfcAfcGfsa  72 AUUGAGAGAAGUCCACCACGA 155 AM05053-AS asUfsusGfaGfaGfaAfgUfcCfaCfcAfcgsa  73 AUUGAGAGAAGUCCACCACGA 155 AM05054-AS asUfsusGfaGfaGfaAfgUfcCfaCfcAfcusu  74 AUUGAGAGAAGUCCACCACUU 156 AM05055-AS vpusUfsusGfaGfaGfaAfgUfcCfaCfcAfcGfsa  75 UUUGAGAGAAGUCCACCACGA 157 AM05056-AS asAfsusUfgAfgAfgAfaGfuCfcAfcCfaCfsg  76 AAUUGAGAGAAGUCCACCACG 158 AM05057-AS asAfsusUfgAfgAfgAfaGfuCfcAfcCfacsg  77 AAUUGAGAGAAGUCCACCACG 158 AM05058-AS asAfsusUfgAfgAfgAfaGfuCfcAfcCfausu  78 AAUUGAGAGAAGUCCACCAUU 159 AM05060-AS vpusAfsusUfgAfgAfgAfaGfuCfcAfcCfaCfsg  79 UAUUGAGAGAAGUCCACCACG 160 AM05351-AS usAfscsCfaAfuUfuAfuGfcCfuAfcAfgGfsu  80 UACCAAUUUAUGCCUACAGGU 161 AM05608-AS usAfscCfaAfuUfuAfuGfcCfuAfcAfgsusu  81 UACCAAUUUAUGCCUACAGUU 154 AM05609-AS usAfscsCfaAfuUfuAfuGfcCfuAfcAfgcsc  82 UACCAAUUUAUGCCUACAGCC 162 AM05610-AS usAfscsCfaAfuUfuAfuGfcCfuAfcAfgccusu  83 UACCAAUUUAUGCCUACAGCCUU 163 AM05611-AS usAfscsCfaAfuUfuAfuGfcCfuAfcAfgccusc  84 UACCAAUUUAUGCCUACAGCCUC 164 AM05612-AS usAfscscaauUfuAfuGfcCfuacagcsc  85 UACCAAUUUAUGCCUACAGCC 162 AM05613-AS usAfscscaauUfuAfuGfcCfuacagccusu  86 UACCAAUUUAUGCCUACAGCCUU 163 AM05614-AS usAfscscaauUfuAfuGfcCfuacagccusc  87 UACCAAUUUAUGCCUACAGCCUC 164 AM05618-AS asUfsusgagaGfaAfgUfcCfaccacusu  88 AUUGAGAGAAGUCCACCACUU 156 AM05621-AS usUfsusGfaGfaGfaAfgUfcCfaCfcAfcusu  89 UUUGAGAGAAGUCCACCACUU 165 AM05623-AS asUfsusGfaGfaGfaAfgUfcCfaCfcAfcggusu  90 AUUGAGAGAAGUCCACCACGGUU 166 AM05626-AS asUfsusgagaGfaAfgUfcCfaccacggusu  91 AUUGAGAGAAGUCCACCACGGUU 166 AM05628-AS asUfsusGfaGfaGfaAfgUfcCfaCfcAfcgagsu  92 AUUGAGAGAAGUCCACCACGAGU 167 AM05631-AS usAfsusUfgAfgAfgAfaGfuCfcAfcCfaCfsg  93 UAUUGAGAGAAGUCCACCACG 160 AM05632-AS usAfsusugagAfgAfaGfuCfcaccacsg  94 UAUUGAGAGAAGUCCACCACG 160 AM05633-AS usAfsusUfgAfgAfgAfaGfuCfcAfcCfaCfgusu  95 UAUUGAGAGAAGUCCACCACGUU 168 AM05634-AS usAfsusugagAfgAfaGfuCfcaccacgasg  96 UAUUGAGAGAAGUCCACCACGAG 169 AM05635-AS usAfsusUfgAfgAfgAfaGfuCfcAfcCfaCfgasg  97 UAUUGAGAGAAGUCCACCACGAG 169 AM05637-AS usAfsusUfgAfgAfgAfaGfuCfcAfcCfaCfgsa  98 UAUUGAGAGAAGUCCACCACGA 170 AM05638-AS usAfsusugagAfgAfaGfuCfcaccacgsa  99 UAUUGAGAGAAGUCCACCACGA 170 AM05747-AS asGfsasAfaAfuugagAfgAfaGfuCfcAfsc 100 AGAAAAUUGAGAGAAGUCCAC 171 AM05849-AS usAfscsCfaAfuuuauGfcCfuAfcAfgusu 101 UACCAAUUUAUGCCUACAGUU 154 AM05850-AS usAfscsCfaAfuuuauGfcCfuAfcAfgcsc 102 UACCAAUUUAUGCCUACAGCC 162 AM05851-AS usAfscsCfaAfuuuauGfcCfuAfcAfgcusu 103 UACCAAUUUAUGCCUACAGCUU 172 AM05852-AS usAfscsCfaAfuuuauGfcCfuAfcAfgccsu 104 UACCAAUUUAUGCCUACAGCCU 173 AM05853-AS usAfscsCfaAfuuuauGfcCfuAfcAfgccusu 105 UACCAAUUUAUGCCUACAGCCUU 163 AM05854-AS usAfscsCfaAfuuuauGfcCfuAfcAfgccusc 106 UACCAAUUUAUGCCUACAGCCUC 164 AM05855-AS cPrpusAfscsCfaAfuUfuAfuGfcCfuAfcAfgusu 107 UACCAAUUUAUGCCUACAGUU 154 AM05860-AS cPrpusAfsusUfgAfgAfgAfaGfuCfcAfcCfaCfsg 108 UAUUGAGAGAAGUCCACCACG 160 AM05862-AS usAfsusUfgAfgagaaGfuCfcAfcCfausu 109 UAUUGAGAGAAGUCCACCAUU 174 AM05863-AS usAfsusUfgAfgagaaGfuCfcAfcCfacsg 110 UAUUGAGAGAAGUCCACCACG 160 AM05864-AS usAfsusUfgAfgagaaGfuCfcAfcCfacsusu 111 UAUUGAGAGAAGUCCACCACUU 175 AM05865-AS usAfsusUfgAfgagaaGfuCfcAfcCfacsgsa 112 UAUUGAGAGAAGUCCACCACGA 170 AM05867-AS vpusAfsusUfgAfgagaaGfuCfcAfcCfaCfsg 113 UAUUGAGAGAAGUCCACCACG 160 AM05873-AS usUfsusGfaGfagaagUfcCfaCfcAfcusu 114 UUUGAGAGAAGUCCACCACUU 165 AM05874-AS usUfsusGfaGfagaagUfcCfaCfcAfcgsa 115 UUUGAGAGAAGUCCACCACGA 157 AM05875-AS usUfsusGfaGfagaagUfcCfaCfcAfcgusu 116 UUUGAGAGAAGUCCACCACGUU 176 AM05876-AS usUfsusGfaGfagaagUfcCfaCfcAfcgasg 117 UUUGAGAGAAGUCCACCACGAG 177 AM05877-AS cPrpusUfsusGfaGfaGfaAfgUfcCfaCfcAfcusu 118 UUUGAGAGAAGUCCACCACUU 165 AM06074-AS cPrpusAfsusUfgAfgagaaGfuCfcAfcCfacsusu 119 UAUUGAGAGAAGUCCACCACUU 175 AM06142-AS usAfsusUfgAfgagaaGfuCfcAfcCfacusu 120 UAUUGAGAGAAGUCCACCACUU 175 AM06143-AS usAfsusUfgAfgagaaGfuCfcAfcCfacgusu 121 UAUUGAGAGAAGUCCACCACGUU 168 AM06144-AS usAfsusUfgAfgagaaGfuCfcAfcCfacuus(invAb) 122 UAUUGAGAGAAGUCCACCACUU 175 AM06145-AS usAfsusUfgAfgagaaGfuCfcAfcCfacgasg 123 UAUUGAGAGAAGUCCACCACGAG 169 AM06222-AS usAfsusUfgAfgAfgAfaGfuCfcAfcCfacusu 124 UAUUGAGAGAAGUCCACCACUU 175 AM06281-AS asGfsasAfaAfuUfgAfgAfgAfaGfuCfcusu 125 AGAAAAUUGAGAGAAGUCCUU 178 AM06282-AS asGfsasAfaAfuUfgAfgAfgAfaGfuCfcasc 126 AGAAAAUUGAGAGAAGUCCAC 171 AM06283-AS asGfsasAfaAfuUfgAfgAfgAfaGfuCfcacusu 127 AGAAAAUUGAGAGAAGUCCACUU 179 AM06284-AS asGfsasAfaAfuUfgAfgAfgAfaGfuCfcacsc 128 AGAAAAUUGAGAGAAGUCCACC 180 AM06285-AS usGfsasAfaAfuUfgAfgAfgAfaGfuCfcusu 129 UGAAAAUUGAGAGAAGUCCUU 152 AM06286-AS usGfsasAfaAfuUfgAfgAfgAfaGfuCfcasc 130 UGAAAAUUGAGAGAAGUCCAC 181 AM06299-AS asCfscsAfaUfuUfaUfgCfcUfaCfaGfcusu 131 ACCAAUUUAUGCCUACAGCUU 182 AM06300-AS asCfscsAfaUfuUfaUfgCfcUfaCfaGfccusu 132 ACCAAUUUAUGCCUACAGCCUU 183 AM06301-AS asCfscsAfaUfuUfaUfgCfcUfaCfaGfccusc 133 ACCAAUUUAUGCCUACAGCCUC 184 AM06302-AS usCfscsAfaUfuUfaUfgCfcUfaCfaGfcusu 134 UCCAAUUUAUGCCUACAGCUU 185 AM06303-AS usCfscsAfaUfuUfaUfgCfcUfaCfaGfccusu 135 UCCAAUUUAUGCCUACAGCCUU 186 AM06463-AS cPrpusAfscsCfaAfuUfuAfuGfcCfuAfcAfgcsc 136 UACCAAUUUAUGCCUACAGCC 162 AM06464-AS usAfscsCfaAfuUfuAfuGfcCfuAfcAfgscsc 137 UACCAAUUUAUGCCUACAGCC 162 AM06465-AS cPrpusAfscsCfaAfuUfuAfuGfcCfuAfcAfgscsc 138 UACCAAUUUAUGCCUACAGCC 162 AM06604-AS usAfscsCfaAfuUfuAfuGfcCfuAfcAfgcsu 139 UACCAAUUUAUGCCUACAGCU 187 AM06606-AS usAfscsCfaAfuUfuAfuGfcCfuAfcAfgcsg 140 UACCAAUUUAUGCCUACAGCG 188 AM06608-AS asAfscsCfaAfuUfuAfuGfcCfuAfcAfgcsc 141 AACCAAUUUAUGCCUACAGCC 189 AM06611-AS usAfscsCfaAfuUfUfAfuGfcCfuAfcAfgusu 142 UACCAAUUUAUGCCUACAGUU 154 AM06612-AS usAfscsCfaAfuUfuAfuGfcCfuAfcAfgCfsc 143 UACCAAUUUAUGCCUACAGCC 162 AM06614-AS asCfscAfaUfuUfaUfgCfcUfaCfaGfcCfsu 144 ACCAAUUUAUGCCUACAGCCU 190 AM06616-AS usCfscAfaUfuUfaUfgCfcUfaCfaGfcCfsu 145 UCCAAUUUAUGCCUACAGCCU 191 AM06618-AS asCfscAfaUfuUfaUfgCfcUfaCfaGfccsg 146 ACCAAUUUAUGCCUACAGCCG 192 AM06620-AS usCfscAfaUfuUfaUfgCfcUfaCfaGfccsg 147 UCCAAUUUAUGCCUACAGCCG 193 AM06751-AS usAfscsCfaAfuUfuAfuGfcCfuAfcAfggsg 148 UACCAAUUUAUGCCUACAGGG 194

TABLE-US-00004 TABLE 4 HBV RNAi agent sense strand sequences. SEQ SEQ ID Unmodified ID Strand ID Modified sequence (5′.fwdarw.3′) NO. sequence (5′.fwdarw.3′) NO. AM04444-SS (NAG25)uusgsccuguagGfCfAfuaaauugguaus(invdT) 195 UUGCCUGUAGGCAUAAAUUGGUAUT 275 AM04445-SS (NAG25)uauausgsccuguagGfCfAfuaaauuggu(invdA) 196 UAUAUGCCUGUAGGCAUAAAUUGGUA 276 AM04767-SS (NAG25)gcggagsgcuguagGfCfAfuaaauuggTM(invdA) 197 GCGGAGGCUGUAGGCAUAAAUUGGTA 277 AM05010-SS (NAG25)scsuguagGfCfAfuaaauugguauus(invAb) 198 CUGUAGGCAUAAAUUGGUAUU 278 AM05015-SS (NAG25)sgsccuguagGfCfAfuaaauugguas(invAb) 199 GCCUGUAGGCAUAAAUUGGUA 279 AM05016-SS (NAG25)sgsccuguagGfCfAfuaaauuggus(invdA) 200 GCCUGUAGGCAUAAAUUGGUA 279 AM05017-SS (NAG25)sgsccuguagGfCfAfuaaauugguAMs(invAb) 201 GCCUGUAGGCAUAAAUUGGUA 279 AM05018-SS (NAG25)sgsccuguagGfCfAfuaaauuggTMAMs(invAb) 202 GCCUGUAGGCAUAAAUUGGTA 280 AM05019-SS (NAG25)sasacuguagGfCfAfuaaauugguas(invAb) 203 AACUGUAGGCAUAAAUUGGUA 281 AM05034-SS (NAG25)suscguggugGfAfCfuucucucaaus(invAb) 204 UCGUGGUGGACUUCUCUCAAU 282 AM05046-SS (NAG25)sasaguggugGfAfCfuucucucaaus(invAb) 205 AAGUGGUGGACUUCUCUCAAU 283 AM05047-SS (NAG25)suscguggugGfAfCfuucucucaAMTMs(invAb) 206 UCGUGGUGGACUUCUCUCAAT 284 AM05048-SS (NAG25)scsgugguggAfCfUfucucucaauus(invAb) 207 CGUGGUGGACUUCUCUCAAUU 285 AM05049-SS (NAG25)sasaugguggAfCfUfucucucaauus(invAb) 208 AAUGGUGGACUUCUCUCAAUU 286 AM05050-SS (NAG25)scsgugguggAfCfUfucucucaaTMTMs(invAb) 209 CGUGGUGGACUUCUCUCAATT 287 AM05051-SS (NAG25)sgsgacuucuCfUfCfaauuuucuaas(invAb) 210 GGACUUCUCUCAAUUUUCUAA 288 AM05063-SS (NAG25)scsgugguggAfCfUfucucucaauas(invAb) 211 CGUGGUGGACUUCUCUCAAUA 289 AM05064-SS (NAG25)suscguggugGfAfCfuucucucaaas(invAb) 212 UCGUGGUGGACUUCUCUCAAA 290 AM05346-SS (NAG31)sasccuguagGfCfAfuaaauugguas(invAb) 213 ACCUGUAGGCAUAAAUUGGUA 291 AM05347-SS (NAG31)s(invAb)scuguagGfCfAfuaaauugguas(invAb) 214 CUGUAGGCAUAAAUUGGUA 292 AM05606-SS (NAG25)s(invAb)scuguagGfCfAfuaaauugguas(invAb) 215 CUGUAGGCAUAAAUUGGUA 292 AM05607-SS (NAG37)s(invAb)scuguagGfCfAfuaaauugguas(invAb) 216 CUGUAGGCAUAAAUUGGUA 292 AM0561S-SS (NAG25)s(invAb)sacuguagGfCfAfuaaauugguas(invAb) 217 ACUGUAGGCAUAAAUUGGUA 293 AM05616-SS (NAG25)sgsgcuguagGfCfAfuaaauugguas(invAb) 218 GGCUGUAGGCAUAAAUUGGUA 294 AM05617-SS (NAG37)sasaguggugGfAfCfuucucucaaus(invAb) 219 AAGUGGUGGACUUCUCUCAAU 283 AM05620-SS (NAG25)sasaguggugGfAfCfuucucucaaas(invAb) 220 AAGUGGUGGACUUCUCUCAAA 295 AM05622-SS (NAG25)scscguggugGfAfCfuucucucaaus(invAb) 221 CCGUGGUGGACUUCUCUCAAU 296 AM05624-SS (NAG25)s(invAb)sccguggugGfAfCfuucucucaaus(invAb) 222 CCGUGGUGGACUUCUCUCAAU 296 AM05627-SS (NAG25)scsucguggugGfAfCfuucucucaaus(invAb) 223 CUCGUGGUGGACUUCUCUCAAU 297 AM05629-SS (NAG25)s(invAb)sguggugGfAfCfuucucucaaus(invAb) 224 GUGGUGGACUUCUCUCAAU 298 AM05630-SS (NAG25)s(invAb)sguggugGfAfCfuucucucaauusu(invAb) 225 GUGGUGGACUUCUCUCAAUUU 299 AM05636-SS (NAG25)suscgugguggAfCfUfucucucaauus(invAb) 226 UCGUGGUGGACUUCUCUCAAUU 300 AM05639-SS (NAG25)s(invAb)sugguggAfCfUfucucucaauus(invAb) 227 UGGUGGACUUCUCUCAAUU 301 AM05640-SS (NAG37)s(invAb)sugguggAfCfUfucucucaauus(invAb) 228 UGGUGGACUUCUCUCAAUU 301 AM05746-SS (NAG25)sgsuggacuuCfUfCfucaauuuucus(invAb) 229 GUGGACUUCUCUCAAUUUUCU 302 AM05856-SS (NAG25)s(invAb)scuguagGfCfAfuaaauugguausu(invAb) 230 CUGUAGGCAUAAAUUGGUAUU 278 AM05857-SS (NAG25)s(invAb)sgcuguagGfCfAfuaaauugguausu(invAb) 231 GCUGUAGGCAUAAAUUGGUAUU 303 AM05858-SS (NAG25)s(invAb)sggcuguagGfCfAfuaaauugguausu(invAb) 232 GGCUGUAGGCAUAAAUUGGUAUU 304 AM05859-SS (NAG25)s(invAb)saacuguagGfCfAfuaaauugguausu(invAb) 233 AACUGUAGGCAUAAAUUGGUAUU 305 AM05868-SS (NAG25)s(invAb)ugguggAfCfUfucucucaauausu(invAb) 234 UGGUGGACUUCUCUCAAUAUU 306 AM05869-SS (NAG25)s(invAb)sgugguggAfCfUfucucucaauausu(invAb) 235 GUGGUGGACUUCUCUCAAUAUU 307 AM05870-SS (NAG25)sasaugguggAfCfUfucucucaauausu(invAb) 236 AAUGGUGGACUUCUCUCAAUAUU 308 AM05871-SS (NAG25)scsgugguggAfCfUfucucucaauausu(invAb) 237 CGUGGUGGACUUCUCUCAAUAUU 309 AM05872-SS (NAG31)scsgugguggAfCfUfucucucaauas(invAb) 238 CGUGGUGGACUUCUCUCAAUA 289 AM05879-SS (NAG25)s(invAb)saaguggugGfAfCfuucucucaaus(invAb) 239 AAGUGGUGGACUUCUCUCAAU 283 AM05880-SS (NAG25)s(invAb)sguggugGfAfCfuucucucaaausu(invAb) 240 GUGGUGGACUUCUCUCAAAUU 310 AM05881-SS (NAG25)s(invAb)scguggugGfAfCfuucucucaaausu(invAb) 241 CGUGGUGGACUUCUCUCAAAUU 311 AM05882-SS (NAG25)sasaguggugGfAfCfuucucucaaausu(invAb) 242 AAGUGGUGGACUUCUCUCAAAUU 312 AM05883-SS (NAG25)suscguggugGfAfCfuucucucaaausu(invAb) 243 UCGUGGUGGACUUCUCUCAAAUU 313 AM06146-SS (NAG37)s(invAb)sgugguggAfCfUfucucucaauausu(invAb) 244 GUGGUGGACUUCUCUCAAUAUU 307 AM06147-SS (NAG37)s(invAb)scgugguggAfCfUfucucucaauausu(invAb) 245 CGUGGUGGACUUCUCUCAAUAUU 309 AM06148-SS (NAG37)s(invAb)scucgugguggAfCfUfucucucaauas(invAb) 246 CUCGUGGUGGACUUCUCUCAAUA 314 AM06149-SS (NAG37)s(invAb)scucgugguggAfCfUfucucucaauausu(invAb) 247 CUCGUGGUGGACUUCUCUCAAUAUU 315 AM06150-SS (NAG37)s(invAb)sggcuguagGfCfAfuaaauugguas(invAb) 248 GGCUGUAGGCAUAAAUUGGUA 294 AM06151-SS (NAG37)s(invAb)sgaggcuguagGfCfAfuaaauugguas (invAb) 249 GAGGCUGUAGGCAUAAAUUGGUA 316 AM06152-SS (NAG37)s(invAb)sgaggcuguagGfCfAfuaaauugguausu(invAb) 250 GAGGCUGUAGGCAUAAAUUGGUAUU 317 AM06287-SS (NAG37)s(invAb)sggacuuCfUfCfucaauuuucus(invAb) 251 GGACUUCUCUCAAUUUUCU 318 AM06288-SS (NAG37)s(invAb)sguggacuuCfUfCfucaauuuucus(invAb) 252 GUGGACUUCUCUCAAUUUUCU 302 AM06289-SS (NAG37)s(invAb)sgguggacuuCfUfCfucaauuuucus(invAb) 253 GGUGGACUUCUCUCAAUUUUCU 319 AM06290-SS (NAG37)s(invAb)sggacuuCfUfCfucaauuuucas(invAb) 254 GGACUUCUCUCAAUUUUCA 320 AM06291-SS (NAG37)s(invAb)sguggacuuCfUfCfucaauuuucas(invAb) 255 GUGGACUUCUCUCAAUUUUCA 321 AM06304-SS (NAG37)s(invAb)sgcuguaGfGfCfauaaauuggus(invAb) 256 GCUGUAGGCAUAAAUUGGU 322 AM06305-SS (NAG37)s(invAb)sggcuguaGfGfCfauaaauuggus(invAb) 257 GGCUGUAGGCAUAAAUUGGU 323 AM06306-SS (NAG37)s(invAb)sgaggcuguaGfGfCfauaaauuggus(invAb) 258 GAGGCUGUAGGCAUAAAUUGGU 324 AM06307-SS (NAG37)s(invAb)sgcuguaGfGfCfauaaauuggas(invAb) 259 GCUGUAGGCAUAAAUUGGA 325 AM06308-SS (NAG37)s(invAb)sggcuguaGfGfCfauaaauuggas(invAb) 260 GGCUGUAGGCAUAAAUUGGA 326 AM06603-SS (NAG37)s(invAb)sagcuguagGfCfAfuaaauugguas(invAb) 261 AGCUGUAGGCAUAAAUUGGUA 327 AM06605-SS (NAG37)s(invAb)scgcuguagGfCfAfuaaauugguas(invAb) 262 CGCUGUAGGCAUAAAUUGGUA 328 AM06607-SS (NAG37)s(invAb)sggcuguagGfCfAfuaaauugguus(invAb) 263 GGCUGUAGGCAUAAAUUGGUU 329 AM06609-SS (NAG37)s(invAb)scuguagGfCfAfuaaauugguasuus(invAb) 264 CUGUAGGCAUAAAUUGGUAUU 278 AM06610-SS (NAG37)s(invAb)scuGfuAfgGfCfAfuAfaAfuUfgGfuasuus 265 CUGUAGGCAUAAAUUGGUAUU 278 (invAb) AM06613-SS (NAG37)s(invAb)saggcuguaGfGfCfauaaauuggus(invAb) 266 AGGCUGUAGGCAUAAAUUGGU 330 AM06615-SS (NAG37)s(invAb)saggcuguaGfGfCfauaaauuggas(invAb) 267 AGGCUGUAGGCAUAAAUUGGA 331 AM06617-SS (NAG37)s(invAb)scggcuguaGfGfCfauaaauuggus(invAb) 268 CGGCUGUAGGCAUAAAUUGGU 332 AM06619-SS (NAG37)s(invAb)scggcuguaGfGfCfauaaauuggas(invAb) 269 CGGCUGUAGGCAUAAAUUGGA 333 AM06750-SS (NAG37)s(invAb)scccuguagGfCfAfuaaauugguas(invAb) 270 CCCUGUAGGCAUAAAUUGGUA 334 AM06752-SS (NAG37)csgcuguagGfCfAfuaaauugguas(invAb) 271 CGCUGUAGGCAUAAAUUGGUA 328 AM06753-SS (NAG37)csccuguagGfCfAfuaaauugguas(invAb) 272 CCCUGUAGGCAUAAAUUGGUA 334 AM06776-SS (NAG25)s(invAb)sguggacuuCfUfCfucaauuuucus(invAb) 273 GUGGACUUCUCUCAAUUUUCU 302 AM06777-SS (NAG25)s(invAb)scgcuguagGfCfAfuaaauugguas(invAb) 274 CGCUGUAGGCAUAAAUUGGUA 328

[0621] The HBV RNAi agents described herein are formed by annealing an antisense strand with a sense strand. A sense strand containing a sequence listed in Table 4 can be hybridized to any antisense strand containing a sequence listed in Table 3, provided the two sequences have a region of at least about 85% complementarity over a contiguous 16, 17, 18, 19, 20, or 21 nucleotide sequence.

[0622] In some embodiments, the antisense strand of an HBV RNAi agent disclosed herein differs by 0, 1, 2, or 3 nucleotides from any of the antisense strand sequences in Table 3. In some embodiments, the sense strand of an HBV RNAi agent disclosed herein differs by 0, 1, 2, or 3 nucleotides from any of the sense strand sequences in Table 4.

[0623] In some embodiments, an HBV RNAi agent antisense strand comprises a nucleotide sequence of any of the sequences in Table 3. In some embodiments, an HBV RNAi agent antisense strand comprises the sequence of nucleotides (from 5′ end.fwdarw.3′ end) 1-17, 2-17, 1-18, 2-18, 1-19, 2-19, 1-20, 2-20, 1-21, 2-21, 1-22, 2-22, 1-23, 2-23, 1-24, 2-24, 1-25, 2-25, 1-26, or 2-26 of any of the sequences in Table 3.

[0624] In some embodiments, an HBV RNAi agent sense strand comprises the nucleotide sequence of any of the sequences in Table 4. In some embodiments, an HBV RNAi agent sense strand comprises the sequence of nucleotides (from 5′ end.fwdarw.3′ end) 1-17, 2-17, 3-17, 4-17, 1-18, 2-18, 3-18, 4-18, 1-19, 2-19, 3-19, 4-19, 1-20, 2-20, 3-20, 4-20, 1-21, 2-21, 3-21, 4-21, 1-22, 2-22, 3-22, 4-22, 1-23, 2-23, 3-23, 4-23, 1-24, 2-24, 3-24, 4-24, 1-25, 2-25, 3-25, 4-25, 1-26, 2-26, 3-26, or 4-26 of any of the sequences in Table 4.

[0625] For the HBV RNAi agents disclosed herein, the nucleotide at position 1 of the antisense strand (from 5′ end.fwdarw.3′ end) can be perfectly complementary to an HBV gene, or can be non-complementary to an HBV gene. In some embodiments, the nucleotide at position 1 of the antisense strand (from 5′ end.fwdarw.3′ end) is a U, A, or dT. In some embodiments, the nucleotide at position 1 of the antisense strand (from 5′ end.fwdarw.3′ end) forms an A:U or U:A base pair with the sense strand.

[0626] In some embodiments, an HBV RNAi agent antisense strand comprises the sequence of nucleotides (from 5′ end.fwdarw.3′ end) 2-18 or 2-19 of any of the antisense strand sequences in Table 3. In some embodiments, an HBV RNAi sense strand comprises the sequence of nucleotides (from 5′ end.fwdarw.3′ end) 1-17 or 1-18 of any of the sense strand sequences in Table 4.

[0627] In some embodiments, an HBV RNAi agent includes (i) an antisense strand comprising the sequence of nucleotides (from 5′ end.fwdarw.3′ end) 2-18 or 2-19 of any of the antisense strand sequences in Table 3, and (ii) a sense strand comprising the sequence of nucleotides (from 5′ end.fwdarw.3′ end) 1-17 or 1-18 of any of the sense strand sequences in Table 4.

[0628] A sense strand containing a sequence listed in Table 4 can be hybridized to any antisense strand containing a sequence listed in Table 3 provided the two sequences have a region of at least about 85% complementarity over a contiguous 16, 17, 18, 19, 20, or 21 nucleotide sequence. Representative sequence pairings are exemplified by the Duplex ID Nos. shown in Table 5.

[0629] In some embodiments, an HBV RNAi agent comprises of any of the Duplex ID Nos. presented herein. In some embodiments, an HBV RNAi agent consists of any of the Duplex ID Nos. presented herein. In some embodiments, an HBV RNAi agent comprises the sense strand and/or the antisense strand nucleotide sequences of any of the Duplex ID Nos. presented herein. In some embodiments, an HBV RNAi agent comprises the sense strand and antisense strand nucleotide sequences of any of the Duplex ID Nos. presented herein and a targeting group and/or linking group wherein the targeting group and/or linking group is covalently linked (i.e. conjugated) to the sense strand or the antisense strand. In some embodiments, an HBV RNAi agent comprises the sense strand and antisense strand modified nucleotide sequences of any of the Duplex ID Nos. presented herein. In some embodiments, an HBV RNAi agent comprises the sense strand and antisense strand modified nucleotide sequences of any of the Duplex ID Nos. presented herein and a targeting group and/or linking group wherein the targeting group and/or linking group is covalently linked to the sense strand or the antisense strand.

[0630] In some embodiments, an HBV RNAi agent comprises an antisense strand and a sense strand having the nucleotide sequences of any of the antisense strand/sense strand duplexes of Table 5, and further comprises an asialoglycoprotein receptor ligand targeting group.

[0631] In some embodiments, an HBV RNAi agent comprises an antisense strand and a sense strand having the nucleotide sequences of any of the antisense strand and/or sense strand nucleotide sequences of any of the duplexes of Table 5, and further comprises a targeting group selected from the group consisting of (PAZ), (NAG13), (NAG13)s, (NAG18), (NAG18)s, (NAG24), (NAG24)s, (NAG25), (NAG25)s, (NAG26), (NAG26)s, (NAG27), (NAG27)s, (NAG28), (NAG28)s, (NAG29), (NAG29)s, (NAG30), (NAG30)s, (NAG31), (NAG31)s, (NAG32), (NAG32)s, (NAG33), (NAG33)s, (NAG34), (NAG34)s, (NAG35), (NAG35)s, (NAG36), (NAG36)s, (NAG37), (NAG37)s.

[0632] In some embodiments, an HBV RNAi agent comprises an antisense strand and a sense strand having the modified nucleotide sequences of any of the antisense strand and/or sense strand nucleotide sequences of any of the duplexes of Table 5.

[0633] In some embodiments, an HBV RNAi agent comprises an antisense strand and a sense strand having the modified nucleotide sequences of any of the antisense strand and/or sense strand nucleotide sequences of any of the duplexes of Table 5, and further comprises an asialoglycoprotein receptor ligand targeting group.

[0634] In some embodiments, an HBV RNAi agent comprises any of the duplexes of Table 5.

[0635] In some embodiments, an HBV RNAi agent consists of any of the duplexes of Table 5.

TABLE-US-00005 TABLE 5 Examples of HBV RNAi agent duplexes. Duplex ID Antisense Strand ID Sense Strand ID AD03498 AM03508-AS AM04445-SS AD03499 AM04441-AS AM04444-SS AD03500 AM04442-AS AM04444-SS AD03501 AM04443-AS AM04444-SS AD03738 AM04768-AS AM04767-SS AD03739 AM04769-AS AM04767-SS AD03967 AM04443-AS AM05010-SS AD03968 AM05011-AS AM05010-SS AD03969 AM04443-AS AM05015-SS AD03970 AM05011-AS AM05019-SS AD03971 AM05012-AS AM05015-SS AD03972 AM04443-AS AM05016-SS AD03973 AM04443-AS AM05017-SS AD03974 AM04443-AS AM05018-SS AD03975 AM05013-AS AM05015-SS AD03976 AM05014-AS AM05019-SS AD03977 AM05013-AS AM05017-SS AD03978 AM05013-AS AM04444-SS AD04001 AM05052-AS AM05034-SS AD04002 AM05053-AS AM05034-SS AD04003 AM05054-AS AM05046-SS AD04004 AM05052-AS AM05047-SS AD04005 AM05055-AS AM05064-SS AD04006 AM05056-AS AM05048-SS AD04007 AM05057-AS AM05048-SS AD04008 AM05058-AS AM05049-SS AD04009 AM05056-AS AM05050-SS AD04010 AM05060-AS AM05063-SS AD04176 AM05351-AS AM05346-SS AD04177 AM04443-AS AM05347-SS AD04178 AM05011-AS AM05347-SS AD04412 AM05011-AS AM05606-SS AD04413 AM05011-AS AM05607-SS AD04414 AM05608-AS AM05606-SS AD04415 AM05011-AS AM05615-SS AD04416 AM05609-AS AM05616-SS AD04417 AM05610-AS AM05616-SS AD04418 AM05611-AS AM05616-SS AD04419 AM05612-AS AM05616-SS AD04420 AM05613-AS AM05616-SS AD04421 AM05614-AS AM05616-SS AD04422 AM05054-AS AM05617-SS AD04423 AM05618-AS AM05046-SS AD04425 AM05621-AS AM05620-SS AD04426 AM05623-AS AM05622-SS AD04427 AM05623-AS AM05624-SS AD04428 AM05626-AS AM05622-SS AD04429 AM05626-AS AM05624-SS AD04430 AM05628-AS AM05627-SS AD04431 AM05054-AS AM05629-SS AD04432 AM05054-AS AM05630-SS AD04433 AM05631-AS AM05048-SS AD04434 AM05632-AS AM05048-SS AD04435 AM05633-AS AM05048-SS AD04436 AM05635-AS AM05048-SS AD04437 AM05634-AS AM05048-SS AD04438 AM05637-AS AM05636-SS AD04439 AM05638-AS AM05636-SS AD04440 AM05058-AS AM05639-SS AD04441 AM05057-AS AM05639-SS AD04442 AM05057-AS AM05640-SS AD04511 AM05747-AS AM05746-SS AD04570 AM05011-AS AM05856-SS AD04571 AM05849-AS AM05856-SS AD04572 AM05850-AS AM05856-SS AD04573 AM05851-AS AM05857-SS AD04574 AM05852-AS AM05857-SS AD04575 AM05853-AS AM05858-SS AD04576 AM05854-AS AM05858-SS AD04577 AM05011-AS AM05859-SS AD04578 AM05850-AS AM05858-SS AD04579 AM05014-AS AM05347-SS AD04580 AM05855-AS AM05347-SS AD04581 AM05860-AS AM05063-SS AD04583 AM05862-AS AM05868-SS AD04584 AM05863-AS AM05868-SS AD04585 AM05864-AS AM05869-SS AD04586 AM05865-AS AM05869-SS AD04587 AM05862-AS AM05870-SS AD04588 AM05863-AS AM05871-SS AD04590 AM05867-AS AM05063-SS AD04591 AM05860-AS AM05872-SS AD04592 AM05054-AS AM05879-SS AD04593 AM05873-AS AM05880-SS AD04594 AM05874-AS AM05880-SS AD04595 AM05875-AS AM05881-SS AD04596 AM05876-AS AM05881-SS AD04597 AM05873-AS AM05882-SS AD04598 AM05874-AS AM05883-SS AD04599 AM05877-AS AM05620-SS AD04734 AM06074-AS AM05869-SS AD04771 AM06142-AS AM06146-SS AD04772 AM06143-AS AM06147-SS AD04773 AM06144-AS AM06146-SS AD04774 AM06145-AS AM06148-SS AD04775 AM06145-AS AM06149-SS AD04776 AM05850-AS AM06150-SS AD04777 AM05854-AS AM06151-SS AD04778 AM05854-AS AM06152-SS AD04822 AM06222-AS AM06146-SS AD04823 AM05609-AS AM06150-SS AD04871 AM06281-AS AM06287-SS AD04872 AM06282-AS AM06288-SS AD04873 AM06283-AS AM06288-SS AD04874 AM06284-AS AM06289-SS AD04875 AM06285-AS AM06290-SS AD04876 AM06286-AS AM06291-SS AD04881 AM06299-AS AM06304-SS AD04882 AM06300-AS AM06305-SS AD04883 AM06301-AS AM06306-SS AD04884 AM06302-AS AM06307-SS AD04885 AM06303-AS AM06308-SS AD04962 AM05864-AS AM06146-SS AD04963 AM05855-AS AM05607-SS AD04981 AM06463-AS AM06150-SS AD04982 AM06464-AS AM06150-SS AD04983 AM06465-AS AM06150-SS AD05069 AM06604-AS AM06603-SS AD05070 AM06606-AS AM06605-SS AD05071 AM06608-AS AM06607-SS AD05072 AM05011-AS AM06609-SS AD05073 AM06611-AS AM06610-SS AD05074 AM06612-AS AM06150-SS AD05075 AM06614-AS AM06613-SS AD05076 AM06616-AS AM06615-SS AD05077 AM06618-AS AM06617-SS AD05078 AM06620-AS AM06619-SS AD05147 AM06751-AS AM06750-SS AD05148 AM06606-AS AM06752-SS AD05149 AM06751-AS AM06753-SS AD05164 AM06282-AS AM06776-SS AD05165 AM06606-AS AM06777-SS

[0636] In some embodiments, an HBV RNAi agent is prepared or provided as a salt, mixed salt, or a free-acid. The RNAi agents described herein, upon delivery to a cell expressing an HBV gene, inhibit or knockdown expression of one or more HBV genes in vivo.

Targeting Groups, Linking Groups, and Delivery Vehicles

[0637] In some embodiments, an HBV RNAi agent is conjugated to one or more non-nucleotide groups including, but not limited to a targeting group, linking group, delivery polymer, or a delivery vehicle. The non-nucleotide group can enhance targeting, delivery or attachment of the RNAi agent. Examples of targeting groups and linking groups are provided in Table 6. The non-nucleotide group can be covalently linked to the 3′ and/or 5′ end of either the sense strand and/or the antisense strand. In some embodiments, an HBV RNAi agent contains a non-nucleotide group linked to the 3′ and/or 5′ end of the sense strand. In some embodiments, a non-nucleotide group is linked to the 5′ end of an HBV RNAi agent sense strand. A non-nucleotide group may be linked directly or indirectly to the RNAi agent via a linker/linking group. In some embodiments, a non-nucleotide group is linked to the RNAi agent via a labile, cleavable, or reversible bond or linker.

[0638] In some embodiments, a non-nucleotide group enhances the pharmacokinetic or biodistribution properties of an RNAi agent or conjugate to which it is attached to improve cell- or tissue-specific distribution and cell-specific uptake of the conjugate. In some embodiments, a non-nucleotide group enhances endocytosis of the RNAi agent.

[0639] Targeting groups or targeting moieties enhance the pharmacokinetic or biodistribution properties of a conjugate to which they are attached to improve cell-specific distribution and cell-specific uptake of the conjugate. A targeting group can be monovalent, divalent, trivalent, tetravalent, or have higher valency. Representative targeting groups include, without limitation, compounds with affinity to cell surface molecule, cell receptor ligands, hapten, antibodies, monoclonal antibodies, antibody fragments, and antibody mimics with affinity to cell surface molecules. In some embodiments, a targeting group is linked to an RNAi agent using a linker, such as a PEG linker or one, two, or three abasic and/or ribitol (abasic ribose) groups. In some embodiments, a targeting group comprises a galactose derivative cluster.

[0640] The HBV RNAi agents described herein may be synthesized having a reactive group, such as an amine group, at the 5′-terminus. The reactive group may be used to subsequently attach a targeting moiety using methods typical in the art.

[0641] In some embodiments, a targeting group comprises an asialoglycoprotein receptor ligand. In some embodiments, an asialoglycoprotein receptor ligand includes or consists of one or more galactose derivatives. As used herein, the term galactose derivative includes both galactose and derivatives of galactose having affinity for the asialoglycoprotein receptor that is equal to or greater than that of galactose. Galactose derivatives include, but are not limited to: galactose, galactosamine, N-formylgalactosamine, N-acetyl-galactosamine, N-propionyl-galactosamine, N-n-butanoyl-galactosamine, and N-iso-butanoylgalactos-amine (see for example: Iobst, S. T. and Drickamer, K. J. B. C. 1996, 271, 6686). Galactose derivatives, and clusters of galactose derivatives, that are useful for in vivo targeting of oligonucleotides and other molecules to the liver are known in the art (see, for example, Baenziger and Fiete, 1980, Cell, 22, 611-620; Connolly et al., 1982, J. Biol. Chem., 257, 939-945). Galactose derivatives have been used to target molecules to hepatocytes in vivo through their binding to the asialoglycoprotein receptor (ASGPr) expressed on the surface of hepatocytes. Binding of ASGPr ligands to the ASGPr(s) facilitates cell-specific targeting to hepatocytes and endocytosis of the molecule into hepatocytes. ASGPr ligands can be monomeric (e.g., having a single galactose derivative) or multimeric (e.g., having multiple galactose derivatives). The galactose derivative or galactose derivative cluster may be attached to the 3′ or 5′ end of the RN Ai polynucleotide using methods known in the art. The preparation of targeting groups, such as galactose derivative clusters, is described in, for example, U.S. patent application Ser. Nos. 15/452,324 and 15/452,423, the contents of both of which are incorporated herein in their entirety.

[0642] As used herein, a galactose derivative cluster comprises a molecule having two to four terminal galactose derivatives. A terminal galactose derivative is attached to a molecule through its C-1 carbon. In some embodiments, the galactose derivative cluster is a galactose derivative trimer (also referred to as tri-antennary galactose derivative or tri-valent galactose derivative). In some embodiments, the galactose derivative cluster comprises N-acetyl-galactosamines. In some embodiments, the galactose derivative cluster comprises three N-acetyl-galactosamines. In some embodiments, the galactose derivative cluster is a galactose derivative tetramer (also referred to as tetra-antennary galactose derivative or tetra-valent galactose derivative). In some embodiments, the galactose derivative cluster comprises four N-acetyl-galactosamines.

[0643] As used herein, a galactose derivative trimer contains three galactose derivatives, each linked to a central branch point. As used herein, a galactose derivative tetramer contains four galactose derivatives, each linked to a central branch point. The galactose derivatives can be attached to the central branch point through the C-1 carbons of the saccharides. In some embodiments, the galactose derivatives are linked to the branch point via linkers or spacers. In some embodiments, the linker or spacer is a flexible hydrophilic spacer, such as a PEG group (see, for example, U.S. Pat. No. 5,885,968; Biessen et al. J. Med. Chem. 1995 Vol. 39 p. 1538-1546). In some embodiments, the PEG spacer is a PEGS spacer. The branch point can be any small molecule which permits attachment of three galactose derivatives and further permits attachment of the branch point to the RNAi agent. An example of branch point group is a di-lysine or di-glutamate. Attachment of the branch point to the RNAi agent can occur through a linker or spacer. In some embodiments, the linker or spacer comprises a flexible hydrophilic spacer, such as, but not limited to, a PEG spacer. In some embodiments, the linker comprises a rigid linker, such as a cyclic group. In some embodiments, a galactose derivative comprises or consists of N-acetyl-galactosamine. In some embodiments, the galactose derivative cluster is comprised of a galactose derivative tetramer, which can be, for example, an N-acetyl-galactosamine tetramer.

[0644] In some embodiments, pharmaceutical compositions for delivering an HBV RNAi agent to a liver cell in vivo are described. Such pharmaceutical compositions can include, for example, an HBV RNAi agent conjugated to a galactose derivative cluster. In some embodiments, the galactose derivative cluster is comprised of a galactose derivative trimer, which can be, for example, an N-acetyl-galactosamine trimer, or galactose derivative tetramer, which can be, for example, an N-acetyl-galactosamine tetramer.

[0645] Targeting groups include, but are not limited to, (PAZ), (NAG13), (NAG13)s, (NAG18), (NAG18)s, (NAG24), (NAG24)s, (NAG25), (NAG25)s, (NAG26), (NAG26)s, (NAG27), (NAG27)s, (NAG28), (NAG28)s, (NAG29), (NAG29)s, (NAG30), (NAG30)s, (NAG31), (NAG31)s, (NAG32), (NAG32)s, (NAG33), (NAG33)s, (NAG34), (NAG34)s, (NAG35), (NAG35)s, (NAG36), (NAG36)s, (NAG37), (NAG37)s, (NAG38), (NAG38)s, (NAG39), and (NAG39)s. Other targeting groups, including galactose cluster targeting ligands, are known in the art.

[0646] In some embodiments, a linking group is conjugated to the RNAi agent. The linking group facilitates covalent linkage of the agent to a targeting group or delivery polymer or delivery vehicle. The linking group can be linked to the 3′ or the 5′ end of the RNAi agent sense strand or antisense strand. In some embodiments, the linking group is linked to the RNAi agent sense strand. In some embodiments, the linking group is conjugated to the 5′ or 3′ end of an RNAi agent sense strand. In some embodiments, a linking group is conjugated to the 5′ end of an RNAi agent sense strand. Examples of linking groups, include, but are not limited to: reactive groups such a primary amines and alkynes, alkyl groups, abasic nucleosides, ribitol (abasic ribose), and/or PEG groups.

[0647] A linker or linking group is a connection between two atoms that links one chemical group (such as an RNAi agent) or segment of interest to another chemical group (such as a targeting group or delivery polymer) or segment of interest via one or more covalent bonds. A labile linkage contains a labile bond. A linkage may optionally include a spacer that increases the distance between the two joined atoms. A spacer may further add flexibility and/or length to the linkage. Spacers may include, but are not be limited to, alkyl groups, alkenyl groups, alkynyl groups, aryl groups, aralkyl groups, aralkenyl groups, and aralkynyl groups; each of which can contain one or more heteroatoms, heterocycles, amino acids, nucleotides, and saccharides. Spacer groups are well known in the art and the preceding list is not meant to limit the scope of the description.

[0648] Any of the HBV RNAi agent nucleotide sequences listed in Tables 3 and 4, whether modified or unmodified, may contain 3′ or 5′ targeting group and/or linking group. Any of the HBV RNAi agent sequences listed in Table 3 and 4 which contain a 3′ or 5′ targeting group and/or linking group, may alternatively contain no 3′ or 5′ targeting group and/or linking group, or may contain a different 3′ or 5′ targeting group and/or linking group including, but not limited to, those depicted in Table 3. Any of the HBV RNAi agent duplexes listed in Table 5, whether modified or unmodified, may further comprise a targeting group and/or linking group, including, but not limited to, those depicted in Table 3, and the targeting group or linking group may be attached to the 3′ or 5′ terminus of either the sense strand or the antisense strand of the HBV RNAi agent duplex.

[0649] Examples of targeting groups and linking groups are provided in Table 6. Table 4 provides several embodiments of HBV RNAi agent sense strands having a targeting group or linking group linked to the 5′ or 3′ end.

TABLE-US-00006 TABLE 6 Structures representing various modified nucleotides, targeting groups, and linking groups. [00001]embedded image [00002]embedded image [00003]embedded image [00004]embedded image [00005]embedded image [00006]embedded image [00007]embedded image [00008]embedded image [00009]embedded image [00010]embedded image [00011]embedded image [00012]embedded image [00013]embedded image [00014]embedded image [00015]embedded image [00016]embedded image [00017]embedded image [00018]embedded image [00019]embedded image [00020]embedded image [00021]embedded image [00022]embedded image [00023]embedded image [00024]embedded image [00025]embedded image [00026]embedded image [00027]embedded image [00028]embedded image [00029]embedded image [00030]embedded image [00031]embedded image [00032]embedded image [00033]embedded image [00034]embedded image [00035]embedded image [00036]embedded image [00037]embedded image [00038]embedded image [00039]embedded image [00040]embedded image [00041]embedded image [00042]embedded image [00043]embedded image [00044]embedded image [00045]embedded image [00046]embedded image

[0650] In each of the above structures in Table 6, NAG comprises an N-acetyl-galactosamine or another ASGPr ligand, as would be understood by a person of ordinary skill in the art to be attached in view of the structures above and description provided herein. For example, in some embodiments, NAG in the structures provided in Table 6 is represented by the following structure:

##STR00047##

[0651] Each (NAGx) may be attached to an HBV RNAi agent via a phosphate group (as in (NAG25), (NAG30), and (NAG31)), or a phosphorothioate group, (as is (NAG25)s, (NAG29)s, (NAG30)s, (NAG31)s, or (NAG37)s), or another linking group.

##STR00048##

[0652] Other linking groups known in the art may be used.

Delivery Vehicles

[0653] In another aspect, the methods described herein further comprises a delivery vehicle. In some embodiments, the delivery vehicle may be used to deliver an RNAi agent to a cell or tissue. A delivery vehicle is a compound that improves delivery of the RNAi agent to a cell or tissue. A delivery vehicle can include, or consist of, but is not limited to: a polymer, such as an amphipathic polymer, a membrane active polymer, a peptide, a melittin peptide, a melittin-like peptide (MLP), a lipid, a reversibly modified polymer or peptide, or a reversibly modified membrane active polyamine.

[0654] In some embodiments, the RNAi agents can be combined with lipids, nanoparticles, polymers, liposomes, micelles, DPCs or other delivery systems available in the art. The RNAi agents can also be chemically conjugated to targeting groups, lipids (including, but not limited to cholesterol and cholesteryl derivatives), nanoparticles, polymers, liposomes, micelles, DPCs (see, for example WO 2000/053722, WO 2008/0022309, WO 2011/104169, and WO 2012/083185, WO 2013/032829, WO 2013/158141, each of which is incorporated herein by reference), or other delivery systems available in the art.

Pharmaceutical Compositions and Formulations

[0655] In another aspect, methods described herein comprise one or more HBV RNAi agents, wherein the one or more HBV agents are prepared as pharmaceutical compositions or formulations. In some embodiments, pharmaceutical compositions include at least one HBV RNAi agent. These pharmaceutical compositions are particularly useful in the inhibition of the expression of the target mRNA in a target cell, a group of cells, a tissue, or an organism. The pharmaceutical compositions can be used to treat a subject having a disease or disorder that would benefit from reduction in the level of the target mRNA, or inhibition in expression of the target gene. The pharmaceutical compositions can be used to treat a subject at risk of developing a disease or disorder that would benefit from reduction of the level of the target mRNA or an inhibition in expression the target gene. In one embodiment, the method includes administering an HBV RNAi agent linked to a targeting ligand as described herein, to a subject to be treated. In some embodiments, one or more pharmaceutically acceptable excipients (including vehicles, carriers, diluents, and/or delivery polymers) are added to the pharmaceutical compositions including an HBV RNAi agent, thereby forming a pharmaceutical formulation suitable for in vivo delivery to a human.

[0656] The pharmaceutical compositions that include an HBV RNAi agent and methods disclosed herein may decrease the level of the target mRNA in a cell, group of cells, group of cells, tissue, or subject, including: administering to the subject a therapeutically effective amount of a herein described HBV RNAi agent, thereby inhibiting the expression of a target mRNA in the subject.

[0657] In some embodiments, the described pharmaceutical compositions including an HBV RNAi agent are used for treating or managing clinical presentations associated with HBV infection. In some embodiments, a therapeutically or prophylactically effective amount of one or more of pharmaceutical compositions is administered to a subject in need of such treatment, prevention or management. In some embodiments, administration of any of the disclosed HBV RNAi agents can be used to decrease the number, severity, and/or frequency of symptoms of a disease in a subject.

[0658] The described pharmaceutical compositions including an HBV RNAi agent can be used to treat at least one symptom in a subject having a disease or disorder that would benefit from reduction or inhibition in expression of HBV mRNA. In some embodiments, the subject is administered a therapeutically effective amount of one or more pharmaceutical compositions including an HBV RNAi agent thereby treating the symptom. In other embodiments, the subject is administered a prophylactically effective amount of one or more HBV RNAi agents, thereby preventing the at least one symptom.

[0659] The route of administration is the path by which an HBV RNAi agent is brought into contact with the body. In general, methods of administering drugs and nucleic acids for treatment of a mammal are well known in the art and can be applied to administration of the compositions described herein. The HBV RNAi agents disclosed herein can be administered via any suitable route in a preparation appropriately tailored to the particular route. Thus, herein described pharmaceutical compositions can be administered by injection, for example, intravenously, intramuscularly, intracutaneously, subcutaneously, intraarticularly, or intraperitoneally. In some embodiments, there herein described pharmaceutical compositions via subcutaneous injection.

[0660] The pharmaceutical compositions including an HBV RNAi agent described herein can be delivered to a cell, group of cells, tumor, tissue, or subject using oligonucleotide delivery technologies known in the art. In general, any suitable method recognized in the art for delivering a nucleic acid molecule (in vitro or in vivo) can be adapted for use with a herein described compositions. For example, delivery can be by local administration, (e.g., direct injection, implantation, or topical administering), systemic administration, or subcutaneous, intravenous, intraperitoneal, or parenteral routes, including intracranial (e.g., intraventricular, intraparenchymal and intrathecal), intramuscular, transdermal, airway (aerosol), nasal, oral, rectal, or topical (including buccal and sublingual) administration. In certain embodiments, the compositions are administered by subcutaneous or intravenous infusion or injection.

[0661] Accordingly, in some embodiments, the herein described pharmaceutical compositions may comprise one or more pharmaceutically acceptable excipients. In some embodiments, the pharmaceutical compositions described herein can be formulated for administration to a subject.

[0662] As used herein, a pharmaceutical composition or medicament includes a pharmacologically effective amount of at least one of the described therapeutic compounds and one or more pharmaceutically acceptable excipients. Pharmaceutically acceptable excipients (excipients) are substances other than the Active Pharmaceutical ingredient (API, therapeutic product, e.g., HBV RNAi agent) that are intentionally included in the drug delivery system. Excipients do not exert or are not intended to exert a therapeutic effect at the intended dosage. Excipients may act to a) aid in processing of the drug delivery system during manufacture, b) protect, support or enhance stability, bioavailability or patient acceptability of the API, c) assist in product identification, and/or d) enhance any other attribute of the overall safety, effectiveness, of delivery of the API during storage or use. A pharmaceutically acceptable excipient may or may not be an inert substance.

[0663] Excipients include, but are not limited to: absorption enhancers, anti-adherents, anti-foaming agents, anti-oxidants, binders, buffering agents, carriers, coating agents, colors, delivery enhancers, delivery polymers, dextran, dextrose, diluents, disintegrants, emulsifiers, extenders, fillers, flavors, glidants, humectants, lubricants, oils, polymers, preservatives, saline, salts, solvents, sugars, suspending agents, sustained release matrices, sweeteners, thickening agents, tonicity agents, vehicles, water-repelling agents, and wetting agents.

[0664] Pharmaceutical compositions suitable for injectable use include sterile aqueous solutions (where water soluble) or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersion. For intravenous administration, suitable carriers include physiological saline, bacteriostatic water, Cremophor ELTM (BASF, Parsippany, N.J.) or phosphate buffered saline. It should be stable under the conditions of manufacture and storage and should be preserved against the contaminating action of microorganisms such as bacteria and fungi. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyethylene glycol), and suitable mixtures thereof. The proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants. In many cases, it will be preferable to include isotonic agents, for example, sugars, polyalcohols such as mannitol, sorbitol, and sodium chloride in the composition. Prolonged absorption of the injectable compositions can be brought about by including in the composition an agent which delays absorption, for example, aluminum monostearate and gelatin.

[0665] Sterile injectable solutions can be prepared by incorporating the active compound in the required amount in an appropriate solvent with one or a combination of ingredients enumerated above, as required, followed by filter sterilization. Generally, dispersions are prepared by incorporating the active compound into a sterile vehicle which contains a basic dispersion medium and the required other ingredients from those enumerated above. In the case of sterile powders for the preparation of sterile injectable solutions, methods of preparation include vacuum drying and freeze-drying which yields a powder of the active ingredient plus any additional desired ingredient from a previously sterile-filtered solution thereof.

[0666] Formulations suitable for intra-articular administration can be in the form of a sterile aqueous preparation of the drug that can be in microcrystalline form, for example, in the form of an aqueous microcrystalline suspension. Liposomal formulations or biodegradable polymer systems can also be used to present the drug for both intra-articular and ophthalmic administration.

[0667] The active compounds can be prepared with carriers that will protect the compound against rapid elimination from the body, such as a controlled release formulation, including implants and microencapsulated delivery systems. Biodegradable, biocompatible polymers can be used, such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and polylactic acid. Methods for preparation of such formulations will be apparent to those skilled in the art. Liposomal suspensions can also be used as pharmaceutically acceptable carriers. These can be prepared according to methods known to those skilled in the art, for example, as described in U.S. Pat. No. 4,522,811.

[0668] The HBV RNAi agents can be formulated in compositions in dosage unit form for ease of administration and uniformity of dosage. Dosage unit form refers to physically discrete units suited as unitary dosages for the subject to be treated; each unit containing a predetermined quantity of active compound calculated to produce the desired therapeutic effect in association with the required pharmaceutical carrier. The specification for the dosage unit forms of the disclosure are dictated by and directly dependent on the unique characteristics of the active compound and the therapeutic effect to be achieved, and the limitations inherent in the art of compounding such an active compound for the treatment of individuals.

[0669] A pharmaceutical composition can contain other additional components commonly found in pharmaceutical compositions. Such additional components include, but are not limited to: anti-pruritics, astringents, local anesthetics, or anti-inflammatory agents (e.g., antihistamine, diphenhydramine, etc.). It is also envisioned that cells, tissues or isolated organs that express or comprise the herein defined RNAi agents may be used as “pharmaceutical compositions.” As used herein, “pharmacologically effective amount,” “therapeutically effective amount,” or simply “effective amount” refers to that amount of an RNAi agent to produce a pharmacological, therapeutic or preventive result.

[0670] Generally, an effective amount of an active compound will be in the range of from about 0.1 to about 100 mg/kg of body weight/day, e.g., from about 1.0 to about 50 mg/kg of body weight/day. In some embodiments, an effective amount of an active compound will be in the range of from about 0.25 to about 5 mg/kg of body weight per dose. In some embodiments, an effective amount of an active compound will be in the range of 25-400 mg per 1-18 weeks or 1-6 months. In some embodiments, an effective amount of an active compound will be in the range of 50-125 mg per 4 weeks or per one month. In some embodiments, an effective amount of an active compound will be in the range of 40-200 mg per 4 weeks or per one month. In some embodiments, an effective amount of an active compound will be 40 mg per 4 weeks or per one month. In some embodiments, an effective amount of an active compound will be 100 mg per 4 weeks or per one month. In some embodiments, an effective amount of an active compound will be 200 mg per 4 weeks or per one month. In some embodiments, an effective amount of an active ingredient will be in the range of from about 0.5 to about 3 mg/kg of body weight per dose. In some embodiments, an effective amount of an active ingredient will be in the range of from about 25-400 mg per dose. In some embodiments, an effective amount of an active ingredient will be in the range of from about 50-125 mg per dose. In some embodiments, an effective amount of an active ingredient will be about 35 mg, 50 mg, 100 mg, 200 mg, 300 mg or 400 mg per dose. In some embodiments, an effective amount of an active ingredient will be about 40 mg, 100 mg, or 200 mg per dose. The amount administered will also likely depend on such variables as the overall health status of the patient, the relative biological efficacy of the compound delivered, the formulation of the drug, the presence and types of excipients in the formulation, and the route of administration. Also, it is to be understood that the initial dosage administered can be increased beyond the above upper level in order to rapidly achieve the desired blood-level or tissue level, or the initial dosage can be smaller than the optimum.

[0671] The one or more (e.g., at least two) HBV RNAi agents described herein can be formulated into one single composition or separate individual compositions. In some embodiments, the HBV RNAi agents in separate individual compositions can be formulated with the same or different excipients and carriers. In some embodiments, the HBV RNAi agents in separate individual compositions agents can be administered through same or different administration routes. In some embodiments, the HBV RNAi agents are administered subcutaneously.

[0672] For treatment of disease or for formation of a medicament or composition for treatment of a disease, the pharmaceutical compositions described herein including an HBV RNAi agent can be combined with an excipient or with a second therapeutic agent or treatment including, but not limited to: a second or other RNAi agent, a small molecule drug, an antibody, an antibody fragment, and/or a vaccine.

[0673] The described HBV RNAi agents, when added to pharmaceutically acceptable excipients or adjuvants, can be packaged into kits, containers, packs, or dispensers. The pharmaceutical compositions described herein may be packaged in pre-filled syringes or vials.

Methods of Treatment and Inhibition of Expression

[0674] Described herein are methods for treating a subject (e.g., a human or mammal) having a disease or disorder that would benefit from administration of the compound comprising administering one or more HBV RNAi agents described herein to the subject. In some embodiments, the subject (e.g., a human) has a disease or disorder that would benefit from reduction or inhibition in expression of HBV mRNA. The subject is administered a therapeutically effective amount of any one or more RNAi agents. The subject can be a human, patient, or human patient. The subject may be an adult, adolescent, child, or infant. Also described herein are methods for treating a subject in need thereof comprising administering a pharmaceutical composition described herein, wherein the pharmaceutical composition comprises an HBV RNAi agent. Such methods include administration of a pharmaceutical composition described herein to a human being or animal.

[0675] In some embodiments, the symptoms and diseases associated with an HBV infection include but are not limited to chronic liver diseases/disorders, inflammations, fibrotic conditions, proliferative disorders (including cancers, such as hepatocellular carcinoma), Hepatitis D Virus (HDV) infection, and acute HBV infection. In some embodiments, the symptoms and diseases are associated with chronic HBV infection and/or HDV infection. In some embodiments, the subject has been tested for HBV infection for at least 6-12 months. In some embodiments, the subject has a diagnosis of HBeAg positive or HBeAg negative chronic HBV infection. In some embodiments the subject has a diagnosis of HBeAg positive or HBeAg negative chronic HBV infection for at least 6 months. In some embodiments, the symptom or disease associated with the HBV infection is a chronic liver disease or disorder, liver inflammation, liver fibrotic condition, a proliferative hepatocellular disorder, hepatocellular carcinoma, Hepatitis D virus infection, acute HBV infection, chronic hepatitis B or chronic HBV infection. In some embodiments, the symptom or disease associated with the HBV infection is chronic HBV infection or chronic hepatitis B.

[0676] In some embodiments, the subject is infected with HBV. In some embodiments, the described methods are used to treat at least one symptom in a subject having a HBV infection. The subject is administered a therapeutically effective amount of any one or more of the described RNAi agents.

[0677] In some embodiments, the subject has both a HBV infection and a HDV infection. In some embodiments, the methods described herein are used to treat a subject infected with both HBV and HDV. In some embodiments, the described methods are used to treat at least one symptom in a subject having a HBV or a HDV infection. The subject is administered a therapeutically effective amount of any one or more of the described RNAi agents.

[0678] In some embodiments, the methods described herein are used to treat or manage a clinical presentation wherein a subject infected with HBV. The subject is administered a therapeutically or effective amount of one or more of the HBV RNAi agents or HBV RNAi agent-containing compositions described herein. In some embodiments, the method comprises administering a composition comprising an HBV RNAi agent described herein to a subject to be treated.

[0679] In some embodiments, the method comprises administering one or more HBV RNAi agents described herein. In some embodiments, the one or more HBV RNAi agents are administered in the amount of about 5-1000 mg per dose administration. In some embodiments, the one or more HBV RNAi agents are administered in the amount of about 5-25 mg, about 25-50 mg, about 50-75 mg, about 75-100 mg, about 100-125 mg, about 125-150 mg, about 150-175 mg, about 175-200 mg, about 200-225 mg, about 225-250 mg, about 250-275 mg, about 275-300 mg, about 300-325 mg, about 325-350 mg, about 350-375 mg, about 375-400 mg, about 400-425 mg, about 425-450 mg, about 450-475 mg, about 475-500 mg, about 500-550 mg, about 550-600 mg, about 600-650 mg, about 650-700 mg, about 700-750 mg, about 750-800 mg, about 800-850 mg, about 850-900 mg, about 900-950 mg, about 950-1000 mg, about 5-50 mg, about 50-100 mg, about 100-200 mg, about 200-300 mg, about 300-400 mg, about 400-500 mg, about 500-750 mg, about 750-1000 mg, 25-100 mg, 50-150 mg, 100-200 mg, 150-250 mg, 200-300 mg, 300-400 mg, 25-200 mg, or 200-400 mg per dose administration. In some embodiments, the one or more HBV RNAi agents are administered in the amount of about 25 mg, about 50 mg, about 75 mg, about 100 mg, about 125 mg, about 150 mg, about 175 mg, about 200 mg, about 250 mg, about 300 mg, about 350 mg, about 400 mg, about 450 mg, about 500 mg, about 600 mg, about 700 mg, about 800 mg, about 900 mg, or about 1000 mg per dose administration. In some embodiments, the one or more HBV RNAi agents are administered in the amount of about 25 mg, about 50 mg, about 75 mg, about 100 mg, or about 125 mg per dose administration. In some embodiments, the one or more HBV RNAi agents are administered in the amount of about 35 mg, about 50 mg, about 100 mg, about 200 mg, about 300 mg, or about 400 mg per dose administration. In some embodiments, the one or more HBV RNAi agents are administered in the amount of about 40 mg, about 100 mg, or about 200 mg per dose administration.

[0680] In some embodiments, the method comprises administering a combination of at least two HBV RNAi agents, wherein each HBV RNAi agent is designed to target a different HBV transcript (for example, a composition that includes two HBV RNAi agents, wherein the first HBV RNAi agent includes an antisense strand that is at least partially complementary to a nucleotide sequence located in the S ORF of an HBV gene, while the second HBV RNAi agent includes an antisense strand that is at least partially complementary to a nucleotide sequence located in the X ORF of an HBV gene).

[0681] In some embodiments, the at least two HBV RNAi agents are administered in the amount of about 5-1000 mg per dose administration. In some embodiments, the at least two HBV RNAi agents are administered in the amount of about 5-25 mg, about 25-50 mg, about 50-75 mg, about 75-100 mg, about 100-125 mg, about 125-150 mg, about 150-175 mg, about 175-200 mg, about 200-225 mg, about 225-250 mg, about 250-275 mg, about 275-300 mg, about 300-325 mg, about 325-350 mg, about 350-375 mg, about 375-400 mg, about 400-425 mg, about 425-450 mg, about 450-475 mg, about 475-500 mg, about 500-550 mg, about 550-600 mg, about 600-650 mg, about 650-700 mg, about 700-750 mg, about 750-800 mg, about 800-850 mg, about 850-900 mg, about 900-950 mg, about 950-1000 mg, about 5-50 mg, about 50-100 mg, about 100-200 mg, about 200-300 mg, about 300-400 mg, about 400-500 mg, about 500-750 mg, about 750-1000 mg, 25-100 mg, 50-150 mg, 100-200 mg, 150-250 mg, 200-300 mg, 300-400 mg, 25-200 mg, or 200-400 mg per dose administration. In some embodiments, the at least two HBV RNAi agents are administered in the amount of about 25 mg, about 50 mg, about 75 mg, about 100 mg, about 125 mg, about 150 mg, about 175 mg, about 200 mg, about 250 mg, about 300 mg, about 350 mg, about 400 mg, about 450 mg, about 500 mg, about 600 mg, about 700 mg, about 800 mg, about 900 mg, or about 1000 mg per dose administration. In some embodiments, the at least two HBV RNAi agents are administered in the amount of about 25 mg, about 50 mg, about 75 mg, about 100 mg, or about 125 mg per dose administration. In some embodiments, the at least two HBV RNAi agents are administered in the amount of about 35 mg, about 50 mg, about 100 mg, about 200 mg, about 300 mg, or about 400 mg per dose administration. In some embodiments, the at least two HBV RNAi agents are administered in the amount of about 40 mg, about 100 mg, or about 200 mg per dose administration.

[0682] In some embodiments, the at least two HBV RNAi agents are administered in a combined amount of about 1-10 mg/kg per dose administration. In some embodiments, the at least two HBV RNAi agents are administered in a combined amount of about 1-5 mg/kg per dose administration. In some embodiments, the at least two HBV RNAi agents are administered in a combined amount of about 1-1.5 mg/kg, about 1.5-2.0 mg/kg, about 2.0-2.5 mg/kg, about 2.5-3.0 mg/kg, about 3.0-3.5 mg/kg, about 3.5-4.0 mg/kg, about 4.0-4.5 mg/kg, about 4.5-5.0 mg/kg, about 5.0-5.5 mg/kg, about 5.5-6.0 mg/kg, about 6.0-6.5 mg/kg, about 6.5-7.0 mg/kg, about 7.0-7.5 mg/kg, about 7.5-8.0 mg/kg, about 8.0-8.5 mg/kg, about 8.5-9.0 mg/kg, about 9.0-9.5 mg/kg, about 9.5-10 mg/kg, about 1-2.5 mg/kg, about 2.5-5.0 mg/kg, about 5.0-7.5 mg/kg, about 7.5-10 mg/kg, about 1-5.0 mg/kg, or about 5.0-10 mg/kg per dose administration.

[0683] In some embodiments, the at least two HBV RNAi agents are administered simultaneously. In some embodiments, the at least two HBV RNAi agents are administered sequentially. In some embodiments, the at least two HBV RNAi agents are administered as a single composition. In some embodiments, the at least two HBV RNAi agents are administered as two or more individual compositions.

[0684] In some embodiments, described herein are methods of treating or preventing an HBV-associated disease or symptoms in a subject or inhibiting expression of one or more HBV genes comprising administering a composition that comprises a combination of one HBV RNAi agent that targets the S ORF of an HBV RNA (i.e., having an antisense strand that targets the S transcripts (S, pre-S1, and pre-S2), the pregenomic RNA (core and polymerase), and the pre-core transcripts (HBeAg) of an HBV genome), and one HBV RNAi agent that targets the X ORF of an HBV RNA (i.e., having an antisense strand that targets the X transcript of an HBV genome, the S transcripts (S, pre-S1, and pre-S2), the pregenomic RNA (core and polymerase), and the pre-core transcripts (HBeAg) of an HBV genome). In some embodiments, the composition described herein comprises at least one HBV RNAi agent that contains a sequence that targets the S ORF of an HBV gene, and a second HBV RNAi agent that contains a sequence that targets the X ORF of an HBV gene.

[0685] In some embodiments, the two HBV RNAi agents are administered in a ratio of about 1:1, 2:1, 3:1, 4:1 or 5:1. In some embodiments, the two HBV RNAi agents are administered in a ratio of about 2:1.

[0686] In some embodiments, the two HBV RNAi agents are administered in a combined amount of about 5-1000 mg per dose administration and in the ratio of about 2:1, about 3:1, about 1:1, about 4:1, about 5:1 or about 1:2. In some embodiments, the two HBV RNAi agents are administered in a combined amount of about 5-125 mg per dose administration and in the ratio of about 2:1, about 3:1, about 1:1, about 4:1, about 5:1 or about 1:2. In some embodiments, the two HBV RNAi agents are administered in a combined amount of about 25-150 mg per dose administration and in the ratio of about 2:1, about 3:1, about 1:1, about 4:1, about 5:1 or about 1:2. In some embodiments, the two HBV RNAi agents are administered in a combined amount of about 50-200 mg per dose administration and in the ratio of about 2:1, about 3:1, about 1:1, about 4:1, about 5:1 or about 1:2. In some embodiments, the two HBV RNAi agents are administered in a combined amount of about 100-250 mg per dose administration and in the ratio of about 2:1, about 3:1, about 1:1, about 4:1, about 5:1 or about 1:2. In some embodiments, the two HBV RNAi agents are administered in a combined amount of about 200-300 mg per dose administration and in the ratio of about 2:1, about 3:1, about 1:1, about 4:1, about 5:1 or about 1:2. In some embodiments, the two HBV RNAi agents are administered in a combined amount of about 300-400 mg per dose administration and in the ratio of about 2:1, about 3:1, about 1:1, about 4:1, about 5:1 or about 1:2. In some embodiments, the two HBV RNAi agents are administered in a combined amount of about 400-500 mg per dose administration and in the ratio of about 2:1, about 3:1, about 1:1, about 4:1, about 5:1 or about 1:2. In some embodiments, the two HBV RNAi agents are administered in a combined amount of about 500-750 mg per dose administration and in the ratio of about 2:1, about 3:1, about 1:1, about 4:1, about 5:1 or about 1:2. In some embodiments, the two HBV RNAi agents are administered in a combined amount of about 750-1000 mg per dose administration and in the ratio of about 2:1, about 3:1, about 1:1, about 4:1, about 5:1 or about 1:2. In some embodiments, the two HBV RNAi agents are administered in a combined amount of about 25-125 mg per dose administration and in the ratio of about 2:1, about 3:1, about 1:1, about 4:1, about 5:1 or about 1:2. In some embodiments, the two HBV RNAi agents are administered in a combined amount of about 5-1000 mg per dose administration and in the ratio of about 2:1. In some embodiments, the two HBV RNAi agents are administered in a combined amount of about 25-75 mg per dose administration and in the ratio of about 2:1. In some embodiments, the two HBV RNAi agents are administered in a combined amount of about 50-125 mg per dose administration and in the ratio of about 2:1. In some embodiments, the two HBV RNAi agents are administered in a combined amount of about 75-150 mg per dose administration and in the ratio of about 2:1. In some embodiments, the two HBV RNAi agents are administered in a combined amount of about 100-200 mg per dose administration and in the ratio of about 2:1. In some embodiments, the two HBV RNAi agents are administered in a combined amount of about 200-300 mg per dose administration and in the ratio of about 2:1. In some embodiments, the two HBV RNAi agents are administered in a combined amount of about 300-400 mg per dose administration and in the ratio of about 2:1. In some embodiments, the two HBV RNAi agents are administered in a combined amount of about 400-500 mg per dose administration and in the ratio of about 2:1. In some embodiments, the two HBV RNAi agents are administered in a combined amount of about 500-750 mg per dose administration and in the ratio of about 2:1. In some embodiments, the two HBV RNAi agents are administered in a combined amount of about 750-1000 mg per dose administration and in the ratio of about 2:1. In some embodiments, the two HBV RNAi agents are administered in a combined amount of about 35 mg per dose administration and in the ratio of about 2:1. In some embodiments, the two HBV RNAi agents are administered in a combined amount of about 40 mg per dose administration and in the ratio of about 2:1. In some embodiments, the two HBV RNAi agents are administered in a combined amount of about 100 mg per dose administration and in the ratio of about 2:1. In some embodiments, the two HBV RNAi agents are administered in a combined amount of about 200 mg per dose administration and in the ratio of about 2:1. In some embodiments, the two HBV RNAi agents are administered in a combined amount of about 300 mg per dose administration and in the ratio of about 2:1. In some embodiments, the two HBV RNAi agents are administered in a combined amount of about 400 mg per dose administration and in the ratio of about 2:1. In another aspect, methods described here comprise administering one or more HBV RNAi agents (e.g., two or more) in 1-18 week intervals or 1-6 month intervals. In some embodiments, the HBV RNAi agents are administered in about 1-18 week intervals. In some embodiments, the HBV RNAi agents are administered in about 1-week intervals, about 2-week intervals, about 3-week intervals, about 4-week intervals, about 5-week intervals, about 6-week intervals, about 7-week intervals, about 8-week intervals, about 9-week intervals, about 10-week intervals, about 11-week intervals, about 12-week intervals, about 13-week intervals, about 14-week intervals, about 15-week intervals, about 16-week intervals, about 17-week intervals, or about 18-week intervals. In some embodiments, the HBV RNAi agents are administered in about 1-6 month intervals. In some embodiments, the HBV RNAi agents are administered in about 1-month intervals, about 2-month intervals, about 3-month intervals, about 4-month intervals, about 5-month intervals, or about 6-month intervals. In some embodiments, the HBV RNAi agents are administered in about 4-week intervals or 1-month intervals. In some embodiments, the HBV RNAi agents are administered in about 7-day, 14-day, 21-day or 28-day intervals. In some embodiments, the HBV RNAi agents are administered in about 28-day intervals (i.e., Q4W).

[0687] In another aspect, methods described here comprise administering one or more HBV RNAi agents (e.g., two or more) for a duration of about 1-12 months or 1-18 weeks. In some embodiments, the RNAi agents are administered for a duration of about 1-12 months. In some embodiments, the HBV RNAi agents are administered for a duration of at least about 1 month, at least about 2 months, at least about 3 months, at least about 4 months, at least about 5 months, at least about 6 months, at least about 7 months, at least about 8 months, at least about 9 months, at least about 10 months, at least about 11 months or at least about 12 months. In some embodiments, the HBV RNAi agents are administered for a duration of about 1-18 weeks. In some embodiments, the HBV RNAi agents are administered for a duration of at least about 1 week, at least about 2 weeks, at least about 3 weeks, at least about 4 weeks, at least about 5 weeks, at least about 6 weeks, at least about 7 weeks, at least about 8 weeks, at least about 9 weeks, at least about 10 weeks, at least about 11 weeks, at least about 12 weeks, at least about 13 weeks, at least about 14 weeks, at least about 15 weeks, at least about 16 weeks, at least about 17 weeks, or at least about 18 weeks. In some embodiments, the HBV RNAi agents are administered for a duration of about 12 weeks or 3 months.

[0688] In some embodiments, the first RNAi agent is administered in an amount of about 3-650 mg per dose administration, and the second RNAi agent is administered in an amount of about 2-325 mg per dose administration. In some embodiments, the first RNAi agent is administered in an amount of about 35-265 mg per dose administration. In some embodiments, the first RNAi agent is administered in an amount of about 50-75 mg per dose administration. In some embodiments, the second RNAi agent is administered in an amount of about 20-125 mg per dose administration. In some embodiments, the second RNAi agent is administered in an amount of about 25-50 mg per dose administration.

[0689] In some embodiments, two RNAi agents are administered at a combined dose of 25-400 mg per dose administration. In an embodiment, two RNAi agents are administered at a combined dose of 25-400 mg, and the first RNAi agent is administered with the second RNAi agent at a ratio of 1:1. In an embodiment, the dose of each of the first and second RNAi agents is in an amount of about 12 mg for a combined dose of about 25 mg. In an embodiment, the dose of each of the first and second RNAi agents is in an amount of about 17 mg for a combined dose of about 35 mg. In an embodiment, the dose of each of the first and second RNAi agents is in an amount of about 25 mg for a combined dose of about 50 mg. In an embodiment, the dose of each of the first and second RNAi agents is in an amount of about 50 mg for a combined dose of about 100 mg. In an embodiment, the dose of each of the first and second RNAi agents is in an amount of about 100 mg for a combined dose of about 200 mg. In an embodiment, the dose of each of the first and second RNAi agents is in an amount of about 150 mg for a combined dose of about 300 mg. In an embodiment, the dose of each of the first and second RNAi agents is in an amount of about 200 mg for a combined dose of about 400 mg.

[0690] In an embodiment, two RNAi agents are administered at a combined dose of 25-400 mg per dose, and the first RNAi agent is administered with the second RNAi agent at a ratio of 2:1. In an embodiment, the dose of the first RNAi agent is in an amount of about 16 mg, and the dose of the second RNAi agent is in an amount of about 8 mg for a combined dose of about 25 mg. In an embodiment, the dose of the first RNAi agent is in an amount of about 24 mg, and the dose of the second RNAi agent is in an amount of about 12 mg for a combined dose of about 35 mg. In an embodiment, the dose of the first RNAi agent is in an amount of about 33 mg, and the dose of the second RNAi agent is in an amount of about 17 mg for a combined dose of about 50 mg. In an embodiment, the dose of the first RNAi agent is in an amount of about 65 mg, and the dose of the second RNAi agent is in an amount of about 35 mg for a combined dose of about 100 mg. In an embodiment, the dose of the first RNAi agent is in an amount of about 133 mg, and the dose of the second RNAi agent is in an amount of about 67 mg for a combined dose of about 200 mg. In an embodiment, the dose of the first RNAi agent is in an amount of about 200 mg, and the dose of the second RNAi agent is in an amount of about 100 mg for a combined dose of about 300 mg. In an embodiment, the dose of the first RNAi agent is in an amount of about 270 mg, and the dose of the second RNAi agent is in an amount of about 135 mg for a combined dose of about 400 mg.

[0691] In an embodiment, two RNAi agents are administered at a combined dose of 25-400 mg per dose, the first RNAi agent is administered with the second RNAi agent at a ratio of 3:1. In an embodiment, the dose of the first RNAi agent is in an amount of about 18 mg, and the dose of the second RNAi agent is in an amount of about 6 mg for a combined dose of about 25 mg. In an embodiment, the dose of the first RNAi agent is in an amount of about 27 mg, and the dose of the second RNAi agent is in an amount of about 9 mg for a combined dose of about 35 mg. In an embodiment, the dose of the first RNAi agent is in an amount of about 36 mg, and the dose of the second RNAi agent is in an amount of about 12 mg for a combined dose of about 50 mg. In an embodiment, the dose of the first RNAi agent is in an amount of about 75 mg, and the dose of the second RNAi agent is in an amount of about 25 mg for a combined dose of about 100 mg. In an embodiment, the dose of the first RNAi agent is in an amount of about 150 mg, and the dose of the second RNAi agent is in an amount of about 50 mg for a combined dose of about 200 mg. In an embodiment, the dose of the first RNAi agent is in an amount of about 225 mg, and the dose of the second RNAi agent is in an amount of about 75 mg for a combined dose of about 300 mg. In an embodiment, the dose of the first RNAi agent is in an amount of about 300 mg, and the dose of the second RNAi agent is in an amount of about 100 mg for a combined dose of about 400 mg.

[0692] In some embodiments, the two HBV RNAi agents are administered in a combined amount of about 1-10 mg/kg per dose administration. In some embodiments, the two HBV RNAi agents are administered in a combined amount of about 1-5 mg/kg per dose administration. In some embodiments, the two HBV RNAi agents are administered in a combined amount of about 1-1.5 mg/kg, about 1.5-2.0 mg/kg, about 2.0-2.5 mg/kg, about 2.5-3.0 mg/kg, about 3.0-3.5 mg/kg, about 3.5-4.0 mg/kg, about 4.0-4.5 mg/kg, about 4.5-5.0 mg/kg, about 5.0-5.5 mg/kg, about 5.5-6.0 mg/kg, about 6.0-6.5 mg/kg, about 6.5-7.0 mg/kg, about 7.0-7.5 mg/kg, about 7.5-8.0 mg/kg, about 8.0-8.5 mg/kg, about 8.5-9.0 mg/kg, about 9.0-9.5 mg/kg, about 9.5-10 mg/kg, about 1-2.5 mg/kg, about 2.5-5.0 mg/kg, about 5.0-7.5 mg/kg, about 7.5-10 mg/kg, about 1-5.0 mg/kg, or about 5.0-10 mg/kg per dose administration.

[0693] In some embodiments, the first RNAi agent is administered in an amount of about 0.6-7 mg/kg per dose administration, and the second RNAi agent is administered in an amount of about 0.3-5 mg/kg per dose administration. In some embodiments, the second RNAi agent is administered in an amount of about 0.5-2.5 mg/kg per dose administration. In some embodiments, the second RNAi agent is administered in an amount of about 0.3-1.5 mg/kg per dose administration. In some embodiments, the first RNAi agent is administered in an amount of about 0.6-5 mg/kg per dose administration. In some embodiments, the first RNAi agent is administered in an amount of about 1-2.5 mg/kg per dose administration.

[0694] In some embodiments, the gene expression level and/or mRNA level of an HBV gene in a subject to whom a described HBV RNAi agent is administered is reduced by at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or greater than 99% relative to the subject prior to being administered the HBV RNAi agent or to a subject not receiving the HBV RNAi agent. The gene expression level and/or mRNA level in the subject may be reduced in a cell, group of cells, and/or tissue of the subject. In some embodiments, the expressed protein level of an HBV gene in a subject to whom a described HBV RNAi agent has been administered is reduced by at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or greater than 99% relative to the subject prior to being administered the HBV RNAi agent or to a subject not receiving the HBV RNAi agent. The protein level in the subject may be reduced in a cell, group of cells, tissue, blood, and/or other fluid of the subject. For example, in some embodiments, the amount or level of Hepatitis B surface antigen (HBsAg) in a subject to whom a described HBV RNAi agent has been administered is reduced by at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or greater than 99% relative to the subject prior to being administered the HBV RNAi agent or to a subject not receiving the HBV RNAi agent. In some embodiments, the amount or level of Hepatitis B e-antigen (HBeAg) in a subject to whom a described HBV RNAi agent has been administered is reduced by at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or greater than 99% relative to the subject prior to being administered the HBV RNAi agent or to a subject not receiving the HBV RNAi agent. In some embodiments, the amount or level of serum HBV DNA in a subject to whom a described HBV RNAi agent has been administered is reduced by at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or greater than 99% relative to the subject prior to being administered the HBV RNAi agent or to a subject not receiving the HBV RNAi agent. A reduction in the presence of serum HBV DNA, HBV gene expression, HBV mRNA, or HBV protein amounts or levels may be assessed by methods known in the art. Reduction or decrease in HBV mRNA amount or level, expressed protein amount or level, and/or serum HBV DNA amount or level, are collectively referred to herein as a reduction or decrease in HBV or inhibiting or reducing the expression of HBV.

Cells and Tissues and Non-Human Organisms

[0695] Cells, tissues, and non-human organisms that include at least one of the HBV RNAi agents described herein is contemplated. The cell, tissue, or non-human organism is made by delivering the RNAi agent to the cell, tissue, or non-human organism.

[0696] The above provided embodiments and items are now illustrated with the following, non-limiting examples.

EXAMPLES

Example 1. Synthesis of HBV RNAi Agents

[0697] HBV RNAi agent duplexes shown in Table 5 were synthesized in accordance with the following:

[0698] A. Synthesis.

[0699] The sense and antisense strands of the HBV RNAi agents were synthesized according to phosphoramidite technology on solid phase used in oligonucleotide synthesis. Depending on the scale, either a MerMade96E® (Bioautomation), a MerMade12® (Bioautomation), or an OP Pilot 100 (GE Healthcare) was used. Syntheses were performed on a solid support made of controlled pore glass (CPG, 500 Å or 600 Å, obtained from Prime Synthesis, Aston, Pa., USA). All RNA and 2′-modified phosphoramidites were purchased from Thermo Fisher Scientific (Milwaukee, Wis., USA). Specifically, the following 2′-O-methyl phosphoramidites were used: (5′-O-dimethoxytrityl-N.sup.6-(benzoyl)-2′-O-methyl-adenosine-3′-O-(2-cyanoethyl-N,N-diisopropylamino) phosphoramidite, 5′-O-dimethoxy-trityl-N.sup.4-(acetyl)-2′-O-methyl-cytidine-3′-O-(2-cyanoethyl-N,N-diisopropyl-amino) phosphoramidite, (5′-O-dimethoxytrityl-N.sup.2-(isobutyryl)-2′-O-methyl-guanosine-3′-O-(2-cyanoethyl-N,N-diisopropylamino) phosphoramidite, and 5′-O-dimethoxytrityl-2′-O-methyl-uridine-3′-O-(2-cyanoethyl-N,N-diisopropylamino) phosphoramidite. The 2′-deoxy-2′-fluoro-phosphoramidites carried the same protecting groups as the 2′-O-methyl amidites. The abasic (3′-O-dimethoxytrityl-2′-deoxyribose-5′-O-(2-cyanoethyl-N,N-diisopropylamino) phosphoramidites were purchased from ChemGenes (Wilmington, Mass., USA). Targeting ligand containing phosphoramidites were dissolved in anhydrous dichloromethane or anhydrous acetonitrile (50 mM), while all other amidites were dissolved in anhydrous acetonitrile (50 mM) and molecular sieves (3 Å) were added. 5-Benzylthio-1H-tetrazole (BTT, 250 mM in acetonitrile) or 5-Ethylthio-1H-tetrazole (ETT, 250 mM in acetonitrile) was used as activator solution. Coupling times were 12 min (RNA), 15 min (targeting ligand), 90 sec (2′OMe), and 60 sec (2′F). In order to introduce phosphorothioate linkages, a 100 mM solution of 3-phenyl 1,2,4-dithiazoline-5-one (POS, obtained from PolyOrg, Inc., Leominster, Mass., USA) in anhydrous Acetonitrile was employed.

[0700] B. Cleavage and Deprotection of Support Bound Oligomer.

[0701] After finalization of the solid phase synthesis, the dried solid support was treated with a 1:1 volume solution of 40 wt. % methylamine in water and 28% ammonium hydroxide solution (Aldrich) for 1.5 hours at 30° C. The solution was evaporated and the solid residue was reconstituted in water (see below).

[0702] C. Purification.

[0703] Crude oligomers were purified by anionic exchange HPLC using a TSKgel SuperQ-5PW 13 μm column and Shimadzu LC-8 system. Buffer A was 20 mM Tris, 5 mM EDTA, pH 9.0 and contained 20% Acetonitrile and buffer B was the same as buffer A with the addition of 1.5 M sodium chloride. UV traces at 260 nm were recorded. Appropriate fractions were pooled then run on size exclusion HPLC using a GE Healthcare XK 26/40 column packed with Sephadex G-25 fine with a running buffer of filtered DI water or 100 mM ammonium bicarbonate, pH 6.7 and 20% Acetonitrile.

[0704] D. Annealing.

[0705] Complementary strands were mixed by combining equimolar RNA solutions (sense and antisense) in 1×Phosphate-Buffered Saline (Corning, Cellgro) to form the RNAi agents. Some RNAi agents were lyophilized and stored at −15 to −25° C. Duplex concentration was determined by measuring the solution absorbance on a UV-Vis spectrometer in 1×Phosphate-Buffered Saline. The solution absorbance at 260 nm was then multiplied by a conversion factor and the dilution factor to determine the duplex concentration. Unless otherwise stated, all conversion factor was 0.037 mg/(mL.Math.cm). For some experiments, a conversion factor was calculated from an experimentally determined extinction coefficient.

Example 2. pHBV Model Mice

[0706] Six to eight-week-old female NOD.CB17-Prkdscid/NcrCrl (NOD-SCID) mice were transiently transfected in vivo with MC-HBV1.3 by hydrodynamic tail vein injection (Yang P L et al. “Hydrodynamic injection of viral DNA: a mouse model of acute hepatitis B virus infection,” PNAS USA 2002 Vol. 99: p. 13825-13830), administered 30 to 45 days prior to administration of an HBV RNAi agent or control. MC-HBV1.3 is a plasmid-derived minicircle that contains the same terminally redundant human hepatitis B virus sequence HBV1.3 as in plasmid pHBV1.3 and in the HBV1.3.32 transgenic mice (GenBank accession #V01460) (Guidotti L G et al., “High-level hepatitis B virus replication in transgenic mice,” J Virol 1995 Vol. 69, p 6158-6169.). 5 or 10 μg MC-HBV1.3 in Ringer's Solution in a total volume of 10% of the animal's body weight was injected into mice via tail vein to create pHBV model of chronic HBV infection. The solution was injected through a 27-gauge needle in 5-7 seconds as previously described (Zhang G et al., “High levels of foreign gene expression in hepatocytes after tail vein injection of naked plasmid DNA.” Human Gene Therapy 1999 Vol. 10, p 1735-1737.). At pre-dose (either day 1 pre-dose, day −1, or day −2), Hepatitis B surface antigen (HBsAg) HBsAg expression levels in serum were measured by ELISA and the mice were grouped according to average HBsAg expression levels.

[0707] Analyses:

[0708] At various times, before and after administration of HBV RNAi agents, serum HBsAg, serum HBeAg, serum HBV DNA, or liver HBV RNA may be measured. HBV expression levels were normalized to pre-administration expression levels and to control mice injected with phosphate buffered saline (“PBS”).

[0709] i) Serum Collection:

[0710] Mice were anesthetized with 2-3% isoflurane and blood samples were collected from the submandibular area into serum separation tubes (Sarstedt AG & Co., Nümbrecht, Germany). Blood was allowed to coagulate at ambient temperature for 20 min. The tubes were centrifuged at 8,000×g for 3 min to separate the serum and stored at 4° C.

[0711] ii) Serum Hepatitis B Surface Antigen (HBsAg) Levels:

[0712] Serum was collected and diluted 10 to 8000-fold in PBS containing 5% nonfat dry milk. Secondary HBsAg standards diluted in the nonfat milk solution were prepared from serum of ICR mice (Harlan Sprague Dawley) that had been transfected with 10 μg HBsAg-expressing plasmid pRc/CMV-HBs (Aldevron, Fargo, N. Dak.). HBsAg levels were determined with a GS HBsAg EIA 3.0 kit (Bio-Rad Laboratories, Inc., Redmond, Wash.) as described by the manufacturer. Recombinant HBsAg protein, ayw subtype, also diluted in nonfat milk in PBS, was used as a primary standard (Aldevron).

[0713] HBsAg expression for each animal was normalized to the control group of mice injected with PBS in order to account for the non-treatment related decline in expression of MC-HBV1.3. First, the HBsAg level for each animal at a time point was divided by the pre-treatment level of expression in that animal in order to determine the ratio of expression “normalized to pre-treatment”. Expression at a specific time point was then normalized to the control group by dividing the “normalized to pre-treatment” ratio for an individual animal by the average “normalized to pre-treatment” ratio of all mice in the normal PBS control group.

[0714] iii) Serum Hepatitis B e-Antigen (HBeAg) Levels:

[0715] HBeAg analysis was performed with the HBeAg enzyme linked immunosorbent assay (ELISA) as described by the manufacturer (DiaSorin) using serum diluted 4- to 20-fold in 5% nonfat dry milk. The amount of antigen was determined in the linear range of the assay and quantitated against HBeAg protein standards (Fitzgerald Industries International, catalog #30-AH18, Acton, Mass.).

[0716] HBeAg expression for each animal was normalized to the control group of mice injected with PBS in order to account for the non-treatment related decline in expression of MC-HBV1.3. For evaluation of HBeAg in serum, HBeAg is analyzed from pooled group or subgroup serum samples. First, the HBeAg level for each pooled group or subgroup was divided by the pre-treatment level of expression in the same group or subgroup in order to determine the ratio of expression “normalized to pre-treatment”. Expression at a specific time point was then normalized to the control group by dividing the “normalized to pre-treatment” ratio for a group or subgroup by the average “normalized to pre-treatment” ratio of all samples from the normal PBS control group.

[0717] iv) Serum HBV DNA Levels:

[0718] Equal volumes of serum from mice in a group or subgroup were pooled to a final volume of 100 μL. DNA was isolated from serum samples using the QIAamp MinElute Virus Spin Kit (Qiagen, Valencia, Calif.) following the manufacturer's instructions. Sterile 0.9% saline was added to each sample to a final volume of 200 μL. Serum samples were added to tubes containing buffer and protease. Carrier RNA was added to aid in the isolation of small amounts of DNA. 1 ng of pHCR/UbC-SEAP plasmid DNA (Wooddell C I, et al. “Long-term RNA interference from optimized siRNA expression constructs in adult mice.” Biochem Biophys Res Commun (2005) 334, 117-127) was added as a recovery control. After incubating 15 min at 56° C., nucleic acids were precipitated from the lysates with ethanol and the entire solution applied to a column. After washing, the samples were eluted into a volume of 50 μL Buffer AVE.

[0719] The number of copies of HBV genomes in DNA isolated from the pHBV mouse model serum was determined by qPCR. Plasmid pSEAP-HBV353-777, encoding a short segment of the HBV genome within the S gene (bases 353-777 of GenBank accession #V01460), was used to create a six log standard curve. Samples with recovery of DNA below 2 standard deviations from the average, based on detection of pHCR/UbC-SEAP were omitted. TaqMan chemistry-based primers and probes with fluor/ZEN/IBFQ are utilized.

[0720] qPCR assays were performed on a 7500 Fast or StepOne Plus Real-Time PCR system (Life Technologies). For evaluation of HBV DNA in serum, DNA was isolated from singlet or duplicate purification steps from pooled group serum samples. Quantitations of HBV DNA and recovery control plasmid were determined by qPCR reactions performed in triplicate. The probes to quantitate HBV and pHCR/UbC-SEAP were included in each reaction.

Example 3. HBV RNAi Agents in pHBV Model Mice

[0721] The pHBV mouse model described in Example 2, above, was used. At day 1, each mouse was administered a single subcutaneous injection of 200 μl containing 2 mg/kg (mpk) of an HBV RNAi agent formulated in phosphate buffered saline (“PBS”), or 200 μl of phosphate buffered saline without an HBV RNAi agent, to be used as a control. Each of the HBV RNAi agents included N-acetyl-galactosamine targeting ligands conjugated to the 5′-terminal end of the sense strand, as shown in Tables 4 and 5. The HBV RNAi agents tested included those having the duplex numbers shown in Table 7, below. The injections were performed between the skin and muscle (i.e. subcutaneous injections) into the loose skin over the neck and shoulder area. Three (3) mice in each group were tested (n=3).

[0722] Serum was collected on day 8, day 15, day 22, and day 29, and serum Hepatitis B surface antigen (HBsAg) levels were determined pursuant to the procedure set forth in Example 2, above. Data from the experiment is shown in the following Table:

TABLE-US-00007 TABLE 7 Average HBsAg levels normalized to pre-treatment and PBS control in pHBV mice following administration of HBV RNAi agents from Example 3 (standard deviation reflected as (+/−)). Group Day 8 Day 15 Day 22 Day 29 PBS 1.000 ± 0.185 1.000 ± 0.288 1.000 ± 0.540 1.000 ± 0.326 AD04178 0.164 ± 0.043 0.206 ± 0.044 0.293 ± 0.050 0.348 ± 0.099 AD04579 0.083 ± 0.028 0.099 ± 0.022 0.112 ± 0.022 0.138 ± 0.056 AD04580 0.048 ± 0.007 0.073 ± 0.012 0.085 ± 0.012 0.126 ± 0.014 AD04570 0.241 ± 0.076 0.294 ± 0.071 0.276 ± 0.068 0.474 ± 0.092 AD04572 0.190 ± 0.040 0.279 ± 0.011 0.323 ± 0.049 0.441 ± 0.046 AD04573 0.333 ± 0.143 0.505 ± 0.106 0.361 ± 0.060 0.444 ± 0.068 AD04574 0.291 ± 0.032 0.650 ± 0.056 0.388 ± 0.048 0.485 ± 0.070 AD04575 0.397 ± 0.189 0.514 ± 0.234 0.574 ± 0.204 0.689 ± 0.207 AD04419 0.262 ± 0.038 0.174 ± 0.042 0.258 ± 0.064 0.311 ± 0.089 AD04578 0.210 ± 0.056 0.235 ± 0.033 0.298 ± 0.035 0.336 ± 0.049

[0723] RNAi agents AD04178, AD04579, AD04580, AD04570, AD04572, AD04573, AD04574, AD04575, AD04419, and AD04578 were each designed to have antisense strand sequences at least partially complementary to the X open reading frame at positions 1781-1789 of the HBV genome shown in Tables 1 and 2, above. Each of the HBV RNAi agents showed substantial reduction in HBsAg as compared to the PBS control across all measured time points. For example, AD04580 showed greater than 95% reduction in s-antigen levels at day 8 (0.048±0.007 HBsAg level) when normalized to pre-treatment and PBS control.

[0724] Additionally, serum HBV DNA levels were determined for the PBS, AD04579, and AD04580 groups from serum samples collected on days 8, 15, 22, 29, 36, 43 and 50, pursuant to the procedure set forth in Example 2, above. Serum from each group was pooled and then DNA was isolated from the serum in duplicate isolations. Data are presented in the following Table:

TABLE-US-00008 TABLE 8 Average Serum HBV DNA levels normalized to pre-treatment and PBS control in pHBV mice following administration of HBV RNAi agents from Example 3 (standard deviation reflected as (+/−)). Group Day 8 Day 15 Day 22 Day 29 PBS 1.0000 ± 0.1185 1.0000 ± 0.0591 1.0000 ± 0.0322 1.0000 ± 0.0597 AD04579 0.1541 ± 0.0070 0.1776 ± 0.0027 0.1810 ± 0.0450 0.3738 ± 0.0302 AD04580 0.0921 ± 0.0253 0.0869 ± 0.0117 0.1444 ± 0.0755 0.0950 ± 0.0026 Group Day 36 Day 43 Day 50 PBS 1.0000 ± 0.1625 1.0000 ± 0.0055 1.0000 ± 0.1484 AD04579 0.9670 ± 0.1247 0.7643 ± 0.1334 0.6299 ± 0 1319 AD04580 0.4949 ± 0.0096 0.4350 ± 0.0344 0.6819 ± 0.0266

[0725] The data in Table 8 indicate that both RNAi agents examined provided a substantial reduction in HBV DNA levels compared to the PBS group, with AD04580 achieving slightly greater than 1 log knockdown at nadir (e.g., 0.0869±0.0117 average serum DNA level at day 15).

Example 4. HBV RNAi Agents in pHBV Model Mice

[0726] The pHBV mouse model described in Example 2, above, was used. At day 1, each mouse was given a single subcutaneous administration of 200 μl containing 2 mg/kg (mpk) of an HBV RNAi agent formulated in phosphate buffered saline, or 200 μl of phosphate buffered saline without an HBV RNAi agent to be used as a control. Each of the HBV RNAi agents included N-acetyl-galactosamine targeting ligands conjugated to the 5′-terminal end of the sense strand, as shown in Tables 4 and 5. The HBV RNAi agents administered included those listed in Table 9, below. The injections were performed between the skin and muscle (i.e. subcutaneous injections) into the loose skin over the neck and shoulder area. Three (3) mice in each group were tested (n=3).

[0727] Serum was collected on day 8, day 15, day 22, and day 29, and serum Hepatitis B surface antigen (HBsAg) levels were determined pursuant to the procedure set forth in Example 2, above. Data from the experiment is shown in the following Table:

TABLE-US-00009 TABLE 9 Average HBsAg levels normalized to pre-treatment and PBS control in pHBV mice following administration of HBV RNAi agents from Example 4 (standard deviation reflected as (+/−)). Group Day 8 Day 15 Day 22 Day 29 PBS 1.000 ± 0.085 1.000 ± 0.235 1.000 ± 0.171 1.000 ± 0.099 AD04010 0.229 ± 0.141 0.165 ± 0.091 0.142 ± 0.085 0.116 ± 0.076 AD04581 0.379 ± 0.042 0.221 ± 0.066 0.135 ± 0.040 0.112 ± 0.050 AD04591 0.285 ± 0.101 0.145 ± 0.064 0.086 ± 0.024 0.081 ± 0.026 AD04434 0.295 ± 0.041 0.191 ± 0.008 0.147 ± 0.016 0.187 ± 0.049 AD04583 0.488 ± 0.018 0.545 ± 0.037 0.511 ± 0.086 0.663 ± 0.112 AD04584 0.392 ± 0.136 0.337 ± 0.073 0.364 ± 0.075 0.515 ± 0.155 AD04585 0.099 ± 0.016 0.042 ± 0.014 0.030 ± 0.009 0.044 ± 0.014 AD04586 0.222 ± 0.056 0.107 ± 0.034 0.074 ± 0.016 0.106 ± 0.039 AD04588 0.255 ± 0.065 0.205 ± 0.021 0.185 ± 0.021 0.207 ± 0.024 AD04438 0.265 ± 0.106 0.113 ± 0.045 0.091 ± 0.031 0.130 ± 0.038

[0728] RNAi agents AD04010, AD04581, AD04591, AD04434, AD04583, AD04584, AD04585, AD04586, AD04588, and AD04438 were designed to have antisense strand sequences that are at least partially complementary to the S open reading frame at positions 257-275 of the HBV genome, as shown in Tables 1 and 2. The HBV RNAi agents shown in Table 9, directly above, each showed substantial reduction in HBsAg as compared to the PBS control across all measured time points. For example, AD04585 exhibited approximately a 90% reduction of HBsAg at day 8, a 95% reduction at day 15, a 97% reduction at day 22, and a 95% reduction at day 29.

[0729] Additionally, serum HBV DNA levels were determined for the PBS, AD04585 groups from serum samples collected on days 8, 15, 22, 29, 36, 43 and 50, pursuant to the procedure set forth in Example 2, above. Serum from each group was pooled and then DNA was isolated from the serum in duplicate isolations. Data are presented in the following Table:

TABLE-US-00010 TABLE 10 Average Serum HBV DNA levels normalized to pre-treatment and PBS control in pHBV mice following administration of HBV RNAi agents from Example 4 (standard deviation reflected as (+/−)). Group Day 8 Day 15 Day 22 Day 29 PBS 1.000 ± 0.248 1.000 ± 0.089 1.000 ± 0.195 1.000 ± 0.180 AD04585 0.901 ± 0.183 0.225 ± 0.003 0.187 ± 0.023 0.191 ± 0.004 Group Day 36 Day 43 Day 50 PBS 1.000 ± 0.018 1.000 ± 0.033 1.000 ± 0.778 AD04585 0.209 ± 0.017 0.171 ± 0.019 0.305 ± 0.010

[0730] The data in Table 10 indicate that HBV RNAi agent AD04585 provided a reduction in HBV DNA levels compared to the PBS group.

Example 5. Dose Response and Combinations of HBV RNAi Agents in pHBV Model Mice

[0731] The pHBV mouse model described in Example 2, above, was used. The mice were divided into various groups including those set forth in Table 11, below, and the mice were given 200 μl subcutaneous injections pursuant to the dosing regimen set forth in Table 11:

TABLE-US-00011 TABLE 11 Dosing groups of pHBV mice for Example 5. Group RNAi Agent and Dose Dosing Regimen A PBS (no RNAi agent) Single injection on day 1 B 3.0 mg/kg AD04585 Single injection on day 1 C 3.0 mg/kg AD04585 Injection on day 1, day 8, and day 15 (i.e., three weekly injections) D 3.0 mg/kg AD04580 Single injection on day 1 E 3.0 mg/kg AD04580 Injection on day 1, day 8, and day 15 (i.e., three weekly injections) F 1.0 mg/kg AD4585 + Injection on day 1, and another injection 1.0 mg/kg AD04580 on day 22 G 1.0 mg/kg AD4585 + Injection on day 1, day 8, day 15, and 1.0 mg/kg AD04580 day 43 H 1.5 mg/kg AD4585 + Injection on day 1, day 22, and day 43 1.5 mg/kg AD04580 I 1.5 mg/kg AD4585 + Injection on day 1, day 8, day 15, and 1.5 mg/kg AD04580 day 43

[0732] Each mouse was given a subcutaneous administration of 200 μl containing the amount of HBV RNAi agent(s) formulated in phosphate buffered saline, or 200 μl of phosphate buffered saline without an HBV RNAi agent, as set forth in Table 11. Each of the HBV RNAi agents included N-acetyl-galactosamine targeting ligands conjugated to the 5′-terminal end of the sense strand, as shown in Tables 4 and 5. The injections were performed between the skin and muscle (i.e. subcutaneous injections) into the loose skin over the neck and shoulder area. Three (3) mice in each group were tested (n=3).

[0733] Serum was collected on day 8, day 15, day 22, day 29, day 36, day 43, day 50, and day 57, and serum Hepatitis B surface antigen (HBsAg) levels were determined pursuant to the procedure set forth in Example 2, above. Data from the experiment is shown in the following Table:

TABLE-US-00012 TABLE 12 Average HBsAg levels normalized to pre-treatment and PBS control in pHBV mice following administration of HBV RNAi agents from Example 5 (standard deviation reflected as (+/−)). Group Day 8 Day 15 Day 22 Day 29 A 1.000 ± 0.162 1.000 ± 0.138 1.000 ± 0.083 1.000 ± 0.204 B 0.060 ± 0.015 0.010 ± 0.003 0.006 ± 0.002 0.007 ± 0.002 C 0.087 ± 0.014 0.004 ± 0.001  0.001 ± 0.0003 0.0002 ± 0.0001 D 0.026 ± 0.009 0.035 ± 0.013 0.037 ± 0.014 0.046 ± 0.006 E 0.023 ± 0.005 0.002 ± 0.001  0.001 ± 0.0003  0.001 ± 0.0004 F 0.063 ± 0.046 0.083 ± 0.051 0.086 ± 0.016 0.027 ± 0.006 G 0.062 ± 0.011 0.022 ± 0.008 0.009 ± 0.003 0.008 ± 0.002 H 0.055 ± 0.015 0.062 ± 0.002 0.072 ± 0.013 0.011 ± 0.001 I 0.031 ± 0.006 0.008 ± 0.001  0.003 ± 0.0004  0.003 ± 0.0003 Group Day 36 Day 43 Day 50 Day 57 A 1.000 ± 0.211 1.000 ± 0.189 1.000 ± 0.179 1.000 ± 0.062 B 0.013 ± 0.005 0.027 ± 0.004 0.026 ± 0.004 0.057 ± 0.012 C  0.001 ± 0.0002 0.002 ± 0.001 0.008 ± 0.004 0.020 ± 0.015 D 0.116 ± 0.019 0.214 ± 0.056 0.263 ± 0.046 0.404 ± 0.030 E  0.003 ± 0.0001 0.007 ± 0.001 0.012 ± 0.002 0.033 ± 0.011 F 0.029 ± 0.003 0.065 ± 0.005 0.064 ± 0.004 0.161 ± 0.033 G 0.014 ± 0.008 0.039 ± 0.011 0.018 ± 0.008 0.046 ± 0.008 H 0.017 ± 0.005 0.039 ± 0.008 0.007 ± 0.001 0.013 ± 0.003 I 0.007 ± 0.001 0.020 ± 0.002 0.005 ± 0.001 0.011 ± 0.002

[0734] HBV RNAi agents AD04580 and AD04585 each individually showed a reduction in HBsAg as compared to the PBS control across all measured time points. Furthermore, combination treatment of AD04585 and AD04580, which as noted in the Examples above target different regions of the HBV genome, also showed reduction in HBsAg as compared to the PBS control across all measured time points.

[0735] Additionally, serum HBV DNA levels were determined for each of the groups in Table 11 from serum samples collected on days 8, 15, 22, 29, and 36, pursuant to the procedure set forth in Example 2, above. Serum from each group was pooled and then DNA was isolated from the serum in duplicate reactions. Data are presented in the following Table:

TABLE-US-00013 TABLE 13 Average Serum HBV DNA levels normalized to pre-treatment and PBS control in pHBV mice following administration of HBV RNAi agents from Example 5 (standard deviation reflected as (+/−)). Group Day 8 Day 15 Day 22 Day 29 A 1.000 ± 0.063 1.000 ± 0.059 1.000 ± 0.372 1.000 ± 0.237 B 0.267 ± 0.003 0.043 ± 0.016 0.038 ± 0.008 0.044 ± 0.004 C 0.236 ± 0.016 0.023 ± 0.001 0.004 ± 0.001 0.002 ± 0.000 D 0.058 ± 0.016 0.085 ± 0.017 0.252 ± 0.071 0.217 ± 0.009 E 0.056 ± 0.002 0.0009 ± 0.0004 0.0005 ± 0.0002 0.003 ± 0.002 F 0.298 ± 0.013 0.351 ± 0.032 0.823 ± 0.127 0.217 ± 0.007 G 0.276 ± 0.035 0.112 ± 0.020 0.061 ± 0.002 0.073 ± 0.002 H 0.232 ± 0.012 0.213 ± 0.028 0.403 ± 0.047 0.079 ± 0.005 I 0.092 ± 0.026 0.055 ± 0.000 0.002 ± 0.003 0.010 ± 0.004 Group Day 36 A 1.000 ± 0.024 B 0.046 ± 0.007 C 0.003 ± 0.000 D 0.319 ± 0.034 E 0.002 ± 0.000 F 0.122 ± 0.004 G 0.047 ± 0.006 H 0.056 ± 0.003 I 0.021 ± 0.007

[0736] The data in Table 13 indicate that the RNAi agents examined, both individually and in combination, provided a reduction in HBV DNA levels compared to the PBS group. Re-dosing or increasing the dose amount yielded additional HBV DNA reductions.

Example 6. HBV RNAi Agents in pHBV Mice: Dose Response and Combination Studies

[0737] The pHBV mouse model described in Example 2, above, was used. Mice were divided into various groups as set forth in Table 14, below, and each mouse was administered a single 200 μl subcutaneous injection pursuant to the dosing regimen set forth in Table 14:

TABLE-US-00014 TABLE 14 Dosing groups of pHBV mice for Example 6. Group RNAi Agent and Dose Dosing Regimen A PBS (no RNAi agent) Single injection on day 1 B 4.0 mg/kg AD04981 Single injection on day 1 C 1.0 mg/kg AD04981 Single injection on day 1 D 2.0 mg/kg AD04981 Single injection on day 1 E 1.0 mg/kg AD04963 Single injection on day 1 F 2.0 mg/kg AD04963 Single injection on day 1 G 3.0 mg/kg AD04872 Single injection on day 1 H 3.0 mg/kg AD04872 + Single injection on day 1 1.0 mg/kg AD04981 I 3.0 mg/kg AD04872 + Single injection on day 1 1.0 mg/kg AD04963 J 3.0 mg/kg AD04872 + Single injection on day 1 2.0 mg/kg AD04981

[0738] Each mouse was given a subcutaneous administration of 200 μl containing the amount of HBV RNAi agent(s) formulated in phosphate buffered saline, or 200 μl of phosphate buffered saline without an HBV RNAi agent, as set forth in Table 14. Each of the HBV RNAi agents included N-acetyl-galactosamine targeting ligands conjugated to the 5′-terminal end of the sense strand, as shown in Tables 4 and 5. The injections were performed between the skin and muscle (i.e. subcutaneous injections) into the loose skin over the neck and shoulder area. Three (3) mice in each group were tested (n=3).

[0739] Serum was collected on day −1 prior to administration, and then on day 8, day 15, day 22, day 29, and day 36, and serum HBsAg levels were determined pursuant to the procedure set forth in Example 2, above. Data from the experiment is shown in the following Table 15, with Average HBsAg reflecting the normalized average value of HBsAg:

TABLE-US-00015 TABLE 15 Average HBsAg levels normalized to pre-treatment and PBS control in pHBV mice following administration of HBV RNAi agents from Example 6 (standard deviation reflected as (+/−)). Group Day 8 Day 15 Day 22 A 1.000 ± 0.068 1.000 ± 0.183 1.000 ± 0.181 B 0.085 ± 0.020 0.068 ± 0.005 0.089 ± 0.014 C 0.283 ± 0.039 0.343 ± 0.055 0.436 ± 0.004 D 0.161 ± 0.052 0.137 ± 0.036 0.190 ± 0.068 E 0.182 ± 0.040 0.233 ± 0.023 0.436 ± 0.029 F 0.078 ± 0.024 0.093 ± 0.015 0.167 ± 0.028 G 0.066 ± 0.030 0.013 ± 0.002 0.010 ± 0.002 H 0.033 ± 0.012 0.016 ± 0.005 0.020 ± 0.005 I 0.040 ± 0.011 0.028 ± 0.003 0.032 ± 0.007 J 0.035 ± 0.010 0.019 ± 0.002 0.021 ± 0.001 Group Day 29 Day 36 A 1.000 ± 0.032 1.000 ± 0.141 B 0.148 ± 0.016 0.194 ± 0.047 C 0.622 ± 0.041 0.741 ± 0.132 D 0.234 ± 0.055 0.280 ± 0.071 E 0.623 ± 0.116 0.782 ± 0.114 F 0.259 ± 0.014 0.368 ± 0.068 G 0.010 ± 0.003 0.009 ± 0.004 H 0.022 ± 0.005 0.024 ± 0.009 I 0.065 ± 0.014 0.087 ± 0.015 J  0.031 ± 0.0001 0.044 ± 0.002

[0740] The HBV RNAi agents tested showed a reduction in HBsAg as compared to the PBS control across all measured time points. Furthermore, combination treatment of AD04872 (which includes an antisense strand sequence that is at least partially complementary to the S ORF at positions 261-279 of the HBV genome, as shown in Tables 1 and 2) and either AD04981 or AD04963 (both of which include antisense strand sequences that are at least partially complementary to the X ORF at positions 1781-1799 of the HBV genome, as shown in Tables 1 and 2), which are shown in Groups H, I, and J of Example 6, illustrate that combination treatment of two RNAi agents targeting, one which targets in the S ORF, and the other which targets in the X ORF of the HBV genome, similarly showed reduction in HBsAg compared to the PBS control across all measured time points.

[0741] Additionally, Serum Hepatitis B e-antigen (HBeAg) levels were also assessed. Samples from the mice in each respective group were first pooled, and the resulting serum samples were assayed in singlet. Data from the experiment is shown in the following Table:

TABLE-US-00016 TABLE 16 Average HBeAg levels normalized to pre-treatment and PBS control in pHBV mice following administration of HBV RNAi agents from Example 6. Group Day 8 Day 15 Day 22 Day 29 Day 36 A 1.000 1.000 1.000 0.183 1.000 B 0.138 0.180 0.274 0.005 0.089 C 0.316 0.376 0.588 0.055 0.436 D 0.167 0.250 0.262 0.036 0.190 E 0.301 0.327 0.447 0.023 0.436 F 0.167 0.172 0.305 0.015 0.167 G 0.275 0.135 0.158 0.002 0.010 H 0.080 0.053 0.094 0.005 0.020 I 0.165 0.124 0.185 0.003 0.032 J 0.120 0.057 0.101 0.002 0.021

[0742] As shown in Table 16, the combination AD04872 (which targets the S ORF of the HBV genome) with either AD04981 or AD04963 (both of which target the X ORF of the HBV genome), showed a further reduction in HBeAg levels relative to administering AD04872 alone.

Example 7. HBV RNAi Agents in pHBV Mice: Additional Dose Response and Combination Studies

[0743] The pHBV mouse model described in Example 2, above, was used. Mice were divided into various groups as set forth in Table 17, below, and each mouse was administered a single 200 μl subcutaneous injection pursuant to the dosing regimen set forth in Table 17:

TABLE-US-00017 TABLE 17 Dosing groups of pHBV mice for Example 7. Group RNAi Agent and Dose Dosing Regimen A PBS (no RNAi agent) Single injection on day 1 B 4.0 mg/kg AD04776 Single injection on day 1 C 1.0 mg/kg AD04982 Single injection on day 1 D 2.0 mg/kg AD04982 Single injection on day 1 E 1.0 mg/kg AD04776 Single injection on day 1 F 2.0 mg/kg AD04776 Single injection on day 1 G 3.0 mg/kg AD04872 Single injection on day 1 H 3.0 mg/kg AD04872 + Single injection on day 1 1.0 mg/kg AD04982 I 3.0 mg/kg AD04872 + Single injection on day 1 2.0 mg/kg AD04982

[0744] Each mouse was given a subcutaneous administration of 200 μl containing the amount of HBV RNAi agent(s) formulated in phosphate buffered saline, or 200 μl of phosphate buffered saline without an HBV RNAi agent, as set forth in Table 17. Each of the HBV RNAi agents included N-acetyl-galactosamine targeting ligands conjugated to the 5′-terminal end of the sense strand, as shown in Tables 4 and 5. The injections were performed between the skin and muscle (i.e. subcutaneous injections) into the loose skin over the neck and shoulder area. Four (4) mice in each group were tested on day −1 and day 8 (n=4), and then one mouse per group was euthanized for histological evaluation. Three (3) mice in each group were tested at day 22 and day 29 (n=3).

[0745] Serum was collected on day −1 prior to administration, and then on day 8, day 15, day 22, and day 29, and serum Hepatitis B surface antigen (HBsAg) levels were determined pursuant to the procedure set forth in Example 2, above. Data from the experiment is shown in the following Table 18:

TABLE-US-00018 TABLE 18 Average HBsAg levels normalized to pre-treatment (day −1) and PBS control in pHBV mice following administration of HBV RNAi agents from Example 7 (standard deviation reflected as (+/−)). Group Day 8 Day 15 Day 22 Day 29 A 1.000 ± 0.347 1.000 ± 0.278 1.000 ± 0.194 1.000 ± 0.318 B 0.117 ± 0.069 0.085 ± 0.039 0.148 ± 0.045 0.198 ± 0.049 C 0.519 ± 0.058 0.375 ± 0.012 0.422 ± 0.046 0.525 ± 0.037 D 0.342 ± 0.062 0.255 ± 0.046 0.272 ± 0.122 0.314 ± 0.068 E 0.279 ± 0.057 0.245 ± 0.032 0.374 ± 0.121 0.304 ± 0.035 F 0.224 ± 0.018 0.161 ± 0.009 0.310 ± 0.016 0.482 ± 0.053 G 0.029 ± 0.010 0.005 ± 0.001 0.004 ± 0.001 0.006 ± 0.001 H 0.016 ± 0.005 0.004 ± 0.001 0.010 ± 0.006 0.015 ± 0.008 I 0.026 ± 0.012 0.008 ± 0.001 0.010 ± 0.002 0.015 ± 0.005

[0746] The HBV RNAi agents tested showed a reduction in HBsAg as compared to the PBS control across all measured time points.

[0747] Additionally, Serum Hepatitis B e-antigen (HBeAg) levels were also assessed. Samples from the mice in each respective group were first pooled, and the resulting serum samples were assayed in singlet. Data from the experiment is shown in the following Table:

TABLE-US-00019 TABLE 19 Average HBeAg levels normalized to pre-treatment and PBS control in pHBV mice following administration of HBV RNAi agents from Example 7. Group Day 8 Day 15 Day 22 Day 29 Day 36 A 1.000 1.000 1.000 1.000 1.000 B 0.193 0.213 0.260 0.307 0.464 C 0.471 0.424 0.562 0.513 0.705 D 0.335 0.310 0.411 0.442 0.500 E 0.381 0.368 0.355 0.564 0.483 F 0.275 0.255 0.370 0.495 0.449 G 0.323 0.218 0.205 0.250 0.190 H 0.124 0.102 0.099 0.156 0.156 I 0.081 0.059 0.045 0.063 0.086

TABLE-US-00020 TABLE 19-1 Average HBeAg fold knockdown normalized to pre- treatment and PBS control in pHBV mice following administration of HBV RNAi agents from Example 7. Day 8 Day 15 Day 22 Day 29 Day 36 Group (Fold KD) (Fold KD) (Fold KD) (Fold KD) (Fold KD) A 1.0 1.0 1.0 1.0 1.0 B 5.2 4.7 3.8 3.3 2.2 C 2.1 2.4 1.8 2.0 1.4 D 3.0 3.2 2.4 2.3 2.0 E 2.6 2.7 2.8 1.8 2.1 F 3.6 3.9 2.7 2.0 2.2 G 3.1 4.6 4.9 4.0 5.3 H 8.1 9.8 10.1 6.4 6.4 I 12.3 17.0 22.3 15.7 11.6

[0748] Table 19-1 reflects the fold knockdown ratio of HBeAg compared to control, which is calculated as normalized HBeAg level of the control (PBS) group/normalized HBeAg level of the respected RNAi agent(s) group (i.e., 1.000/HBeAg level). The data in Table 19-1 indicate that the combination of AD04872 (which, as noted above, includes an antisense strand sequence that is at least partially complementary to the S ORF at positions 261-279 of the HBV genome) with AD04982 (which includes an antisense strand sequence that is at least partially complementary to the X ORF at positions 1781-1799 of the HBV genome), showed a further reduction in HBeAg levels relative to administering the individual RNAi agents alone (See, e.g., Tables 19 and 19-1 for Groups H and I). Further, the data from this Example also show that the combination of AD04872 with AD04982 resulted in fold decrease of HBeAg greater than the sum of the fold decrease of HBeAg in AD04872 and AD04982 administered individually. For example, Group I (which is the administration of 3.0 mg/kg AD04872+2.0 mg/kg AD04982) resulted in a fold decrease of HBeAg at day 15 of 17.0, which is greater than the sum of the fold decrease for Group G (3.0 mg/kg AD04872) of 4.6 plus the fold decrease for Group D (2.0 mg/kg AD04982) of 3.2.

[0749] Further, serum HBV DNA levels were determined for each of the groups in Table 17 from serum samples collected on days −1, 8, 15, 22, 29, and 36, pursuant to the procedure set forth in Example 2, above. Serum HBV DNA was isolated from each animal at each time point. Data are presented in the following Table:

TABLE-US-00021 TABLE 20 Average Serum HBV DNA levels normalized to pre-treatment and PBS control in pHBV mice following administration of HBV RNAi agents from Example 7 (standard deviation reflected as (+/−)). Group Day 8 Day 15 Day 22 Day 29 A 1.000 ± 0.493 1.000 ± 0.358 1.000 ± 0.424 1.000 ± 0.387 B 0.224 ± 0.150 0.263 ± 0.185 0.335 ± 0.204 0.449 ± 0.108 C 0.358 ± 0.207 0.428 ± 0.073 0.433 ± 0.220 0.474 ± 0.090 D 0.516 ± 0.163 0.523 ± 0.264 0.244 ± 0.123 0.241 ± 0.085 E 0.601 ± 0.388 0.319 ± 0.125 0.279 ± 0.138 0.506 ± 0.525 F 0.363 ± 0.128 0.374 ± 0.197 0.275 ± 0.146 0.385 ± 0.141 G 0.071 ± 0.032 0.022 ± 0.009 0.015 ± 0.015 0.025 ± 0.005 H 0.069 ± 0.070 0.018 ± 0.014 0.019 ± 0.020 0.022 ± 0.001 I 0.044 ± 0.024 0.033 ± 0.016 0.017 ± 0.012 0.022 ± 0.014 Group Day 36 A 1.000 ± 0.326 B 0.603 ± 0.068 C 0.509 ± 0.163 D 0.543 ± 0.079 E 0.444 ± 0.407 F 0.721 ± 0.043 G 0.058 ± 0.030 H 0.047 ± 0.021 I 0.058 ± 0.051

[0750] The data in Table 20 indicate that the RNAi agents examined, both individually and in combination, provided a reduction in HBV DNA levels compared to the PBS group, and further show that the combination of AD04872 (which targets the S ORF) and AD04982 (which targets the X ORF) reduces serum HBV DNA to a similar degree as an equal amount of AD04872 alone.

Example 8. HBV RNAi Agents in pHBV Mice: Further Dose Response and Combination Studies

[0751] The pHBV mouse model described in Example 2, above, was used. Mice were divided into various groups as set forth in Table 21, below, and each mouse was administered a single 200 μl subcutaneous injection pursuant to the dosing regimen set forth in Table 21:

TABLE-US-00022 TABLE 21 Dosing groups of pHBV mice for Example 8. Number of Group RNAi Agent and Dose Dosing Regimen Animals (n) 1 .sup.  PBS (no RNAi agent) Single injection on day 1 4 2A 4.0 mg/kg AD04872 + Single injection on day 1 4 1.0 mg/kg AD05070 2B 4.0 mg/kg AD04872 + Single injection on day 1 4 1.0 mg/kg AD05070 3A 3.3 mg/kg AD04872 + Single injection on day 1 4 1.7 mg/kg AD05070 3B 3.3 mg/kg AD04872 + Single injection on day 1 4 1.7 mg/kg AD05070 4A 3.2 mg/kg AD04872 + Single injection on day 1 4 0.8 mg/kg AD05070 4B 3.2 mg/kg AD04872 + Single injection on day 1 4 0.8 mg/kg AD05070 5A 2.7 mg/kg AD04872 + Single injection on day 1 4 1.3 mg/kg AD05070 5B 2.7 mg/kg AD04872 + Single injection on day 1 4 1.3 mg/kg AD05070 6A 4.0 mg/kg AD05070 Single injection on day 1 4 6B 4.0 mg/kg AD05070 Single injection on day 1 4 7A 1.7 mg/kg AD05070 Single injection on day 1 4 7B 1.7 mg/kg AD05070 Single injection on day 1 4 8A 0.8 mg/kg AD05070 Single injection on day 1 4 8B 0.8 mg/kg AD05070 Single injection on day 1 4 9 .sup.  1.7 mg/kg AD05148 Single injection on day 1 4 10 .sup.  2.7 mg/kg AD04872 Single injection on day 1 3 11 .sup.  1.7 mg/kg AD05147 Single injection on day 1 3 12 .sup.  4.0 mg/kg AD04872 Single injection on day 1 3 13 .sup.  1.7 mg/kg AD05149 Single injection on day 1 3

[0752] Additionally, the mice are scheduled to be euthanized pursuant to the following schedule: [0753] Day 11: Euthanize 2 mice from groups 2A, 3A, 4A, 5A, 6A, 7A and 8A, and euthanize one mouse from group 9. [0754] Day 14: Euthanize 2 mice from groups 2A, 3A, 4A, 5A, 6A, 7A, and 8A. [0755] Day 21: Euthanize 2 mice from groups 2B, 3B, 4B, 5B, 6B, 7B, and 8B. [0756] Day 28: Euthanize 2 mice from groups 1, 2B, 3B, 4B, 5B, 6B, 7B, and 8B, and all mice (4) from groups 10 and 12.

[0757] Each mouse was given a subcutaneous administration of 200 μl containing the amount of HBV RNAi agent(s) formulated in phosphate buffered saline, or 200 μl of phosphate buffered saline without an HBV RNAi agent, as set forth in Table 21. Each of the HBV RNAi agents included N-acetyl-galactosamine targeting ligands conjugated to the 5′-terminal end of the sense strand, as shown in Tables 4 and 5. The injections were performed between the skin and muscle (i.e. subcutaneous injections) into the loose skin over the neck and shoulder area. As shown in Table 14 above, four (4) mice in each group were tested (n=4), except for groups 10, 11, 12 and 13, in which three mice were tested (n=3).

[0758] Serum was collected on day −1 prior to administration, and on days 8, 14, 21 and 28, and serum Hepatitis B surface antigen (HBsAg) levels were determined pursuant to the procedure set forth in Example 2, above. Data from the experiment is shown in the following Table:

TABLE-US-00023 TABLE 22 Average HBsAg levels normalized to pre-treatment and PBS control in pHBV mice following administration of HBV RNAi agents from Example 8 (standard deviation reflected as (+/−)). Group Number Day 8 Day 14 Day 21 Day 28 1 .sup.  1.000 ± 0.089 1.000 ± 0.087 1.000 ± 0.132 1.000 ± 0.138 2A 0.009 ± 0.003 0.005 ± 0.001 2B 0.006 ± 0.003 0.002 ± 0.001 0.004 ± 0.001 0.005 ± 0.001 3A 0.032 ± 0.021 0.009 ± 0.004 3B 0.028 ± 0.027 0.008 ± 0.006 0.012 ± 0.005 0.015 ± 0.005 4A 0.036 ± 0.020 0.012 ± 0.006 4B 0.029 ± 0.025 0.010 ± 0.008 0.015 ± 0.005 0.022 ± 0.004 5A 0.027 ± 0.014 0.008 ± 0.002 5B 0.027 ± 0.013 0.007 ± 0.003 0.019 ± 0.004 0.031 ± 0.005 6A 0.058 ± 0.035 0.069 ± 0.039 6B 0.117 ± 0.058 0.079 ± 0.047 0.145 ± 0.082 0.135 ± 0.061 7A 0.189 ± 0.100 0.084 ± 0.029 7B 0.099 ± 0.010 0.147 ± 0.025 0.267 ± 0.048 0.345 ± 0.063 8A 0.355 ± 0.099 0.366 ± 0.069 8B 0.271 ± 0.058 0.334 ± 0.060 0.464 ± 0.055 0.624 ± 0.053 9 .sup.  0.239 ± 0.148 0.179 ± 0.127 0.309 ± 0.213 0.345 ± 0.225 10 .sup.  0.018 ± 0.009 0.005 ± 0.003 0.005 ± 0.002 0.007 ± 0.003 11 .sup.  0.129 ± 0.068 0.138 ± 0.060 0.239 ± 0.092 0.315 ± 0.119 12 .sup.  0.033 ± 0.022 0.002 ± 0.001 0.002 ± 0.001  0.002 ± 0.0004 13 .sup.  0.200 ± 0.093 0.239 ± 0.114 0.367 ± 0.123 0.477 ± 0.125

[0759] The HBV RNAi agents tested, both alone and in combination, showed a substantial reduction in HBsAg as compared to the PBS control across all measured time points.

Example 9. RNAi Agent Delivery

[0760] The pHBV mouse model described in Example 2, above, was used. At day 1, each mouse was administered a single subcutaneous injection of 200 μl containing 10 mg/kg (mpk) of an HBV RNAi agent formulated in phosphate buffered saline, or 200 μl of phosphate buffered saline without an HBV RNAi agent, to be used as a control. The HBV RNAi agents tested included those having the duplex numbers shown in Table 23, below, which each included N-acetyl-galactosamine targeting ligands conjugated to the 5′-terminal end of the sense strand, as shown in Tables 4 and 5. The injections were performed between the skin and muscle (i.e. subcutaneous injections) into the loose skin over the neck and shoulder area. Three (3) mice in each group were tested (n=3).

[0761] Serum was collected prior to administration, and then on day 8, day 15, day 22, and day 29, and serum Hepatitis B surface antigen (HBsAg) levels were determined pursuant to the procedure set forth in Example 2, above. Data from the experiment is shown in the following Table:

TABLE-US-00024 TABLE 23 Average HBsAg levels normalized to pre-treatment and PBS control in pHBV mice following administration of HBV RNAi agents from Example 9 (standard deviation reflected as (+/−)). HBsAg in serum at nadir % KD at Day of RNAi agent (norm. fraction) nadir nadir PBS 1.000 N/A N/A AD03498 0.087 ± 0.016 91.3% 8 AD03499 0.069 ± 0.011 93.1% 15 AD03500 0.095 ± 0.031 90.5% 8 AD03501 0.046 ± 0.020 95.4% 15

[0762] Each of the HBV RNAi agents shown in Table 23, above, included an antisense strand sequence that is at least partially complementary to the X ORF at positions 1781-1799 of the HBV genome. Each of the RNAi agents showed a significant knockdown compared to PBS control.

Example 10. HBV RNAi Agents in pHBV Mice: Further Combination Studies

[0763] The pHBV mouse model described in Example 2, above, was used. Mice were divided into various groups as set forth in Table 24, below, and each mouse was administered a single 200 μl subcutaneous injection pursuant to the dosing regimen set forth in Table 24:

TABLE-US-00025 TABLE 24 Dosing groups of pHBV mice for Example 10. Group RNAi Agent and Dose Dosing Regimen A PBS Group I (no Single injection on day 1 and day 22 RNAi agent) B PBS Group II (no Single injection on day 1 and day 22 RNAi agent) C 3.0 mg/kg AD04585 Single injection on day 1, day 22, day 50, and day 64 D 3.0 mg/kg AD04771 Single injection on day 1 and day 22 E 3.0 mg/kg AD04580 Single injection on day 1, day 22, day 50, and day 64 F 3.0 mg/kg AD04776 Single injection on day 1 and day 22 G 1.5 mg/kg AD04585 + Single injection on day 1, day 22, day 1.5 mg/kg AD04580 50, and day 64 H 1.5 mg/kg AD04771 + Single injection on day 1 and day 22 1.5 mg/kg AD04776 I 2.0 mg/kg AD04771 + Single injection on day 1 and day 22 1.0 mg/kg AD04776 J 2.25 mg/kg AD04771 + Single injection on day 1 and day 22 0.75 mg/kg AD04776

[0764] Each mouse was given a subcutaneous administration of 200 μl containing the amount of HBV RNAi agent(s) formulated in phosphate buffered saline, or 200 μl of phosphate buffered saline without an HBV RNAi agent, as set forth in Table 24. Each of the HBV RNAi agents included N-acetyl-galactosamine targeting ligands conjugated to the 5′-terminal end of the sense strand, as shown in Tables 4 and 5. The injections were performed between the skin and muscle (i.e. subcutaneous injections) into the loose skin over the neck and shoulder area. Three (3) mice in each group were tested (n=3).

[0765] Serum was collected prior to administration, and then on day −1, day 8, day 15, day 22, day 29, day 36, day 43, day 50, day 57, and day 64. Serum Hepatitis B surface antigen (HBsAg) levels were determined pursuant to the procedure set forth in Example 2, above. Data from the experiment is shown in the following:

TABLE-US-00026 TABLE 25 Average HBsAg levels normalized to pre-treatment and PBS control (Group A used as control) in pHBV mice following administration of HBV RNAi agents from Example 10 (standard deviation reflected as (+/−)). Group Day 8 Day 15 Day 22 A 1.000 ± 0.146 1.000 ± 0.095 1.000 ± 0.202 B 0.931 ± 0.161 1.091 ± 0.156 1.132 ± 0.259 C 0.071 ± 0.050 0.031 ± 0.022 0.024 ± 0.013 D 0.134 ± 0.035 0.130 ± 0.024 0.119 ± 0.028 E 0.015 ± 0.001 0.041 ± 0.012 0.087 ± 0.015 F 0.197 ± 0.081 0.308 ± 0.138 0.476 ± 0.156 G 0.029 ± 0.015 0.069 ± 0.029 0.094 ± 0.016 H 0.191 ± 0.057 0.315 ± 0.094 0.420 ± 0.126 I 0.153 ± 0.050 0.194 ± 0.076 0.233 ± 0.116 J 0.155 ± 0.059 0.177 ± 0.067 0.316 ± 0.117 Group Day 29 Day 36 Day 43 A 1.000 ± 0.182 1.000 ± 0.287 1.000 ± 0.298 B 1.417 ± 0.414 1.166 ± 0.248 C 0.007 ± 0.005 0.004 ± 0.003 0.006 ± 0.001 D 0.048 ± 0.023 0.036 ± 0.020 0.052 ± 0.027 E 0.014 ± 0.006 0.021 ± 0.011 0.026 ± 0.011 F 0.246 ± 0.081 0.244 ± 0.097 0.179 ± 0.061 G 0.023 ± 0.009 0.027 ± 0.009 0.037 ± 0.013 H 0.200 ± 0.080 0.185 ± 0.081 0.194 ± 0.055 I 0.141 ± 0.082 0.133 ± 0.051 0.151 ± 0.082 J 0.133 ± 0.064 0.102 ± 0.039 0.129 ± 0.050 Group Day 50 Day 57 Day 64 A 1.000 ± 0.296 1.000 ± 0.394 1.000 ± 0.395 B C  0.015 ± 0.0001 0.002 ± 0.001 0.004 ± 0.001 D E 0.052 ± 0.015 0.009 ± 0.002 0.018 ± 0.007 F G 0.076 ± 0.020 0.012 ± 0.003 0.020 ± 0.007 H I J

[0766] HBV RNAi agents AD04585 and AD04771 were designed to have antisense strand sequences that are at least partially complementary to the S open reading frame at positions 257-275 of the HBV genome, as shown in Tables 1 and 2. HBV RNAi agents AD04580 and AD04776 were designed to have antisense strand sequences that are at least partially complementary to the X open reading frame at positions 1781-1799 of the HBV genome, as shown in Tables 1 and 2 The HBV RNAi agents tested, both alone and in combination, showed a reduction in HBsAg as compared to the PBS control across all measured time points. Each subsequent dose further reduced the nadir of HBsAg reduction.

[0767] Additionally, serum HBV DNA levels were determined for Group C (3.0 mg/kg AD04585), Group E (3.0 mg/kg AD04580), and Group G (1.5 mg/kg AD04585+1.5 mg/kg AD04580) in Table 24, from serum samples collected on days −1, 8, 15, 22, 29, and 36, 43 and 50 pursuant to the procedure set forth in Example 2, above. Serum HBV DNA was isolated for each animal at each of these time points. Data are presented in the following Table:

TABLE-US-00027 TABLE 26 Average Serum HBV DNA levels normalized to pre-treatment and PBS controls (both PBS groups A and B) in pHBV mice following administration of HBV RNAi agents from Example 10 (standard deviation reflected as (+/−)). Group Day 8 Day 15 Day 22 Day 29 A/B 1.000 ± 0.316 1.000 ± 0.427 1.000 ± 0.428 1.000 ± 0.475 (PBS) C 0.172 ± 0.151 0.142 ± 0.079 0.252 ± 0.132 0.072 ± 0.086 E 0.024 ± 0.015 0.042 ± 0.037 0.449 ± 0.184 0.053 ± 0.048 G 0.093 ± 0.053 0.083 ± 0.037 0.370 ± 0.153 0.211 ± 0.060 Group Day 36 Day 43 Day 50 A/B 1.000 ± 0.623 1.000 ± 0.532 1.000 ± 0.532 (PBS) C 0.044 ± 0.020 0.104 ± 0.033 0.156 ± 0.016 E 0.012 ± 0.004 0.061 ± 0.031 0.161 ± 0.019 G 0.048 ± 0.022 0.147 ± 0.010 0.295 ± 0.041

[0768] The data in Table 26 indicate that the HBV RNAi agents examined, both individually and in combination, provided a reduction in HBV DNA levels compared to the PBS group.

Example 11. HBV RNAi Agents in pHBV Mice: Combination Studies

[0769] The pHBV mouse model described in Example 2, above, was used. Mice were divided into various groups as set forth in Table 27, below, and each mouse was administered a single 200 μl subcutaneous injection pursuant to the dosing regimen set forth in Table 27:

TABLE-US-00028 TABLE 27 Dosing groups of pHBV mice for Example 11. Group RNAi Agent and Dose Dosing Regimen A PBS (no RNAi agent) Single injection on day 1 B 3.0 mg/kg AD04962 Single injection on day 1 C 3.0 mg/kg AD04963 Single injection on day 1 D 1.5 mg/kg AD04962 + Single injection on day 1 1.5 mg/kg AD04963 E 2.0 mg/kg AD04962 + Single injection on day 1 1.0 mg/kg AD04963 F 2.25 mg/kg AD04962 + Single injection on day 1 0.75 mg/kg AD04963 G 1.5 mg/kg AD04962 + Single injection on day 1 1.5 mg/kg AD04963 H 3.0 mg/kg AD04962 + Single injection on day 1 3.0 mg/kg AD04963 I 1.5 mg/kg AD04962 + Single injection on day 1 1.5 mg/kg AD04963 J 4.5 mg/kg AD04962 + Single injection on day 1 4.5 mg/kg AD04963 K 3.0 mg/kg AD04872 Single injection on day 1 L 3.0 mg/kg AD04882 Single injection on day 1 M 3.0 mg/kg AD04885 Single injection on day 1

[0770] Each mouse was given a subcutaneous administration of 200 μl containing the amount of HBV RNAi agent(s) formulated in phosphate buffered saline, or 200 μl of phosphate buffered saline without an HBV RNAi agent, as set forth in Table 24. Each of the HBV RNAi agents included N-acetyl-galactosamine targeting ligands conjugated to the 5′-terminal end of the sense strand, as shown in Tables 4 and 5. The injections were performed between the skin and muscle (i.e. subcutaneous injections) into the loose skin over the neck and shoulder area. Three (3) mice in each group were tested (n=3).

[0771] Serum was collected on day −1 prior to administration, and then on day 8, day 15, day 22, day 29, and day 36 (except for Group L (AD04882) and Group M (AD04885), and serum Hepatitis B surface antigen (HBsAg) levels were determined pursuant to the procedure set forth in Example 2, above. Data from the experiment is shown in the following Table:

TABLE-US-00029 TABLE 28 Average HBsAg normalized to pre-treatment and PBS control in pHBV mice following administration of HBV RNAi agents from Example 11 (standard deviation reflected as (+/−)). Group Day 8 Day 15 Day 22 A 1.000 ± 0.048 1.000 ± 0.144 1.000 ± 0.083 B 0.125 ± 0.025 0.083 ± 0.014 0.063 ± 0.016 C 0.019 ± 0.005 0.035 ± 0.008 0.052 ± 0.009 D 0.054 ± 0.013 0.079 ± 0.009 0.108 ± 0.021 E 0.099 ± 0.025 0.098 ± 0.053 0.142 ± 0.050 F 0.070 ± 0.015 0.103 ± 0.036 0.140 ± 0.020 G 0.041 ± 0.021 0.012 ± 0.008 0.021 ± 0.013 H 0.020 ± 0.006 0.044 ± 0.010 0.062 ± 0.019 I 0.077 ± 0.017 0.019 ± 0.004 0.004 ± 0.001 J 0.012 ± 0.002 0.021 ± 0.001 0.032 ± 0.002 K 0.045 ± 0.014 0.013 ± 0.005 0.008 ± 0.005 L 0.106 ± 0.020 0.176 ± 0.044 0.215 ± 0.082 M 0.275 ± 0.029 0.378 ± 0.080 0.572 ± 0.043 Group Day 29 Day 36 A 1.000 ± 0.209 1.000 ± 0.270 B 0.079 ± 0.020 0.096 ± 0.007 C 0.087 ± 0.014 0.164 ± 0.026 D 0.176 ± 0.014 0.292 ± 0.030 E 0.223 ± 0.082 0.373 ± 0.150 F 0.213 ± 0.020 0.328 ± 0.034 G 0.031 ± 0.013 0.078 ± 0.064 H  0.97 ± 0.028 0.160 ± 0.060 I 0.008 ± 0.001  0.002 ± 0.0003 J 0.044 ± 0.008 0.069 ± 0.009 K 0.011 ± 0.007 0.011 ± 0.009 L 0.299 ± 0.009 M 0.792 ± 0.057

[0772] RNAi agent AD04962 was designed to have an antisense strand sequence that is at least partially complementary to the S open reading frame at positions 257-275 of the HBV genome, as shown in Tables 1 and 2. RNAi agent AD04872 was designed to have an antisense strand sequence that is at least partially complementary to the S open reading frame at positions 261-279 of the HBV genome, as shown in Tables 1 and 2. RNAi agent AD04963 was designed to have an antisense strand sequence that is at least partially complementary to the X open reading frame at positions 1781-1799 of the HBV genome, as shown in Tables 1 and 2. RNAi agents AD04882 and AD04885 were designed to have antisense strand sequences that are at least partially complementary to the X open reading frame at positions 1780-1798 of the HBV genome, as shown in Tables 1 and 2. The HBV RNAi agents shown in Table 9, directly above, each showed a reduction in HBsAg as compared to the PBS control across all measured timepoints, both individually and in combination. Re-dosing yielded additional HBsAg reduction.

[0773] Additionally, Serum Hepatitis B e-antigen (HBeAg) levels were also assessed for all groups except Groups L and M. Samples from the mice in each respective group were first pooled, and the resulting serum samples were assayed in singlet. Data from the experiment is shown in the following Table:

TABLE-US-00030 TABLE 29 Average HBeAg levels normalized to pre-treatment and PBS control in pHBV mice following administration of HBV RNAi agents from Example 11. Group Day 8 Day 22 Day 29 Day 36 A 1.000 1.000 1.000 1.000 B 0.425 0.291 0.371 0.365 C 0.152 0.170 0.328 0.356 D 0.266 0.249 0.456 0.440 E 0.278 0.295 0.589 0.561 F 0.306 0.291 0.718 0.522 G 0.183 0.138 0.291 0.249 H 0.091 0.131 0.315 0.238 I 0.183 0.052 0.069 0.036 J 0.089 0.114 0.190 0.236 K 0.458 0.172 0.322 0.207

[0774] Further, serum HBV DNA levels were determined for each of the groups in Table 27 from serum samples collected on days 8, 15, 22, and 29, pursuant to the procedure set forth in Example 2, above. Serum HBV DNA was isolated from each animal at each time point. Data are presented in the following Table:

TABLE-US-00031 TABLE 30 Average Serum HBV DNA levels normalized to pre-treatment and PBS control in pHBV mice following administration of HBV RNAi agents from Example 7 (standard deviation reflected as (+/−)). Group Day 8 Day 15 Day 22 Day 29 A 1.000 ± 0.232 1.000 ± 0.463 1.000 ± 0.272 1.000 ± 0.205 B 0.577 ± 0.219 0.222 ± 0.064 0.196 ± 0.055 0.261 ± 0.117 C 0.165 ± 0.051 0.070 ± 0.042 0.142 ± 0.105 0.228 ± 0.174 D 0.343 ± 0.125 0.307 ± 0.091 0.300 ± 0.092 0.356 ± 0.032 E 0.262 ± 0.033 0.216 ± 0.018 0.227 ± 0.028 0.279 ± 0.090 F 0.320 ± 0.134 0.332 ± 0.208 0.344 ± 0.209 0.338 ± 0.211 G 0.231 ± 0.036 0.034 ± 0.024 0.069 ± 0.039 0.077 ± 0.020 H 0.229 ± 0.101 0.155 ± 0.121 0.148 ± 0.079 0.215 ± 0.035 I 0.281 ± 0.129 0.109 ± 0.071 0.023 ± 0.019 0.011 ± 0.009 J 0.078 ± 0.050 0.061 ± 0.020 0.074 ± 0.029 0.056 ± 0.030 K 0.314 ± 0.064 0.119 ± 0.043 0.076 ± 0.067 0.078 ± 0.095 L 0.295 ± 0.077 0.305 ± 0.101 0.213 ± 0.088 0.186 ± 0.084 M 0.515 ± 0.247 0.505 ± 0.293 0.488 ± 0.318 0.478 ± 0.267

[0775] The data in Table 30 indicate that the RNAi agents examined, both individually and in combination, provided a reduction in HBV DNA levels compared to the PBS group. Re-dosing yielded addition reduction of HBV DNA.

Example 12. HBV RNAi Agents in pHBV Mice

[0776] The pHBV mouse model described in Example 2, above, was used. Mice were divided into various groups as set forth in Table 31, below, and each mouse was administered a single 200 μl subcutaneous injection pursuant to the dosing regimen set forth in Table 31:

TABLE-US-00032 TABLE 31 Dosing groups of pHBV mice for Example 12. Group RNAi Agent and Dose Dosing Regimen A PBS (no RNAi agent) Single injection on day 1 B 2.0 mg/kg AD04871 Single injection on day 1 C 2.0 mg/kg AD04872 Single injection on day 1 D 2.0 mg/kg AD04874 Single injection on day 1 E 2.0 mg/kg AD04875 Single injection on day 1 F 2.0 mg/kg AD04876 Single injection on day 1 G 2.0 mg/kg AD04881 Single injection on day 1 H 2.0 mg/kg AD04883 Single injection on day 1 I 2.0 mg/kg AD04884 Single injection on day 1

[0777] Each mouse was given a subcutaneous administration of 200 μl containing the amount of HBV RNAi agent formulated in phosphate buffered saline, or 200 μl of phosphate buffered saline without an HBV RNAi agent, as set forth in Table 24. Each of the HBV RNAi agents included N-acetyl-galactosamine targeting ligands conjugated to the 5′-terminal end of the sense strand, as shown in Tables 4 and 5. The injections were performed between the skin and muscle (i.e. subcutaneous injections) into the loose skin over the neck and shoulder area. Three (3) mice in each group were tested (n=3).

[0778] Serum was collected prior to administration, and then on day 8, day 15, and day 22. Group A (PBS), Group B (2.0 mg/kg AD04871), Group C (2.0 mg/kg AD04872), Group D (2.0 mg/kg AD04874), Group E (2.0 mg/kg AD04875), and Group F (2.0 mg/kg AD04876) also had serum collected on day 29, day 36, day 43, and day 50. Serum Hepatitis B surface antigen (HBsAg) levels were determined pursuant to the procedure set forth in Example 2, above. Data from the experiment is shown in the following Table:

TABLE-US-00033 TABLE 32 Average HBsAg normalized to pre-treatmenl and PBS control in pHBV mice following administration of HBV RNAi agents from Example 12 (standard deviation reflected as (+/−)). Group Day 8 Day 15 Day 22 Day 29 A 1.000 ± 0.132 1.000 ± 0.089 1.000 ± 0.080 1.000 ± 0.098 B 0.102 ± 0.034 0.041 ± 0.021 0.049 ± 0.033 0.048 ± 0.031 C 0.153 ± 0.064 0.064 ± 0.032 0.063 ± 0.034 0.042 ± 0.017 D 0.123 ± 0.022 0.049 ± 0.017 0.039 ± 0.010 0.023 ± 0.001 E 0.190 ± 0.075 0.094 ± 0.038 0.107 ± 0.061 0.081 ± 0.051 F 0.190 ± 0.031 0.076 ± 0.035 0.084 ± 0.038 0.049 ± 0.024 G 0.159 ± 0.047 0.216 ± 0.057 0.235 ± 0.151 H 0.508 ± 0.078 0.666 ± 0.131 0.543 ± 0.048 I 0.279 ± 0.087 0.357 ± 0.078 0.614 ± 0.156 Group Day 36 Day 43 Day 50 A 1.000 ± 0.065 1.000 ± 0.242 1.000 ± 0.224 B 0.054 ± 0.038 0.064 ± 0.030 0.092 ± 0.025 C 0.049 ± 0.017 0.054 ± 0.015 0.085 ± 0.010 D 0.037 ± 0.004 0.037 ± 0.010 0.065 ± 0.012 E 0.126 ± 0.077 0.125 ± 0.063 0.170 ± 0.079 F 0.089 ± 0.044 0.082 ± 0.034 0.115 ± 0.028 G H I

[0779] HBV RNAi agents AD04871, AD04872, AD04874, AD04875, and AD04876 were each designed to have antisense strand sequences that are at least partially complementary to the S open reading frame at positions 261-279 of the HBV genome, as shown in Tables 1 and 2. Each of these HBV RNAi agents should a substantial reduction in HBsAg compared to PBS control. For example, a single 2 mg/kg dose of each of AD04871 (Group B), AD04872 (Group C) and AD04874 (Group D), and AD04876 (Group F), exhibited a greater than 90% reduction in HBsAg for each of the timepoints measured from day 15 through day 43 compared to control. HBV RNAi agents AD04881, AD04883, AD04884 were each designed to have antisense strand sequences that are at least partially complementary to the X open reading frame at positions 1780-1798 of the HBV genome, as shown in Tables 1 and 2.

Example 13. Dose Response and Combinations of HBV RNAi Agents in X Region Knockout Model Mice

[0780] As an alternative means in assessing the effects of the combination of an RNAi agent that includes an antisense strand sequence that is at least partially complementary to a region located in the S ORF of an HBV mRNA, and a second RNAi agent that includes an antisense strand sequence that is at least partially complementary to a region located in the X ORF of an HBV mRNA, a plasmid was generated that included the HBV genome with a knockout of the binding site for HBV RNAi agents that target positions 1780 and 1781, as shown in Tables 1 and 2 (hereinafter referred to as X Region Knockout mice). This model was generated by mutating ten (10) bases in the pHBV1.3 plasmid within the binding site of these RNAi agents. The remainder of the HBV mRNA, including the S-region, remained functional. Thus, in this HBV mouse model, inclusion of an HBV RNAi agent having an antisense strand that targets positions 1780 and 1781 of the HBV genome disclosed herein is expected to be ineffective in silencing expression.

[0781] The mice were divided into various groups including those set forth in Table 33, below, and the mice were given 200 μl subcutaneous injections pursuant to the dosing regimen set forth in the following Table:

TABLE-US-00034 TABLE 33 Dosing groups of X Region Knockout mice for Example 13. Number of Group RNAi Agent and Dose Dosing Regimen Animals (n) 1 PBS (no RNAi agent) Single injection on day 1 4 2 2.0 mg/kg AD04585 + Single injection on day 1 4 1.0 mg/kg AD04963 3 2.0 mg/kg AD04872 + Single injection on day 1 4 1.0 mg/kg AD04963 4 2.5 mg/kg AD04585 + Single injection on day 1 4 0.5 mg/kg AD04963 5 2.5 mg/kg AD04872 + Single injection on day 1 4 0.5 mg/kg AD04963 6 3.0 mg/kg AD04963 Single injection on day 15 1

[0782] Each mouse was given a subcutaneous administration of 200 μl containing the amount of HBV RNAi agent(s) formulated in phosphate buffered saline, or 200 μl of phosphate buffered saline without an HBV RNAi agent, as set forth in Table 33. Each of the HBV RNAi agents included N-acetyl-galactosamine targeting ligands conjugated to the 5′-terminal end of the sense strand, as shown in Tables 4 and 5. The injections were performed between the skin and muscle (i.e. subcutaneous injections) into the loose skin over the neck and shoulder area. Three (3) mice in each group were tested (n=3).

[0783] Serum was collected on day 5, day 8, day 15, day 22, and day 29 and serum Hepatitis B surface antigen (HBsAg) levels were determined pursuant to the procedure set forth in Example 2, above. Serum was also collected for Groups 1 through 5 on days 36 and 43. Data from the experiment is shown in the following Table 34:

TABLE-US-00035 TABLE 34 Average HBsAg normalized to pre-treatment and PBS control in X Region Knockout mice following administration of HBV RNAi agents from Example 13 (standard deviation reflected as (+/−)). Group Day 8 Day 15 Day 22 1 1.000 ± 0.186 1.000 ± 0.165 1.000 ± 0.132 2 0.061 ± 0.034 0.041 ± 0.035 0.030 ± 0.015 3 0.020 ± 0.011 0.007 ± 0.003 0.003 ± 0.002 4 0.063 ± 0.039 0.022 ± 0.011 0.029 ± 0.013 5 0.027 ± 0.014 0.003 ± 0.003 0.001 ± 0.001 6 0.948 1.360 1.652 Day 29 Day 36 Day 43 1 1.000 ± 0.059 1.000 ± 0.044 1.000 ± 0.045 2 0.051 ± 0.029 0.062 ± 0.029 3 0.004 ± 0.003 0.008 ± 0.003 0.018 ± 0.007 4 0.040 ± 0.022 0.061 ± 0.030 5 0.002 ± 0.001 0.003 ± 0.002 0.014 ± 0.006 6 1.831

[0784] As expected, Group 6, which was a single dose of 3.0 mg/kg of HBV RNAi agent AD04963 and includes an antisense strand that is at least partially complementary to the X open reading frame at positions 1781-1799 of the HBV genome, was unable to provide knockdown of HBsAg. Additionally, each of Groups 2 through 5 provided substantial knockdown of HBsAg compared to PBS control, with both Group 3 and Group 5 exhibiting a greater than 2 log reduction in HBsAg at nadir (day 22).

Example 14. Dose Response and Combinations of HBV RNAi Agents in X Region Knockout Model Mice

[0785] The X Region Knockout mouse model described in Example 13, above, was used. Mice were divided into various groups including those set forth in Table 31, below, and each mouse was administered a single 200 μl subcutaneous injection pursuant to the dosing regimen set forth in Table 35:

TABLE-US-00036 TABLE 35 Dosing groups of X Region Knockout mice for Example 14. Group RNAi Agent and Dose Dosing Regimen 1 PBS (no RNAi agent) Single injection on day 1 2 2.0 mg kg AD04872 Single injection on day 1 3 2.0 mg/kg AD04872 + Single injection on day 1 0.7 mg/kg AD05070 4 2.0 mg/kg AD04872 + Single injection on day 1 1.0 mg/kg AD05070 5 2.0 mg/kg AD04872 + Single injection on day 1 2.0 mg/kg AD05070

[0786] Each mouse was given a subcutaneous administration of 200 μl containing the amount of HBV RNAi agent(s) formulated in phosphate buffered saline, or 200 μl of phosphate buffered saline without an HBV RNAi agent, as set forth in Table 35. Each of the HBV RNAi agents included N-acetyl-galactosamine targeting ligands conjugated to the 5′-terminal end of the sense strand, as shown in Tables 4 and 5. The injections were performed between the skin and muscle (i.e. subcutaneous injections) into the loose skin over the neck and shoulder area. Three (3) mice in each group shown in Table 35 were tested (n=3).

[0787] Serum was collected on day 1 (pre-dose), day 8, day 15, day 22, and day 29, and serum Hepatitis B surface antigen (HBsAg) levels were determined pursuant to the procedure set forth in Example 2, above. Data from the experiment is shown in the following Table:

TABLE-US-00037 TABLE 36 Average HBsAg levels normalized to pre-treatment and PBS control in X Region Knockout mice from Example 14. Group Day 8 Day 15 Day 22 Day 29 1 1.000 ± 0.120 1.000 ± 0.255 1.000 ± 0.224 1.000 ± 0.143 2 0.104 ± 0.104 0.009 ± 0.009 0.005 ± 0.004 0.005 ± 0.003 3 0.076 ± 0.041 0.010 ± 0.009 0.006 ± 0.005 0.005 ± 0.005 4 0.036 ± 0.008 0.002 ± 0.001 0.001 ± 0.001 0.002 ± 0.001 5 0.019 ± 0.017 0.003 ± 0.002 0.003 ± 0.001 0.004 ± 0.000

[0788] Table 36 shows that HBV RNAi agent AD04872 administered alone, and the combination of AD04872 (which includes an antisense strand that is at least partially complementary to the S open reading from at positions 261-279 of the HBV genome) and AD05070 (which includes an antisense strand that is at least partially complementary to the X open reading frame at positions 1781-1799 of the HBV genome), provided significant knockdown of HBsAg compared to PBS control across each of the time points measured. Addition of 0.7 mg/kg to 2 mg/kg HBV RNAi agent AD05070 for which there was a mutated target site in this X Region Knockout model did not diminish the activity of the 2 mg/kg HBV RNAi agent AD04872.

[0789] Additionally, serum HBV DNA levels were determined from serum samples collected on days 8, 15, and 22 pursuant to the procedure set forth in Example 2, above. Serum from each group was pooled and then DNA was isolated from the serum in singlet. Data are presented in the following Table:

TABLE-US-00038 TABLE 37 Average Seram HBV DNA levels normalized to pre-treatment and PBS controls in X Region Knockout mice following administration of HBV RNAi agents from Example 14 (standard deviation reflected as (+/−)). Group Day 8 Day 15 Day 22 1 1.000 ± 0.007 1.000 ± 0.011 1.000 ± 0.066 2 0.225 ± 0.019 0.022 ± 0.001 0.036 ± 0.001 3 0.151 ± 0.002 0.029 ± 0.001 0.042 ± 0.003 4 0.140 ± 0.006 0.016 ± 0.000 0.018 ± 0.000 5 0.069 ± 0.002 0.018 ± 0.003 0.043 ± 0.002

[0790] Addition of 0.7 mg/kg to 2 mg/kg HBV RNAi agent AD05070 for which there was a mutated target site in this X Region Knockout model did not diminish the activity of the 2 mg/kg HBV RNAi agent AD04872.

Example 15. HBV RNAi Agents in pHBV Mice

[0791] The pHBV mouse model described in Example 2, above, was used. Mice were divided into various groups including those set forth in Table 38, below, and each mouse was administered a single 200 μl subcutaneous injection pursuant to the dosing regimen set forth in Table 38:

TABLE-US-00039 TABLE 38 Dosing groups of pHBV mice for Example 15. Group RNAi Agent and Dose Dosing Regimen 1 PBS (no RNAi agent) Single injection on day 1 2 2.0 mg/kg AD04776 Single injection on day 1 3 2.0 mg/kg AD05069 Single injection on day 1 4 2.0 mg/kg AD05070 Single injection on day 1 5 2.0 mg/kg AD05071 Single injection on day 1 6 2.0 mg/kg AD05073 Single injection on day 1 7 2.0 mg/kg AD05074 Single injection on day 1 8 2.0 mg/kg AD05075 Single injection on day 1 9 2.0 mg/kg AD05076 Single injection on day 1 10 2.0 mg/kg AD05077 Single injection on day 1 11 2.0 mg/kg AD05078 Single injection on day 1 12 3.0 mg/kg AD04872 + Single injection on day 1 1.0 mg/kg AD04776 13 3.0 mg/kg AD04872 + Single injection on day 1 1.0 mg/kg AD05069 14 3.0 mg/kg AD04872 + Single injection on day 1 1.0 mg/kg AD05070 15 3.0 mg/kg AD04872 + Single injection on day 1 1.0 mg/kg AD05071 16 3.0 mg/kg AD04872 + Single injection on day 1 1.0 mg/kg AD05073 17 3.0 mg/kg AD04872 + Single injection on day 1 1.0 mg/kg AD05074 18 3.0 mg/kg AD04872 + Single injection on day 1 1.0 mg/kg AD05075 19 3.0 mg/kg AD04872 + Single injection on day 1 1.0 mg/kg AD05076 20 3.0 mg/kg AD04872 + Single injection on day 1 1.0 mg/kg AD05077 21 3.0 mg/kg AD04872 + Single injection on day 1 1.0 mg/kg AD05078

[0792] Each mouse was given a subcutaneous administration of 200 μl containing the amount of HBV RNAi agent(s) formulated in phosphate buffered saline, or 200 μl of phosphate buffered saline without an HBV RNAi agent, as set forth in Table 38. Each of the HBV RNAi agents included N-acetyl-galactosamine targeting ligands conjugated to the 5′-terminal end of the sense strand, as shown in Tables 4 and 5. The injections were performed between the skin and muscle (i.e. subcutaneous injections) into the loose skin over the neck and shoulder area. Three (3) mice in each group were tested (n=3).

[0793] Serum was collected on day −1 prior to administration, and then on day 8, day 15, day 22, day 29, day 36, day 43, and day 50. Serum Hepatitis B surface antigen (HBsAg) levels were determined pursuant to the procedure set forth in Example 2, above. Data from the experiment is shown in the following Table 39, with Average HBsAg reflecting the normalized average value of HBsAg:

TABLE-US-00040 TABLE 39 Average HBsAg normalized to pre-treatment and PBS control in pHBV mice following administration of HBV RNAi agents from Example 15. Group Day 8 Day 15 Day 22 Day 29 1 1.000 ± 0.119 1.000 ± 0.047 1.000 ± 0.080 1.000 ± 0.027 2 0.339 ± 0.076 0.414 ± 0.126 0.385 ± 0.067 0.450 ± 0.075 3 0.240 ± 0.096 0.361 ± 0.078 0.446 ± 0.073 0.508 ± 0.114 4 0.081 ± 0.026 0.127 ± 0.031 0.223 ± 0.057 0.330 ± 0.112 5 0.452 ± 0.020 0.431 ± 0.126 0.373 ± 0.079 0.383 ± 0.080 6 0.375 ± 0.181 0.632 ± 0.192 0.463 ± 0.117 0.567 ± 0.159 7 0.325 ± 0.032 0.438 ± 0.125 0.393 ± 0.056 0.443 ± 0.096 8 0.155 ± 0.031 0.322 ± 0.019 0.333 ± 0.077 0.463 ± 0.043 9 0.245 ± 0.063 0.467 ± 0.090 0.477 ± 0.045 0.562 ± 0.049 10 0.120 ± 0.062 0.173 ± 0.029 0.289 ± 0.019 0.331 ± 0.042 11 0.128 ± 0.042 0.172 ± 0.046 0.179 ± 0.015 0.215 ± 0.049 12 0.040 ± 0.015 0.014 ± 0.004 0.014 ± 0.006 0.015 ± 0.004 13 0.050 ± 0.020 0.015 ± 0.011 0.017 ± 0.008 0.022 ± 0.009 14 0.020 ± 0.011 0.011 ± 0.006 0.015 ± 0.006 0.023 ± 0.004 15 0.043 ± 0.005 0.013 ± 0.005 0.010 ± 0.002 0.011 ± 0.004 16 0.021 ± 0.017 0.008 ± 0.004 0.012 ± 0.003 0.011 ± 0.001 17 0.032 ± 0.011 0.009 ± 0.003 0.007 ± 0.002  0.008 ± 0.0003 18 0.023 ± 0.014 0.010 ± 0.006 0.009 ± 0.006 0.009 ± 0.004 19 0.025 ± 0.006 0.010 ± 0.004 0.009 ± 0.002 0.010 ± 0.003 20 0.061 ± 0.013 0.027 ± 0.006 0.020 ± 0.003 0.029 ± 0.006 21 0.061 ± 0.050 0.013 ± 0.010 0.012 ± 0.005 0.018 ± 0.006 Group Day 36 Day 43 Day 50 1 1.000 ± 0.031 1.000 ± 0.114 1.000 ± 0.112 2 0.617 ± 0.116 0.643 ± 0.154 0.665 ± 0.199 3 0.638 ± 0.067 0.743 ± 0.015 0.792 ± 0.115 4 0.472 ± 0.121 0.515 ± 0.126 0.689 ± 0.167 5 0.591 ± 0.159 0.604 ± 0.086 0.709 ± 0.115 6 0.717 ± 0.136 0.686 ± 0.194 0.781 ± 0.301 7 0.586 ± 0.069 0.775 ± 0.143 0.747 ± 0.095 8 0.666 ± 0.066 0.803 ± 0.096 0.856 ± 0.180 9 0.801 ± 0.047 0.667 ± 0.055 0.765 ± 0.208 10 0.640 ± 0.059 0.667 ± 0.034 0.742 ± 0.133 11 0.429 ± 0.063 0.383 ± 0.005 0.497 ± 0.060 12 0.037 ± 0.013 0.044 ± 0.012 0.056 ± 0.014 13 0.046 ± 0.011 0.055 ± 0.010 0.070 ± 0.010 14 0.054 ± 0.016 0.070 ± 0.018 0.096 ± 0.012 15 0.029 ± 0.011 0.032 ± 0.015 0.051 ± 0.020 16 0.033 ± 0.005 0.038 ± 0.007 0.062 ± 0.004 17 0.021 ± 0.002 0.031 ± 0.004 0.061 ± 0.005 18 0.034 ± 0.014 0.047 ± 0.016 0.079 ± 0.017 19 0.028 ± 0.005 0.037 ± 0.006 0.060 ± 0.011 20 0.070 ± 0.009 0.063 ± 0.018 0.097 ± 0.018 21 0.040 ± 0.012 0.066 ± 0.007 0.120 ± 0.036

[0794] RNAi agents AD04776, AD05069, AD05070, AD05071, AD05073, and AD05074 were each designed to have an antisense strand sequence that is at least partially complementary to the X open reading frame at positions 1781-1799 of the HBV genome, as shown in Tables 1 and 2. RNAi agents AD05075, AD05076, AD05077, and AD05078 were each designed to have antisense strand sequences that are at least partially complementary to the X open reading frame at positions 1780-1798 of the HBV genome, as shown in Tables 1 and 2.

[0795] Table 39 shows that HBV RNAi agents AD04776, AD05069, AD05070, AD05071, AD05073, and AD05074 administered alone or their combination with AD04872 (which includes an antisense strand that is at least partially complementary to the S open reading from at positions 261-279 of the HBV genome) provided significant knockdown of HBsAg compared to PBS control across each of the time points measured.

Example 16. HBV RNAi Agents in pHBV Mice: Dose Response and Combination Studies

[0796] The pHBV mouse model described in Example 2, above, was used. Mice were divided into various groups as set forth in Table 40, below, and each mouse was administered a single 200 μl subcutaneous injection pursuant to the dosing regimen set forth in Table 40:

TABLE-US-00041 TABLE 40 Dosing groups of pHBV mice for Example 16. Group RNAi Agent and Dose Dosing Regimen 1 PBS (no RNAi agent) Single injection on day 1 2 3.2 mg/kg AD04872 Single injection on day 1 3 3.2 mg/kg AD04872 Single injection on day 1 and day 22 4 3.0 mg/kg AD04872 + Single injection on day 1 0.8 mg/kg AD05070 5 3.0 mg/kg AD04872 + Single injection on day 1 and day 22 0.8 mg/kg AD05070 6 3.0 mg/kg AD04872 + Single injection on day 1 1.0 mg/kg AD05070 7 3.0 mg/kg AD04872 + Single injection on day 1 and day 22 1.0 mg/kg AD05070 8 2.7 mg/kg AD04872 + Single injection on day 1 1.3 mg/kg AD05070 9 2.7 mg/kg AD04872 + Single injection on day 1 and day 22 1.3 mg/kg AD05070 10 2.0 mg/kg AD04872 + Single injection on day 1 and day 22 2.0 mg/kg AD04776 11 0.8 mg/kg AD05070 Single injection on day 1 and day 22 12 1.3 mg/kg AD05070 Single injection on day 1 and day 22

[0797] Each mouse was given a subcutaneous administration of 200 μl containing the amount of HBV RNAi agent(s) formulated in phosphate buffered saline, or 200 μl of phosphate buffered saline without an HBV RNAi agent, as set forth in Table 40. Each of the HBV RNAi agents included N-acetyl-galactosamine targeting ligands conjugated to the 5′-terminal end of the sense strand, as shown in Tables 4 and 5. The injections were performed between the skin and muscle (i.e. subcutaneous injections) into the loose skin over the neck and shoulder area. Six (6) mice in each group were tested (n=6).

[0798] Serum was collected prior to administration, and then on day 8, day 15, day 22, and day 29, and serum Hepatitis B surface antigen (HBsAg) levels were determined pursuant to the procedure set forth in Example 2, above. Data from the experiment is shown in the following Table 41:

TABLE-US-00042 TABLE 41 Average HBsAg levels normalized to pre-treatment and PBS control in pHBV mice following administration of HBV RNAi agents from Example 16 (standard deviation reflected as (+/−)). Group Day 8 Day 15 Day 22 Day 29 1 1.000 ± 0.117 1.000 ± 0.213 1.000 ± 0.169 1.000 ± 0.130 2 0.050 ± 0.018 0.015 ± 0.007 0.011 ± 0.005 0.009 ± 0.006 3 0.051 ± 0.037 0.014 ± 0.011 0.010 ± 0.006 0.002 ± 0.001 4 0.029 ± 0.018 0.010 ± 0.006 0.011 ± 0.006 0.010 ± 0.005 5 0.022 ± 0.003 0.007 ± 0.001 0.009 ± 0.003 0.001 ± 0.001 6 0.027 ± 0.012 0.007 ± 0.004 0.008 ± 0.005 0.011 ± 0.005 7 0.028 ± 0.012 0.010 ± 0.005 0.009 ± 0.005 0.001 ± 0.000 8 0.033 ± 0.016 0.016 ± 0.008 0.020 ± 0.009 0.021 ± 0.011 9 0.034 ± 0.025 0.015 ± 0.011 0.018 ± 0.013 0.003 ± 0.002 10 0.038 ± 0.021 0.015 ± 0.005 0.019 ± 0.004 0.003 ± 0.001 11 0.446 ± 0.143 0.376 ± 0.120 0.474 ± 0.149 0.338 ± 0.123 12 0.307 ± 0.111 0.257 ± 0.122 0.236 ± 0.057 0.138 ± 0.031

[0799] The HBV RNAi agents tested, both individually and in combination, showed a reduction in HBsAg as compared to the PBS control across all measured time points. HBsAg expression was further reduced in all groups that were re-dosed on day 22.

[0800] Additionally, Serum Hepatitis B e-antigen (HBeAg) levels were also assessed. For the day 8 measurement, the serum samples for all six mice in each group were pooled, and the resulting samples were assayed in singlet. For the day −1, day 15, day 22, and day 29 measurements, the six mice from each group were paired within each group and their respective serum samples were pooled, forming three subgroups for each group. The serum samples for each of the three subgroups for each group were then assayed. Data from the experiment is shown in the following Table 42:

TABLE-US-00043 TABLE 42 Average HBeAg levels normalized to pre-treatment and PBS control in pHBV mice following administration of HBV RNAi agents from Example 16 (standard deviation for days 15, 22, and 29 reflected as (+/−)). Group Day 8 Day 15 Day 22 Day 29 1 1.000 1.000 ± 0.011 1.000 ± 0.170 1.000 ± 0.173 2 0.510 0.308 ± 0.031 0.217 ± 0.021 0.226 ± 0.035 3 0.488 0.301 ± 0.065 0.283 ± 0.081 0.147 ± 0.030 4 0.213 0.216 ± 0.067 0.192 ± 0.029 0.141 ± 0.048 5 0.192 0.211 ± 0.053 0.216 ± 0.088 0.047 ± 0.016 6 0.176 0.163 ± 0.022 0.238 ± 0.069 0.117 ± 0.011 7 0.165 0.175 ± 0.046 0.215 ± 0.061 0.028 ± 0.012 8 0.128 0.166 ± 0.065 0.386 ± 0.284 0.167 ± 0.118 9 0.172 0.171 ± 0.037 0.244 ± 0.052 0.032 ± 0.010 10 0.180 0.211 ± 0.012 0.283 ± 0.034 0.034 ± 0.001 11 0.634 0.594 ± 0.082 0.840 ± 0.152 0.271 ± 0.029 12 0.486 0.441 ± 0.066 0.804 ± 0.096 0.214 ± 0.039

[0801] The HBV RNAi agents tested, both individually and in combination, showed a reduction in HBeAg as compared to the saline control across all measured time points. HBeAg expression was further reduced in all groups that were re-dosed on day 22.

[0802] Further, serum HBV DNA levels were determined for each of the groups in Table 40 from serum samples collected on days −1, 8, 15, and 22, pursuant to the procedure set forth in Example 2, above. Serum from each pair of mice was pooled and then DNA was isolated from each serum pool in a single isolation. Data are presented in the following Table:

TABLE-US-00044 TABLE 43 Average Serum HBV DNA levels normalized to pre-treatment and PBS control in pHBV mice following administration of HBV RNAi agents from Example 16 (standard deviation reflected as (+/−)). Group Day 8 Day 15 Day 22 1 1.000 ± 0.122 1.000 ± 0.299 1.000 ± 0.241 2 0.312 ± 0.016 0.126 ± 0.008 0.087 ± 0.018 3 0.264 ± 0.065 0.081 ± 0.023 0.073 ± 0.028 4 0.321 ± 0.254 0.120 ± 0.066 0.134 ± 0.101 5 0.319 ± 0.081 0.108 ± 0.038 0.098 ± 0.051 6 0.260 ± 0.095 0.068 ± 0.010 0.076 ± 0.031 7 0.170 ± 0.028 0.082 ± 0.013 0.062 ± 0.018 8 0.188 ± 0.020 0.192 ± 0.160 0.307 ± 0.309 9 0.242 ± 0.003 0.100 ± 0.042 0.075 ± 0.028 10 0.322 ± 0.028 0.159 ± 0.025 0.086 ± 0.016 11 1.124 ± 0.142 0.742 ± 0.127 0.807 ± 0.192 12 1.004 ± 0.144 0.541 ± 0.340 0.569 ± 0.060

[0803] The HBV RNAi agents tested, both individually and in combination, showed a reduction in serum HBV DNA as compared to the saline control across all measured time points except in groups 11 and 12 that had no reduction in serum HBV DNA at Day 8.

Example 17. HBV RNAi Agents in pHBV Mice

[0804] The pHBV mouse model described in Example 2, above, was used. Mice were divided into various groups as set forth in Table 44, below, and each mouse was administered a single 200 μl subcutaneous injection pursuant to the dosing regimen set forth in Table 44:

TABLE-US-00045 TABLE 44 Dosing groups of pHBV mice for Example 17. Group RNAi Agent and Dose Dosing Regimen 1 PBS (no RNAi agent) Single injection on day 1 2 5 mg/kg AD04585 + Single injection on day 1 1 mg/kg AD04963 3 5 mg/kg AD04872 + Single injection on day 1 1 mg/kg AD04963 4 5 mg/kg AD04585 + Single injection on day 1 1 mg/kg AD04963 and day 8 5 5 mg/kg AD04872 + Single injection on day 1 1 mg/kg AD04963 and day 8 6 2.5 mg/kg AD04585 + Single injection on day 1 0.5 mg/kg AD04963 7 2.0 mg/kg AD04585 + Single injection on day 1 1.0 mg/kg AD04963 8 2.5 mg/kg AD04872 + Single injection on day 1 0.5 mg/kg AD04963 9 2.0 mg/kg AD04872 + Single injection on day 1 1.0 mg/kg AD04963 10 5 mg/kg AD04872 + Single injection on day 1 1 mg/kg AD04981 11 2.5 mg/kg AD04872 + Single injection on day 1 0.5 mg/kg AD04981 and day 8 12 2.5 mg/kg AD04872 + Single injection on day 1 0.5 mg/kg AD04981 13 2 mg/kg AD04872 + Single injection on day 1 1 mg/kg AD04981 14 2.5 mg/kg AD04585 + Single injection on day 1 0.5 mg/kg AD04981 15 2 mg/kg AD04585 + Single injection on day 1 1 mg/kg AD04981 16 0.5 mg/kg AD04981 Single injection on day 1

[0805] Each mouse was given a subcutaneous administration of 200 μl containing the amount of HBV RNAi agent(s) formulated in phosphate buffered saline, or 200 μl of phosphate buffered saline without an HBV RNAi agent, as set forth in Table 44. Each of the HBV RNAi agents included N-acetyl-galactosamine targeting ligands conjugated to the 5′-terminal end of the sense strand, as shown in Tables 4 and 5. The injections were performed between the skin and muscle (i.e. subcutaneous injections) into the loose skin over the neck and shoulder area. Three (3) mice in each group were tested (n=3).

[0806] Serum was collected prior to administration, and then on day 8, day 14, day 21, and day 29 and day 36, and serum Hepatitis B surface antigen (HBsAg) levels were determined pursuant to the procedure set forth in Example 2, above. Data from the experiment is shown in the following Table 45:

TABLE-US-00046 TABLE 45 Average HBsAg levels normalized to pre-treatment and PBS control in pHBV mice following administration of HBV RNAi agents from Example 17 (standard deviation reflected as (+/−)). Group Day 8 Day 14 Day 21 Day 29 1 1.000 ± 0.068 1.000 ± 0.125 1.000 ± 0.152 1.000 ± 0.110 2 0.058 ± 0.033 0.059 ± 0.022 0.085 ± 0.023 0.158 ± 0.021 3 0.025 ± 0.009 0.014 ± 0.006 0.015 ± 0.008 0.026 ± 0.015 4 0.032 ± 0.007 0.005 ± 0.001 0.006 ± 0.002 0.014 ± 0.002 5 0.024 ± 0.009 0.003 ± 0.001  0.001 ± 0.0004  0.001 ± 0.0005 6 0.063 ± 0.020 0.077 ± 0.013 0.131 ± 0.011 0.214 ± 0.026 7 0.041 ± 0.018 0.059 ± 0.017 0.091 ± 0.016 0.140 ± 0.045 8 0.070 ± 0.008 0.046 ± 0.016 0.043 ± 0.009 0.055 ± 0.012 9 0.043 ± 0.006 0.027 ± 0.003 0.064 ± 0.017 0.064 ± 0.014 10 0.015 ± 0.008 0.005 ± 0.003 0.005 ± 0.003 0.005 ± 0.003 11 0.047 ± 0.014 0.005 ± 0.003 0.003 ± 0.002 0.003 ± 0.003 12 0.062 ± 0.006 0.025 ± 0.007 0.027 ± 0.005 0.033 ± 0.005 13 0.092 ± 0.029 0.050 ± 0.021 0.050 ± 0.022  0.054 ± 0.0019 14 0.310 ± 0.180 0.056 ± 0.010 0.081 ± 0.010  0.112 ± 0.0018 15 0.304 ± 0.044 0.083 ± 0.021 0.115 ± 0.013 0.165 ± 0.025 16 1.667 ± 0.217 0.416 ± 0.163 0.341 ± 0.179  0.511 ± 0.0011 Group Day 36 1 1.000 ± 0.225 2 3 0.049 ± 0.019 4 5  0.004 ± 0.0004 6 7 8 0.081 ± 0.010 9 0.108 ± 0.026 10 0.009 ± 0.004 11 0.005 ± 0.003 12 0.060 ± 0.014 13 0.094 ± 0.027 14 15 16 0.634 ± 0.005

[0807] The HBV RNAi agent combinations tested showed a reduction in HBsAg as compared to the saline control across all measured time points. Combinations containing AD04872 showed greater reductions than the equivalent combinations with AD04585 in place of AD04872.

[0808] Additionally, serum HBV DNA levels were determined for serum samples collected on days 8, 14, 21, and 29 pursuant to the procedure set forth in Example 2, above. Serum HBV DNA was isolated from each animal at each time point. Data are presented in the following Table 46:

TABLE-US-00047 TABLE 46 Average Serum HBV DNA levels normalized to pre-treatment and PBS control in pHBV mice following administration of HBV RNAi agents from Example 17 (standard deviation reflected as (+/−)). Group Day 8 Day 14 Day 21 Day 29 1 1.000 ± 0.280 1.000 ± 0.269 1.000 ± 0.418 1.000 ± 0.383 2 0.136 ± 0.068 0.192 ± 0.071 0.173 ± 0.032 0.292 ± 0.039 3 0.097 ± 0.034 0.068 ± 0.016 0.076 ± 0.034 0.131 ± 0.061 4 0.061 ± 0.039 0.002 ± 0.001 0.003 ± 0.001 0.019 ± 0.013 5 0.068 ± 0.025 0.003 ± 0.002 0.0009 ± 0.0003 0.0009 ± 0.0003 6 0.354 ± 0.299 0.345 ± 0.187 0.522 ± 0.234 0.509 ± 0.106 7 0.103 ± 0.064 0.291 ± 0.025 0.203 ± 0.043 0.203 ± 0.015 8 0.336 ± 0.142 0.185 ± 0.071 0.183 ± 0.065 0.162 ± 0.064 9 0.198 ± 0.055 0.093 ± 0.023 0.118 ± 0.054 0.143 ± 0.032 10 0.122 ± 0.071 0.024 ± 0.026 0.023 ± 0.020 0.014 ± 0.017 11 0.160 ± 0.069 0.016 ± 0.023 0.003 ± 0.001 0.005 ± 0.004 12 0.158 ± 0.039 0.120 ± 0.044 0.100 ± 0.049 0.091 ± 0.034 13 0.190 ± 0.038 0.169 ± 0.025 0.066 ± 0.015 0.081 ± 0.015 14 0.434 ± 0.136 0.318 ± 0.104 0.144 ± 0.094 0.240 ± 0.029 15 0.358 ± 0.185 0.287 ± 0.108 0.279 ± 0.080 0.303 ± 0.038 16 0.713 ± 0.085 0.674 ± 0.140 0.496 ± 0.128 0.590 ± 0.093

[0809] The HBV RNAi agent combinations tested showed a reduction in serum HBV DNA as compared to the saline control across all measured time points. Combinations containing AD04872 showed greater reductions than the equivalent combinations with AD04585 in place of AD04872. These greater reductions were observed at Day 22 and Day 29.

Example 18. HBV RNAi Agents in a HBV-Infected Humanized Mouse Model

[0810] For this study, Male FRG® (genotype Fah −/−/Rag2 −/−/Il2rg −/− triple knockout mice on a C57BL/6 background (Yecuris) were transplanted with human hepatocytes when they were 1-2 months old. The human hepatocytes were allowed to repopulate the liver for approximately 6 months with periodic NTBC treatment to discourage growth of mouse hepatocytes. At 9 months of age the mice were given an intravenous inoculation of 4×10.sup.8 genomes/kg HBV genotype C, which infected the human hepatocytes. After 2-3 months, serum HBV DNA levels reached a plateau indicating the human hepatocytes were maximally infected (mouse hepatocytes cannot be infected by HBV). Mice were one year old at the start of treatment with HBV RNAi agents, thus nearing the end of their life span.

[0811] Pre-treatment serum samples were taken on day −10 and day −3. Beginning on day 1, each mouse was administered an oral daily gavage with 0.01 mg/kg Entecavir dissolved in water to inhibit HBV replication. Daily dosing of Entecavir continued until the day mice were euthanized. Entecavir administration was expected to reduce serum HBV DNA in chronically infected human patients, but not reduce HBsAg.

[0812] Mice were divided into various groups including those set forth in Table 47, below:

TABLE-US-00048 TABLE 47 Dosing groups of HBV-infected FRG humanized model mice for Example 18. RNAi Agent and Terminal Group Dose Dosing Regimen Day A- mouse PBS (no RNAi Single injection Euthanized 1 agent) on day 1 day 21 (unhealthy animal) A- mouse PBS (no RNAi Single injection Euthanized 2 agent) on day 1 and day day 36 29 B- mouse 4.0 mg/kg AD04872 + Single injection Euthanized 1 2.0 mg/kg AD05070 on day 1 and day day 36 29 B- mouse 4.0 mg/kg AD04872 + Single injection Euthanized 2 2.0 mg/kg AD05070 on day 1 and day day 40 29 C- mouse 4.5 mg/kg AD04872 + Single injection Euthanized 1 1.5 mg/kg AD05070 on day 1 day 15 C- mouse 4.5 mg/kg AD04872 + Single injection Euthanized 2 1.5 mg/kg AD05070 on day 1 and day day 36 29 C- mouse 4.5 mg/kg AD04872 + Single injection Euthanized 3 1.5 mg/kg AD05070 on day 1 and day day 40 29

[0813] Each mouse was also given a subcutaneous administration of 100 μl per 20 grams body weight containing the amount of HBV RNAi agent(s) formulated in phosphate buffered saline, or an equal volume of phosphate buffered saline without an HBV RNAi agent, on day 1 and on day 29 (if still alive on day 29), pursuant to the schedule as set forth in Table 47, directly above. Each of the HBV RNAi agents included N-acetyl-galactosamine targeting ligands conjugated to the 5′-terminal end of the sense strand, as shown in Tables 4 and 5. The injections were performed between the skin and muscle (i.e. subcutaneous injections) into the loose skin over the neck and shoulder area.

[0814] Serum was collected on day 8, day 15, day 22, day 29, day 36, and day 40 and serum Hepatitis B surface antigen (HBsAg) levels were determined pursuant to the procedure set forth in Example 2, above. Data from the experiment is shown in the following Table:

TABLE-US-00049 TABLE 48 Average HBsAg levels normalized to pre-treatment (day −3) for each individual HBV-infected humanized FRG model mouse from Example 18. Group Day 8 Day 15 Day 22 Day 29 Day 36 Day 40 A-1 0.830 0.828 0.932 0.858 1.107 A-2 1.303 1.328 B-1 0.548 0.314 0.272 0.207 0.138 B-2 0.592 0.337 0.243 0.215 0.160 0.175 C-1 0.643 0.460 0.415 0.251 0.164 C-2 0.353 0.228 0.182 0.172 0.224 0.216 C-3 0.814 0.674

[0815] Additionally, serum HBV DNA levels were determined from serum samples collected on days −10, −3, 8, 15, 22, 29, 36, and 40, pursuant to the procedure set forth in Example 2, above. Data are presented in the following Table 4:

TABLE-US-00050 TABLE 49 Serum HBV DNA levels normalized to the average of pre-treatment day −10 and day −3 for each HBV-infected FRG humanized mouse following administration of HBV RNAi agents from Example 14. Group Day −10 Day−3 Day 8 Day 15 Day 22 Day 29 Day 36 Day 40 A-1 0.883 1.117 0.072 0.038 0.015 0.027 0.060 A-2 1.070 0.930 0.130 0.075 B-1 1.538 0.462 0.032 0.017 0.011 0.006 0.010 B-2 1.350 0.650 0.042 0.018 0.012 0.007 0.008 0.007 C-1 1.348 0.652 0.041 0.020 0.016 0.005 0.004 C-2 1.030 0.970 0.031 0.015 0.006 0.011 0.008 0.008

[0816] As expected, administration of Entecavir reduced viral replication in both the absence and presence of HBV RNAi agents.

Example 19. Clinical Study of HBV RNAi Agents

[0817] A Phase 1/2a, randomized, double-blind, single dose escalating study in healthy volunteers (NHV) and open label, multi-dose escalating study in patients with chronic HBV infection (CHB) were conducted. The study was designed to evaluate the safety, tolerability and pharmacokinetic effects of HBV RNAi agents (AD04872 and AD05070) in healthy patients and patients chronically infected with hepatitis B virus (CHB). The study subject population included healthy adult males and females 18-55 years old and adult males and females 18-65 years old who had a diagnosis of HBeAg positive or HBeAg negative chronic (>6 months) HBV infection.

[0818] NHV subjects were divided into five cohorts of 6 subjects per cohort (cohorts 1-5). NHV cohorts (4 active, 2 placebo) received single doses of a combination of AD04872 and AD05070 in an amount of 35, 100, 200, 300, or 400 mg or normal saline in a blinded fashion via subcutaneous injections. CHB cohorts 1, 1c and 2b-5b were HBeAg positive or negative, nucleoside inhibitors (NUC) naïve or NUC experienced at baseline, and received three monthly doses of a combination of AD04872 and AD05070 in an amount of 25, 50, 100, 200, 300, or 400 mg via subcutaneous injections. Cohort 6 enrolled 4 CHB patients to receive three 100 mg doses of a combination of AD04872 and AD05070 every two weeks. Cohort 7 enrolled 4 CHB patients to receive three weekly 100 mg doses of a combination of AD04872 and AD05070. CHB cohorts 8 and 9 (4 active) were HBeAg positive, treatment naïve or NUC experienced, respectively, that received three monthly doses of a combination of AD04872 and AD05070 in an amount of 300 mg via subcutaneous injections. Cohort 10 and Cohort 11 each enrolled 4 CHB patients to receive 3 weekly 200 mg and 300 mg doses of a combination of AD04872 and AD05070 respectively. NUC experienced CHB patients continued their daily NUC throughout the study and NUC naïve CHB patients started daily NUC on day 1. For CHB, viral DNA, viral RNA and antigens HBsAg, HBeAg, and HBcrAg were measured periodically. The study parameters are summarized in Table 50.

TABLE-US-00051 TABLE 50 Study Title A Phase 1/2a Single Dose-Escalating Study to Evaluate the Safety, Tolerability and Pharmacokinetic Effects of HBV RNAi agents (AD04872 and AD05070) in Normal Adult Volunteers and Multiple Escalating Doses Evaluating Safety, Tolerability and Pharmacodynamic Effects in HBV Patients Development Phase Phase 1 First-in-Human, Phase 2a First-in-Patient Study Objectives Primary Objectives: To determine the incidence and frequency of adverse events possibly or probably related to treatment as a measure of the safety and tolerability of HBV RNAi agents (AD04872 and AD05070) using escalating single doses in healthy volunteers (NHV) and escalating multiple doses in patients chronically infected with hepatitis B virus (CHB). Secondary Objectives: To evaluate the single-dose pharmacokinetics of HBV RNAi agents (AD04872 and AD05070) in NHVs To determine the reduction from Day 1 pre-dose baseline to post-dose nadir of HBsAg in response to HBV RNAi agents (AD04872 and AD05070) in patients chronically infected with HBV (CHB) as a measure of activity. Exploratory Objective: To determine the reduction from Day 1 pre-dosc baseline to post-dose nadir of HBcrAg, HBV RNA (if scientifically feasible) and HBeAg (e+ patients only), in response to HBV RNAi agents (AD04872 and AD05070) in CHB patients as a measure of activity. Study Design Randomized, double-blind, parallel-group, placebo-controlled Study Population This study was conducted in NHVs, adult males and females, aged 18-55 years with BMI between 19.0 and 35.0 kg/m.sup.2 (Cohorts 1-5), and in CHB patients, aged 18-65 years with BMI between 19.0 and 38.0 kg/m.sup.2 (Cohorts 2b, 3b, 4b, 5b, 8 and 9) and had a diagnosis of HBeAg positive or HBeAg negative chronic (>6 months) HBV infection. Cohorts 1-5: NHVs, adult males and females, aged 18-55 years Cohorts 1b, 1c, 2b, 3b, 4b and 5b: Any CHB patient regardless of HBeAg or prior therapy status. Cohort 6: Any CHB patient regardless of HBeAg or prior therapy status. Cohort 7: Any CHB patient regardless of HBeAg or prior therapy status. Cohort 8: HBeAg positive treatment naïve patients (no prior chronic exposure to NUCs or Interferon). Cohort 9: HBeAg positive NUC experienced patients (on entecavir or tenofovir for at least 12 months). Cohort 10: Any CHB patient regardless of HBeAg or prior therapy status. Cohort 11: Any CHB patient regardless of HBeAg or prior therapy status. Investigational HBV RNAi agents (AD04872 and AD05070) Product Dosage and Cohorts 1-5 (NHV): randomized to receive HBV RNAi agents Frequency (AD04872 and AD05070) or placebo (4 active: 2 placebo) at single escalating doses of 35, 100, 200, 300 and 400 mg administered as a single subcutaneous injection. Cohorts 1b, 1c, 2b-5b (CHB): received three monthly doses of 25, 50, 100, 200, 300, or 400 mg HBV RNAi agents (AD04872 and AD05070) via subcutaneous injections. Cohort 6 enrolled 4 HBV patients to receive three 100 mg doses of HBV RNAi agents (AD04872 and AD05070) every two weeks. Cohort 7 enrolled 4 HBV patients to receive three weekly 100 mg doses of HBV RNAi agents (AD04872 and AD05070). Cohorts 8 and 9 (CHB): received three monthly SQ doses of 300 mg HBV RNAi agents (AD04872 and AD05070) via subcutaneous injections. Cohort 10 and Cohort 11 each enrolled 4 HBV patients to receive 3 weekly 200 mg and 300 mg doses of HBV RNAi agents (AD04872 and AD05070) respectively. NUC experienced CHB patients continued their daily NUC throughout the study and NUC naïve CHB patients started daily NUC on day 1. Reference Placebo (PBO): normal saline (0.9%) administered subcutaneously Formulation with matching volume. Efficacy Evaluation Virology assessments will be performed (CHB patients only) and Criteria included: Quantitative assessments: HBV DNA, HBV RNA, HBsAg, HBeAg, HBcrAg, Safety Evaluation Safety was assessed by vital signs, clinical laboratory Criteria measurements, resting ECG measurements, adverse events, serious adverse events, injection site reactions and 90-day post-EOS pregnancy follow up. Pharmacokinetics Blood samples will be collected from each subject for Evaluation pharmacokinetic analysis after dose 1 (Cohorts 1-5, NHV only) Data Analysis Screening, Compliance, Tolerability and Safety Data: Safety analyses will be performed and the results summarized by cohort. The incidence and frequency of adverse events (AEs), serious adverse events (SAEs), related AEs, related SAEs, and AEs leading to discontinuation, will be summarized by cohort per SOC, PT, and severity. Other safety parameters will be summarized at each scheduled time. Virology assessments (CHB patients only): Quantitative HBsAg (qHBsAg): Log change from baseline to nadir and duration of response from nadir back to approximately 20% of baseline or EOS (Roche Elecsys, LLOQ 0.05 IU/mL) Quantitative HBV DNA (when quantifiable at baseline): Log change from baseline to EOS ((Roche Cobas, LLOQ 20 IU/mL) Quantitative HBV RNA: Log change from baseline to nadir and duration of response from baseline to EOS (Abbott m2000, LLOQ 1.65 Log U/mL, Butler 2018) Quantitative HBcrAg: Log change from baseline to nadir and duration of response from baseline to EOS (Fujirebo Lumipulse, LLOQ 1 kU/mL) Quantitative HBeAg: Log change from baseline to nadir and duration of response from baseline to EOS (Diasorin Liaison, LLOQ 0.01 PEIU/mL) Pharmacokinetics (NHV subjects only): Plasma concentrations of HBV RNAi agents (AD04872 and AD05070) product constituents will be used to calculate the following PK parameters: maximum observed plasma concentration (Cmax), area under the plasma concentration time curve (AUC) from time 0 to 24 hours (AUC0-24), AUC from time 0 extrapolated to infinity (AUCinf), and terminal elimination half-life ( t1/2). Pharmacokinetic parameters will be determined using non- compartmental methods.

[0819] FIGS. 1 and 14 show the mean log change for antigen HBsAg from day 1 for CHB patients (cohorts 2b, 3b, 4b, 5b, 8 and 9). Table 51 below shows the NADIR HBsAg responses for CHB patients with more than 6 weeks of HBsAg data collected. Strong HBsAg responses were observed in all HBV patients with monthly doses and were similar in HBeAg positive and HBeAg negative patients and in NUC naïve and NUC experienced patients. Range of HBsAg reductions was from −1.3 to −3.8 Log.sub.10. FIGS. 2-12 show the individual changes in HBV DNA, HBV RNA, HBeAg and HBcrAg in CHB patients (cohorts 1b, 1c, 2b, 3b, 4b, 5b, 6, 7, 8, 9, 10 and 11). All these virologic parameters (HBV DNA, HBV RNA, HBeAg and HBcrAg) showed responses to HBV RNAi agents (AD04872 and AD05070). FIG. 13 shows the NADIR Log HBsAg reduction data by CHB patients. Similar responses were observed for patients HBeAg positive and HBeAg negative patients.

TABLE-US-00052 TABLE 51 NADIR HBsAg responses for CHB patients NADIR HBsAg responses Percentage of CHB patients >1 log (90%) reduction 100%  >1.5 log (97%) reduction 83% >2 log (99%) reduction 38% >3 log (99.9%) reduction  3%

[0820] Table 52 and Table 53 show the safety and tolerability results from the study in healthy patients and CHB patients, respectively. HBV RNAi agents (AD04872 and AD05070) administered subcutaneously appear to be well tolerated at single or multiple monthly doses up to 400 mg. Mild injection site reactions were observed with approximately 12% of subcutaneous injections.

TABLE-US-00053 TABLE 52 Safety and Tolerability in Healthy Patients AEs in Healthy Volunteers Cohort 1 Cohort 2 Cohort 3 Cohort 4 Cohort 5 35 mg 100 mg 200 mg 300 mg 400 mg All active HBV HBV HBV HBV HBV HBV All RNAi RNAi RNAi RNAi RNAi RNAi PBO AE Reported agents agents agents agents agents agents Placebo Total Terms N = 4 N = 4 N = 4 N = 4 N = 4 N = 4 N = 10 AEs Hot flush, 1 1 2 1 3 Feeling hot, Subjective Pyrexia Headache 1 2 1 1 2 7 2 9 Abdominal 1 2 1 4 1 5 pain Upper 1 1 2 4 2 6 respiratory tract infection Lethargy, 1 2 3 2 5 Fatigue Myalgia 1 1 1 2 Sore Throat 1 1 2 2 4 Sensation of 1 1 1 2 feeling dehydrated Discomfort/ 1 2 1 4 1 5 bruising at cannula site Nausea 1 1 2 4 1 5 Dizziness, 1 1 2 3 Lightheadedness, Vertigo Flu like illness, 1 1 2 2 Non Specific Viral Illness Emesis 1 1 2 1 3 Bruising/ 1 1 2 2 tenderness at injection site Total AEs in >1 4 13 8 8 6 39 17 56 NHV

TABLE-US-00054 TABLE 53 Safety and Tolerability in CHB Patients AEs in HB V Patients Cohort 2b Cohort 3b Cohort 4b Cohort 5b Cohort 8 Cohort 9 100 mg 200 mg 300 mg 400 mg 300 mg 300 mg HBV HBV HBV HBV HBV HBV RNAi RNAi RNAi RNAi RNAi RNAi Total agents agents agents agents agents agents AEs AE Reported Terms N = 4 N = 4 N = 4 N = 4 N = 4 N = 4 N = 24 Insect bites 1 1 2 Upper respiratory 1 1 1 3 infection, sore throat Erythema, redness, 1 2 2 2 7 hematoma, rash at injection site Acne 2 2 Headache 2 2 Raised creatine kinase 1 1 2 Diarrhea 1 1 2 Lower back ache/pain 1 1 2 Total AEs in >1 CHB 2 0 8 3 7 2 22

Example 20. Clinical Study of HBV RNAi Agents

[0821] A Phase 1/2a, randomized, double-blind, multiple dose escalating study in healthy volunteers (NHV) and open label, multi-dose escalating study in patients with chronic HBV infection (CHB) were conducted. The study was designed to evaluate the safety, tolerability and pharmacokinetic effects of HBV RNAi agents (AD04872 and AD05070) in healthy patients and patients chronically infected with hepatitis B virus (CHB). The study subject population included healthy adult males and females 18-55 years old and adult males and females 18-65 years old who had a diagnosis of HBeAg positive or HBeAg negative chronic (>6 months) HBV infection.

[0822] NHV subjects were divided into five cohorts of 6 subjects per cohort (cohorts 1-5). NHV cohorts (4 active, 2 placebo) received single doses of a combination of AD04872 and AD05070 in an amount of 35, 100, 200, 300, or 400 mg or normal saline in a blinded fashion via subcutaneous injections. CHB cohorts 1, 1c and 2b-5b were HBeAg positive or negative, nucleoside inhibitors (NUC) naïve or NUC experienced at baseline, and received three doses of a combination of AD04872 and AD05070 in an amount of 35, 50, 100, 200, 300, or 400 mg via subcutaneous injections in 28-day intervals. Cohort 6 enrolled 4 CHB patients to receive three 100 mg doses of a combination of AD04872 and AD05070 every two weeks. Cohort 7 enrolled 4 CHB patients to receive three weekly 100 mg doses of a combination of AD04872 and AD05070. CHB cohorts 8 and 9 (4 active) were HBeAg positive, treatment naïve or NUC experienced, respectively, that received three doses of a combination of AD04872 and AD05070 in an amount of 300 mg via subcutaneous injections in 28-day intervals. Cohort 10 and Cohort 11 each enrolled 4 CHB patients to receive 3 weekly 200 mg and 300 mg doses of a combination of AD04872 and AD05070 respectively. NUC experienced CHB patients continued their daily NUC throughout the study and NUC naïve CHB patients started daily NUC on day 1. For CHB, viral DNA, viral RNA and antigens HBsAg, HBeAg, and HBcrAg were measured periodically. The study parameters are summarized in Table 54.

TABLE-US-00055 TABLE 54 Study Title A Phase 1/2a Single Dose-Escalating Study to Evaluate the Safety, Tolerability and Pharmacokinetic Effects of HBV RNAi agents (AD04872 and AD05070) in Normal Adult Volunteers and Multiple Escalating Doses Evaluating Safety, Tolerability and Pharmacodynamic Effects in HBV Patients Development Phase Phase 1 First-in-Human, Phase 2a First-in-Patient Study Objectives Primary Objectives: To determine the incidence and frequency of adverse events possibly or probably related to treatment as a measure of the safety and tolerability of HBV RNAi agents (AD04872 and AD05070) using escalating single doses in healthy volunteers (NHV) and escalating multiple doses in patients chronically infected with hepatitis B virus (CHB). Secondary Objectives: To evaluate the single-dose pharmacokinetics of HBV RNAi agents (AD04872 and AD05070) in NHVs To determine the reduction from Day 1 pre-dose baseline to post-dose nadir of HBsAg in response to HBV RNAi agents (AD04872 and AD05070) in patients chronically infected with HBV (CHB) as a measure of activity. Exploratory Objective: To determine the reduction from Day 1 pre-dose baseline to post-dose nadir of HBcrAg, HBV RNA (if scientifically feasible) and HBeAg (e+ patients only), in response to HBV RNAi agents (AD04872 and AD05070) in CHB patients as a measure of activity. Study Design Randomized, double-blind, parallel-group, placebo-controlled Study Population This study was conducted in NHVs, adult males and females, aged 18-55 years with BMI between 19.0 and 35.0 kg/m.sup.2 (Cohorts 1-5), and in CHB patients, aged 18-65 years with BMI between 19.0 and 38.0 kg/m.sup.2 (Cohorts 2b, 3b, 4b, 5b, 8 and 9) and had a diagnosis of HBeAg positive or HBeAg negative chronic (>6 months) HBV infection. Cohorts 1-5: NHVs, adult males and females, aged 18-55 years Cohorts 1b, 1c, 2b, 3b, 4b and 5b: Any CHB patient regardless of HBeAg or prior therapy status. Cohort 6: Any CHB patient regardless of HBeAg or prior therapy status. Cohort 7: Any CHB patient regardless of HBeAg or prior therapy status. Cohort 8: HBeAg positive treatment naïve patients (no prior chronic exposure to NUCs or Interferon). Cohort 9: HBeAg positive NUC experienced patients (on entecavir or tenofovir for at least 12 months). Cohort 10: Any CHB patient regardless of HBeAg or prior therapy status. Cohort 11: Any CHB patient regardless of HBeAg or prior therapy status. Investigational HBV RNAi agents (AD04872 and AD05070) Product Dosage and Cohorts 1-5 (NHV): randomized to receive HBV RNAi agents Frequency (AD04872 and AD05070) or placebo (4 active: 2 placebo) at single escalating doses of 35, 100, 200, 300 and 400 mg administered as a single subcutaneous injection. Cohorts 1b, 1c, 2b-5b (CHB): received three doses of 25, 50, 100, 200, 300, or 400 mg HBV RNAi agents (AD04872 and AD05070) via subcutaneous injections in 28-day intervals. Cohort 6 enrolled 4 HBV patients to receive three 100 mg doses of HBV RNAi agents (AD04872 and AD05070) every two weeks. Cohort 7 enrolled 4 HBV patients to receive three weekly 100 mg doses of HBV RNAi agents (AD04872 and AD05070). Cohorts 8 and 9 (CHB): received three SQ doses of 300 mg HBV RNAi agents (AD04872 and AD05070) via subcutaneous injections in 28-day intervals. Cohort 10 and Cohort 11 each enrolled 4 HBV patients to receive 3 weekly 200 mg and 300 mg doses of HBV RNAi agents (AD04872 and AD05070) respectively. NUC experienced CHB patients continued their daily NUC throughout the study and NUC naïve CHB patients started daily NUC on day 1. Reference Placebo (PBO): normal saline (0.9%) administered subcutaneously Formulation with matching volume. Efficacy Evaluation Virology assessments will be performed (CHB patients only) and Criteria included: Quantitative assessments: HBV DNA, HBV RNA, HBsAg, HBeAg, HBcrAg, Safety Evaluation Safety was assessed by vital signs, clinical laboratory Criteria measurements, resting ECG measurements, adverse events, serious adverse events, injection site reactions and 90-day post-EOS pregnancv follow up. Pharmacokinetics Blood samples will be collected from each subject for Evaluation pharmacokinetic analysis after dose 1 (Cohorts 1-5, NHV only) Data Analysis Screening, Compliance, Tolerability and Safety Data: Safety analyses will be performed and the results summarized by cohort. The incidence and frequency of adverse events (AEs), serious adverse events (SAEs), related AEs, related SAEs, and AEs leading to discontinuation, will be summarized by cohort per SOC, PT, and severity. Other safety parameters will be summarized at each scheduled time. Virology assessments (CHB patients only): Quantitative HBsAg (qHBsAg): Log change from baseline to nadir and duration of response from nadir back to approximately 20% of baseline or EOS (Roche Elecsys, LLOQ 0.05 IU/mL) Quantitative HBV DNA (when quantifiable at baseline): Log change from baseline to EOS ((Roche Cobas, LLOQ 20 IU/mL) Quantitative HBV RNA: Log change from baseline to nadir and duration of response from baseline to EOS (Abbott m2000, LLOQ 1.65 Log U/mL, Butler 2018) Quantitative HBcrAg: Log change from baseline to nadir and duration of response from baseline to EOS (Fujirebo Lumipulse, LLOQ 1 kU/mL) Quantitative HBeAg: Log change from baseline to nadir and duration of response from baseline to EOS (Diasorin Liaison, LLOQ 0.01 PEIU/mL) Pharmacokinetics (NHV subjects only): Plasma concentrations of HBV RNAi agents (AD04872 and AD05070) product constituents will be used to calculate the following PK parameters: maximum observed plasma concentration (Cmax), area under the plasma concentration time curve (AUC) from time 0 to 24 hours (AUC0-24), AUC from time 0 extrapolated to infinity (AUCinf), and terminal elimination half-life (t½). Pharmacokinetic parameters will be determined using non- compartmental methods.

[0823] FIG. 15 shows the mean change for antigen HBsAg from day 1 for CHB patients receiving three doses of HBV RNAi agents (AD04872 and AD05070) via subcutaneous injections in 28-day intervals (cohorts 1b, 1c, 2b, 3b, 4b, 5b, 8 and 9). The mean HBsAg decline was more pronounced in HBeAg positive than in HBeAg negative participants. In general, HBsAg declines were sustained over time at least until Day 168 across all doses. FIG. 16 shows the mean changes for antigen HBsAg and HBeAg from day 1 for HBsAg-positive CHB patients receiving three doses of HBV RNAi agents (AD04872 and AD05070) via subcutaneous injections in 28-day intervals (cohorts 1b, 1c, 2b, 3b, 4b, 5b, 8 and 9). The RNAi agents showed target activity on both HBeAg and HBsAg with a more pronounced reduction in HBsAg.

[0824] FIG. 20 shows the mean change for antigen HBsAg from day 1 for CHB patients receiving three doses of HBV RNAi agents (AD04872 and AD05070) via subcutaneous injections in 28-day intervals (cohorts 1b, 1c, 2b, 3b, 4b, 5b, 8 and 9). The mean HBsAg decline was more pronounced in HBeAg positive than in HBeAg negative participants. In general, HBsAg declines were sustained over time at least until day 392 across all doses. FIG. 21 shows the mean changes for antigen HBsAg and HBeAg from day 1 for HBsAg-positive CHB patients receiving three doses of HBV RNAi agents (AD04872 and AD05070) via subcutaneous injections in 28-day intervals (cohorts 1b, 1c, 2b, 3b, 4b, 5b, 8 and 9). The RNAi agents showed target activity on both HBeAg and HBsAg with a more pronounced reduction in HBsAg and with sustained mean HBeAg and HBsAg responses.

[0825] For all parameters, sustained suppression was defined as a ≥1.0 log.sub.10 reduction from day 1 or a value <lower limit of quantification at day 336. Safety and viral parameters (HBsAg, HBeAg, HBV DNA, HBV RNA, HBcrAg) were assessed in 8 CHB pts/cohort (NA experienced or naïve; HBeAg +ve or −ve) who received 3 subcutaneous JNJ-3989 doses (days 1, 27, 57) of 100, 200, 300 (n=16) or 400 mg. Patients started/continued with an NA on day 1 and continued throughout the study. For patients with quantifiable parameters on day 1 and available data at day 336, a sustained suppression was observed for HBV RNA in 15/26 patients, HBeAg in 9/14 patients and HBcrAg in 10/24 patients. JNJ-3989 (100-400 mg) with an NA was well tolerated in CHB patients. A ≥1.0 log.sub.10 reduction in HBsAg at nadir was achieved in 98% of patients. A subset of patients had sustained suppression of HBsAg ˜9 months after the last RNAi dose (mean 1.74); cf. FIG. 22. Sustained suppression of other viral parameters was also seen.

Example 21. Clinical Study of HBV RNAi Agents

[0826] A Phase 1/2a, randomized, double-blind, multiple dose escalating study in healthy volunteers (NHV) and open label, multi-dose escalating study in patients with chronic HBV infection (CHB) were conducted. The study was designed to evaluate the safety, tolerability and pharmacokinetic effects of HBV RNAi agents (AD04872 and AD05070) in NHV and patients chronically infected with hepatitis B virus (CHB). The study subject population included healthy adult males and females 18-55 years old and adult males and females 18-65 years old who had a diagnosis of HBeAg positive or HBeAg negative chronic (HBsAg positive for >6 months) HBV infection.

[0827] NHV subjects were divided into five cohorts of 6 subjects per cohort (cohorts 1-5). NHV cohorts (4 active, 2 placebo) received single doses of a combination of AD04872 and AD05070 in an amount of 35, 100, 200, 300, or 400 mg or normal saline in a blinded fashion via subcutaneous injections. CHB cohorts 1b, 1c and 2b-5b were HBeAg positive or negative, nucleoside inhibitors (NUC) naïve or NUC experienced at baseline, and received three doses of a combination of AD04872 and AD05070 in an amount of 25, 50, 100, 200, 300, or 400 mg via subcutaneous injections in 28-day intervals. Cohort 6 enrolled 4 CHB patients to receive three 100 mg doses of a combination of AD04872 and AD05070 every two weeks. Cohort 7 enrolled 4 CHB patients to receive three weekly 100 mg doses of a combination of AD04872 and AD05070. CHB cohorts 8 and 9 (4 active) were HBeAg positive, NUC treatment naïve or NUC experienced, respectively, that received three doses of a combination of AD04872 and AD05070 in an amount of 300 mg via subcutaneous injections in 28-day intervals. Cohort 10 and Cohort 11 each enrolled 4 CHB patients to receive 3 weekly 200 mg and 300 mg doses of a combination of AD04872 and AD05070 respectively. NUC experienced CHB patients continued their daily NUC throughout the study and NUC naïve CHB patients started daily NUC on day 1. For CHB cohort, viral DNA, viral RNA and antigens HBsAg, HBeAg, and HBcrAg were measured periodically.

[0828] HBV RNAi agents (AD04872 and AD05070) was designed to silence HBV RNA transcripts from episomal cccDNA and host-integrated HBV DNA. HBV RNAi agents reduces serum HBsAg levels by ≥1 log 10 in all patients receiving three HBV RNAi agents doses (100-400 mg, one every 4 weeks (Q4w) with an NA), regardless of baseline HBeAg status or prior NA therapy, as shown in Example 19. Given the lack of a dose response with 100-400 mg Q4w HBV RNAi agents, in this Example, cohorts 2b-5b were expanded from four to eight patients, and two lower dose cohorts 1b and 1c (25 and 50 mg Q4w, respectively) were added. Efficacy data and safety data up to Day 113 are presented (i.e., two months post HBV RNAi agents dosing) for cohorts 2b-5b and 1b and 1c, as discussed below.

[0829] In cohorts 1b, 1c and 2b-5b, HBeAg positive or negative, NA-experienced or -naïve CHB patients were enrolled and received three subcutaneous HBV RNAi agents doses of 25, 50, 100, 200, 300 or 400 mg Q4w on Days 1, 27 and 57. All patients either started (NA-naïve) or continued (NA-experienced) with daily NA (TDF or ETV) treatment on Day 1 and continued beyond the end of HBV RNAi agents dosing. Study visits were at screening and on Days 1, 8, 15, 29, 43, 57, 85 and 113, then extended follow up approximately every 2 months for 12 months. Serum viral parameters were assessed, i.e., HBV DNA (lower limit of quantification [LLOQ]: 20 IU/mL), HBV RNA (LLOQ: 1.65 log.sub.10 U/mL.sup.4), HBsAg (LLOQ: 0.05 IU/mL), HBeAg (LLOQ: 0.01 PEIU/mL; value below 0.11 PEIU/mL are reported as not detected), and HBcrAg (LLOQ: 1 kU/mL). Safety assessments included clinical laboratory assessments and adverse events (AEs) assessed from screening through Day 113, as reported here, and through the extended follow-up period. The study parameters are summarized in Table 55.

TABLE-US-00056 TABLE 55 Study Title A Phase 1/2a Single Dose-Escalating Study to Evaluate the Safety, Tolerability and Pharmacokinetic Effects of HBV RNAi agents (AD04872 and AD05070) in Normal Adult Volunteers and Multiple Escalating Doses Evaluating Safety, Tolerability and Pharmacodynamic Effects in HBV Patients Development Phase Phase 1 First-in-Human, Phase 2a First-in-Patient Study Objectives Primary Objectives: To determine the incidence and frequency of adverse events possibly or probably related to treatment as a measure of the safety and tolerability of HBV RNAi agents (AD04872 and AD05070) using escalating single doses in healthy volunteers (NHV) and escalating multiple doses in patients chronically infected with hepatitis B virus (CHB). Secondary Objectives: To evaluate the single-dose pharmacokinetics of HBV RNAi agents (AD04872 and AD05070) in NHVs To determine the reduction from Day 1 pre-dose baseline to post-dose nadir of HBsAg in response to HBV RNAi agents (AD04872 and AD05070) in patients chronically infected with HBV (CHB) as a measure of activity. Exploratory Objective: To determine the reduction from Day 1 pre-dose baseline to post-dose nadir of HBcrAg, HBV RNA (if scientifically feasible) and HBeAg (e+ patients only), in response to HBV RNAi agents (AD04872 and AD05070) in CHB patients as a measure of activity. Study Design Randomized, double-blind, parallel-group, placebo-controlled Study Population This study was conducted in NHVs, adult males and females, aged 18-55 years with BMI between 19.0 and 35.0 kg/m.sup.2 (Cohorts 1-5), and in CHB patients, aged 18-65 years with BMI between 19.0 and 38.0 kg/m.sup.2 (Cohorts 2b, 3b, 4b, 5b, 8 and 9) and had a diagnosis of HBeAg positive or HBeAg negative chronic (>6 months) HBV infection. Cohorts 1-5: NHVs, adult males and females, aged 18-55 years Cohorts 1b, 1c, 2b, 3b, 4b and 5b: Any CHB patient regardless of HBeAg or prior therapy status. Cohort 6: Any CHB patient regardless of HBeAg or prior therapy status. Cohort 7: Any CHB patient regardless of HBeAg or prior therapy status. Cohort 8: HBeAg positive treatment naïve patients (no prior chronic exposure to NUCs or Interferon). Cohort 9: HBeAg positive NUC experienced patients (on entecavir or tenofovir for at least 12 months). Cohort 10: Any CHB patient regardless of HBeAg or prior therapy status. Cohort 11: Any CHB patient regardless of HBeAg or prior therapy status. Investigational HBV RNAi agents (AD04872 and AD05070) Product Dosage and Cohorts 1-5 (NHV): randomized to receive HBV RNAi agents Frequency (AD04872 and AD05070) or placebo (4 active: 2 placebo) at single escalating doses of 35, 100, 200, 300 and 400 mg administered as a single subcutaneous injection. Cohorts 1b, 1c, 2b-5b (CHB) (8 patients each cohort): received three doses of 25, 50, 100, 200, 300, or 400 mg HBV RNAi agents (AD04872 and AD05070) via subcutaneous injections in 28-day intervals. Cohort 6 enrolled 4 HBV patients to receive three 100 mg doses of HBV RNAi agents (AD04872 and AD05070) every two weeks. Cohort 7 enrolled 4 HBV patients to receive three weekly 100 mg doses of HBV RNAi agents (AD04872 and AD05070). Cohorts 8 and 9 (CHB): received three SQ doses of 300 mg HBV RNAi agents (AD04872 and AD05070) via subcutaneous injections in 28-day intervals. Cohort 10 and Cohort 11 each enrolled 4 HBV patients to receive 3 weekly 200 mg and 300 mg doses of HBV RNAi agents (AD04872 and AD05070) respectively. NUC experienced CHB patients continued their daily NUC throughout the study and NUC naïve CHB patients started daily NUC on day 1. Reference Placebo (PBO): normal saline (0.9%) administered subcutaneously Formulation with matching volume. Efficacy Evaluation Virology assessments will be performed (CHB patients only) and Criteria included: Quantitative assessments: HBV DNA, HBV RNA, HBsAg, HBeAg, HBcrAg, Safety Evaluation Safety was assessed by vital signs, clinical laboratory Criteria measurements, resting ECG measurements, adverse events, serious adverse events, injection site reactions and 90-day post-EOS pregnancy follow up. Pharmacokinetics Blood samples will be collected from each subject for Evaluation pharmacokinetic analysis after dose 1 (Cohorts 1-5, NHV only) Data Analysis Screening, Compliance, Tolerability and Safety Data: Safety analyses will be performed and the results summarized by cohort. The incidence and frequency of adverse events (AEs), serious adverse events (SAEs), related AEs, related SAEs, and AEs leading to discontinuation, will be summarized by cohort per SOC, PT, and severity. Other safety parameters will be summarized at each scheduled time. Virology assessments (CHB patients only): Quantitative HBsAg (qHBsAg): Log change from baseline to nadir and duration of response from nadir back to approximately 20% of baseline or EOS (Roche Elecsys, LLOQ 0.05 IU/mL) Quantitative HBV DNA (when quantifiable at baseline): Log change from baseline to EOS ((Roche Cobas, LLOQ 20 IU/mL) Quantitative HBV RNA: Log change from baseline to nadir and duration of response from baseline to EOS (Abbott m2000, LLOQ 1.65 Log U/mL, Butler 2018) Quantitative HBcrAg: Log change from baseline to nadir and duration of response from baseline to EOS (Fujirebo Lumipulse, LLOQ 1 kU/mL) Quantitative HBeAg: Log change from baseline to nadir and duration of response from baseline to EOS (Diasorin Liaison, LLOQ 0.01 PEIU/mL) Pharmacokinetics (NHV subjects only): Plasma concentrations of HBV RNAi agents (AD04872 and AD05070) product constituents will be used to calculate the following PK parameters: maximum observed plasma concentration (Cmax), area under the plasma concentration time curve (AUC) from time 0 to 24 hours (AUC0-24), AUC from time 0 extrapolated to infinity (AUCinf), and terminal elimination half-life (t½). Pharmacokinetic parameters will be determined using non- compartmental methods.

[0830] Baseline characteristics and demographics information for cohorts 1b, 1c, 2b, 3b, 4b and 5b is shown in Table 56. Most patients were NA-experienced (40/48, 83%). All patients received their planned HBV RNAi agents doses with no treatment discontinuations.

TABLE-US-00057 TABLE 56 Cohort 1b 1c 2b 3b 4b 5b 25 mg 50 mg 100 mg 200 mg 300 mg 400 mg All patients N = 8 N = 8 N = 8 N = 8 N = 8 N = 8 N = 48 Age, years; mean (range) 43 (31-52) 48 (36-58) 51 (32-66) 48 (41-57) 52 (40-63) 42 (29-61) 47 (29-66) Male, n (%) 5 (63) 6 (75) 6 (75) 5 (63) 8 (100) 6 (75) 36 (75) Race, n (%) Asian 6 (75) 5 (63) 8 (100) 8 (100) 5 (63) 6 (75) 38 (79) White 0 0 0 0 1 (13) 0 1 (2) Native Hawaiian/other Pacific Islander 1 (13) 1 (13) 0 0 2 (25) 0 4 (8) Black/AA 1 (13) 0 0 0 0 0 1 (2) Other 0 2 (25) 0 0 0 2 (25) 4 (8) BMI, kg/m.sup.2; 27 (20-44) 26 (18-40) 24 (22-29) 25 (19-32) 27 (21-36) 25 (21-36) 26 (18-44) mean (range) HBeAg positive/negative, 2/6 3/5 1/7 1/7 3/5 1/7 11/37 n NA experienced, n (%) 4 (50) 7 (88) 6 (75) 8 (100) 8 (100) 7 (88) 40 (83) Mean (SEM) HBsAg on 6477 (2876) 4595 (1986) 3937 (2142) 3212 (2453) 9381 (8275) 4032 (1652) 5272 (1558) Day 1 (IU/mL) AA: African American; BMI: body mass index; HBeAg: hepatitis B e-antigen; HBsAg: hepatitis B surface antigen; NA: nucleos(t)ide analogue; SEM: standard error of the mean.

[0831] Mean HBsAg changes from Day 1 to Day 113 for CHB patients in cohorts 1b, 1c, 2b, 3b, 4b and 5b are shown in FIG. 17. The patients were given three subcutaneous doses of the HBV RNAi agents in the amount of: 25 mg (cohort 1b), 50 mg (cohort 1c), 100 mg (cohort 2b), 200 mg (cohort 3b), 300 mg (cohort 4b) or 400 mg (cohort 5b) on Day 1, 29 and 57. And all patients were given NA daily. HBV RNAi agents reduced HBsAg levels at all doses evaluated. At Day 113 (typical mean nadir after three doses, 56 days after last dose), mean HBsAg (SEM) log.sub.10 reduction from Day 1 was 1.00 (0.18) with 25 mg, 1.18 (0.08) with 50 mg, 1.54 (0.18) with 100 mg, 1.71 (0.15) with 200 mg, 1.48 (0.11) with 300 mg and 1.75 (0.16) with 400 mg HBV RNAi agents.

[0832] Mean and individual HBsAg changes on Day 113 from Day 1 for all patients in cohorts 1b, 1c, 2b, 3b, 4b and 5b are shown in FIG. 18. The proportion of patients with Day 113 data who achieved ≥1.0 lop) reduction in HBsAg from Day 1 at nadir was 4/8 (25 mg), 6/8 (50 mg), 7/8 (100 mg), 8/8 (200 mg), 8/8 (300 mg) and 8/8 (400 mg). Similar responses were observed for HBeAg positive and negative patients. HBeAg positive patients (n=11) presented a reduction in HBsAg of −1.52 log.sub.10 IU/mL (mean nadir). HBeAg negative patients (n=37) presented a reduction in HBsAg of −1.62 log.sub.10 IU/mL (mean nadir). One patient receiving 200 mg had undetectable HBsAg at Day 113, and achieved 1.6 log 10 reduction on Day 15 prior to HBsAg seroclearance. For patients with HBsAg >100 IU/mL (Day 1) and with Day 113 data, 2/7 (25 mg), 3/8 (50 mg), 5/7 (100 mg), 5/6 (200 mg), 6/8 (300 mg) and 5/7 (400 mg) achieved HBsAg <100 IU/mL with HBV RNAi agents treatment.

[0833] HBV DNA, HBV RNA, HBeAg and HBcrAg changes for individual participants (cohorts 1b, 1c, 2b, 3b, 4b and 5b) receiving 25 mg (cohort 1b), 50 mg (cohort 1c), 100 mg (cohort 2b), 200 mg (cohort 3b), 300 mg (cohort 4b) or 400 mg (cohort 5b) on Day 1, 29 and 57 are shown in FIGS. 19A-19D. All patients were given NA daily. For patients with measurable parameters on Day 1, patients had a robust decline in HBV DNA and HBV RNA levels, and reductions in HBeAg and HBcrAg were less pronounced with the HBV RNAi agents treatment. In addition to HBs, a sustained suppression was observed in a proportion of patients for HBV RNA, HBeAg and HBcrAg. For patients with quantifiable parameters on day 1 and available data at day 336, a sustained suppression was observed for HBV RNA in 15/26, HBeAg in 9/14 and HBcrAg in 10/24 pts.

[0834] Adverse events (AE) possibly or probably drug related occurring up to and including Day 113 of treatment for participants in cohorts 1b, 1c, 2b, 3b, 4b and 5b are shown in Table 57 below. Safety data for Cohorts 1b to 5b through Day 113 showed that three monthly doses of HBV RNAi agents at 25-400 mg with an NA were generally well tolerated in CHB patients. Three non-drug related serious adverse events were reported (anxiety with depression in a single patient and menorrhagia, each requiring hospitalization). The most commonly reported AEs at least possibly drug related consisted of various AEs at the injection site (e.g, discoloration, erythema, bruising, rash), which were all mild and reported in five patients. There were no reports of thrombocytopenia and one report of possibly drug-related Stage 1 acute kidney injury with creatinine increase (from 1.10 mg/dL Day 1 pre-dose to a peak of 1.55 mg/dL on Day 8 and return to 1.06 mg/dL on Day 15), which was treatment emergent but likely due to creatine supplementation and did not lead to treatment interruption or adjustment. A single AE reported of mild, possibly related, abnormal liver function tests (peak alanine aminotransferase [ALT] 136 U/L) was reported, representing the highest treatment-emergent ALT elevation in cohorts 1b to 5b through Day 113 (end of study). There were no cases of simultaneous elevations of ALT >3× upper limit of normal and total bilirubin >2× upper limit of normal.

TABLE-US-00058 TABLE 57 1b 1c 2b 3b 4b 5b Possibly or probably drug-related 25 mg 50 mg 100 mg 200 mg 300 mg 400 mg All patients AEs in ≥2 patients .sup.a N = 8 N = 8 N = 8 N = 8 N = 8 N = 8 N = 48 Injection site discoloration, 1 mild 0 0 0 2 mild 2 mild 5 injection site erythema, injection site bruising Fatigue 1 mild 0 1 mild 0 0 1 mild 3 Blood creatine phosphokinase 1 mild 0 0 0 1 severe 0 2 elevated Hot flush, flushing 0 1 mild 0 0 0 1 mild 2 Blood bilirubin increased, 0 0 0 1 mild 1 mild 0 2 hyperbilirubinemia Pruritus 1 mild 0 1 mild 0 0 0 2 .sup.a MedDRA preferred term aggregated based on similarity

[0835] In CHB patients, HBV RNAi agents with an NA had strong activity against HBsAg, HBV DNA and HBV RNA. Reductions in HBeAg and HBcrAg were generally less pronounced. HBsAg reductions were similar in HBeAg positive and HBeAg negative patients. Expanded cohorts with 100-400 mg HBV RNAi agents confirmed previous findings that HBsAg declines were similar with these doses; 97% (31/32) of these patients achieved a ≥1.0 log.sub.10 (90%) reduction in HBsAg. The 25 mg and 50 mg HBV RNAi agents doses were active in reducing HBsAg, and appeared less effective than higher doses. HBsAg responses with HBV RNAi agents are consistent with its ability to silence HBV RNA from cccDNA and host-integrated viral DNA (which is a major source of HBsAg in certain CHB populations). HBV RNAi agents (and NA) treatment was well tolerated at doses up to 400 mg Q4w for three doses. Overall, HBV RNAi agents demonstrated anti-HBV characteristics desirable for an RNAi therapy.

Other Embodiments

[0836] The following embodiments are exemplary and should not be considered as limiting the invention as described herein.

[0837] Embodiment 1 A method for inhibiting expression of a Hepatitis B Virus gene in a human subject in need thereof comprising administering to the human subject an effective amount of a pharmaceutical composition comprising: [0838] (a) a first RNAi agent comprising: [0839] (i) an antisense strand comprising a nucleotide sequence of any one of the following: SEQ ID NO:100, SEQ ID NO: 111, SEQ ID NO:126, SEQ ID NO:127, SEQ ID NO:128, SEQ ID NO:171, SEQ ID NO: 175, SEQ ID NO: 179, and SEQ ID NO: 180, and [0840] (ii) a sense strand comprising a nucleotide sequence of any one of the following: SEQ ID NO:229, SEQ ID NO: 235, SEQ ID NO:252, SEQ ID NO:253, SEQ ID NO:273, SEQ ID NO: 307, SEQ ID NO:302 and SEQ ID NO:319, and [0841] (b) a second RNAi agent comprising: [0842] (i) an antisense strand comprising a nucleotide sequence of any one of the following: SEQ ID NO:140, SEQ ID NO: 107, SEQ ID NO: 136, SEQ ID NO: 137, SEQ ID NO:188, SEQ ID NO: 154 and SEQ ID NO: 162, and [0843] (ii) a sense strand comprising a nucleotide sequence of any one of the following: SEQ ID NO:262, SEQ ID NO:271, SEQ ID NO: 216, SEQ ID NO: 248, SEQ ID NO:274, SEQ ID NO:328, SEQ ID NO: 292, and SEQ ID NO: 294;
and wherein the first and second RNAi agents are administered in a combined amount of about 50-400 mg per month.

[0844] Embodiment 2 A method for treating or preventing a symptom or a disease associated with an infection caused by Hepatitis B Virus in a human subject in need thereof comprising administering to the human subject an effective amount of a pharmaceutical composition comprising: [0845] (a) a first RNAi agent comprising: [0846] (i) an antisense strand comprising a nucleotide sequence of any one of the following: SEQ ID NO:100, SEQ ID NO:126, SEQ ID NO:127, SEQ ID NO:128, SEQ ID NO:171, SEQ ID NO: 179 and SEQ ID NO: 180, an [0847] (ii) a sense strand comprising a nucleotide sequence of any one of the following: SEQ ID NO:229, SEQ ID NO:252, SEQ ID NO:253, SEQ ID NO:273, SEQ ID NO:302, and SEQ ID NO:319, and [0848] (b) a second RNAi agent comprising: [0849] (i) an antisense strand comprising a nucleotide sequence of any one of the following: SEQ ID NO:140, SEQ ID NO: 107, SEQ ID NO: 136, SEQ ID NO: 137, SEQ ID NO:188, SEQ ID NO: 154 and SEQ ID NO: 162, and [0850] (ii) a sense strand comprising a nucleotide sequence of any one of the following: SEQ ID NO:262, SEQ ID NO:271, SEQ ID NO: 216, SEQ ID NO: 248, SEQ ID NO:274, SEQ ID NO:328, SEQ ID NO: 292, and SEQ ID NO: 294;
and wherein the first and second RNAi agents are administered in a combined amount of about 50-400 mg per month.

[0851] Embodiment 3 The method of Embodiment 1 or Embodiment 2, wherein the first and/or second RNAi agent further comprises a targeting ligand conjugated to the 5′ end of the sense or antisense strand.

[0852] Embodiment 4 The method of Embodiment 3, wherein the targeting ligand comprises N-acetyl-galactosamine.

[0853] Embodiment 5 The method of Embodiment 4, wherein the targeting ligand is (NAG25), (NAG25)s, (NAG31), (NAG31)s, (NAG37), or (NAG37)s.

[0854] Embodiment 6 The method of any one of Embodiments 3-5, wherein the targeting ligand is conjugated to the sense strand of the RNAi agent.

[0855] Embodiment 7 The method of any one of Embodiments 3-5, wherein the targeting ligand is conjugated to the antisense strand of the RNAi agent.

[0856] Embodiment 8. The method of any one of Embodiments 1-7, wherein the first RNAi agent is administered in the amount of about 20-275 mg.

[0857] Embodiment 9. The method of any one of Embodiments 1-8, wherein the second RNAi agent is administered in the amount of about 10-150 mg.

[0858] Embodiment 10. The method of any one of Embodiments 1-9, wherein the pharmaceutical composition comprises RNAi agent comprising a duplex structure of AD04511 (SEQ ID NO: 100 and SEQ ID NO:229), AD04872 (SEQ ID NO: 126 and SEQ ID NO:252), AD04873 (SEQ ID NO: 127 and SEQ ID NO:252), AD04874 (SEQ ID NO: 128 and SEQ ID NO:253), AD05070 (SEQ ID NO:140 and SEQ ID NO:262), AD05148 (SEQ ID NO:140 and SEQ ID NO:271), AD05164 (SEQ ID NO:126 and SEQ ID NO:273), AD05165 (SEQ ID NO:140 and SEQ ID NO:274), or a mixture of any of the foregoing.

[0859] Embodiment 11. The method of Embodiment 10, wherein the pharmaceutical composition comprises an RNAi agent comprising the duplex structure of AD04872 (SEQ ID NO: 126 and SEQ ID NO:252) and an RNAi agent comprising the duplex structure of AD05070 (SEQ ID NO:140 and SEQ ID NO:262).

[0860] Embodiment 12. The method of Embodiment 11, wherein the duplex structure of AD04872 is conjugated to (NAG37) and the duplex structure of AD05070 is conjugated to (NAG37).

[0861] Embodiment 13. The method of Embodiment 12, wherein the (NAG37) is conjugated to the 5′ end of the respective sense strands of the duplex of AD04872 and the duplex of AD05070.

[0862] Embodiment 14. The method of any one of Embodiments 11-13, wherein the ratio of the duplex of AD04872 and the duplex of AD05070 is between about 1:2 to about 5:1.

[0863] Embodiment 15. The method of Embodiment 14, wherein the ratio of the duplex of AD04872 and the duplex of AD05070 is about 2:1.

[0864] Embodiment 16. The method of any one of Embodiments 1-15, wherein the composition further comprises a pharmaceutically acceptable excipient.

[0865] Embodiment 17. The method of any one of Embodiments 1-16, wherein the composition is administered subcutaneously.

[0866] Embodiment 18. The method of any one of Embodiments 1-17, wherein the first and second RNAi agents are administered in a combined amount of about 25, 35, 50, 100, 200, 300 mg or 400 mg per month.

[0867] Embodiment 19. The method of any one of Embodiments 1-18, wherein the first and second RNAi agents are administered in 7-day, 14-day, 21-day or 28-day intervals.

[0868] Embodiment 20. The method of any one of Embodiments 1-19, wherein the composition is administered to the subject for up to 6 months.

[0869] Embodiment 21. The method of any one of Embodiments 1-20 further comprising administering to the subject a second active agent.

[0870] Embodiment 22. The method of Embodiment 21, wherein the second active agent is a nucleoside analog.

[0871] Embodiment 23. The method of Embodiment 22, wherein the nucleoside analog is Entecavir or Tenofovir.

[0872] Embodiment 24. The method of any one of Embodiments 1-23, wherein the level of HBsAg, HBeAg, or serum HBV DNA in the human subject is reduced by at least 40% after the administration of the composition.

[0873] Embodiment 25. The method of any one of Embodiments 2-24, wherein the symptom or disease associated with the HBV infection is a chronic liver disease or disorder, liver inflammation, fibrotic condition, a proliferative disorder, hepatocellular carcinoma, Hepatitis D virus infection, acute HBV infection or chronic HBV infection.

[0874] Embodiment 26. The method of any one of Embodiments 2-25, wherein the symptom or disease associated with the HBV infection is chronic HBV infection.

[0875] Embodiment 27. A method for inhibiting expression of a Hepatitis B Virus gene in a human subject in need thereof comprising administering to the human subject an effective amount of a pharmaceutical composition comprising: [0876] (a) a first RNAi agent comprising: [0877] (i) an antisense strand comprising a nucleotide sequence of any one of the following: SEQ ID NO:100, SEQ ID NO: 111, SEQ ID NO:126, SEQ ID NO:127, SEQ ID NO:128, SEQ ID NO:171, SEQ ID NO: 175, SEQ ID NO: 179, and SEQ ID NO: 180, and [0878] (ii) a sense strand comprising a nucleotide sequence of any one of the following: SEQ ID NO:229, SEQ ID NO: 235, SEQ ID NO:252, SEQ ID NO:253, SEQ ID NO:273, SEQ ID NO: 307, SEQ ID NO:302 and SEQ ID NO:319, and [0879] (b) a second RNAi agent comprising: [0880] (i) an antisense strand comprising a nucleotide sequence of any one of the following: SEQ ID NO:140, SEQ ID NO: 107, SEQ ID NO: 136, SEQ ID NO: 137, SEQ ID NO:188, SEQ ID NO: 154 and SEQ ID NO: 162, and [0881] (ii) a sense strand comprising a nucleotide sequence of any one of the following: SEQ ID NO:262, SEQ ID NO:271, SEQ ID NO: 216, SEQ ID NO: 248, SEQ ID NO:274, SEQ ID NO:328, SEQ ID NO: 292, and SEQ ID NO: 294;
and wherein the first and second RNAi agents are administered in a combined amount of about 25-400 mg per month.

[0882] Embodiment 28. A method for treating or preventing a symptom or a disease associated with an infection caused by Hepatitis B Virus in a human subject in need thereof comprising administering to the human subject an effective amount of a pharmaceutical composition comprising: [0883] (a) a first RNAi agent comprising: [0884] (i) an antisense strand comprising a nucleotide sequence of any one of the following: SEQ ID NO:100, SEQ ID NO:126, SEQ ID NO:127, SEQ ID NO:128, SEQ ID NO:171, SEQ ID NO: 179 and SEQ ID NO: 180, and [0885] (ii) a sense strand comprising a nucleotide sequence of any one of the following: SEQ ID NO:229, SEQ ID NO:252, SEQ ID NO:253, SEQ ID NO:273, SEQ ID NO:302, and SEQ ID NO:319, and [0886] (b) a second RNAi agent comprising: [0887] (i) an antisense strand comprising a nucleotide sequence of any one of the following: SEQ ID NO:140, SEQ ID NO: 107, SEQ ID NO: 136, SEQ ID NO: 137, SEQ ID NO:188, SEQ ID NO: 154 and SEQ ID NO: 162, and [0888] (ii) a sense strand comprising a nucleotide sequence of any one of the following: SEQ ID NO:262, SEQ ID NO:271, SEQ ID NO: 216, SEQ ID NO: 248, SEQ ID NO:274, SEQ ID NO:328, SEQ ID NO: 292, and SEQ ID NO: 294;
and wherein the first and second RNAi agents are administered in a combined amount of about 25-400 mg per month.

[0889] Embodiment 29. The method of Embodiment 27 or Embodiment 28, wherein the first and/or second RNAi agent further comprises a targeting ligand conjugated to the sense or antisense strand.

[0890] Embodiment 30. The method of Embodiment 29, wherein the targeting ligand comprises N-acetyl-galactosamine.

[0891] Embodiment 31. The method of Embodiment 30, wherein the targeting ligand is (NAG25), (NAG25)s, (NAG31), (NAG31)s, (NAG37), or (NAG37)s.

[0892] Embodiment 32. The method of any one of Embodiments 29-31, wherein the targeting ligand is conjugated to the sense strand of the RNAi agent.

[0893] Embodiment 33. The method of any one of Embodiments 29-31, wherein the targeting ligand is conjugated to the antisense strand of the RNAi agent.

[0894] Embodiment 34. The method of any one of Embodiments 27-33, wherein the first RNAi agent is administered in the amount of about 20-275 mg.

[0895] Embodiment 35. The method of any one of Embodiments 28-34, wherein the second RNAi agent is administered in the amount of about 10-150 mg.

[0896] Embodiment 36. The method of any one of Embodiments 27-35, wherein the pharmaceutical composition comprises RNAi agent comprising a duplex structure of AD04511 (SEQ ID NO: 100 and SEQ ID NO:229), AD04872 (SEQ ID NO: 126 and SEQ ID NO:252), AD04873 (SEQ ID NO: 127 and SEQ ID NO:252), AD04874 (SEQ ID NO: 128 and SEQ ID NO:253), AD05070 (SEQ ID NO:140 and SEQ ID NO:262), AD05148 (SEQ ID NO:140 and SEQ ID NO:271), AD05164 (SEQ ID NO:126 and SEQ ID NO:273), AD05165 (SEQ ID NO:140 and SEQ ID NO:274), or a mixture of any of the foregoing.

[0897] Embodiment 37. The method of Embodiment 36, wherein the pharmaceutical composition comprises an RNAi agent comprising the duplex structure of AD04872 (SEQ ID NO: 126 and SEQ ID NO:252) and an RNAi agent comprising the duplex structure of AD05070 (SEQ ID NO:140 and SEQ ID NO:262).

[0898] Embodiment 38. The method of Embodiment 37, wherein the duplex structure of AD04872 is conjugated to (NAG37) and the duplex structure of AD05070 is conjugated to (NAG37).

[0899] Embodiment 39. The method of Embodiment 38, wherein the (NAG37) is conjugated to the 5′ end of the respective sense strands of the duplex of AD04872 and the duplex of AD05070.

[0900] Embodiment 40. The method of any one of Embodiments 37-39, wherein the ratio of the duplex of AD04872 and the duplex of AD05070 is between about 1:2 to about 5:1.

[0901] Embodiment 41. The method of Embodiment 40, wherein the ratio of the duplex of AD04872 and the duplex of AD05070 is about 2:1.

[0902] Embodiment 42. The method of any one of Embodiments 27-41, wherein the composition further comprises a pharmaceutically acceptable excipient.

[0903] Embodiment 43. The method of any one of Embodiments 27-42, wherein the composition is administered subcutaneously.

[0904] Embodiment 44. The method of any one of Embodiments 27-43, wherein the first and second RNAi agents are administered in a combined amount of about any of 25, 35, 50, 100, 200, 300 mg or 400 mg per month.

[0905] Embodiment 45. The method of any one of Embodiments 27-43, wherein the first and second RNAi agents are administered in a combined amount of about 40 mg, about 100 mg, or about 200 mg per month.

[0906] Embodiment 46. The method of Embodiment 45, wherein the first and second RNAi agents are administered in a combined amount of about 40 mg per month.

[0907] Embodiment 47. The method of Embodiment 45, wherein the first and second RNAi agents are administered in a combined amount of about 100 mg per month.

[0908] Embodiment 48. The method of Embodiment 45, wherein the first and second RNAi agents are administered in a combined amount of about 200 mg per month.

[0909] Embodiment 49. The method of any one of Embodiments 27-48, wherein the first and second RNAi agents are administered in 7-day, 14-day, 21-day or 28-day intervals.

[0910] Embodiment 50. The method of any one of Embodiments 27-48, wherein the first and second RNAi agents are administered in 28-day intervals.

[0911] Embodiment 51. The method of Embodiment 50, wherein the first and second RNAi agents are administered in a combined amount of about 40 mg, about 100 mg, or about 200 mg per month and in 28-day intervals.

[0912] Embodiment 52. The method of Embodiment 51, wherein the first and second RNAi agents are administered in a combined amount of about 40 mg per month and in 28-day intervals.

[0913] Embodiment 53. The method of Embodiment 51, wherein the first and second RNAi agents are administered in a combined amount of about 100 mg per month and in 28-day intervals.

[0914] Embodiment 54. The method of Embodiment 51, wherein the first and second RNAi agents are administered in a combined amount of about 200 mg per month and in 28-day intervals.

[0915] Embodiment 55. The method of any one of Embodiments 27-54, wherein the composition is administered to the subject for up to 6 months.

[0916] Embodiment 56. The method of any one of Embodiments 27-55 further comprising administering to the subject a second active agent.

[0917] Embodiment 57. The method of Embodiment 56, wherein the second active agent is a nucleoside analog.

[0918] Embodiment 58. The method of Embodiment 57, wherein the nucleoside analog is Entecavir or Tenofovir.

[0919] Embodiment 59. The method of any one of Embodiments 27-58, wherein the level of HBsAg, HBeAg, or serum HBV DNA in the human subject is reduced by at least 40% after the administration of the composition.

[0920] Embodiment 60. The method of any one of Embodiments 28-59, wherein the symptom or disease associated with the HBV infection is a chronic liver disease or disorder, liver inflammation, liver fibrotic condition, a proliferative hepatocellular disorder, hepatocellular carcinoma, Hepatitis D virus infection, acute HBV infection, chronic hepatitis B or chronic HBV infection.

[0921] Embodiment 61. The method of any one of Embodiments 28-60, wherein the symptom or disease associated with the HBV infection is chronic HBV infection or chronic hepatitis B.

[0922] Embodiment 62. A method for inhibiting expression of a Hepatitis B Virus gene in a human subject in need thereof comprising administering to the human subject an effective amount of a pharmaceutical composition comprising: [0923] (a) a first RNAi agent comprising: [0924] (i) an antisense strand comprising a nucleotide sequence of any one of the following: SEQ ID NO:100, SEQ ID NO: 111, SEQ ID NO:126, SEQ ID NO:127, SEQ ID NO:128, SEQ ID NO:171, SEQ ID NO: 175, SEQ ID NO: 179, and SEQ ID NO: 180, and [0925] (ii) a sense strand comprising a nucleotide sequence of any one of the following: SEQ ID NO:229, SEQ ID NO: 235, SEQ ID NO:252, SEQ ID NO:253, SEQ ID NO:273, SEQ ID NO: 307, SEQ ID NO:302 and SEQ ID NO:319, and [0926] (b) a second RNAi agent comprising: [0927] (i) an antisense strand comprising a nucleotide sequence of any one of the following: SEQ ID NO:140, SEQ ID NO: 107, SEQ ID NO: 136, SEQ ID NO: 137, SEQ ID NO:188, SEQ ID NO: 154 and SEQ ID NO: 162, and [0928] (ii) a sense strand comprising a nucleotide sequence of any one of the following: SEQ ID NO:262, SEQ ID NO:271, SEQ ID NO: 216, SEQ ID NO: 248, SEQ ID NO:274, SEQ ID NO:328, SEQ ID NO: 292, and SEQ ID NO: 294;
and wherein the first and second RNAi agents are administered in a combined amount of about 25-400 mg per 28 days.

[0929] Embodiment 63. A method for treating or preventing a symptom or a disease associated with an infection caused by Hepatitis B Virus in a human subject in need thereof comprising administering to the human subject an effective amount of a pharmaceutical composition comprising: [0930] (a) a first RNAi agent comprising: [0931] (i) an antisense strand comprising a nucleotide sequence of any one of the following: SEQ ID NO:100, SEQ ID NO:126, SEQ ID NO:127, SEQ ID NO:128, SEQ ID NO:171, SEQ ID NO: 179 and SEQ ID NO: 180, and [0932] (ii) a sense strand comprising a nucleotide sequence of any one of the following: SEQ ID NO:229, SEQ ID NO:252, SEQ ID NO:253, SEQ ID NO:273, SEQ ID NO:302, and SEQ ID NO:319, and [0933] (b) a second RNAi agent comprising: [0934] (i) an antisense strand comprising a nucleotide sequence of any one of the following: SEQ ID NO:140, SEQ ID NO: 107, SEQ ID NO: 136, SEQ ID NO: 137, SEQ ID NO:188, SEQ ID NO: 154 and SEQ ID NO: 162, and [0935] (ii) a sense strand comprising a nucleotide sequence of any one of the following: SEQ ID NO:262, SEQ ID NO:271, SEQ ID NO: 216, SEQ ID NO: 248, SEQ ID NO:274, SEQ ID NO:328, SEQ ID NO: 292, and SEQ ID NO: 294;
and wherein the first and second RNAi agents are administered in a combined amount of about 25-400 mg per 28 days.

[0936] Embodiment 64. The method of Embodiment 62 or Embodiment 63, wherein the first and/or second RNAi agent further comprises a targeting ligand conjugated to the 5′ end of the sense or antisense strand.

[0937] Embodiment 65. The method of Embodiment 64, wherein the targeting ligand comprises N-acetyl-galactosamine.

[0938] Embodiment 66. The method of Embodiment 65, wherein the targeting ligand is (NAG25), (NAG25)s, (NAG31), (NAG31)s, (NAG37), or (NAG37)s.

[0939] Embodiment 67. The method of any one of Embodiments 64-66, wherein the targeting ligand is conjugated to the sense strand of the RNAi agent.

[0940] Embodiment 68. The method of any one of Embodiments 64-66, wherein the targeting ligand is conjugated to the antisense strand of the RNAi agent.

[0941] Embodiment 69. The method of any one of Embodiments 62-68, wherein the first RNAi agent is administered in the amount of about 20-275 mg.

[0942] Embodiment 70. The method of any one of Embodiments 62-69, wherein the second RNAi agent is administered in the amount of about 10-150 mg.

[0943] Embodiment 71. The method of any one of Embodiments 62-70, wherein the pharmaceutical composition comprises RNAi agent comprising a duplex structure of AD04511 (SEQ ID NO: 100 and SEQ ID NO:229), AD04872 (SEQ ID NO: 126 and SEQ ID NO:252), AD04873 (SEQ ID NO: 127 and SEQ ID NO:252), AD04874 (SEQ ID NO: 128 and SEQ ID NO:253), AD05070 (SEQ ID NO:140 and SEQ ID NO:262), AD05148 (SEQ ID NO:140 and SEQ ID NO:271), AD05164 (SEQ ID NO:126 and SEQ ID NO:273), AD05165 (SEQ ID NO:140 and SEQ ID NO:274), or a mixture of any of the foregoing.

[0944] Embodiment 72. The method of Embodiment 71, wherein the pharmaceutical composition comprises an RNAi agent comprising the duplex structure of AD04872 (SEQ ID NO: 126 and SEQ ID NO:252) and an RNAi agent comprising the duplex structure of AD05070 (SEQ ID NO:140 and SEQ ID NO:262).

[0945] Embodiment 73. The method of Embodiment 72, wherein the duplex structure of AD04872 is conjugated to (NAG37) and the duplex structure of AD05070 is conjugated to (NAG37).

[0946] Embodiment 74. The method of Embodiment 73, wherein the (NAG37) is conjugated to the 5′ end of the respective sense strands of the duplex of AD04872 and the duplex of AD05070.

[0947] Embodiment 75. The method of any one of Embodiments 72-74, wherein the ratio of the duplex of AD04872 and the duplex of AD05070 is between about 1:2 to about 5:1.

[0948] Embodiment 76. The method of Embodiment 75, wherein the ratio of the duplex of AD04872 and the duplex of AD05070 is about 2:1.

[0949] Embodiment 77. The method of any one of Embodiments 62-76, wherein the composition further comprises a pharmaceutically acceptable excipient.

[0950] Embodiment 78. The method of any one of Embodiments 62-77, wherein the composition is administered subcutaneously.

[0951] Embodiment 79. The method of any one of Embodiments 62-78, wherein the first and second RNAi agents are administered in a combined amount of about any of 25, 35, 50, 100, 200, 300 mg or 400 mg per 28 days.

[0952] Embodiment 80. The method of any one of Embodiments 62-78, wherein the first and second RNAi agents are administered in a combined amount of about 40 mg, about 100 mg, or about 200 mg per 28 days.

[0953] Embodiment 81. The method of Embodiment 80, wherein the first and second RNAi agents are administered in a combined amount of about 40 mg per 28 days.

[0954] Embodiment 82. The method of Embodiment 80, wherein the first and second RNAi agents are administered in a combined amount of about 100 mg per 28 days.

[0955] Embodiment 83. The method of Embodiment 80, wherein the first and second RNAi agents are administered in a combined amount of about 200 mg per 28 days.

[0956] Embodiment 84. The method of any one of Embodiments 62-83, wherein the first and second RNAi agents are administered in 7-day, 14-day, 21-day or 28-day intervals.

[0957] Embodiment 85. The method of any one of Embodiments 62-84, wherein the first and second RNAi agents are administered in 28-day intervals.

[0958] Embodiment 86. The method of Embodiment 85, wherein the first and second RNAi agents are administered in a combined amount of about 40 mg, about 100 mg, or about 200 mg per 28 days and in 28-day intervals.

[0959] Embodiment 87. The method of Embodiment 86, wherein the first and second RNAi agents are administered in a combined amount of about 40 mg per 28 days and in 28-day intervals.

[0960] Embodiment 88. The method of Embodiment 86, wherein the first and second RNAi agents are administered in a combined amount of about 100 mg per 28 days and in 28-day intervals.

[0961] Embodiment 89. The method of Embodiment 86, wherein the first and second RNAi agents are administered in a combined amount of about 200 mg per 28 days and in 28-day intervals.

[0962] Embodiment 90. The method of any one of Embodiments 62-89, wherein the composition is administered to the subject for up to 6 months.

[0963] Embodiment 91. The method of any one of Embodiments 62-90, further comprising administering to the subject a second active agent.

[0964] Embodiment 92. The method of Embodiment 91, wherein the second active agent is a nucleoside analog.

[0965] Embodiment 93. The method of Embodiment 92, wherein the nucleoside analog is Entecavir or Tenofovir.

[0966] Embodiment 94. The method of any one of Embodiments 62-93, wherein the level of HBsAg, HBeAg, or serum HBV DNA in the human subject is reduced by at least 40% after the administration of the composition.

[0967] Embodiment 95. The method of any one of Embodiments 63-94, wherein the symptom or disease associated with the HBV infection is a chronic liver disease or disorder, liver inflammation, liver fibrotic condition, a proliferative hepatocellular disorder, hepatocellular carcinoma, Hepatitis D virus infection, acute HBV infection, chronic hepatitis B or chronic HBV infection.

[0968] Embodiment 96. The method of any one of Embodiments 63-95, wherein the symptom or disease associated with the HBV infection is chronic HBV infection or chronic hepatitis B.

[0969] Embodiment 97. A pharmaceutical composition for use in inhibiting expression of a Hepatitis B Virus gene in a human subject, wherein said use comprises the administration of an effective amount of the pharmaceutical composition to the human subject, the pharmaceutical composition comprising: [0970] (a) a first RNAi agent comprising: [0971] (i) an antisense strand comprising a nucleotide sequence of any one of the following: SEQ ID NO:100, SEQ ID NO: 111, SEQ ID NO:126, SEQ ID NO:127, SEQ ID NO:128, SEQ ID NO:171, SEQ ID NO: 175, SEQ ID NO: 179, and SEQ ID NO: 180, and [0972] (ii) a sense strand comprising a nucleotide sequence of any one of the following: SEQ ID NO:229, SEQ ID NO: 235, SEQ ID NO:252, SEQ ID NO:253, SEQ ID NO:273, SEQ ID NO: 307, SEQ ID NO:302 and SEQ ID NO:319, and [0973] (b) a second RNAi agent comprising: [0974] (i) an antisense strand comprising a nucleotide sequence of any one of the following: SEQ ID NO:140, SEQ ID NO: 107, SEQ ID NO: 136, SEQ ID NO: 137, SEQ ID NO:188, SEQ ID NO: 154 and SEQ ID NO: 162, and [0975] (ii) a sense strand comprising a nucleotide sequence of any one of the following: SEQ ID NO:262, SEQ ID NO:271, SEQ ID NO: 216, SEQ ID NO: 248, SEQ ID NO:274, SEQ ID NO:328, SEQ ID NO: 292, and SEQ ID NO: 294;
and wherein the first and second RNAi agents are administered in a combined amount of about 25-400 mg per 28 days.

[0976] Embodiment 98. A pharmaceutical composition for use in treating or preventing a symptom or a disease associated with an infection caused by Hepatitis B Virus in a human subject, wherein said use comprises the administration of an effective amount of the pharmaceutical composition to the human subject, the pharmaceutical composition comprising: [0977] (a) a first RNAi agent comprising: [0978] (i) an antisense strand comprising a nucleotide sequence of any one of the following: SEQ ID NO:100, SEQ ID NO:126, SEQ ID NO:127, SEQ ID NO:128, SEQ ID NO:171, SEQ ID NO: 179 and SEQ ID NO: 180, and [0979] (ii) a sense strand comprising a nucleotide sequence of any one of the following: SEQ ID NO:229, SEQ ID NO:252, SEQ ID NO:253, SEQ ID NO:273, SEQ ID NO:302, and SEQ ID NO:319, and [0980] (b) a second RNAi agent comprising: [0981] (i) an antisense strand comprising a nucleotide sequence of any one of the following: SEQ ID NO:140, SEQ ID NO: 107, SEQ ID NO: 136, SEQ ID NO: 137, SEQ ID NO:188, SEQ ID NO: 154 and SEQ ID NO: 162, and [0982] (ii) a sense strand comprising a nucleotide sequence of any one of the following: SEQ ID NO:262, SEQ ID NO:271, SEQ ID NO: 216, SEQ ID NO: 248, SEQ ID NO:274, SEQ ID NO:328, SEQ ID NO: 292, and SEQ ID NO: 294;
and wherein the first and second RNAi agents are administered in a combined amount of about 25-400 mg per 28 days.

[0983] Embodiment 99. The pharmaceutical composition of Embodiment 97 or Embodiment 98, wherein the first and/or second RNAi agent further comprises a targeting ligand conjugated to the 5′ end of the sense or antisense strand.

[0984] Embodiment 100. The pharmaceutical composition of Embodiment 99, wherein the targeting ligand comprises N-acetyl-galactosamine.

[0985] Embodiment 101. The pharmaceutical composition of Embodiment 100, wherein the targeting ligand is (NAG25), (NAG25)s, (NAG31), (NAG31)s, (NAG37), or (NAG37)s.

[0986] Embodiment 102. The pharmaceutical composition of any one of Embodiments 99-101, wherein the targeting ligand is conjugated to the sense strand of the RNAi agent.

[0987] Embodiment 103. The pharmaceutical composition of any one of Embodiments 99-101, wherein the targeting ligand is conjugated to the antisense strand of the RNAi agent.

[0988] Embodiment 104. The pharmaceutical composition of any one of Embodiments 97-103, wherein the first RNAi agent is administered in the amount of about 20-275 mg.

[0989] Embodiment 105. The pharmaceutical composition of any one of Embodiments 97-104, wherein the second RNAi agent is administered in the amount of about 10-150 mg.

[0990] Embodiment 106. The pharmaceutical composition of any one of Embodiments 97-105, wherein the pharmaceutical composition comprises RNAi agent comprising a duplex structure of AD04511 (SEQ ID NO: 100 and SEQ ID NO:229), AD04872 (SEQ ID NO: 126 and SEQ ID NO:252), AD04873 (SEQ ID NO: 127 and SEQ ID NO:252), AD04874 (SEQ ID NO: 128 and SEQ ID NO:253), AD05070 (SEQ ID NO:140 and SEQ ID NO:262), AD05148 (SEQ ID NO:140 and SEQ ID NO:271), AD05164 (SEQ ID NO:126 and SEQ ID NO:273), AD05165 (SEQ ID NO:140 and SEQ ID NO:274), or a mixture of any of the foregoing.

[0991] Embodiment 107. The pharmaceutical composition of Embodiment 106, wherein the pharmaceutical composition comprises an RNAi agent comprising the duplex structure of AD04872 (SEQ ID NO: 126 and SEQ ID NO:252) and an RNAi agent comprising the duplex structure of AD05070 (SEQ ID NO:140 and SEQ ID NO:262).

[0992] Embodiment 108. The pharmaceutical composition of Embodiment 107, wherein the duplex structure of AD04872 is conjugated to (NAG37) and the duplex structure of AD05070 is conjugated to (NAG37).

[0993] Embodiment 109. The pharmaceutical composition of Embodiment 108, wherein the (NAG37) is conjugated to the 5′ end of the respective sense strands of the duplex of AD04872 and the duplex of AD05070.

[0994] Embodiment 110. The pharmaceutical composition of any one of Embodiments 107-109, wherein the ratio of the duplex of AD04872 and the duplex of AD05070 is between about 1:2 to about 5:1.

[0995] Embodiment 111. The pharmaceutical composition of Embodiment 110, wherein the ratio of the duplex of AD04872 and the duplex of AD05070 is about 2:1.

[0996] Embodiment 112. The pharmaceutical composition of any one of Embodiments 97-111, wherein the composition further comprises a pharmaceutically acceptable excipient.

[0997] Embodiment 113. The pharmaceutical composition of any one of Embodiments 97-112, wherein the composition is administered subcutaneously.

[0998] Embodiment 114. The pharmaceutical composition of any one of Embodiments 97-113, wherein the first and second RNAi agents are administered in a combined amount of about any of 25, 35, 50, 100, 200, 300 mg or 400 mg per 28 days.

[0999] Embodiment 115. The pharmaceutical composition of any one of Embodiments 97-114, wherein the first and second RNAi agents are administered in a combined amount of about 40 mg, about 100 mg, or about 200 mg per 28 days.

[1000] Embodiment 116. The pharmaceutical composition of Embodiment 115, wherein the first and second RNAi agents are administered in a combined amount of about 40 mg per 28 days.

[1001] Embodiment 117. The pharmaceutical composition of Embodiment 115, wherein the first and second RNAi agents are administered in a combined amount of about 100 mg per 28 days.

[1002] Embodiment 118. The pharmaceutical composition of Embodiment 115, wherein the first and second RNAi agents are administered in a combined amount of about 200 mg per 28 days.

[1003] Embodiment 119. The pharmaceutical composition of any one of Embodiments 97-118, wherein the first and second RNAi agents are administered in 7-day, 14-day, 21-day or 28-day intervals.

[1004] Embodiment 120. The pharmaceutical composition of any one of Embodiments 97-118, wherein the first and second RNAi agents are administered in 28-day intervals.

[1005] Embodiment 121. The pharmaceutical composition of Embodiment 120, wherein the first and second RNAi agents are administered in a combined amount of about 40 mg, about 100 mg, or about 200 mg per 28 days and in 28-day intervals.

[1006] Embodiment 122. The pharmaceutical composition of Embodiment 121, wherein the first and second RNAi agents are administered in a combined amount of about 40 mg per 28 days and in 28-day intervals.

[1007] Embodiment 123. The pharmaceutical composition of Embodiment 121, wherein the first and second RNAi agents are administered in a combined amount of about 100 mg per 28 days and in 28-day intervals.

[1008] Embodiment 124. The pharmaceutical composition of Embodiment 121, wherein the first and second RNAi agents are administered in a combined amount of about 200 mg per 28 days and in 28-day intervals.

[1009] Embodiment 125. The pharmaceutical composition of any one of Embodiments 97-124, wherein the composition is administered to the subject for up to 6 months.

[1010] Embodiment 126. The pharmaceutical composition of any one of Embodiments 97-125, further comprising administering to the subject a second active agent.

[1011] Embodiment 127. The pharmaceutical composition of Embodiment 126, wherein the second active agent is a nucleoside analog.

[1012] Embodiment 128. The pharmaceutical composition of Embodiment 127, wherein the nucleoside analog is Entecavir or Tenofovir.

[1013] Embodiment 129. The pharmaceutical composition of any one of Embodiments 97-128, wherein the level of HBsAg, HBeAg, or serum HBV DNA in the human subject is reduced by at least 40% after the administration of the composition.

[1014] Embodiment 130. The pharmaceutical composition of any one of Embodiments 98-129, wherein the symptom or disease associated with the HBV infection is a chronic liver disease or disorder, liver inflammation, liver fibrotic condition, a proliferative hepatocellular disorder, hepatocellular carcinoma, Hepatitis D virus infection, acute HBV infection, chronic hepatitis B, or chronic HBV infection.

[1015] Embodiment 131. The pharmaceutical composition of any one of Embodiments 98-130, wherein the symptom or disease associated with the HBV infection is chronic HBV infection or chronic hepatitis B.

[1016] It is to be understood that while the invention has been described in conjunction with the detailed description thereof, the foregoing description is intended to illustrate and not limit the scope of the invention, which is defined by the scope of the appended claims. Other aspects, advantages, and modifications are within the scope of the following claims.